Academic literature on the topic 'AR gene'

Abstract Alterations in androgen levels lead to reproductive defects in both males and females, including hypogonadotropic hypogonadism, anovulation, and infertility. Androgens have been shown to down-regulate GnRH mRNA levels through an androgen receptor (AR)-dependent mechanism. Here, we investigate how androgen regulates expression from the GnRH regulatory region in the GT1-7 cell line, a model of GnRH neurons. A synthetic androgen, R1881, repressed transcription from the GnRH promoter (GnRH-P) in an AR-dependent manner, and liganded AR associated with the chromatin at the GnRH-P in live GT1-7 cells. The three known octamer-binding transcription factor-1 (Oct-1) binding sites in GnRH-P were required for AR-mediated repression, although other sequences were also involved. Although a multimer of the consensus Oct-1 binding site was not repressed, a multimer of the cluster of Oct-1, Pre-B cell leukemia transcription factor (Pbx)/Prep, and NK2 homeobox 1 (Nkx2.1) binding sites, found at −106/−91 in GnRH-P, was sufficient for repression. In fact, overexpression of any of these factors disrupted the androgen response, indicating that a balance of factors in this tripartite complex is required for AR repression. AR bound to this region in EMSA, indicating a direct interaction of AR with DNA or with other transcription factors bound to GnRH-P at this sequence. Collectively, our data demonstrate that GnRH transcription is repressed by AR via multiple sequences in GnRH-P, including three Oct-1 binding sites, and that this repression requires the complex interaction of several transcription factors.

Androgen insensitivity syndrome (AIS), manifesting incomplete virilization in 46,XY individuals, is caused mostly by androgen receptor (AR) gene mutations. Therefore, a search for AR mutations is a routine approach in AIS diagnosis. However, some AIS patients lack AR mutations, which complicates the diagnosis. Here, we describe a patient suffering from partial androgen insensitivity syndrome (PAIS) and lacking AR mutations. The whole exome sequencing of the patient and his family members identified a heterozygous FKBP4 gene mutation, c.956T>C (p.Leu319Pro), inherited from the mother. The gene encodes FKBP prolyl isomerase 4, a positive regulator of the AR signaling pathway. This is the first report describing a FKBP4 gene mutation in association with a human disorder of sexual development (DSD). Importantly, the dysfunction of a homologous gene was previously reported in mice, resulting in a phenotype corresponding to PAIS. Moreover, the Leu319Pro amino acid substitution occurred in a highly conserved position of the FKBP4 region, responsible for interaction with other proteins that are crucial for the AR functional heterocomplex formation and therefore the substitution is predicted to cause the disease. We proposed the FKBP4 gene as a candidate AIS gene and suggest screening that gene for the molecular diagnosis of AIS patients lacking AR gene mutations.

Previous studies demonstrated an enhanced β2-adrenoceptor (AR) responsiveness in animals susceptible to ventricular fibrillation (VF) that was eliminated by exercise training. The present study investigated the effects of endurance exercise training on β1-AR and β2-AR expression in dogs susceptible to VF. Myocardial ischemia was induced by a 2-min occlusion of the left circumflex artery during the last minute of exercise in dogs with healed infarctions: 20 had VF [susceptible (S)] and 13 did not [resistant (R)]. These dogs were randomly assigned to either 10-wk exercise training [treadmill running; n = 9 (S) or 8 (R)] or an equivalent sedentary period [ n = 11 (S) or 5 (R)]. Left ventricular tissue β-AR protein and mRNA were quantified by Western blot analysis and RT-PCR, respectively. Because β2-ARs are located in caveolae, caveolin-3 was also quantified. β1-AR gene expression decreased (∼5-fold), β2-AR gene expression was not changed, and the ratio of β2-AR to β1-AR gene expression was significantly increased in susceptible compared with resistant dogs. β1-AR protein decreased (∼50%) and β2-AR protein increased (400%) in noncaveolar fractions of the cell membrane in susceptible dogs. Exercise training returned β1-AR gene expression to levels seen in resistant animals but did not alter β2-AR protein levels in susceptible dogs. These data suggest that β1-AR gene expression was decreased in susceptible dogs compared with resistant dogs and, further, that exercise training improves β1-AR gene expression, thereby restoring a more normal β-AR balance.

Castration-resistant prostate cancer (CRPC) is driven by AR gene aberrations that arise during androgen receptor (AR)-targeted therapy. AR amplification and mutations have been profiled in circulating tumor cells (CTCs), but whether AR gene rearrangements can be assessed in CTCs is unknown. In this study, we leveraged CRPC cell lines with defined AR gene rearrangements to develop and validate a CTC DNA analysis approach that utilized whole genome amplification and targeted DNA-sequencing of AR and other genes important in CRPC. We tested the utility of this approach by analyzing matched CTC DNA and plasma cell-free DNA (cfDNA) from a case series of ten CRPC patients. One of ten CTC samples and two of ten cfDNA samples were positive for AR gene rearrangements. All AR gene rearrangements were discordant between matched liquid biopsy samples. One patient harbored separate AR gene rearrangements in CTC DNA and cfDNA, but concordant AR amplification and AR T878A mutation. This patient also displayed concordant loss of TP53 and PTEN, but the loss of RB1 in cfDNA only. The overall frequency of discordant alterations in these genes between matched CTC DNA and cfDNA was high. This study establishes the technical feasibility of analyzing structural rearrangements, mutations, and copy number variants in AR and other CRPC genes using two different sources of DNA from a single blood sample. Paired CTC DNA and cfDNA analysis may have utility for capturing the heterogeneity of genetic alterations in CRPC patients.

The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become imperative to unify AR gene data resources for easy accessibility for researchers. However, due to the absence of a centralized platform for AR gene resources, availability, consistency, and accuracy of information vary considerably across different databases. In this article, we explore existing AR gene data resources in order to make them more visible to the clinical microbiology community, to identify their limitations, and to propose potential solutions.

Abstract Evidence that the androgen receptor (AR) is not only important in androgen-dependent prostate cancer, but also continues to play a role in tumors that become resistant to androgen deprivation therapies, highlights the need to find alternate means to block AR activity. AR, a hormone-activated transcription factor, and its coactivators are phosphoproteins. Thus, we sought to determine whether inhibition of specific cell signaling pathways would reduce AR function. We found that short-term inhibition of p42/p44 MAPK activity either by a MAPK kinase inhibitor, U0126, or by depletion of kinase with small interfering RNA caused target gene-specific reductions in AR activity. AR enhances histone H3 acetylation of target genes that are sensitive to U0126 including prostate-specific antigen and TMPRSS2, but does not increase histone H3 acetylation of the U0126-resistant PMEPA1 gene. Thus, although AR induces transcription of many target genes, the molecular changes induced by AR at the chromatin level are target gene specific. Long-term treatment (24–48 h) with U0126 causes a G1 cell cycle arrest and reduces AR expression both through a decrease in AR mRNA and a reduction in AR protein stability. Thus, treatments that reduce p42/p44 MAPK activity in prostate cancer have the potential to reduce AR activity through a reduction in expression levels as well as by target gene-selective inhibition of AR function.

Few effective therapies exist for the treatment of castration-resistant prostate cancer (CRPC). Recent evidence suggests that CRPC may be caused by augmented androgen/androgen receptor (AR) signaling, generally involving AR overexpression. Aberrant androgen/AR signaling associated with AR overexpression also plays a key role in prostate carcinogenesis. Although AR overexpression could be attributed to gene amplification, only 10–20% of CRPCs exhibit AR gene amplification, and aberrant AR expression in the remaining instances of CRPC is thought to be attributed to transcriptional, translational, and post-translational mechanisms. Overexpression of AR at the protein level, as well as the mRNA level, has been found in CRPC, suggesting a key role for transcriptional regulation of AR expression. Since the analysis of the AR promoter region in the 1990s, several transcription factors have been reported to regulate AR transcription. In this review, we discuss the molecules involved in the control of AR gene expression, with emphasis on its transcriptional control by transcription factors in prostate cancer. We also consider the therapeutic potential of targeting AR expression.

According to its incidence patterns, colorectal cancer (CRC) tends to occur more frequently in males than in females, and the evidence shows that CRC is a hormone-related tumor. These findings indicate that androgen receptor (AR) gene methylation might be important for the regulation of the CRC risk in the different sexes. We used a case–control study to investigate the association between AR methylation in peripheral blood (PBL) and CRC risk. A cohort study was conducted to analyze the effect of AR methylation levels in both PBL and tissue on the prognosis of CRC. AR methylation levels were detected using methylation-sensitive high-resolution melting (MS-HRM). The results indicate that the hypomethylation of AR was significantly associated with the risk of CRC (OR = 1.869, 95% CI: 1.629–2.141, P < 0.001), and the results remained similar after adjusting for the propensity score (PS) (OR = 1.344, 95% CI: 1.147–1.575, P < 0.001) and PS matching (OR = 1.138, 95% CI: 1.000–1.292 P = 0.049). The hypomethylation of AR was significantly associated with CRC in males (OR = 2.309, 95% CI: 1.200–4.245; P = 0.012) but not females (OR = 1.000, 95% CI: 0.567–1.765; P = 0.999). The methylation status of AR in PBL and tissue does not seem to be associated with prognosis in colorectal cancer (OR = 1.425, 95% CI: 0.895–2.269, P = 0.135; OR = 0.930, 95% CI: 0.674–1.285, P = 0.661). We conclude that AR hypomethylation in PBL is associated with a high risk of CRC and may serve as a biomarker. Further studies involving large sample sizes are needed to validate the results of this study.

Abstract Androgen-binding activity has been identified in normal and pathological thyroids, but evidence for the expression of the canonic androgen receptor (AR) in the thyroid has not been provided so far. In this study we have used reverse transcription (RT)-PCR to examine RNA expression of the canonic AR gene in human thyroid tissues, in primary cultures of human thyrocytes and in a variety of neoplastic thyroid cell lines (NPA, TPC and WRO). An AR cDNA fragment with the expected size of 262 bp was detected in normal tissues and cultured thyrocytes as well as in neoplastic cell lines, demonstrating that the gene for AR is indeed expressed in thyroid follicular cells. Immunocytochemical analysis revealed the presence of the AR protein in cancer cell lines and androgen treatment increased nuclear positivity to AR. In a survey of 35 thyroid tissues AR cDNA was detected in all the non-neoplastic samples (6 normal and 3 goitrous) and in 19 of 26 neoplastic samples. AR cDNA was not detected in 4 of the 9 follicular adenomas and in 3 of the 12 papillary carcinomas. AR was revealed by immunohistochemistry in 1 of 2 normal thyroids, in 1 goiter and in 1 of 2 neoplastic thyroids. These findings show the presence of the canonic AR in the human thyroid. Journal of Endocrinology (1996) 148, 77–85

ABSTRACTThis study examined the impact of oral exposure to antibiotic-resistant bacteria and antibiotic administration methods on antibiotic resistance (AR) gene pools and the profile of resistant bacteria in host gastrointestinal (GI) tracts using C57BL/6J mice with natural gut microbiota. Mice inoculated with a mixture oftet(M)-carryingEnterococcusspp. orblaCMY-2-carryingEscherichia coliwere treated with different doses of tetracycline hydrochloride (Tet) or ampicillin sodium (Amp) and delivered via either feed or intravenous (i.v.) injection. Quantitative PCR assessment of mouse fecal samples revealed that (i) AR gene pools were below the detection limit in mice without prior inoculation of AR gene carriers regardless of subsequent exposure to corresponding antibiotics; (ii) oral exposure to high doses of Tet and Amp in mice inoculated with AR gene carriers led to rapid enrichment of corresponding AR gene pools in feces; (iii) significantly less or delayed development of AR in the GI tract of the AR carrier-inoculated mice was observed when the same doses of antibiotics were administered via i.v. injection rather than oral administration; and (iv) antibiotic dosage, and maybe the excretion route, affected AR in the GI tract. The shift of dominant AR bacterial populations in the gut microbiota was consistent with the dynamics of AR gene pools. The emergence of endogenous resistant bacteria in the gut microbiota corresponding to drug exposure was also observed. Together, these data suggest that oral administration of antibiotics has a prominent effect on AR amplification and development in gut microbiota, which may be minimized by alternative drug administration approaches, as illustrated by i.v. injection in this study and proper drug selection.

Made available in DSpace on 2016-08-10T10:38:30Z (GMT). No. of bitstreams: 1 Caroline Oliveira Araujo Melo.pdf: 9819543 bytes, checksum: 9c73c3b07e3a86d2b7a6f185fa67e197 (MD5) Previous issue date: 2010-01-11
The androgen is a generic term usually applied to describe a group of sex steroid hormones. Androgens are produced primarily by a male's testes. However, some small amounts are also produced by the ovaries in females and by the adrenal gland, in both sexes. Androgens are responsible for the male sex differentiation during embryogenesis at the 6th or 7th week of gestation , triggering the development of the testes and penis in male fetuses and is directed by the testicular determining factor, the gene SRY (sex determining region on Y chromosome), located on the short arm of chromosome Y. The differentiation of male external genitalia in penis, scrotum and penile urethra occurs between the 9th and 13th weeks of pregnancy and requires adequate concentration of testosterone and converting this to another more potent androgen dihydrotestosterone (DHT), through the action of 5α reductase in target tissues. The actions of testosterone and DHT require the presence of functional androgen receptors, which, after the connection with these hormones, activate the transcription of specific genes in target tissues. The AR gene is a protein coding gene located at Xq11.2-q12. It spans over 90 kb and codes for a protein that functions as a steroid-hormone activated transcription factor. The AR, like other members of the nuclear receptor superfamily, has three major functional domains: the AR is characterized by a modular structure consisting of four functional domains: an N-terminal domain (NTD), a DNA-binding domain (DBD), a hinge region, and a ligand (androgen-) binding domain (LBD). Mutations in the AR gene cause the X-linked Androgen Insensitivity Syndrome (AIS) characterized by androgen unresponsiveness, which affects the proper male sexual development both at embryogenesis and puberty. As a genetic disorder, AIS presents a problem and a burden to the affected people and their families and a major medical challenge for the health providers. This impaired response to androgen results from the incapacity or reduced capacity of the androgen receptor (AR) to transactivate androgen-responsive genes in target cells, and leads to abnormal differentiation and development of male internal and external genitalia, and thus leading to male pseudohermaphroditism.
Andrógeno é um termo genérico geralmente utilizado para descrever um grupo de hormônios esteroides sexuais. Os andrógenos são produzidos no homem primariamente pelos testículos. No entanto, algumas pequenas quantidades são também produzidas pelos ovários nas mulheres e pelas glândulas adrenais, em ambos os sexos. Os andrógenos são responsáveis pela diferenciação sexual masculina durante a embriogênese na 6ª ou 7ª semana de gestação, desencadeando o desenvolvimento dos testículos e pênis em fetos masculinos e é dirigido pelo fator determinante testicular, o gene SRY (região determinante do sexo no cromossomo Y), localizado no braço curto do cromossomo Y. A diferenciação da genitália externa masculina em pênis, escroto e uretra peniana ocorre entre a 9ª e 13ª semana de gravidez e requer concentração adequada de testosterona e a conversão para um outro andrógeno mais potente, a dihidrotestosterona (DHT), através da ação da 5 α- redutase em tecidos alvos. As ações da testosterona e DHT requerem a presença dos receptores androgênicos funcionais. O gene AR é uma proteína codificada para o gene localizado no Xq11.2-q12. Ele abrange mais de 90 kb e codifica pra a proteína que funciona como um hormônio esteroide que ativa o fator de transcrição. O AR, como outros membros da superfamília de receptores nucleares, tem três domínios principais: o AR é caracterizado por uma estrutura modular consistindo de quatro domínios funcionais: o domínio N-terminal (NTD), um domínio de ligação ao DNA (DBD), a região de dobradiça, e um domínio de ligação ao ligante (LBD). Mutações no gene AR causam a Síndrome de Insensibilidade aos Andrógens ligada ao cromossomo X (AIS) caracterizada pela insensibilidade androgênica, que afeta o desenvolvimento sexual adequado tanto na embriogênese quanto na puberdade. Como uma desordem genética, o AIS apresenta um problema e um fardo para as pessoas afetadas e suas famílias e um grande desafio médico para os provedores de saúde. Essa resposta prejudicada aos andrógenos resulta na incapacidade ou redução da capacidade do receptor de andrógeno (AR) de transativar os genes responsivos aos andrógenos em células alvo, e leva à diferenciação e desenvolvimento anormais da genitália masculina interna e externa, e assim, levando ao pseudohermafroditismo masculino.

Orientador: Maricilda Palandi de Mello
Dissertação (mestrado) - Universidade Estadual de Campinas, Instituto de Biologia
Made available in DSpace on 2018-08-15T17:10:17Z (GMT). No. of bitstreams: 1 Petroli_ReginaldoJose_M.pdf: 2303670 bytes, checksum: 1836c8a6df94a76ee177d830781dc293 (MD5) Previous issue date: 2010
Resumo: Considera-se que insensibilidade androgênica seja a causa mais freqüente dos distúrbios da diferenciação do sexo em pacientes com cariótipo 46,XY. Trata-se de uma anomalia recessiva ligada ao cromossomo X, que pode se manifestar de forma branda, parcial ou completa, com um amplo espectro de variação fenotípica. O gene do receptor de andrógenos (AR) está localizado no cromossomo X, na região Xq11-12, sendo organizado em oito exons separados por introns de até 26 kb. Sua região codificante apresenta aproximadamente 2.757 pares de bases traduzindo uma proteína de 919 aminoácidos, cujo peso molecular é de aproximadamente 110 kDa. A proteína AR apresenta três domínios funcionais: domínio de regulação transcricional (amino-terminal), domínio de ligação ao DNA que contém dois dedos de zinco (zinc finger) e domínio de ligação ao esteróide (carboxi-terminal). O domínio amino-terminal possui repetições dos aminoácidos glutamina e glicina cujos números podem variar dentro da população normal. O domínio de ligação ao esteróide (carboxi-terminal), apresenta o maior número de mutações, cerca de 55% das descritas neste gene. Entre o domínio de ligação ao DNA e o domínio de ligação ao esteróide encontra-se a região hinge que contém um sinal responsável pela localização nuclear necessária para a translocação do complexo andrógeno/receptor do citoplasma para o núcleo da célula. Pacientes com cariótipo 46,XY e diagnóstico de insensibilidade androgênica geralmente apresentam fenótipo feminino ou ambigüidade genital, porém a produção de testosterona é normal. Nestes pacientes a investigação de mutações no gene do receptor de andrógeno é indicada para a identificação da alteração molecular relacionada à doença. Desta maneira, o presente estudo teve como objetivo a caracterização das alterações moleculares do gene AR, através da análise de seus oito exons e junções exons-introns por reação da cadeia da polimerase (PCR) seguida de sequenciamento dos fragmentos amplificados. Das 47 famílias que compõem a casuística deste trabalho, 14 apresentaram mutações no gene, sendo uma relacionada ao fenótipo brando da insensibilidade androgênica (p.P694S), sete relacionadas ao fenótipo parcial da insensibilidade androgênica (p.Q58L, p.A596T, p.S597R, p.M742V, p.Q798E, p.L830F e p.A896V) e seis relacionadas ao fenótipo completo da insensibilidade androgênica (p.R774H, p.P766S, p.C806F, p.R832Term, p.R855H e p.V866M). Uma paciente apresentou duas alterações, ambas no exon 6 deste gene. Quatro mutações estão sendo descritas pela primeira vez neste trabalho em pacientes com insensibilidade androgênica
Abstract: The androgen insensitivity syndrome (AIS) is considered the most frequent disorders of sex differentiation in patients with 46,XY karyotype. It is a recessive X linked disorder, which manifests as mild, partial or complete forms, with a broad spectrum of phenotypic variation. The androgen receptor gene (AR) is located on the X chromosome within Xq11-12 region. It is organized in eight exons separated by introns up to 26 kb in length. Its coding region comprises approximately 2,757 base pairs translating a protein of 919 amino acids, whose molecular weight is approximately 110 kDa. The AR protein has three functional domains: the transcriptional regulatory domain, the DNA binding domain which contains two zinc fingers and the steroid binding domain in the carboxy-terminal region. The amino-terminal domain presents repeats of glutamine and glycine whose numbers of residues vary within the normal population. The steroid-binding domain presents the highest number of mutations, around 55% of the mutations described in this gene are located in this region. Between the DNA-binding domain and the steroid-binding domain there is a hinge region that contains a signal responsible for nuclear localization required for translocation of the complex androgen/receptor from the cytoplasm to the cell nucleus. Patients with 46,XY karyotype and androgen insensitivity diagnosis usually have female or ambiguous genitalia, but normal testosterone production. In these patients the investigation of androgen receptor gene mutations is indicated to identify the molecular changes related with AIS. Therefore, the aim of this study was to characterize molecular alterations in the AR gene, by analysis of the eight exons and introns-exons junctions by polymerase chain reaction (PCR) followed by sequencing the amplified fragments. Fourteen out of 46 families comprised in this study had mutations identified. One mutation corresponded to the mild phenotype of androgen insensitivity (p.P694S), seven were related to the partial androgen insensitivity phenotype (p.Q58L, p.A596T, P. S597R, p.M742V, p.Q798E, p.L830F and p.A896V), and six were associated to the complete androgen insensitivity phenotype (p.R774H, p.P766S, p.C806F, p.R832Term, p.R855H and p.V866M). One patient presented two mutations, both located in exon 6 of the gene. Four mutations were described for the first time in this research in patients with androgen insensitivity
Mestrado
Genetica Animal e Evolução
Mestre em Genética e Biologia Molecular

The full abstract for this thesis is available in the body of the thesis, and will be available when the embargo expires.
Medicine, Faculty of
Experimental Medicine, Division of
Medicine, Department of
Graduate

Made available in DSpace on 2016-08-16T18:18:42Z (GMT). No. of bitstreams: 1 Tese MARCELO SOUZA DE ANDRADE.pdf: 1768433 bytes, checksum: 8051d8f14c6a38ec8166fcb2e817b674 (MD5) Previous issue date: 2012-04-25
FUNDAÇÃO DE AMPARO À PESQUISA E AO DESENVOLVIMENTO CIENTIFICO E TECNOLÓGICO DO MARANHÃO
Introduction. The androgen insensitivity syndrome (AIS) is a rare disease (1:20,000 to 1:64.000)-linked X chromosome, which generates a disorder of sexual differentiation of the male fetus (XY) with a spectrum of phenotypes ranging from females complete (CAIS) to a male phenotype with discrete signs of androgen insensitivity. An increasing number of mutations have been cataloged and nearly 500 mutations have been related to CAIS and 1000 to the androgen receptor gene. The AR gene is located on Xq11-12, with eight exons, about 919 amino acids. Objective. To characterize the mutations in the AR gene families in the region of the "Bico do Papagaio" in the southwestern state of Maranhao. Methodology. We used molecular biology techniques such as DNA extraction, PCR, electrophoresis, purification of PCR products and sequencing. In addition, we analyzed the clinical and hormonal characteristics of 14 patients and their families. Results. In one family (with two twin affected), we found the mutation R753X and the third molecular diagnosis of CAIS in twins described in the World. In another family, with 12 patients, was identified a new mutation in exon 8, as described P893A, protein AR. Conclusion. This work enabled the application of molecular techniques for the accurate diagnosis of AIS, genetic counseling for relatives of affected patients, and contribute to the formation of more qualified human resources, aiming at the development of biotechnology in the state of Maranhão.
Introdução. A Síndrome de Insensibilidade Androgênica (AIS) é uma doença rara (1:20.000 a 1:64.000), de transmissão ligada ao cromossomo X, que gera um distúrbio da diferenciação sexual do feto masculino (XY) com um espectro de fenótipo que varia desde o feminino completo (CAIS) até um fenótipo masculino com discretos sinais de insensibilidade androgênica. Um número crescente de mutações tem sido catalogadas e quase 500 mutações já foram relacionadas à CAIS e cerca de 1000 ao gene do receptor androgênico. O gene AR localiza-se em Xq11-12, com 8 exons, com cerca de 919 aminoácidos. Objetivo. Caracterizar as mutações no gene AR em famílias da região do Bico do Papagaio , no sudoeste do Estado do Maranhão. Metodologia. Foram utilizadas técnicas de biologia molecular como extração de DNA, PCR, Eletroforese, Purificação de produtos de PCR e Sequenciamento automático. Além disso, foram analisados o quadro clínico e hormonal de 14 pacientes e de seus familiares. Resultados. Em uma das famílias (com duas gêmeas afetadas), foi encontrada a mutação R753X, sendo o terceiro diagnóstico molecular de CAIS em gêmeas descrito no Mundo. Em outra família, com 12 pacientes, foi a identificada uma mutação nova no exon 8, descrita como P893A, na proteína AR. Conclusão. Este trabalho possibilitou a aplicação de técnicas moleculares para o diagnóstico preciso de AIS, aconselhamento genético aos familiares das pacientes afetadas, além de contribuir para a formação de recursos humanos mais qualificados, visando o desenvolvimento da biotecnologia no Estado do Maranhão.

Made available in DSpace on 2014-12-17T14:03:45Z (GMT). No. of bitstreams: 1 OliviaMNS.pdf: 1791724 bytes, checksum: ee4754a0285c7794728cf70013277cc2 (MD5) Previous issue date: 2006-10-03
Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior
The aetiology of autoimmunes disease is multifactorial and involves interactions among environmental, hormonal and genetic factors. Many different genes may contribute to autoimmunes disease susceptibility. The major histocompatibility complex (MHC) genes have been extensively studied, however many non-polymorphic MHC genes have also been reported to contribute to autoimmune diseases susceptibility. The aim of the present study was to evaluate the influence of SLC11A1 gene in systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA). Ninety-six patients with SLE, 37 with RA and 202 controls enrolled in this case-control study, were evaluated with regard to demographic, genetic, laboratorial and clinical data. SLE mainly affects females in the ratio of 18 women for each man, 88,3% of the patients aged from 15 to 45 years old and it occurs with similar frequency in whites and mulattos. The rate of RA between women and men was 11:1, with 77,1% of the cases occurring from 31 to 60 years. The genetic analysis of the point mutation -236 of the SLC11A1 gene by SSCP did not show significant differences between alleles/genotypes in patients with SLE or RA when compared to controls. The most frequent clinical manifestations in patients with SLE were cutaneous (87%) and joint (84.9%). In patients with RA, the most frequent out-joint clinical manifestation were rheumatoid nodules (13,5%). Antinuclear antibodies were present in 100% of the patients with SLE. There was no significant relation between activity of disease and presence of rheumatoid factor in patients with RA, however 55,6% of patients with active disease presented positive rheumatoid factor. Significant association between alleles/genotypes of point mutation -236 and clinical manifestations was not found
A etiologia das doen?as autoimunes ? multifatorial, resultando de intera??es complexas de fatores ambientais, hormonais e gen?ticos. Diversos genes contribuem para a suscetibilidade ?s doen?as autoimunes. Os genes do complexo principal de histocompatibilidade (MHC) tem sido amplamente estudados, por?m genes n?o-MHC tamb?m parecem contribuir para a suscetibilidade a autoimunidade. O presente estudo tem por objetivo avaliar a influ?ncia do gene SLC11A1 nas doen?as autoimunes lupus eritematoso sist?mico (LES) e artrite reumat?ide (AR). Foram arrolados 96 pacientes com LES, 37 com AR e 202 controles saud?veis, em estudo caso-controle, avaliando os dados demogr?ficos, gen?ticos e cl?nico-laboratoriais. LES afetou principalmente o sexo feminino na raz?o de 18 mulheres para 1 homem, sendo 88,3% na faixa et?ria entre 15 e 45 anos e ocorreu com freq??ncias semelhantes em brancos e pardos. A raz?o encontrada de AR entre mulheres e homens foi 11:1, com 77,1% dos casos ocorrendo entre 31 e 60 anos. A an?lise gen?tica do ponto de muta??o -236 da regi?o promotora do gene SLC11A1 por SSCP, n?o mostrou diferen?as significativas entre as freq??ncias de alelos ou gen?tipos de pacientes com LES ou AR em rela??o aos controles. As manifesta??es cl?nicas mais freq?entes nos pacientes com LES foram a cut?nea (87%) e articular (84,9%). Na AR a manifesta??o cl?nica extra-articular mais encontrada foi a presen?a de n?dulo reumat?ide (13,5%). A pesquisa do anticorpo anti-nuclear (FAN) foi positiva em 100% dos pacientes com LES. N?o houve rela??o significativa entre doen?a ativa e presen?a de fator reumat?ide em pacientes com AR, no entanto, 55,6% dos pacientes com doen?a ativa, apresentavam fator reumat?ide positivo. N?o foi encontrada associa??o significativa entre as manifesta??es cl?nicas ou achados laboratoriais e alelos/gen?tipos do ponto de muta??o -236

Made available in DSpace on 2014-07-29T15:16:33Z (GMT). No. of bitstreams: 1 dissertacao wyara biologia.pdf: 1287742 bytes, checksum: 4b2f592f2b219248664d4916820cd874 (MD5) Previous issue date: 2009-03-31
Male idiopathic infertility is related to defects in normal spermatogenesis, due to genetic causes. The spermatogenesis is a dependent process on high levels of male sex hormones, the androgens. The androgen, in turn, perform its function when associated with the androgen receptor (AR), protein encoded by AR gene. Mutation in AR gene lead to a synthesis of non functional AR, which results in the failure of the process of spermatogenesis and, consequently, causes male infertility. This work has as its main objective the verification of the occurrence of mutation in the AR gene in patients with male idiopathic infertility who come from the HC-UFG Human Reproduction Center. Samples were analyzed from 206 patients. The result was that 95 patients were found to be normal while 111 with an altered result for the spermogram. The samples were amplified for exons 1, 4, 6, 7 and 8 of the AR gene and the results subjected to statistical analysis, Mann Whitney, logistic regression, and chi tests. The existence of the relationship between defects of sperm and AR gene mutation was verified. The analysis of the relationship between the spermogram and the AR gene mutation in five evaluated exons was significant only for exons 1 and 7. Patients with numerical unsettled spermogram had a higher frequency of mutations in exon 7, teratozoospermics in exon 1 and exon 7 in astenozoospermics patients. Exons 4, 6 and 8 showed no meaningful statistical relationship in reference to the alteration of the spermogram. Among results related to social custom, alcohol proved to be significant for mutation in the AR gene. This study has reaffirmed the relationship between the presence of mutation in AR genes as probable causes of defects in spermatogenesis. Consequently, male idiopathic infertility depends not only on the genetic factor, but also on the association between this factor and the environment where man inhabits
A infertilidade masculina idiopática está relacionada a defeitos na espermatogênese normal, devido a causas genéticas. A espermatogênese é um processo dependente de altos níveis de hormônios sexuais masculinos, os andrógenos. E os andrógenos, por sua vez, exercem sua função quando associados ao receptor androgênico (RA), proteína codificada pelo gene RA. Mutações no gene RA levam a síntese do RA não funcional, o que acarreta em falhas no processo de espermatogênese e consequentemente causam infertilidade masculina. O trabalho teve como principal objetivo verificar a ocorrência ou não de mutação no gene RA em pacientes com infertilidade masculina idiopática do Centro de Reprodução Humana do HCUFG. Foram analisadas 206 amostras de pacientes, sendo 95 normais e 111 alterados para o espermograma. As amostras foram amplificadas para os exons 1, 4, 6, 7 e 8 do gene RA e os resultados submetidos às análises estatísticas, teste U, quiquadrado e regressão logística. Foi verificada a existência de relação entre alteração no espermograma e mutação no gene RA. A análise da relação entre espermograma e mutação no gene RA dos cinco exons avaliados foi significativa somente para os exons 1 e 7. Os pacientes com alteração numérica para o espermograma apresentaram uma freqüência maior de mutações no exon 7, os pacientes teratozoospérmicos no exon 1 e os astenozoospérmicos no exon 7. Os exons 4, 6 e 8 não apresentaram relação estatística significativa para alterações no espermograma. Dentre os resultados referentes aos hábitos sociais, o etilismo mostrou-se significativo para mutações no gene RA. A realização desse estudo vem reafirmar a relação entre presença de mutações no gene RA como prováveis causas de defeitos na espermatogênese e, consequentemente, infertilidade masculina idiopática, não dependendo exclusivamente do fator gênico, mas da associação entre este fator e o meio ambiente onde o homem está inserido

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
CHAPTER I - Prostate cancer is a common disease in the world and in some countries it is one of the main causes of male population mortality. Some molecular markers have been associated with prostate carcinogenesis. To observe changes in transcript levels of the AR, SRD5A2, KLK2, PSMA and PCA3 genes, the mRNA was analyzed in tissues with prostatic adenocarcinoma (PCa, N= 48) and benign prostatic hyperplasia (BPH, N= 25), performed through a differential multiplex RT-PCR assay. Significant differences were observed in the relative expression of these genes between cancerous and non-cancerous tissues. The optical density ratio of the cDNA amplicons between PCa and BPH for the AR gene was 1.6-fold higher for the prostatic adenocarcinoma. On the other hand, the SRD5A2 mRNA levels were associated with BPH and were 1.4-fold higher than that of PCa. For KLK2, PSMA and PCA3, the transcriptional levels were respectively, 1.9-, 1.9- and 5-fold higher in PCa than those in BPH tissues. Of the diagnostics tests carried through individually, the PCA3 gene was that presented higher sensitivity and accuracy, and the inclusion of the serum PSA improved the sensitivity (of 76 to 92%), positive preditive value (of 85 to 94%), negative preditive value (of 60 to 62%) and accuracy (of 74 to 78%). The results suggest that the higher AR, KLK2, PSMA, and PCA3 and/or reduced SRD5A2 genes expression in prostatic tissues may indicate the occurrence of prostate adenocarcinoma; however the PCA3 and serum PSA analysis together are highly promising as auxiliary method in the diagnosis of this cancer. CHAPTER II - Purpose: Prostate cancer (PCa) is the most commonly diagnosed malignancy in men, and it consists of multifactorial and multifocal events. Due to the complexity of the disease process, which includes genome alterations, local invasion, micrometastatic cell extravasations to circulation, invasion of secondary organ tissues, and resistance to hormonal blockage, many markers must be used to represent the multiple and variable events that lead to cancer development. The low specificity of the unique serum marker for prostate cancer diagnostics, PSA, has leaded us to investigate four potential markers in the peripheral blood of patients by detecting their mRNA levels and associating them to clinical parameters. Methods: The expression levels of the KLK2, KLK3, PCA3 and PSMA transcripts were determined by Nested RT-PCR. Patients with PCa (99) and with benign prostatic hyperplasia (BPH, 36), and healthy volunteers (104) were investigated. Results: Significant differences for the RNA relative levels have been found for the KLK2, PCA3 and PSMA transcripts between PCa and BPH patients or healthy volunteers. The KLK2 and PSMA levels also presented a positive association (P<0.05) with extra-prostatic disease (pT3). The combined positive RT-PCR Nested for the KLK2, PCA3, PSMA genes with serum PSA higher than 4ng/mL presented a 10-fold higher chance of cancer occurrence than healthy controls, with sensitivity, specificity and positive predictive value of 57%, 89% and 93%, respectively. Conclusions: The combined analysis of KLK2, PCA3 and PSMA transcripts may become a useful tool for the discrimination of PCa patients from those with benign disease or healthy individuals. Additionally, the KLK2 and PSMA transcripts may also be used as prognostic markers for the presence of extra-capsular disease and assisting in the prediction of the post-operative outcome. CHAPTER III - Purpose: Transcripts of PCA3/DD3 gene are at the moment the most specific molecule found in prostate cancer specimens. This mRNA can be detected in important sample targets for clinical analyses, such as prostatic tissues, urine after prostatic massage, and the peripheral blood. Methods: The present study evaluated the PCA3 gene expression in prostatic tissues and in peripheral blood of BPH and PCa patients, by RT-PCR assays, and based on its detection together with other clinical parameters, we proposed a model for molecular monitoring in order to improve diagnosis as an auxiliary technology. Results: The concomitant use of PCA3 transcript detection in the peripheral blood and in prostate tissues has improved diagnosis, with sensitivity and an accuracy of 77%. For the molecular staging, patients have been classified as: localized disease (PBL-; negative PCA3) and circulating tumors cells disease (PBL+; positive PCA3). The higher frequencies of PBL- had been observed in T1-T2 stages (75%); on the other hand, the higher PCA3 positivity was observed for the T3-T4 staging (43%), while the T1-T2 stages presented 25% positivity. A correlation was found between the molecular staging and serum PSA < 10ng/mL before surgery, and approximately 60% of patients with T3-T4 stages that presented biochemical failure after radical prostatectomy presented a positive PCA3 result (P= 0.05), with an odds ratio of 16-fold higher for the possibility of disease recurrence in relation to the T1-T2 patients, and an accuracy of 82%. Conclusion: These data demonstrated the importance of the PCA3 gene as an auxiliary method in prostate cancer diagnosis, by distinguishing PCa from BPH patients, and also demonstrated its prognostic value in recurrent disease for post-operative patients. CHAPTER IV - Approximately 98% of all the products transcribed in the human genome correspond to non coding RNAs (ncRNA). Many ncRNA functions are attributed to this structural particularity given mainly for the secondary structures formed from its linear sequence of bases. Among the ncRNA types are tRNA, rRNA, small nuclear RNA, small nucleolar RNA, small interference RNA (siRNA), microRNA (miRNA) and catalytic RNAs (ribozymes). The bioinformatics has supplied useful tools in the prediction of optimal or suboptimal secondary structures allowing the design of interference RNA as miRNAs or siRNAs. In human, miRNAs have been associated with the development of diverse complex diseases as cancer. The PCA3 (DD3) gene was molecularly characterized as cancer and prostate specific, and its transcripts are non-coding, once no peptide products have been found. Due to its structural characteristics, the PCA3 gene belongs thus to the increasing family of ncRNA. In the present work, four new variant molecules of the PCA3 gene have been sequence characterized and their frequencies demonstrated in prostate cancer and in benign prostatic hyperplasia patients, as well as in healthy individuals. We have also investigated and predicted the putative secondary structures formed in order to elucidate its role in prostate cancer biology. No association has been found between the frequency of these molecules and prostate pathologies (PCa or BPH). On the other hand, PCA3 variants were found in 10% (12/115) of cases in the general population. Similar analyses of the possible polypeptides of these molecules demonstrated that it remains as a non-coding RNA, and introns presents in the first, second and fourth variants suggesting a possible role as a miRNA with intracellular activity to these molecules to the PCA3 gene. In prostatic tissues, 100% of the prostate cancer cases presented the RNA molecule with an exon 2 splicing. However, further investigation must be carried out to demonstrate the true role of these splicing variants in prostate tumors and in other pathologies, once these molecules have been preferentially found in the peripheral blood.
CAPÍTULO I - O câncer de próstata é uma doença comum no mundo e já assumiu em alguns países uma das principais causas de mortalidade da população masculina. Vários marcadores moleculares têm sido associados à gênese do câncer de próstata. A fim de demonstrar a expressão diferencial dos níveis transcricionais dos genes AR, SRD5A2, KLK2, PSMA e PCA3 em doenças prostáticas, o RNAm foi analisado em tecidos com adenocarcinoma prostático (CaP, N= 48) e hiperplasia prostática benigna (HPB, N= 25) por meio da técnica RT-PCR multiplex semi-quantitativa. Foram observadas diferenças significativas na expressão relativa desses genes entre os tecidos cancerosos e nãocancerosos. A taxa de densidade ótica entre os amplicons para cDNA provenientes do gene AR foi 1.6 vezes maior no adenocarcinoma prostático. Por outro lado, os níveis de RNAm do gene SRD5A2 foi associado com a HPB e foi 1.4 vezes maior do que no CaP. Para os genes KLK2, PSMA e PCA3, os níveis transcricionais foram respectivamente, 1.9, 1.9 e 5 vezes maior no câncer comparado a tecidos benignos. Dos testes diagnósticos realizados, o gene PCA3 individualmente foi o que apresentou as melhores sensibilidade e acurácia, sendo que a inclusão das medidas de PSA sérico melhorou a sensibilidade (de 76 para 92%), o valor preditivo positivo (de 85 para 94%), o valor preditivo negativo (de 60 para 62%) e a acurácia (de 74 para 78%). Os dados sugerem que a maior expressão dos genes AR, KLK2, PSMA e PCA3 ou expressão reduzida do gene SRD5A2 em tecidos prostáticos podem indicar a ocorrência do adenocarcinoma da próstata, sendo que as análises do gene PCA3 juntamente aos do PSA sérico são altamente promissores como método auxiliar no diagnóstico desse tipo de câncer. CAPÍTULO II - O câncer de próstata (CaP) e o mais comumente diagnosticado na população masculina e consiste de eventos multifatoriais e multifocais. Devido a complexidade da doença, a qual inclui alterações genômicas, invasão local, liberação de células micrometastáticas para a circulação, invasão secundaria de tecidos de outros órgãos, e resistência ao bloqueio hormonal, muitos marcadores podem ser usados para representar os eventos múltiplos e variáveis que levam ao desenvolvimento do câncer. A baixa especificidade do único marcador para diagnostico do câncer de próstata, PSA, tem nos levado a investigar quatro potenciais marcadores no sangue periférico de pacientes pela detecção de seus níveis de RNAm e associá-los a parâmetros clínicos. Os níveis de expressão dos transcritos do KLK2, KLK3, PCA3 e PSMA foram avaliados pela RT-PCR Nested, em pacientes com CaP (99), com hiperplasia prostática benigna (HPB, 36) e voluntários saudáveis (104). Diferenças significativas foram encontradas para a expressão dos genes KLK2, PSMA e PCA3 entre os pacientes com CaP e os pacientes com HPB ou voluntários saudáveis. Os níveis do KLK2 e PSMA também apresentaram associação positiva (P<0.05) com doença extra-prostática (pT3). A RT-PCR Nested positiva combinada para os genes KLK2, PCA3 e PSMA com PSA sérico maior que 4ng/mL apresentou uma chance 10 vezes maior de ocorrência do câncer comparado aos controles saudáveis, com sensibilidade, especificidade e acurácia de 57%, 89% e 93%, respectivamente. A análise combinada dos genes KLK2, PCA3 e PSMA pode ser uma ferramenta útil na distinção de pacientes com CaP daqueles com doença benigna ou de indivíduos saudáveis. Ainda, a analise dos transcritos KLK2 e PSMA podem ser usados como marcadores prognósticos para a presença de doença extra-capsular e auxiliando na predição de recidiva da doença no pós-operatório. CAPÍTULO III - Os transcritos do gene PCA3/DD3 são até o momento as moléculas mais específicas encontradas em espécimes de câncer de próstata. Esses RNAm podem ser detectados em importantes alvos para a análise clínica como tecidos prostáticos, na urina após massagem prostática e em sangue periférico. O presente estudo avaliou a expressão do gene PCA3 em tecidos prostáticos e em sangue periférico de pacientes com HPB e CaP, por técnicas de RT-PCR, e baseado na sua detecção juntamente com os parâmetros clínicos, foi proposto um modelo de estadiamento molecular como técnica assessória para melhor o diagnóstico da doença. O uso concomitante da detecção dos transcritos do gene PCA3 no sangue periférico e no tecido prostático melhorou o diagnóstico, com sensibilidade e acurácia de 77%. Para o estadiamento molecular, os pacientes foram classificados como contendo a doença localizada (PBL-) e em doença com células tumorais circulantes (PBL +). Maiores freqüências de tumor localizado pelo estadiamento molecular foram observadas nos estadios T1-T2 (75%), enquanto que 25 e 43% dos cânceres T1-T2 e T3-T4, respectivamente, apresentaram PCA3 positivo (células circulantes). Uma correlação foi encontrada para o estadiamento molecular para doença localizada e PSA sérico pré-cirúrgico < 10ng/mL, e aproximadamente 60% dos pacientes TNM T3-T4 que apresentaram falha bioquímica após a cirurgia radical apresentaram RTPCR positiva do PCA3 (P= 0.05), com um Odds Ratio 16 vezes maior para a possibilidade de recorrência da doença em relação aos pacientes T1-T2 e uma acurácia de 82%. Esses dados demonstram a importância da detecção do gene PCA3 como método no diagnóstico do câncer de próstata, por distinguir pacientes com CaP daqueles com HPB, e também demonstrando seu valor prognóstico na doença recorrente no pósoperatório dos pacientes. CAPÍTULO IV - Aproximadamente 98% de todos os produtos transcritos do genoma humano correspondem a RNAs não codificantes (RNAnc). Muitas funções dos RNAnc são atribuídas a suas particularidades estruturais dadas principalmente pelas estruturas secundárias formadas a partir da sua sequência linear de bases. Dentre os tipos de RNAnc estão os RNAt, RNAr, small nuclear RNA, small nucleolar RNA, small interference RNA (siRNA), microRNA (miRNA) e RNAs catalíticos (ribozimas). A bioinformática tem fornecido ferramentas úteis na predição de estruturas secundárias ótimas ou subótimas permitindo o design de RNAs de interferência como os miRNAs ou siRNAs. Em humanos, os miRNAs tem sido associados ao desenvolvimento de diversas doenças complexas como o câncer. O gene PCA3 (DD3) foi molecularmente caracterizado como câncer- e próstata- específico e os seus RNAs são os responsáveis por essa característica, isso porque nenhum produto protéico tem sido encontrado para esse gene. Devido às suas características estruturais, o gene PCA3, pertence assim à crescente família de RNAnc. No presente trabalho foi analisado as freqüências de quatro moléculas variantes do gene PCA3, além das anteriormente reportadas, como também foram preditas as suas estruturas secundárias na tentativa de elucidar o seu papel na biologia do câncer de próstata. Nenhuma associação foi encontrada entre a freqüência dessas moléculas e as patologias da próstata como hiperplasia benigna ou câncer, sendo que na população geral analisada essas variantes foram encontradas em apenas 10% (12/115) dos casos. As análises de homologia de possíveis polipeptídeos para essas moléculas demonstram que permanece o papel de RNA não-codificante para o gene PCA3. Ainda, a presença de introns nas variantes 1, 2 e 4 podem sugerir um papel intracelular de miRNA para essas moléculas do gene PCA3. Nos tecidos prostáticos, 100% dos casos de câncer foi representando pela molécula com splicing do exon 2. Contudo, para as variantes de splicing, novas pesquisas deverão ser realizadas incluindo outras patologias além das doenças prostáticas e outros tipos tumorais para verificar o real impacto dessas moléculas, uma vez que foram encontradas preferencialmente no sangue periférico.
Doutor em Genética e Bioquímica

Made available in DSpace on 2011-05-04T12:36:24Z (GMT). No. of bitstreams: 0 Previous issue date: 2010
A silicose é uma pneumoconiose provocada pela inalação da poeira de sílica e consiste em uma lesão pulmonar com participação de citocinas como o Fator de Necrose Tumoral alfa (TNF-a). Há dois polimorfismos nos sítios -238 e -308 do promotor do gene da TNF-a (substituição de uma guanina por uma adenina) que têm sido investigados como possíveis fatores de susceptibilidade para a silicose. A mutação na posição -308 tem sido associada com altos níveis da citocina no sangue, enquanto que a posição -238, com formas mais graves da doença. A exposição ocupacional à sílica continua sendo um problema de Saúde Pública no Brasil. O Centro de Estudos de Saúde do Trabalhador e Ecologia Humana (CESTEH)/FIOCRUZ acompanha trabalhadores do Rio de Janeiro expostos à sílica. Este trabalho teve como objetivo a implementação de uma metodologia para determinação do polimorfismo dos sítios -308 e -238 do promotor da TNF-a para futura utilização na avaliação da exposição à sílica. A genotipagem foi feita através da técnica de PCR-RFLP (Polymerase Chain Reaction Restricition Fragment Length Polymorphism) usando NcoI para -308 e BamHI para -238. Foram realizados ensaios para a implementação da metodologia, sendo esta aplicada em uma amostra populacional de 79 trabalhadores assistidos no ambulatório do CESTEH, sendo todos do sexo masculino e maiores de 18 anos. (...) Nesse estudo, demonstrou-se que a presença do alelo mutante (A) está associada a maiores quantidades da citocina no sangue. Não foram encontradas diferenças significativas entre as médias da enzima GST e a presença ou não do alelo mutante. A presença do alelo -308A apresentou ainda um risco relativo de 3,697 para o desenvolvimento de silicose. A implementação de um método toxico genético permite a identificação de possíveis determinantes de suscetibilidade individual ao desenvolvimento da doença, aumentando o alcanço das avaliações da saúde do trabalhador.
Silicosis is a pneumoconiosis caused by inhalation of silica dust and consists of a lung injury with participation of cytokines, such as Tumor Necrosis Factor alpha (TNF- ). There are two polymorphisms at sites -238 and -308 of the gene promoter in TNF- (replacement of a guanine-adenine), which have been investigated as possible factors of susceptibility for silicosis. The mutation at positon -308 has been associated with high levels of cytokine in the blood, while at -238 with severe forms of the disease. Occupational exposure to silica remains a public health problem in Brazil. The Center for Studies on Workers' Health and Human Ecology (CESTEH) / FIOCRUZ follows Rio de Janeiro's workers exposed to silica. This study aimed to implement a methodology for determining the polymorphism of sites -308 and -238 of the promoter of TNF- for future use in the assessment of exposure to silica. Genotyping was made by PCR-RFLP (Polymerase Chain Reaction – Restricition Fragment Length Polymorphism) using NcoI for -308 and BamHI for -238. Tests were performed for implementing the methodology, which was applied in 79 employees assisted by CESTEH, all male and aged over 18. After the tests, the following conditions were fixed for both sites: 100ng of DNA, extracted from 500μL of whole blood, were used as template for PCR with 1.5 U of Taq-DNA Polymerase Recombinant and a final volume of 50μL. The primers were: 5'AGGCAATAGGTTTTGAGGGCCAT and 5'TCCTCCCTGCTCCGATTCCG as sense and antisense to -308 and 5'AAACAGACCACAGACCTGGTC and 5'CTCACACTCCCCATCCTCCCGGATC to -238. The PCR parameters for -308 site were: 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60, generating a fragment of 107 pb. The PCR parameters for -238 site were; 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60s, generating a fragment of 165 pb. The digestion was made with 5U of endonuclease for 1mg of DNA incubated at 37°C for 1 hour. Individuals with the mutant allele lose the site which is attacked by the restriction enzyme. Workers genotyped for the -308 site showed 16.4% (n = 13) for the GA genotype, 82.3% (n = 65) for GG and 1.3% (n = 1) for the genotype AA. The -238 site showed the frequencies of 2.3% (n = 2) for GA, 97.7% (n = 77) for GG and zero for AA. This study shows that the presence of the mutant allele (A) is associated with greater amounts of cytokine in the blood. There were no significant differences between the means of the enzyme GST and the presence of the mutant allele. The presence of the -308 mutant allele also showed a relative risk of 3,697 for the development of silicosis. The implementation of a toxicogenetic method allows the identification of possible determinants of individual susceptibility to disease development, increasing the reach of the evaluations of occupational health.

Prostate cancer is a heterogeneous disease that arises through the acquisition of key malignant hallmarks. At the molecular level, prostate tumours are dependent upon the androgen receptor pathway, which affects cell function, growth, and behaviour through downstream androgen-regulated genes. Prostate cancer requires this activity and manipulates the AR pathway to maintain signalling. For example, mutation of the AR (to bind ligands other than androgens) or amplification/duplication of the AR allows signalling to continue in the absence of testosterone. Around 50% of prostate cancers have a gene fusion between the androgen-regulated component of the TMPRSS2 gene and a transcription factor (e.g. ETS family members ERG and ETV1). This results in aberrant androgen stimulated cell growth. Current research is using molecular knowledge to identify biomarkers, such as PCA3, and new therapies, such as enzalutamide or abiraterone acetate.

• Embryology: the gonad is initially bipotential. • The testes develop under active control of SRY and other genes. Disorders of sex development (DSDs) are classified according to the karyotype: • 46,XY DSD (incomplete masculinization of a male fetus): ◦ The commonest cause is androgen insensitivity syndrome (AIS): ■ mutations in androgen receptor (AR) gene on X chromosome in complete forms ■ alterations in androgen binding in partial forms. ◦ Abnormalities of testosterone synthesis and conversion, may be: ■ isolated, e.g. 17β‎HSD, 5α‎RD ■ occur in association with defects in steroid biosynthesis, e.g. StAR, 3β‎HSD. • Pure 46,XY gonadal dysgenesis (Swyer syndrome): ◦ phenotype unambiguously female; may present with delayed puberty ◦ Müllerian structures are present but only streak gonads are seen. • Mixed gonadal dysgenesis: ◦ usually asymmetrical, e.g. ovary/streak gonad or ovotestis ◦ karyotype is 45,X/46,XY or 46,XX/46,XY. • Pure 46,XX gonadal dysgenesis: ◦ absent puberty in a phenotypically normal female ◦ intact Müllerian structures but streak ovaries; normal genitalia. • 46,XX DSD (masculinization of a female fetus): ◦ the commonest cause is congenital adrenal hyperplasia, with the vast majority (>90%) due to 21-hydroxylase deficiency (21OHD). • Ovotesticular DSD is rare: ◦ aetiology is unknown, and karyotype usually 46,XX ◦ asymmetrical gonad development; ovary and testis or ovotestis. • DSD may also be part of other genetic syndromes, e.g. Antley–Bixler, Smith–Lemli–Opitz, trisomy 13. • Management requires careful evaluation and counselling, working as part of a multidisciplinary team.

Fragile X syndrome (FXS) is the most common cause of inherited intellectual disability known, and it is the most common single gene disorder associated with autism (Belmonte and Bourgeron 2006; Reddy 2005). It is caused by the lack or deficiency of the FMR1 protein, FMRP (Loesch et al. 2004b). The typical physical features of FXS include prominent ears, hyperextensible finger joints, flat feet, soft skin, and in adolescence and adulthood large testicles (macroorchidism) and a long face (Hagerman 2002b). The behavioral features include poor eye contact, hyperarousal to stimuli, anxiety, hyperactivity, attention deficit, impulsivity, hand stereotypies (such as hand biting and hand flapping), and social deficits including autism and autism spectrum disorder (ASD) (Budimirovic et al. 2006; Clifford et al. 2007; Hall et al. 2008b; Hatton et al. 2006b; Sullivan et al. 2007b). Fragile-X syndrome was first reported by Lubs (1969) in two brothers who had intellectual disability and the appearance of a marker X chromosome, which is a fragile site on their X chromosome. It was later detected that this fragile site on the X chromosome only occurred when the chromosomes were studied in a folate-deficient tissue culture media (Sutherland 1977). Therefore cytogenetic studies were utilized to document cases of FXS throughout the 1980s until the Fragile X Mental Retardation 1 gene (FMR1) was discovered in 1991 (Verkerk et al. 1991). The FMR1 gene was found to have a trinucleotide (CGG) repeat sequence at the 5’ untranslated region, with the normal range later determined to be up to 44 repeats, a gray zone of 45–54 repeats, a premutation of 55–200 repeats, and a full mutation range of more than 200 repeats (Maddalena et al. 2001). Those individuals with the full mutation have a deficit or absence of the FMR1 protein (FMRP) that causes the physical, behavioral, and cognitive features of FXS (Loesch et al. 2004b). Females with the full mutation have another X chromosome that is producing FMRP, depending on the activation ratio (AR) or the percentage of cells that have the normal X chromosome as the active X chromosome.

We live in a world not of science but of science fiction. Like pixel patterns from unconscious software is projected onto a monitor, unconscious archetypal quantum patterns are projected as what Carl Jung called archetypal representation (AR). Projected images are then subject to the vagaries of personal perception, so it may be stipulated that no absolute reality exists for humans. Rather, each person lives in a perceptual fiction. According to Carl G. Jung, dreams are projections from quantum-level unconscious dimensions into the cognitive dimension of “consciousness.” In the language of dream analysis, Jung would have described the science fiction genre as a prospective (future-oriented) dreamscape of archetypal representations. In the media-dream model, quantum patterns are derived from research in cognitive neuroscience and physics. Contemplated as AR, the sci-fi genre is predictive of cultural futures and formats psychological motives and morality. Sci-fi has the potential to detect the psychological dynamics at work during the paradigm shift into a dreamscape of illusion.