To see the other types of publications on this topic, follow the link: AR gene.

Dissertations / Theses on the topic 'AR gene'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 22 dissertations / theses for your research on the topic 'AR gene.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.

1

Melo, Caroline Oliveira Araujo. "ANÁLISE MOLECULAR DO GENE DO RECEPTOR DE ANDRÓGENOS EM HOMENS COM SUSPEITA DE INFERTILIDADE." Pontifícia Universidade Católica de Goiás, 2010. http://localhost:8080/tede/handle/tede/2338.

Full text
Abstract:
Made available in DSpace on 2016-08-10T10:38:30Z (GMT). No. of bitstreams: 1 Caroline Oliveira Araujo Melo.pdf: 9819543 bytes, checksum: 9c73c3b07e3a86d2b7a6f185fa67e197 (MD5) Previous issue date: 2010-01-11
The androgen is a generic term usually applied to describe a group of sex steroid hormones. Androgens are produced primarily by a male's testes. However, some small amounts are also produced by the ovaries in females and by the adrenal gland, in both sexes. Androgens are responsible for the male sex differentiation during embryogenesis at the 6th or 7th week of gestation , triggering the development of the testes and penis in male fetuses and is directed by the testicular determining factor, the gene SRY (sex determining region on Y chromosome), located on the short arm of chromosome Y. The differentiation of male external genitalia in penis, scrotum and penile urethra occurs between the 9th and 13th weeks of pregnancy and requires adequate concentration of testosterone and converting this to another more potent androgen dihydrotestosterone (DHT), through the action of 5α reductase in target tissues. The actions of testosterone and DHT require the presence of functional androgen receptors, which, after the connection with these hormones, activate the transcription of specific genes in target tissues. The AR gene is a protein coding gene located at Xq11.2-q12. It spans over 90 kb and codes for a protein that functions as a steroid-hormone activated transcription factor. The AR, like other members of the nuclear receptor superfamily, has three major functional domains: the AR is characterized by a modular structure consisting of four functional domains: an N-terminal domain (NTD), a DNA-binding domain (DBD), a hinge region, and a ligand (androgen-) binding domain (LBD). Mutations in the AR gene cause the X-linked Androgen Insensitivity Syndrome (AIS) characterized by androgen unresponsiveness, which affects the proper male sexual development both at embryogenesis and puberty. As a genetic disorder, AIS presents a problem and a burden to the affected people and their families and a major medical challenge for the health providers. This impaired response to androgen results from the incapacity or reduced capacity of the androgen receptor (AR) to transactivate androgen-responsive genes in target cells, and leads to abnormal differentiation and development of male internal and external genitalia, and thus leading to male pseudohermaphroditism.
Andrógeno é um termo genérico geralmente utilizado para descrever um grupo de hormônios esteroides sexuais. Os andrógenos são produzidos no homem primariamente pelos testículos. No entanto, algumas pequenas quantidades são também produzidas pelos ovários nas mulheres e pelas glândulas adrenais, em ambos os sexos. Os andrógenos são responsáveis pela diferenciação sexual masculina durante a embriogênese na 6ª ou 7ª semana de gestação, desencadeando o desenvolvimento dos testículos e pênis em fetos masculinos e é dirigido pelo fator determinante testicular, o gene SRY (região determinante do sexo no cromossomo Y), localizado no braço curto do cromossomo Y. A diferenciação da genitália externa masculina em pênis, escroto e uretra peniana ocorre entre a 9ª e 13ª semana de gravidez e requer concentração adequada de testosterona e a conversão para um outro andrógeno mais potente, a dihidrotestosterona (DHT), através da ação da 5 α- redutase em tecidos alvos. As ações da testosterona e DHT requerem a presença dos receptores androgênicos funcionais. O gene AR é uma proteína codificada para o gene localizado no Xq11.2-q12. Ele abrange mais de 90 kb e codifica pra a proteína que funciona como um hormônio esteroide que ativa o fator de transcrição. O AR, como outros membros da superfamília de receptores nucleares, tem três domínios principais: o AR é caracterizado por uma estrutura modular consistindo de quatro domínios funcionais: o domínio N-terminal (NTD), um domínio de ligação ao DNA (DBD), a região de dobradiça, e um domínio de ligação ao ligante (LBD). Mutações no gene AR causam a Síndrome de Insensibilidade aos Andrógens ligada ao cromossomo X (AIS) caracterizada pela insensibilidade androgênica, que afeta o desenvolvimento sexual adequado tanto na embriogênese quanto na puberdade. Como uma desordem genética, o AIS apresenta um problema e um fardo para as pessoas afetadas e suas famílias e um grande desafio médico para os provedores de saúde. Essa resposta prejudicada aos andrógenos resulta na incapacidade ou redução da capacidade do receptor de andrógeno (AR) de transativar os genes responsivos aos andrógenos em células alvo, e leva à diferenciação e desenvolvimento anormais da genitália masculina interna e externa, e assim, levando ao pseudohermafroditismo masculino.
APA, Harvard, Vancouver, ISO, and other styles
2

Petroli, Reginaldo José 1980. "Analise molecular do gene do receptor de androgenos em pacientes 46, XY com ambiguidade genital e produção normal de testosterona." [s.n.], 2010. http://repositorio.unicamp.br/jspui/handle/REPOSIP/317126.

Full text
Abstract:
Orientador: Maricilda Palandi de Mello
Dissertação (mestrado) - Universidade Estadual de Campinas, Instituto de Biologia
Made available in DSpace on 2018-08-15T17:10:17Z (GMT). No. of bitstreams: 1 Petroli_ReginaldoJose_M.pdf: 2303670 bytes, checksum: 1836c8a6df94a76ee177d830781dc293 (MD5) Previous issue date: 2010
Resumo: Considera-se que insensibilidade androgênica seja a causa mais freqüente dos distúrbios da diferenciação do sexo em pacientes com cariótipo 46,XY. Trata-se de uma anomalia recessiva ligada ao cromossomo X, que pode se manifestar de forma branda, parcial ou completa, com um amplo espectro de variação fenotípica. O gene do receptor de andrógenos (AR) está localizado no cromossomo X, na região Xq11-12, sendo organizado em oito exons separados por introns de até 26 kb. Sua região codificante apresenta aproximadamente 2.757 pares de bases traduzindo uma proteína de 919 aminoácidos, cujo peso molecular é de aproximadamente 110 kDa. A proteína AR apresenta três domínios funcionais: domínio de regulação transcricional (amino-terminal), domínio de ligação ao DNA que contém dois dedos de zinco (zinc finger) e domínio de ligação ao esteróide (carboxi-terminal). O domínio amino-terminal possui repetições dos aminoácidos glutamina e glicina cujos números podem variar dentro da população normal. O domínio de ligação ao esteróide (carboxi-terminal), apresenta o maior número de mutações, cerca de 55% das descritas neste gene. Entre o domínio de ligação ao DNA e o domínio de ligação ao esteróide encontra-se a região hinge que contém um sinal responsável pela localização nuclear necessária para a translocação do complexo andrógeno/receptor do citoplasma para o núcleo da célula. Pacientes com cariótipo 46,XY e diagnóstico de insensibilidade androgênica geralmente apresentam fenótipo feminino ou ambigüidade genital, porém a produção de testosterona é normal. Nestes pacientes a investigação de mutações no gene do receptor de andrógeno é indicada para a identificação da alteração molecular relacionada à doença. Desta maneira, o presente estudo teve como objetivo a caracterização das alterações moleculares do gene AR, através da análise de seus oito exons e junções exons-introns por reação da cadeia da polimerase (PCR) seguida de sequenciamento dos fragmentos amplificados. Das 47 famílias que compõem a casuística deste trabalho, 14 apresentaram mutações no gene, sendo uma relacionada ao fenótipo brando da insensibilidade androgênica (p.P694S), sete relacionadas ao fenótipo parcial da insensibilidade androgênica (p.Q58L, p.A596T, p.S597R, p.M742V, p.Q798E, p.L830F e p.A896V) e seis relacionadas ao fenótipo completo da insensibilidade androgênica (p.R774H, p.P766S, p.C806F, p.R832Term, p.R855H e p.V866M). Uma paciente apresentou duas alterações, ambas no exon 6 deste gene. Quatro mutações estão sendo descritas pela primeira vez neste trabalho em pacientes com insensibilidade androgênica
Abstract: The androgen insensitivity syndrome (AIS) is considered the most frequent disorders of sex differentiation in patients with 46,XY karyotype. It is a recessive X linked disorder, which manifests as mild, partial or complete forms, with a broad spectrum of phenotypic variation. The androgen receptor gene (AR) is located on the X chromosome within Xq11-12 region. It is organized in eight exons separated by introns up to 26 kb in length. Its coding region comprises approximately 2,757 base pairs translating a protein of 919 amino acids, whose molecular weight is approximately 110 kDa. The AR protein has three functional domains: the transcriptional regulatory domain, the DNA binding domain which contains two zinc fingers and the steroid binding domain in the carboxy-terminal region. The amino-terminal domain presents repeats of glutamine and glycine whose numbers of residues vary within the normal population. The steroid-binding domain presents the highest number of mutations, around 55% of the mutations described in this gene are located in this region. Between the DNA-binding domain and the steroid-binding domain there is a hinge region that contains a signal responsible for nuclear localization required for translocation of the complex androgen/receptor from the cytoplasm to the cell nucleus. Patients with 46,XY karyotype and androgen insensitivity diagnosis usually have female or ambiguous genitalia, but normal testosterone production. In these patients the investigation of androgen receptor gene mutations is indicated to identify the molecular changes related with AIS. Therefore, the aim of this study was to characterize molecular alterations in the AR gene, by analysis of the eight exons and introns-exons junctions by polymerase chain reaction (PCR) followed by sequencing the amplified fragments. Fourteen out of 46 families comprised in this study had mutations identified. One mutation corresponded to the mild phenotype of androgen insensitivity (p.P694S), seven were related to the partial androgen insensitivity phenotype (p.Q58L, p.A596T, P. S597R, p.M742V, p.Q798E, p.L830F and p.A896V), and six were associated to the complete androgen insensitivity phenotype (p.R774H, p.P766S, p.C806F, p.R832Term, p.R855H and p.V866M). One patient presented two mutations, both located in exon 6 of the gene. Four mutations were described for the first time in this research in patients with androgen insensitivity
Mestrado
Genetica Animal e Evolução
Mestre em Genética e Biologia Molecular
APA, Harvard, Vancouver, ISO, and other styles
3

Kim, Soojin. "Elucidation of AR impact on the paternally expressed Gene 10 (PEG10) in Enzalutamide-resistant prostate cancer." Thesis, University of British Columbia, 2016. http://hdl.handle.net/2429/59301.

Full text
Abstract:
The full abstract for this thesis is available in the body of the thesis, and will be available when the embargo expires.
Medicine, Faculty of
Experimental Medicine, Division of
Medicine, Department of
Graduate
APA, Harvard, Vancouver, ISO, and other styles
4

Alwi, Zilfalil B. "Pharmacogenetics of hypertension: a study of the single nucleotide polymorphisms of the CYP2D6 and Beta-2 AR gene." Thesis, Aston University, 2007. http://publications.aston.ac.uk/11069/.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Andrade, Marcelo Souza de. "ANÁLISE MOLECULAR DO GENE RECEPTOR DE ANDRÓGENO EM PACIENTES E FAMILIARES COM SÍNDROME DA INSENSIBILIDADE AOS ANDRÓGENOS." Universidade Federal do Maranhão, 2012. http://tedebc.ufma.br:8080/jspui/handle/tede/72.

Full text
Abstract:
Made available in DSpace on 2016-08-16T18:18:42Z (GMT). No. of bitstreams: 1 Tese MARCELO SOUZA DE ANDRADE.pdf: 1768433 bytes, checksum: 8051d8f14c6a38ec8166fcb2e817b674 (MD5) Previous issue date: 2012-04-25
FUNDAÇÃO DE AMPARO À PESQUISA E AO DESENVOLVIMENTO CIENTIFICO E TECNOLÓGICO DO MARANHÃO
Introduction. The androgen insensitivity syndrome (AIS) is a rare disease (1:20,000 to 1:64.000)-linked X chromosome, which generates a disorder of sexual differentiation of the male fetus (XY) with a spectrum of phenotypes ranging from females complete (CAIS) to a male phenotype with discrete signs of androgen insensitivity. An increasing number of mutations have been cataloged and nearly 500 mutations have been related to CAIS and 1000 to the androgen receptor gene. The AR gene is located on Xq11-12, with eight exons, about 919 amino acids. Objective. To characterize the mutations in the AR gene families in the region of the "Bico do Papagaio" in the southwestern state of Maranhao. Methodology. We used molecular biology techniques such as DNA extraction, PCR, electrophoresis, purification of PCR products and sequencing. In addition, we analyzed the clinical and hormonal characteristics of 14 patients and their families. Results. In one family (with two twin affected), we found the mutation R753X and the third molecular diagnosis of CAIS in twins described in the World. In another family, with 12 patients, was identified a new mutation in exon 8, as described P893A, protein AR. Conclusion. This work enabled the application of molecular techniques for the accurate diagnosis of AIS, genetic counseling for relatives of affected patients, and contribute to the formation of more qualified human resources, aiming at the development of biotechnology in the state of Maranhão.
Introdução. A Síndrome de Insensibilidade Androgênica (AIS) é uma doença rara (1:20.000 a 1:64.000), de transmissão ligada ao cromossomo X, que gera um distúrbio da diferenciação sexual do feto masculino (XY) com um espectro de fenótipo que varia desde o feminino completo (CAIS) até um fenótipo masculino com discretos sinais de insensibilidade androgênica. Um número crescente de mutações tem sido catalogadas e quase 500 mutações já foram relacionadas à CAIS e cerca de 1000 ao gene do receptor androgênico. O gene AR localiza-se em Xq11-12, com 8 exons, com cerca de 919 aminoácidos. Objetivo. Caracterizar as mutações no gene AR em famílias da região do Bico do Papagaio , no sudoeste do Estado do Maranhão. Metodologia. Foram utilizadas técnicas de biologia molecular como extração de DNA, PCR, Eletroforese, Purificação de produtos de PCR e Sequenciamento automático. Além disso, foram analisados o quadro clínico e hormonal de 14 pacientes e de seus familiares. Resultados. Em uma das famílias (com duas gêmeas afetadas), foi encontrada a mutação R753X, sendo o terceiro diagnóstico molecular de CAIS em gêmeas descrito no Mundo. Em outra família, com 12 pacientes, foi a identificada uma mutação nova no exon 8, descrita como P893A, na proteína AR. Conclusão. Este trabalho possibilitou a aplicação de técnicas moleculares para o diagnóstico preciso de AIS, aconselhamento genético aos familiares das pacientes afetadas, além de contribuir para a formação de recursos humanos mais qualificados, visando o desenvolvimento da biotecnologia no Estado do Maranhão.
APA, Harvard, Vancouver, ISO, and other styles
6

Ma, Qiuping. "Role of FoxO Factors as the Nuclear Mediator for PTEN-AR Antagonism in Prostate Cancer Cells." [Tampa, Fla] : University of South Florida, 2008. http://purl.fcla.edu/usf/dc/et/SFE0002559.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Souza, Ol?via Maria Nascimento de. "Avalia??o demogr?fica, clinico-laboratorial e gen?tica de indiv?duos com lupus eritematoso sist?mico e artrite reumat?ide residentes em regi?o tropical." Universidade Federal do Rio Grande do Norte, 2006. http://repositorio.ufrn.br:8080/jspui/handle/123456789/12631.

Full text
Abstract:
Made available in DSpace on 2014-12-17T14:03:45Z (GMT). No. of bitstreams: 1 OliviaMNS.pdf: 1791724 bytes, checksum: ee4754a0285c7794728cf70013277cc2 (MD5) Previous issue date: 2006-10-03
Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior
The aetiology of autoimmunes disease is multifactorial and involves interactions among environmental, hormonal and genetic factors. Many different genes may contribute to autoimmunes disease susceptibility. The major histocompatibility complex (MHC) genes have been extensively studied, however many non-polymorphic MHC genes have also been reported to contribute to autoimmune diseases susceptibility. The aim of the present study was to evaluate the influence of SLC11A1 gene in systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA). Ninety-six patients with SLE, 37 with RA and 202 controls enrolled in this case-control study, were evaluated with regard to demographic, genetic, laboratorial and clinical data. SLE mainly affects females in the ratio of 18 women for each man, 88,3% of the patients aged from 15 to 45 years old and it occurs with similar frequency in whites and mulattos. The rate of RA between women and men was 11:1, with 77,1% of the cases occurring from 31 to 60 years. The genetic analysis of the point mutation -236 of the SLC11A1 gene by SSCP did not show significant differences between alleles/genotypes in patients with SLE or RA when compared to controls. The most frequent clinical manifestations in patients with SLE were cutaneous (87%) and joint (84.9%). In patients with RA, the most frequent out-joint clinical manifestation were rheumatoid nodules (13,5%). Antinuclear antibodies were present in 100% of the patients with SLE. There was no significant relation between activity of disease and presence of rheumatoid factor in patients with RA, however 55,6% of patients with active disease presented positive rheumatoid factor. Significant association between alleles/genotypes of point mutation -236 and clinical manifestations was not found
A etiologia das doen?as autoimunes ? multifatorial, resultando de intera??es complexas de fatores ambientais, hormonais e gen?ticos. Diversos genes contribuem para a suscetibilidade ?s doen?as autoimunes. Os genes do complexo principal de histocompatibilidade (MHC) tem sido amplamente estudados, por?m genes n?o-MHC tamb?m parecem contribuir para a suscetibilidade a autoimunidade. O presente estudo tem por objetivo avaliar a influ?ncia do gene SLC11A1 nas doen?as autoimunes lupus eritematoso sist?mico (LES) e artrite reumat?ide (AR). Foram arrolados 96 pacientes com LES, 37 com AR e 202 controles saud?veis, em estudo caso-controle, avaliando os dados demogr?ficos, gen?ticos e cl?nico-laboratoriais. LES afetou principalmente o sexo feminino na raz?o de 18 mulheres para 1 homem, sendo 88,3% na faixa et?ria entre 15 e 45 anos e ocorreu com freq??ncias semelhantes em brancos e pardos. A raz?o encontrada de AR entre mulheres e homens foi 11:1, com 77,1% dos casos ocorrendo entre 31 e 60 anos. A an?lise gen?tica do ponto de muta??o -236 da regi?o promotora do gene SLC11A1 por SSCP, n?o mostrou diferen?as significativas entre as freq??ncias de alelos ou gen?tipos de pacientes com LES ou AR em rela??o aos controles. As manifesta??es cl?nicas mais freq?entes nos pacientes com LES foram a cut?nea (87%) e articular (84,9%). Na AR a manifesta??o cl?nica extra-articular mais encontrada foi a presen?a de n?dulo reumat?ide (13,5%). A pesquisa do anticorpo anti-nuclear (FAN) foi positiva em 100% dos pacientes com LES. N?o houve rela??o significativa entre doen?a ativa e presen?a de fator reumat?ide em pacientes com AR, no entanto, 55,6% dos pacientes com doen?a ativa, apresentavam fator reumat?ide positivo. N?o foi encontrada associa??o significativa entre as manifesta??es cl?nicas ou achados laboratoriais e alelos/gen?tipos do ponto de muta??o -236
APA, Harvard, Vancouver, ISO, and other styles
8

MESQUITA, Wyara Elanne de Jesus Castro. "Ánálise de alterações no gene receptor de andrógeno em homens com infertilidade idiopática." Universidade Federal de Goiás, 2009. http://repositorio.bc.ufg.br/tede/handle/tde/1272.

Full text
Abstract:
Made available in DSpace on 2014-07-29T15:16:33Z (GMT). No. of bitstreams: 1 dissertacao wyara biologia.pdf: 1287742 bytes, checksum: 4b2f592f2b219248664d4916820cd874 (MD5) Previous issue date: 2009-03-31
Male idiopathic infertility is related to defects in normal spermatogenesis, due to genetic causes. The spermatogenesis is a dependent process on high levels of male sex hormones, the androgens. The androgen, in turn, perform its function when associated with the androgen receptor (AR), protein encoded by AR gene. Mutation in AR gene lead to a synthesis of non functional AR, which results in the failure of the process of spermatogenesis and, consequently, causes male infertility. This work has as its main objective the verification of the occurrence of mutation in the AR gene in patients with male idiopathic infertility who come from the HC-UFG Human Reproduction Center. Samples were analyzed from 206 patients. The result was that 95 patients were found to be normal while 111 with an altered result for the spermogram. The samples were amplified for exons 1, 4, 6, 7 and 8 of the AR gene and the results subjected to statistical analysis, Mann Whitney, logistic regression, and chi tests. The existence of the relationship between defects of sperm and AR gene mutation was verified. The analysis of the relationship between the spermogram and the AR gene mutation in five evaluated exons was significant only for exons 1 and 7. Patients with numerical unsettled spermogram had a higher frequency of mutations in exon 7, teratozoospermics in exon 1 and exon 7 in astenozoospermics patients. Exons 4, 6 and 8 showed no meaningful statistical relationship in reference to the alteration of the spermogram. Among results related to social custom, alcohol proved to be significant for mutation in the AR gene. This study has reaffirmed the relationship between the presence of mutation in AR genes as probable causes of defects in spermatogenesis. Consequently, male idiopathic infertility depends not only on the genetic factor, but also on the association between this factor and the environment where man inhabits
A infertilidade masculina idiopática está relacionada a defeitos na espermatogênese normal, devido a causas genéticas. A espermatogênese é um processo dependente de altos níveis de hormônios sexuais masculinos, os andrógenos. E os andrógenos, por sua vez, exercem sua função quando associados ao receptor androgênico (RA), proteína codificada pelo gene RA. Mutações no gene RA levam a síntese do RA não funcional, o que acarreta em falhas no processo de espermatogênese e consequentemente causam infertilidade masculina. O trabalho teve como principal objetivo verificar a ocorrência ou não de mutação no gene RA em pacientes com infertilidade masculina idiopática do Centro de Reprodução Humana do HCUFG. Foram analisadas 206 amostras de pacientes, sendo 95 normais e 111 alterados para o espermograma. As amostras foram amplificadas para os exons 1, 4, 6, 7 e 8 do gene RA e os resultados submetidos às análises estatísticas, teste U, quiquadrado e regressão logística. Foi verificada a existência de relação entre alteração no espermograma e mutação no gene RA. A análise da relação entre espermograma e mutação no gene RA dos cinco exons avaliados foi significativa somente para os exons 1 e 7. Os pacientes com alteração numérica para o espermograma apresentaram uma freqüência maior de mutações no exon 7, os pacientes teratozoospérmicos no exon 1 e os astenozoospérmicos no exon 7. Os exons 4, 6 e 8 não apresentaram relação estatística significativa para alterações no espermograma. Dentre os resultados referentes aos hábitos sociais, o etilismo mostrou-se significativo para mutações no gene RA. A realização desse estudo vem reafirmar a relação entre presença de mutações no gene RA como prováveis causas de defeitos na espermatogênese e, consequentemente, infertilidade masculina idiopática, não dependendo exclusivamente do fator gênico, mas da associação entre este fator e o meio ambiente onde o homem está inserido
APA, Harvard, Vancouver, ISO, and other styles
9

Neves, Adriana Freitas. "Variações transcricionais dos genes AR, SRD5A2, KLK2, PCA3, KLK3 e PSMA e implicações no diagnóstico molecular do câncer de próstata." Universidade Federal de Uberlândia, 2007. https://repositorio.ufu.br/handle/123456789/15771.

Full text
Abstract:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
CHAPTER I - Prostate cancer is a common disease in the world and in some countries it is one of the main causes of male population mortality. Some molecular markers have been associated with prostate carcinogenesis. To observe changes in transcript levels of the AR, SRD5A2, KLK2, PSMA and PCA3 genes, the mRNA was analyzed in tissues with prostatic adenocarcinoma (PCa, N= 48) and benign prostatic hyperplasia (BPH, N= 25), performed through a differential multiplex RT-PCR assay. Significant differences were observed in the relative expression of these genes between cancerous and non-cancerous tissues. The optical density ratio of the cDNA amplicons between PCa and BPH for the AR gene was 1.6-fold higher for the prostatic adenocarcinoma. On the other hand, the SRD5A2 mRNA levels were associated with BPH and were 1.4-fold higher than that of PCa. For KLK2, PSMA and PCA3, the transcriptional levels were respectively, 1.9-, 1.9- and 5-fold higher in PCa than those in BPH tissues. Of the diagnostics tests carried through individually, the PCA3 gene was that presented higher sensitivity and accuracy, and the inclusion of the serum PSA improved the sensitivity (of 76 to 92%), positive preditive value (of 85 to 94%), negative preditive value (of 60 to 62%) and accuracy (of 74 to 78%). The results suggest that the higher AR, KLK2, PSMA, and PCA3 and/or reduced SRD5A2 genes expression in prostatic tissues may indicate the occurrence of prostate adenocarcinoma; however the PCA3 and serum PSA analysis together are highly promising as auxiliary method in the diagnosis of this cancer. CHAPTER II - Purpose: Prostate cancer (PCa) is the most commonly diagnosed malignancy in men, and it consists of multifactorial and multifocal events. Due to the complexity of the disease process, which includes genome alterations, local invasion, micrometastatic cell extravasations to circulation, invasion of secondary organ tissues, and resistance to hormonal blockage, many markers must be used to represent the multiple and variable events that lead to cancer development. The low specificity of the unique serum marker for prostate cancer diagnostics, PSA, has leaded us to investigate four potential markers in the peripheral blood of patients by detecting their mRNA levels and associating them to clinical parameters. Methods: The expression levels of the KLK2, KLK3, PCA3 and PSMA transcripts were determined by Nested RT-PCR. Patients with PCa (99) and with benign prostatic hyperplasia (BPH, 36), and healthy volunteers (104) were investigated. Results: Significant differences for the RNA relative levels have been found for the KLK2, PCA3 and PSMA transcripts between PCa and BPH patients or healthy volunteers. The KLK2 and PSMA levels also presented a positive association (P<0.05) with extra-prostatic disease (pT3). The combined positive RT-PCR Nested for the KLK2, PCA3, PSMA genes with serum PSA higher than 4ng/mL presented a 10-fold higher chance of cancer occurrence than healthy controls, with sensitivity, specificity and positive predictive value of 57%, 89% and 93%, respectively. Conclusions: The combined analysis of KLK2, PCA3 and PSMA transcripts may become a useful tool for the discrimination of PCa patients from those with benign disease or healthy individuals. Additionally, the KLK2 and PSMA transcripts may also be used as prognostic markers for the presence of extra-capsular disease and assisting in the prediction of the post-operative outcome. CHAPTER III - Purpose: Transcripts of PCA3/DD3 gene are at the moment the most specific molecule found in prostate cancer specimens. This mRNA can be detected in important sample targets for clinical analyses, such as prostatic tissues, urine after prostatic massage, and the peripheral blood. Methods: The present study evaluated the PCA3 gene expression in prostatic tissues and in peripheral blood of BPH and PCa patients, by RT-PCR assays, and based on its detection together with other clinical parameters, we proposed a model for molecular monitoring in order to improve diagnosis as an auxiliary technology. Results: The concomitant use of PCA3 transcript detection in the peripheral blood and in prostate tissues has improved diagnosis, with sensitivity and an accuracy of 77%. For the molecular staging, patients have been classified as: localized disease (PBL-; negative PCA3) and circulating tumors cells disease (PBL+; positive PCA3). The higher frequencies of PBL- had been observed in T1-T2 stages (75%); on the other hand, the higher PCA3 positivity was observed for the T3-T4 staging (43%), while the T1-T2 stages presented 25% positivity. A correlation was found between the molecular staging and serum PSA < 10ng/mL before surgery, and approximately 60% of patients with T3-T4 stages that presented biochemical failure after radical prostatectomy presented a positive PCA3 result (P= 0.05), with an odds ratio of 16-fold higher for the possibility of disease recurrence in relation to the T1-T2 patients, and an accuracy of 82%. Conclusion: These data demonstrated the importance of the PCA3 gene as an auxiliary method in prostate cancer diagnosis, by distinguishing PCa from BPH patients, and also demonstrated its prognostic value in recurrent disease for post-operative patients. CHAPTER IV - Approximately 98% of all the products transcribed in the human genome correspond to non coding RNAs (ncRNA). Many ncRNA functions are attributed to this structural particularity given mainly for the secondary structures formed from its linear sequence of bases. Among the ncRNA types are tRNA, rRNA, small nuclear RNA, small nucleolar RNA, small interference RNA (siRNA), microRNA (miRNA) and catalytic RNAs (ribozymes). The bioinformatics has supplied useful tools in the prediction of optimal or suboptimal secondary structures allowing the design of interference RNA as miRNAs or siRNAs. In human, miRNAs have been associated with the development of diverse complex diseases as cancer. The PCA3 (DD3) gene was molecularly characterized as cancer and prostate specific, and its transcripts are non-coding, once no peptide products have been found. Due to its structural characteristics, the PCA3 gene belongs thus to the increasing family of ncRNA. In the present work, four new variant molecules of the PCA3 gene have been sequence characterized and their frequencies demonstrated in prostate cancer and in benign prostatic hyperplasia patients, as well as in healthy individuals. We have also investigated and predicted the putative secondary structures formed in order to elucidate its role in prostate cancer biology. No association has been found between the frequency of these molecules and prostate pathologies (PCa or BPH). On the other hand, PCA3 variants were found in 10% (12/115) of cases in the general population. Similar analyses of the possible polypeptides of these molecules demonstrated that it remains as a non-coding RNA, and introns presents in the first, second and fourth variants suggesting a possible role as a miRNA with intracellular activity to these molecules to the PCA3 gene. In prostatic tissues, 100% of the prostate cancer cases presented the RNA molecule with an exon 2 splicing. However, further investigation must be carried out to demonstrate the true role of these splicing variants in prostate tumors and in other pathologies, once these molecules have been preferentially found in the peripheral blood.
CAPÍTULO I - O câncer de próstata é uma doença comum no mundo e já assumiu em alguns países uma das principais causas de mortalidade da população masculina. Vários marcadores moleculares têm sido associados à gênese do câncer de próstata. A fim de demonstrar a expressão diferencial dos níveis transcricionais dos genes AR, SRD5A2, KLK2, PSMA e PCA3 em doenças prostáticas, o RNAm foi analisado em tecidos com adenocarcinoma prostático (CaP, N= 48) e hiperplasia prostática benigna (HPB, N= 25) por meio da técnica RT-PCR multiplex semi-quantitativa. Foram observadas diferenças significativas na expressão relativa desses genes entre os tecidos cancerosos e nãocancerosos. A taxa de densidade ótica entre os amplicons para cDNA provenientes do gene AR foi 1.6 vezes maior no adenocarcinoma prostático. Por outro lado, os níveis de RNAm do gene SRD5A2 foi associado com a HPB e foi 1.4 vezes maior do que no CaP. Para os genes KLK2, PSMA e PCA3, os níveis transcricionais foram respectivamente, 1.9, 1.9 e 5 vezes maior no câncer comparado a tecidos benignos. Dos testes diagnósticos realizados, o gene PCA3 individualmente foi o que apresentou as melhores sensibilidade e acurácia, sendo que a inclusão das medidas de PSA sérico melhorou a sensibilidade (de 76 para 92%), o valor preditivo positivo (de 85 para 94%), o valor preditivo negativo (de 60 para 62%) e a acurácia (de 74 para 78%). Os dados sugerem que a maior expressão dos genes AR, KLK2, PSMA e PCA3 ou expressão reduzida do gene SRD5A2 em tecidos prostáticos podem indicar a ocorrência do adenocarcinoma da próstata, sendo que as análises do gene PCA3 juntamente aos do PSA sérico são altamente promissores como método auxiliar no diagnóstico desse tipo de câncer. CAPÍTULO II - O câncer de próstata (CaP) e o mais comumente diagnosticado na população masculina e consiste de eventos multifatoriais e multifocais. Devido a complexidade da doença, a qual inclui alterações genômicas, invasão local, liberação de células micrometastáticas para a circulação, invasão secundaria de tecidos de outros órgãos, e resistência ao bloqueio hormonal, muitos marcadores podem ser usados para representar os eventos múltiplos e variáveis que levam ao desenvolvimento do câncer. A baixa especificidade do único marcador para diagnostico do câncer de próstata, PSA, tem nos levado a investigar quatro potenciais marcadores no sangue periférico de pacientes pela detecção de seus níveis de RNAm e associá-los a parâmetros clínicos. Os níveis de expressão dos transcritos do KLK2, KLK3, PCA3 e PSMA foram avaliados pela RT-PCR Nested, em pacientes com CaP (99), com hiperplasia prostática benigna (HPB, 36) e voluntários saudáveis (104). Diferenças significativas foram encontradas para a expressão dos genes KLK2, PSMA e PCA3 entre os pacientes com CaP e os pacientes com HPB ou voluntários saudáveis. Os níveis do KLK2 e PSMA também apresentaram associação positiva (P<0.05) com doença extra-prostática (pT3). A RT-PCR Nested positiva combinada para os genes KLK2, PCA3 e PSMA com PSA sérico maior que 4ng/mL apresentou uma chance 10 vezes maior de ocorrência do câncer comparado aos controles saudáveis, com sensibilidade, especificidade e acurácia de 57%, 89% e 93%, respectivamente. A análise combinada dos genes KLK2, PCA3 e PSMA pode ser uma ferramenta útil na distinção de pacientes com CaP daqueles com doença benigna ou de indivíduos saudáveis. Ainda, a analise dos transcritos KLK2 e PSMA podem ser usados como marcadores prognósticos para a presença de doença extra-capsular e auxiliando na predição de recidiva da doença no pós-operatório. CAPÍTULO III - Os transcritos do gene PCA3/DD3 são até o momento as moléculas mais específicas encontradas em espécimes de câncer de próstata. Esses RNAm podem ser detectados em importantes alvos para a análise clínica como tecidos prostáticos, na urina após massagem prostática e em sangue periférico. O presente estudo avaliou a expressão do gene PCA3 em tecidos prostáticos e em sangue periférico de pacientes com HPB e CaP, por técnicas de RT-PCR, e baseado na sua detecção juntamente com os parâmetros clínicos, foi proposto um modelo de estadiamento molecular como técnica assessória para melhor o diagnóstico da doença. O uso concomitante da detecção dos transcritos do gene PCA3 no sangue periférico e no tecido prostático melhorou o diagnóstico, com sensibilidade e acurácia de 77%. Para o estadiamento molecular, os pacientes foram classificados como contendo a doença localizada (PBL-) e em doença com células tumorais circulantes (PBL +). Maiores freqüências de tumor localizado pelo estadiamento molecular foram observadas nos estadios T1-T2 (75%), enquanto que 25 e 43% dos cânceres T1-T2 e T3-T4, respectivamente, apresentaram PCA3 positivo (células circulantes). Uma correlação foi encontrada para o estadiamento molecular para doença localizada e PSA sérico pré-cirúrgico < 10ng/mL, e aproximadamente 60% dos pacientes TNM T3-T4 que apresentaram falha bioquímica após a cirurgia radical apresentaram RTPCR positiva do PCA3 (P= 0.05), com um Odds Ratio 16 vezes maior para a possibilidade de recorrência da doença em relação aos pacientes T1-T2 e uma acurácia de 82%. Esses dados demonstram a importância da detecção do gene PCA3 como método no diagnóstico do câncer de próstata, por distinguir pacientes com CaP daqueles com HPB, e também demonstrando seu valor prognóstico na doença recorrente no pósoperatório dos pacientes. CAPÍTULO IV - Aproximadamente 98% de todos os produtos transcritos do genoma humano correspondem a RNAs não codificantes (RNAnc). Muitas funções dos RNAnc são atribuídas a suas particularidades estruturais dadas principalmente pelas estruturas secundárias formadas a partir da sua sequência linear de bases. Dentre os tipos de RNAnc estão os RNAt, RNAr, small nuclear RNA, small nucleolar RNA, small interference RNA (siRNA), microRNA (miRNA) e RNAs catalíticos (ribozimas). A bioinformática tem fornecido ferramentas úteis na predição de estruturas secundárias ótimas ou subótimas permitindo o design de RNAs de interferência como os miRNAs ou siRNAs. Em humanos, os miRNAs tem sido associados ao desenvolvimento de diversas doenças complexas como o câncer. O gene PCA3 (DD3) foi molecularmente caracterizado como câncer- e próstata- específico e os seus RNAs são os responsáveis por essa característica, isso porque nenhum produto protéico tem sido encontrado para esse gene. Devido às suas características estruturais, o gene PCA3, pertence assim à crescente família de RNAnc. No presente trabalho foi analisado as freqüências de quatro moléculas variantes do gene PCA3, além das anteriormente reportadas, como também foram preditas as suas estruturas secundárias na tentativa de elucidar o seu papel na biologia do câncer de próstata. Nenhuma associação foi encontrada entre a freqüência dessas moléculas e as patologias da próstata como hiperplasia benigna ou câncer, sendo que na população geral analisada essas variantes foram encontradas em apenas 10% (12/115) dos casos. As análises de homologia de possíveis polipeptídeos para essas moléculas demonstram que permanece o papel de RNA não-codificante para o gene PCA3. Ainda, a presença de introns nas variantes 1, 2 e 4 podem sugerir um papel intracelular de miRNA para essas moléculas do gene PCA3. Nos tecidos prostáticos, 100% dos casos de câncer foi representando pela molécula com splicing do exon 2. Contudo, para as variantes de splicing, novas pesquisas deverão ser realizadas incluindo outras patologias além das doenças prostáticas e outros tipos tumorais para verificar o real impacto dessas moléculas, uma vez que foram encontradas preferencialmente no sangue periférico.
Doutor em Genética e Bioquímica
APA, Harvard, Vancouver, ISO, and other styles
10

Souza, Daniel Santos. "Implementação de uma metodologia para genotipagem da região promotora do gene do TNF-a e sua aplicação em uma população exposta à sílica." reponame:Repositório Institucional da FIOCRUZ, 2010. https://www.arca.fiocruz.br/handle/icict/2412.

Full text
Abstract:
Made available in DSpace on 2011-05-04T12:36:24Z (GMT). No. of bitstreams: 0 Previous issue date: 2010
A silicose é uma pneumoconiose provocada pela inalação da poeira de sílica e consiste em uma lesão pulmonar com participação de citocinas como o Fator de Necrose Tumoral alfa (TNF-a). Há dois polimorfismos nos sítios -238 e -308 do promotor do gene da TNF-a (substituição de uma guanina por uma adenina) que têm sido investigados como possíveis fatores de susceptibilidade para a silicose. A mutação na posição -308 tem sido associada com altos níveis da citocina no sangue, enquanto que a posição -238, com formas mais graves da doença. A exposição ocupacional à sílica continua sendo um problema de Saúde Pública no Brasil. O Centro de Estudos de Saúde do Trabalhador e Ecologia Humana (CESTEH)/FIOCRUZ acompanha trabalhadores do Rio de Janeiro expostos à sílica. Este trabalho teve como objetivo a implementação de uma metodologia para determinação do polimorfismo dos sítios -308 e -238 do promotor da TNF-a para futura utilização na avaliação da exposição à sílica. A genotipagem foi feita através da técnica de PCR-RFLP (Polymerase Chain Reaction Restricition Fragment Length Polymorphism) usando NcoI para -308 e BamHI para -238. Foram realizados ensaios para a implementação da metodologia, sendo esta aplicada em uma amostra populacional de 79 trabalhadores assistidos no ambulatório do CESTEH, sendo todos do sexo masculino e maiores de 18 anos. (...) Nesse estudo, demonstrou-se que a presença do alelo mutante (A) está associada a maiores quantidades da citocina no sangue. Não foram encontradas diferenças significativas entre as médias da enzima GST e a presença ou não do alelo mutante. A presença do alelo -308A apresentou ainda um risco relativo de 3,697 para o desenvolvimento de silicose. A implementação de um método toxico genético permite a identificação de possíveis determinantes de suscetibilidade individual ao desenvolvimento da doença, aumentando o alcanço das avaliações da saúde do trabalhador.
Silicosis is a pneumoconiosis caused by inhalation of silica dust and consists of a lung injury with participation of cytokines, such as Tumor Necrosis Factor alpha (TNF- ). There are two polymorphisms at sites -238 and -308 of the gene promoter in TNF- (replacement of a guanine-adenine), which have been investigated as possible factors of susceptibility for silicosis. The mutation at positon -308 has been associated with high levels of cytokine in the blood, while at -238 with severe forms of the disease. Occupational exposure to silica remains a public health problem in Brazil. The Center for Studies on Workers' Health and Human Ecology (CESTEH) / FIOCRUZ follows Rio de Janeiro's workers exposed to silica. This study aimed to implement a methodology for determining the polymorphism of sites -308 and -238 of the promoter of TNF- for future use in the assessment of exposure to silica. Genotyping was made by PCR-RFLP (Polymerase Chain Reaction – Restricition Fragment Length Polymorphism) using NcoI for -308 and BamHI for -238. Tests were performed for implementing the methodology, which was applied in 79 employees assisted by CESTEH, all male and aged over 18. After the tests, the following conditions were fixed for both sites: 100ng of DNA, extracted from 500μL of whole blood, were used as template for PCR with 1.5 U of Taq-DNA Polymerase Recombinant and a final volume of 50μL. The primers were: 5'AGGCAATAGGTTTTGAGGGCCAT and 5'TCCTCCCTGCTCCGATTCCG as sense and antisense to -308 and 5'AAACAGACCACAGACCTGGTC and 5'CTCACACTCCCCATCCTCCCGGATC to -238. The PCR parameters for -308 site were: 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60, generating a fragment of 107 pb. The PCR parameters for -238 site were; 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60s, generating a fragment of 165 pb. The digestion was made with 5U of endonuclease for 1mg of DNA incubated at 37°C for 1 hour. Individuals with the mutant allele lose the site which is attacked by the restriction enzyme. Workers genotyped for the -308 site showed 16.4% (n = 13) for the GA genotype, 82.3% (n = 65) for GG and 1.3% (n = 1) for the genotype AA. The -238 site showed the frequencies of 2.3% (n = 2) for GA, 97.7% (n = 77) for GG and zero for AA. This study shows that the presence of the mutant allele (A) is associated with greater amounts of cytokine in the blood. There were no significant differences between the means of the enzyme GST and the presence of the mutant allele. The presence of the -308 mutant allele also showed a relative risk of 3,697 for the development of silicosis. The implementation of a toxicogenetic method allows the identification of possible determinants of individual susceptibility to disease development, increasing the reach of the evaluations of occupational health.
APA, Harvard, Vancouver, ISO, and other styles
11

Cani, Catarina Gomes. "Estudo histológico e molecular dos efeitos da exposição ao material particulado inalável fino da cidade de São Paulo nos testículos de camundongos." Universidade de São Paulo, 2018. http://www.teses.usp.br/teses/disponiveis/5/5135/tde-09042018-083802/.

Full text
Abstract:
A poluição atmosférica de centros urbanizados e industrializados é associada a diversos efeitos nocivos, incluindo alterações na fertilidade masculina. A toxicidade da poluição atmosférica da cidade de São Paulo já foi demonstrada em estudos experimentais e especula-se que seus efeitos sejam mediados por estresse oxidativo, porém, os mecanismos envolvidos ainda não são totalmente conhecidos. O objetivo deste estudo foi avaliar os efeitos da exposição à poluição atmosférica da cidade de São Paulo sobre os testículos de camundongos. Para isso, os animais foram expostos à fração da poluição atmosférica mais implicada em danos à saúde, o material particulado inalável fino, que é uma complexa mistura de substâncias com 2,5 ?m ou menos de diâmetro aerodinâmico (MP2,5). Um grupo de camundongos foi exposto ao MP2,5 durante o período gestacional e após o nascimento, no período entre o pós-desmame e a idade adulta (grupo pré-natal e pós-desmame - GPNPD); um segundo grupo de camundongos foi exposto ao MP2,5 apenas durante o período gestacional (grupo pré-natal - GPN); o terceiro grupo foi exposto ao MP2,5 apenas após o nascimento, depois do desmame até a idade adulta (grupo pós-desmame - GPD); e o quarto grupo foi o controle (GC), formado por camundongos que foram expostos ao ar filtrado, tanto durante o período gestacional quanto após o nascimento até a idade adulta. Os efeitos do MP2,5 foram avaliados nos testículos de animais adultos, com 90 dias de vida. Técnicas estereológicas foram aplicadas para analisar aspectos estruturais do testículo e o escore de Johnsen foi utilizado para avaliar qualitativamente a espermatogênese. A expressão gênica foi realizada pela técnica de microarranjos de DNA. Na comparação com o GC, os animais do GPNPD apresentaram peso e volume dos testículos, área de superfície dos túbulos seminíferos, volume do epitélio seminífero e peso dos epidídimos maiores, bem como menor qualidade da espermatogênese, com p < 0,05 em todos esses parâmetros. O GPD teve comportamento semelhante, porém, apenas o volume do epitélio seminífero e a qualidade da espermatogênese diferiram significativamente do GC. O volume do epitélio seminífero do GPN foi menor que o do GC e esse foi o único parâmetro com diferença estatística em relação ao GC. A análise de expressão gênica evidenciou alteração de expressão de genes envolvidos na espermatogênese e na esteroidogênese, além de vários outros genes envolvidos nas vias de resposta imune, estresse oxidativo, dano de DNA e apoptose. Os resultados deste estudo mostraram que a exposição ao MP2,5 da cidade de São Paulo foi capaz de causar alterações nas funções testiculares de camundongos
Air pollution in industrial and urban centers is related to negative effects in living organisms, including alterations in male fertility. Experimental studies had already showed toxicity aspects related to the air pollution of the city of Sao Paulo. The hypothesis surrounding its toxicity is based on oxidative stress, but the mechanisms are not yet completed understood. The objective of this study was to evaluate the effects of the exposure to air pollution of the city of Sao Paulo on mice testes. To do so, animals were exposed to the most deleterious fraction of the air pollution, the fine inhalable particulate matter, which consists of a complex mixture of particles sized 2,5 ?m or less of aerodynamic diameter (PM2,5). A group of mice was exposed to PM2,5 during gestational period and after birth, from the weaning day until adulthood (pré-natal and post-weaning group - PNPWG); another group was exposed to PM2,5 during gestational period only (pré-natal group - PNG); a third group was exposed to PM2,5 after birth, from the weaning day until adulthood only (post-weaning group - PWG); and finally, a fourth group of mice was exposed to filtered air during gestational period and from post-weaning day until adulthood (control group - CG). The analyses were performed on testes from adult animals. Stereological techniques were used to analyze structures of the testes and Johnsen\'s score to evaluate spermatogenesis in a qualitative way. DNA microarray were used to evaluate gene expression. Significant differences (p < 0,05) between the PNPWG and the CG were found for testis weight and volume, surface area of the seminiferous tubules, volume of the seminiferous epithelium and epididymis weight. For all these parameters the mean values of the PNPWG were higher. The quality of spermatogenesis in the PNPWG was also significant differently from CG, showing a worse quality of spermatogenesis. The PWG had similar results, however the only parameters with significant difference from the CG were the volume of the seminiferous epithelium and the quality of spermatogenesis. The volume of the seminiferous epithelium from the PNG showed significant lower mean compared to the CG. The gene expression analysis showed differential expression of genes related to spermatogenesis and steroidogenesis. Also, altered expression was found for genes related to oxidative stress, immune response, DNA damage and apoptosis ways. The results of the present study showed that the exposition to the PM2,5 of the city of Sao Paulo was capable of elicit testes alterations in mice
APA, Harvard, Vancouver, ISO, and other styles
12

Wintzingerode-Knorr, Friedrich Wasmuth Lotar Frhr. "Untersuchungen zur mikrobiellen Diversität einer anaeroben, Trichlorbenzol-dechlorierenden Mischkultur." Doctoral thesis, Humboldt-Universität zu Berlin, Mathematisch-Naturwissenschaftliche Fakultät I, 1999. http://dx.doi.org/10.18452/14330.

Full text
Abstract:
Chlorbenzole sind aufgrund ihrer weiten Verbreitung in Industrie und Landwirtschaft und ihrer geringen chemischen Reaktivität sowie guten Fettlöslichkeit ubiquitäre Umweltkontaminanten, die sich in der Nahrungskette anreichern. Eine natürliche, mikrobielle Dechlorierung dieser Verbindungen ist von besonderem Interesse, da die Toxizität chlorierter Benzole mit der Anzahl der Chlorsubstituenten steigt. Im Gegensatz zu Mono- und Dichlorbenzol, die durch aerobe Laborreinkulturen dechlorierbar sind, werden höher chlorierte Benzole bevorzugt unter anaeroben Bedingungen in Mischkulturen mit unbekannter Spezieszusammensetzung dechloriert. Bioreaktoren, in denen solche undefinierten Mischkulturen kontinuierlich kultiviert werden, sind eine vielversprechende Technik bei der Behandlung Chlorbenzol-kontaminierter Abwässer. Aufgrund der unbekannten Zusammensetzung der Population muß die mikrobielle Aktivität jedoch als "black box" betrachtet werden, was eine direkte Steuerung und Optimierung solcher Bioreaktoren erschwert. Zur Bestimmung der mikrobiellen Diversität einer in ihrer Zusammensetzung unbekannten, Trichlorbenzol(TCB)-dechlorierenden Bioreaktorkultur wurde aufgrund der bekannten Limitierungen kulturabhängiger Methoden die kulturunabhängige, vergleichende Sequenzanalyse direkt amplifizierter und klonierter 16S-rDNA gewählt. Die durch eine neuentwickelte Hybridisierungsmethode wesentlich vereinfachte Analyse der 16S-rDNA-Genbibliotheken erlaubte eine phylogenetische Klassifizierung der in der TCB-dechlorierenden Mischkultur abundanten Mikroorganismen (Bakterien und Archaea) und zeigte das Auftreten von 51 bakteriellen 16S-rDNA-Klonfamilien, mit einem weiten phylogenetischen Spektrum und teilweise enge Verwandtschaften zu anaerob dechlorierenden Dehalobacter spp. oder zu unkultivierten Bakterien eines vergleichbaren Biotops. Dieser Diversität stand eine dominierende Methanosaeta-ähnliche Klonfamilie innerhalb der Archaea gegenüber. Die aus der phylogenetischen Klassifizierung abgeleiteten metabolischen Eigenschaften einiger Bakterien und Archaea der TCB-dechlorierenden Mischkultur konnten durch gezielte Anreicherung und in-vitro Kultivierung bzw. die kulturunabhängige Sequenzanalyse funktioneller Gene bestätigt werden. Die dargestellten Ergebnisse lassen eine spezifische Zusammensetzung der TCB-dechlorierenden Mischkultur vermuten und geben Hinweise auf Indikatororganismen, die ein Monitoring und eine damit verbundene Effizienzsteigerung der anaeroben TCB-Dechlorierung im Bioreaktor ermöglichen könnten.
Due to their widespread application in industry and agriculture and their chemical stability chlorobenzenes (CB) are ubiquitous pollutants in soil, sediments, and aquifers. Since toxicity of CBs increases with the number of chlorine substituents, microbial dechlorination of CBs is of major interest. In contrast to di- and monochlorobenzenes (DCB and MCB) higher chlorinated benzenes are more resistant to aerobic dechlorination. However, for these compounds reductive dechlorination by different anaerobic microbial communities is well known. Bioreactors inoculated with complex dechlorinating anaerobic microbiota seem to be promising technologies for bioremediation of CB-contaminated aquifers. Several studies showed the efficiency of such bioreactors in treating chloroaromatic contaminated wastewaters. However, due to the unknown species diversity microbial activity had to be treated as a "black box" and direct optimization was hampered. To determine the microbial diversity of an anaerobic consortium in a fluidized bed reactor used for dechlorination of trichlorobenzene (TCB) I employed comparative sequence analysis of 16S rRNA genes after direct PCR-amplification and cloning from community DNA since culture-based methods have shown to be strongly biased. The application of a new hybridization based screening approach for bacterial 16S rDNA clone libraries drastically simplified the analysis and allowed the phylogenetic classification of the abundant bacteria and archaea. A total of 51 bacterial 16S rDNA clone families were found, which showed a wide distribution among the main bacterial phyla. Several bacterial 16S rDNA clone families were closely related to anaerobic, dechlorinating Dehalobacter spp. and to yet-uncultured bacteria of a similar habitat. In contrast to the high bacterial diversity archaeal 16S rDNA clone libraries were clearly dominated by a Methanosaeta concilii-like clone family. Some yet-uncultured bacteria and archaea of the TCB-dechlorinating consortium were sufficiently closely related to studied organsims that reasonable physiological hypotheses could be formulated. These hypotheses were confirmed by either cultivation of the respective organism or by culture-independent sequence analysis of specific functional genes. The results suggest a specific community structure of the TCB-dechlorinating consortium and give evidence for indiator organisms. Moleculargenetic monitoring of these indicator organisms might allow the optimization of the continous TCB-dechlorination in the fluidized bed reactor.
APA, Harvard, Vancouver, ISO, and other styles
13

Kuasne, Hellen. "Investigação dos genes APEX1, XRCC1, PSA e AR como candidatos a marcadores moleculares para o câncer de próstata." UEL, IAPAR, EMBRAPA. Centro de Ciências Biológicas. Programa de Pós-Graduação em Genética e Biologia Molecular, 2009. http://www.bibliotecadigital.uel.br/document/?code=vtls000157963.

Full text
Abstract:
O câncer de próstata é o segundo tipo de câncer mais incidente no Brasil. Dentre os genes de interesse relacionados com esta neoplasia, destacam-se os participantes da via dos andrógenos, como o Receptor de Andrógeno (AR), o Antígeno Específico da Próstata (PSA) e os da via de reparo a danos no DNA (APEX1 e XRCC1). Polimorfismos nesses genes são freqüentes na população, podendo levar a alterações das atividades gênicas e contribuir para o risco de desenvolvimento e progressão do tumor. O objetivo deste trabalho foi analisar as freqüências dos genótipos prevalentes, heterozigotos e raros dos genes PSA, XRCC1 e APEX1 e o tamanho das repetições CAGs do gene AR em pacientes com carcinoma de próstata (níveis de PSA superiores a 2,5 ng/mL e confirmação histopatológica) e em indivíduos-controle (PSA menor que 2ng/mL). Peças tumorais de 60 pacientes foram genotipadas por análise de fragmentos utilizando seqüenciador automático para caracterizar o comprimento das repetições CAG, as quais foram divididos em alelos curtos (CAG > 20 repetições) ou alelos longos (CAG > 20 repetições). Os genes PSA, XRCC1 e APEX1 foram analisados por PCRRFLP e juntamente com o AR foram avaliados quanto a parâmetros histopatológicos clínicos. A freqüência dos genótipos considerados de risco para o gene XRCC1(A/A ou A/G) foi de 57,6% nos pacientes e 62,2% nos controles. Para o gene APEX1 obteve-se 51,2% dos genótipos considerados de risco (G/G ou G/T) nos pacientes e 38,4% nos controles. A análise estatística pelo cálculo da Odds Ratio (OR) e do intervalo de confiança (IC=95%) mostrou associação positiva entre o gene APEX1 (OR=1,68 IC95% 1,10-2,58) e o câncer de próstata. O mesmo resultado não foi observado para o gene XRCC1 (OR=0,82 IC95% 0,53-1,27) e na análise combinada (OR=1,27 IC95% 0,79-2,05). Ambas as variantes dos genes de reparo não se mostraram relacionadas a graus mais agressivos do processo tumoral. Este estudo demonstrou associação do genótipo G/G do gene PSA com um maior risco de desenvolver câncer de próstata. (OR=1,75 IC95%1,05-2,92), assim como as repetições CAGs curtas do gene AR (OR=1,89 IC95% 1,21-2,96). A análise combinada para os dois genes mostrou um aumento de duas vezes no risco para o desenvolvimento da neoplasia (OR=2,02; IC 95%=1,07-3,82). As repetições curtas CAG estão relacionadas com escore de Gleason 7 (4+3), de pior prognóstico (OR=8,8 IC95% 1,06-73,05), enquanto o genótipo G/G está associado a escores de Gleason maiores que 7 (OR=2,54 IC95% 1,27 -5,07). Os resultados das peças tumorais demonstraram que 38,3 % das amostras apresentaram quadros de instabilidade de microssatélites, tanto no sentido de ganhos como de perdas das repetições CAGs. Concluindo, o genótipo raro do gene APEX1 e as variantes gênicas dos genes AR e PSA parecem influenciar a suscetibilidade para o câncer de próstata, além de estarem envolvidas com estágios mais agressivos do processo tumoral.
The prostate cancer is the second most common type of cancer in Brazil. From the genes of interest related to the prostate cancer, those belong to the androgen pathway, as the Androgen Receptor (AR) and Prostate Specific Antigen (PSA) and those from the DNA repair pathway (APEX1 and XRCC1) have particularly prominence. Polymorphisms in these genes are often seen in the population and may lead to gene activate alterations, contributing to a higher risk of cancer and tumor progression. The aim of this study was to analyze the frequencies of prevalent, heterozygous and rare genotype from the PSA, XRCC1 and APEX1 genes and the length of CAGs repeats of AR gene in patients with prostate cancer (levels of PSA higher than 2,5 ng/mL and histological confirmation) and in free-cancer controls (PSA lower than 2ng/mL). Tumors from 60 patients were genotyped by a fragment analysis on an automated DNA sequencer to verify the length of the CAG repeats, The length of alleles were considered short (CAG >20 repeats) and long (CAG > 20 repeats). The genes PSA, XRCC1 and APEX1 were analyzed by the PCR-RFLP method and, as the AR gene, were evaluated for clinical and pathological parameters. The frequencies of the consider risk genotype for the XRCC1 gene (A/A or A/G) were 57,6% in the patients and 62,2% in the controls. For the APEX1 gene 51,2% of the considered risk genotype (G/G or G/T) were found in the patients and 38,4% in the controls. The statistical analysis by the Odds ratio (OR) and confidence interval (CI=95%) showed positive association between the APEX1 gene and prostate cancer (OR=1,68 CI95% 1,10-2,58). No association was found for the XRCC1 gene (OR=0,82 CI95% 0,53-1,27) or the combined analysis (OR=1,27 CI95% 0,79-2,05). No relationship was found between tumor aggressiveness and variants of repair genes. The genotype G/G of PSA showed association with development prostate cancer risk (OR=1,75 CI95%1,05-2,92), as like as the short repeats of CAG of AR gene (OR=1,89 CI95% 1,21-2,96). The combined analysis for these two genes showed a double risk for this neoplasia (OR=2,02; CI 95%=1,07-3,82). The short repeats of CAG were related with Gleason score 7 of worse prognosis (4+3=7), while the genotype G/G of PSA were associates with Gleason score higher than 7 (OR=2,54 IC95% 1,27 -5,07). The results of tumors analysis showed that 38,3% of the samples had instability of microsatellites, both for gain or lost of the CAG repeats. In conclusion, the rare genotype of the APEX1 gene is associated with a higher risk of prostate cancer, in the same way, the genetics variants of PSA and AR seems to influence the genetic susceptibility for this cancer and tumor aggressiveness.
APA, Harvard, Vancouver, ISO, and other styles
14

Souza, Marilesia Ferreira de. "Análise dos níveis de metilação e de polimorfismos genéticos dos genes GSTP1, MGMT, VDR e AR em pacientes com câncer de próstata." Universidade Estadual de Londrina, Instituto Agronômico do Paraná, EMBRAPA. Programa de Pós-Graduação em Genética e Biologia Molecular, 2013. http://www.bibliotecadigital.uel.br/document/?code=vtls000193576.

Full text
Abstract:
O câncer de próstata é o segundo tipo de neoplasia mais incidente no mundo. A eficácia do exame de PSA (Antigeno Prostático Específico), atualmente empregado para triagem da doença, está em discussão devido à suas limitações quanto à sensibilidade e especificidade. Portanto, a busca de novos marcadores mais sensíveis e eficazes para essa neoplasia é de extrema importância para reduzir o impacto clínico da mesma. A fim de contribuir para a solução deste problema, o presente estudo visou a busca de marcadores genéticos e epigenéticos de diagnóstico e prognóstico para o câncer de próstata. A pesquisa consistiu de amostras de DNA genômico extraídos de sangue periférico de 223 indivíduos com câncer de próstata e 223 indivíduos livres de neoplasia. A técnica de PCR em tempo real foi empregada para a realização da genotipagem de um polimorfismo para cada um dos genes previamente selecionados: GSTP1, MGMT, VDR e AR. A análise genotípica não mostrou associação entre câncer de próstata e os polimorfismos estudados individualmente. Entretanto, a associação dos genótipos GG (GSTP1) e GA (VDR) conferiu um aumento de risco para o câncer de próstata (OR=2,34; IC95%=1,10-4,97, p=0,04). Por outro lado, um efeito protetor para comprometimento de vesícula seminal foi conferido pelo genótipo AG do gene GSTP1 (OR=0,22; IC95%=0,07-0,69, p=0,01), e quando este foi associado com o gene AR (G), apresentou efeito protetor para o câncer de próstata (OR=0,61; IC95%=0,39-0,96, p=0,04). Para a realização das análises de metilação de DNA foram selecionados 76 pacientes dos quais foram obtidas amostras de DNA de tecido tumoral e adjacente normal de próstata. A mensuração dos níveis de metilação dos genes GSTP1 e MGMT foi realizada pela técnica MS-HRM (Methylation-sensitive high resolution melting) e mostrou baixos níveis de metilação de DNA no gene MGMT em ambos tecidos estudados. Em contrapartida, altos níveis de metilação para o gene GSTP1 foram encontrados no tecido tumoral em relação ao tecido adjacente normal (p<0,0001), níveis estes que apresentaram-se associados com a agressividade da doença. Além disso, foi observada associação positiva entre níveis de metilação do promotor do gene GSTP1 e o polimorfismo rs1695 do mesmo gene. Portanto, podemos sugerir com este estudo que combinações de genótipos de genes de diferentes vias podem estar relacionados com risco ou proteção do câncer de próstata; que a metilação do promotor do gene GSTP1 é um bom marcador de prognóstico e diagnóstico, relacionado inclusive com agressividade tumoral; e que polimorfismos neste gene podem estar relacionados com os níveis de metilação do promotor do mesmo.
The prostate cancer is the second most frequent type of cancer around the world. The effectiveness of PSA test (Prostate-specific antigen), currently used for screening the disease, is under discussion because of the limitations in sensitivity and specificity. Therefore, the searching for new markers more sensitive and effective for this neoplasia is extremely important to reduce the clinical impact of the disease. To contribute to the solution of this problem, this study aimed to search for genetic and epigenetic markers for diagnosis and prognosis of prostate cancer. The research consisted of samples of genomic DNA extracted from peripheral blood of 223 patients with prostate cancer and 223 healthy individuals. The real-time PCR was used to perform the genotyping of one polymorphism to each gene previously selected: GSTP1, MGMT, VDR and AR. Genotypic analysis showed no association between prostate cancer and the polymorphisms studied individually. However, the association of the GG genotype (GSTP1) and GA (VDR) provided an increased risk for prostate cancer (OR = 2.34, IC95% = 1.10-4.97, p=0.04). On the other hand, a protective effect for impairment of seminal vesicle was provided by AG genotype of GSTP1 gene (OR = 0.22, IC95% = 0.07- 0.69, p=0.01), and when this genotype was associated with the AR (G), it showed a protective effect for prostate cancer (OR = 0.61, IC95%=0.39-0.96). To carry out the DNA methylation analysis 76 patients were selected and were obtained DNA samples from tumor tissue and adjacent normal tissue of prostate. The measurement of the levels of methylation of GSTP1 and MGMT genes were performed by MS-HRM (Methylation-sensitive high resolution melting), and showed low levels of DNA methylation of MGMT gene in both tissues evaluated. In contrast, high levels of methylation of the GSTP1 gene were found in tumor tissue compared to adjacent normal tissue (p <0.0001), and the high levels of methylation are associated with the aggressiveness of the disease. Furthermore, a positive association was observed between methylation levels of GSTP1 gene and rs1695 polymorphism in the same gene. Therefore, we suggest that genotype combinations of genes from different pathways may be related to risk or protection of prostate cancer; GSTP1 gene promoter hypermethylation is a good marker for prognosis, diagnosis and tumor aggressiveness; and polymorphisms in this gene can be linked to the promoter methylation levels.
APA, Harvard, Vancouver, ISO, and other styles
15

Lai, John. "Functional analyses of polymorphisms in the promoters of the KLK3 and KLK4 genes in prostate cancer." Queensland University of Technology, 2006. http://eprints.qut.edu.au/16454/.

Full text
Abstract:
This PhD aimed to elucidate the mechanisms by which polymorphisms may alter androgen-induced transactivation of androgen receptor (AR) target genes which may be important in prostate cancer aetiology. The second aspect of this PhD focused on identifying and characterising functional polymorphisms that may have utility as predictive risk indicators for prostate cancer and which may aid in earlier therapeutic intervention and better disease management. Analyses were carried out on the kallikrein-related peptidase 3 (KLK3), also known as the prostate specific antigen (PSA), gene and the kallikrein-related peptidase 4 (KLK4) gene. The PSA and KLK4 genes are part of the serine protease family that have trypsin or chymotrypsin like activity and are thought to play a role in the development of hormone-dependent cancers in tissues such as those in the prostate, breast, endometrium and ovaries. In the prostate, PSA is regulated by androgens and three androgen response elements (AREs) have been described in the promoter and upstream enhancer region. The PSA ARE I harbours a polymorphism at -158 bp from the transcription initiation site (TIS) that results in a G to A transition (G-158A). This PhD investigated the functional significance of the PSA G-158A polymorphism which has been reported to be associated with prostate cancer risk. Electromobility shift assays (EMSAs) investigating the interaction of ARE I variants with the AR DNA binding domain (AR-DBD) demonstrated that the A allele had a two-fold increased binding affinity for the AR-DBD when compared with the G allele. This was confirmed with endogenous AR in limited proteolysis-EMSA experiments. The limited proteolysis-EMSA experiments also demonstrated differential sensitivities of PSA ARE I alleles to trypsin digestion, which suggests that the G-158A polymorphism has an allosteric effect on the AR that alters AR/ARE I complex stability. Furthermore, Chromatin Immunoprecipitation (ChIP) assays suggest that the A allele more readily recruited the AR in vivo when compared with the G allele and is consistent with the in vitro binding data. Luciferase reporter assays carried out in both LNCaP and 22Rv1 prostate cancer cells, and using the natural (dihydrotestosterone; DHT) ligand demonstrated that the A allele was more responsive to androgens in LNCaP cells. Hence, this study has elucidated the potential mechanisms by which the G-158A polymorphism may differentially regulate PSA expression (of which up-regulation of PSA is thought to be important in prostate cancer development and progression). KLK4 has similar tissue-restricted expression as PSA and is up-regulated by steroid hormones in many endocrine cells including those in the prostate. A putative ARE (KLK4-pARE) located at -1,005 to -1019 relative to the more predominantly used transcription initiation site, TIS3, was initially found in supershift assays using AR antibodies to interact with endogenous AR. However, subsequent EMSA analysis using purified AR-DBD suggest that KLK4-pARE may be interacting with the AR indirectly. To investigate this hypothesis, a tandem construct of KLK4-pARE was cloned into the pGL3-Promoter vector for hormone-induced reporter assays. However, reporter assays did not demonstrate any responsiveness of KLK4-pARE to androgens, estradiol or progestins. Consequently, Real-Time PCR was carried out to reassess the hormonal regulation of KLK4 at the mRNA level. Consistent with the literature, data from this study suggests that KLK4 may be up-regulated by androgens, progestins and estradiol in a cyclical manner. Hormone-induced luciferase reporter assays were then carried out on seven promoter constructs that span 2.8 kb of the KLK4 promoter from TIS3. However, none of the seven promoter constructs demonstrated any significant responsiveness to androgens, estradiol or progestins. This study suggests that hormone response elements (HREs) that may drive the hormonal regulation of KLK4 in prostate cancer may be located further upstream from the promoter region investigated in this PhD, or alternatively, may lie 3' of TIS3. The characterisation of KLK4 promoter polymorphisms and their flanking sequences were also carried out in parallel to the functional work with the intent to assess the functional significance of any polymorphisms that may be located within HREs. In total 19 polymorphisms were identified from the public databases and from direct sequencing within 2.8 kb of the KLK4 promoter from TIS3. However, the functional and clinical significance of these 19 polymorphisms were not further pursued given the negative findings from the functional work. The PSA AR enhancer region was also assessed for potential polymorphisms that may be associated with prostate cancer risk. A total of 12 polymorphisms were identified in the PSA enhancer of which two (A-4643G and T-5412C) have been reported to alter functionality of the enhancer region and thus, prioritised for further analysis. Association analysis for prostate cancer risk was then carried out on these PSA enhancer polymorphisms as none of the KLK4 promoter polymorphisms were found in functional HREs. No significant association for either the A-4643G or T-5412C polymorphism with prostate cancer risk was found at the P = 0.05 level. However, under an age-adjusted dominant model a 1.22- (95% CI = 1.16-1.26) and 1.23-fold (95% CI = 1.17-1.29) increased risk for prostate cancer was found for the A-4643G or T-5412C polymorphisms, respectively. Both polymorphisms were also assessed for association with tumour grade and stage and PSA levels. Genotypes were significantly different for the A-4643G and T-5412C polymorphisms with tumour stage and PSA levels, respectively. However, these results are likely to be biased by the case population which consist primarily of men who presented with incidental (pT1) and organ-confined (pT2) tumours. To summarise, the A-4643G and T-5412C polymorphisms are unlikely to be associated with prostate cancer risk, PSA levels or stage/grade of disease. However, further analyses in a larger cohort is warranted given that these polymorphisms alter androgen responsiveness of the PSA enhancer and that elevated PSA levels are indicative of men with prostate cancer. To summarise, this PhD has elucidated the functional significance of the PSA G-158A polymorphism in prostate cancer and which may be important in prostate cancer patho-physiology. This PhD has also furthered the understanding of the hormonal regulation of KLK4 in prostate cancer cells. Finally, this PhD has carried out a pilot study on two functional PSA enhancer polymorphisms (A-4643G and T-5412C) with prostate cancer risk.
APA, Harvard, Vancouver, ISO, and other styles
16

Souza, Daniel Bassi de Oliveira. "Outdoor: sem querer, você já leu - um estudo sobre a relação entre gênero e suporte." Pontifícia Universidade Católica de São Paulo, 2009. https://tede2.pucsp.br/handle/handle/14575.

Full text
Abstract:
Made available in DSpace on 2016-04-28T19:34:38Z (GMT). No. of bitstreams: 1 Daniel Bassi de Oliveira Souza.pdf: 2341730 bytes, checksum: d5b1fb466b7b1c5f3ff8c42a39071a8e (MD5) Previous issue date: 2009-05-14
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
This thesis was developed in acording with north-american line in Genre Analisys and deals with the support s influence in the constitution of advertising messages for outdoor, intending verify if the outdoor advertisiment, in advertising discourse, can be considered as a advertising genre or of it is an advertisement adaptded for the support. The general objective of this thesis is to contribute to analitycal studies of genre in Brasil. The specific objectives are: 1) caracterize the advertising practice; 2) verify if there are difference between texts outdoor advertisiment and texts in news and magazines advertisiment; 3) verify, in the case of difference happens, which factors influence such distinctions; 4) verify if the differences are good enough to consider the outdoor advertisiment and news and magazines advertisiments as such different genres. Based on the assumption that the genres emerge as answers for some kind of exigence in communicative situation, the support while one of the elements of such situation cans influence the genre s textualization. In this way, we consider important verify if the inlfuence of the support named outdoor interfers in adverstisement s textualization. To realize this analisys, we used as mothodological apport Bhatia s (1993) model of rethoric movies and steps organization in sales promotional letters intending to verify which similarities and differeces exist among such model and the adverstiment news and maganize movies and steps organization and advertisiment outdoor movies and steps organization. Findings of the analysis indicated that
Esta dissertação se desenvolve segundo a Análise de Gêneros de vertente norte-americana e trata da influência do suporte na constituição de mensagens publicitárias veiculadas em outdoor, a fim de verificar se ele pode ser considerado um gênero do domínio discursivo publicitário ou se é um anúncio adaptado ao suporte. O objetivo geral é contribuir para o estudo analítico de gêneros textuais no Brasil. Os objetivos específicos são: 1) verificar se há diferença, no plano discursivo, entre os textos veiculados em outdoor e anúncios veiculados em jornais e revistas; 2) verificar, caso haja diferença, quais os fatores que influenciam essa distinção; 3) verificar se tais diferenças são suficientes para considerar o outdoor e o anúncio gêneros diferentes. Tendo por pressuposto que os gêneros emergem como respostas a determinadas exigências de uma situação de comunicação, o suporte pode influenciar na textualização do gênero. Nesse sentido, consideramos importante verificar se a influência do suporte outdoor interfere na textualização de um anúncio. Para realizar essa análise, utilizamos como aparato metodológico o modelo de gênero promocional proposto por Bhatia (1993), a fim de verificar as semelhanças e diferenças existentes entre esse modelo e o anúncio de jornal e revista e o outdoor. Os resultados obtidos indicam que: 1) existem diferenças estruturais, quantitativas e qualitativas entre o anúncio de jornal e revista e o outdoor; 2) essas diferenças estão baseadas nas condições de produção, que levam ao uso de estratégias discursivas diferentes para cada situação de comunicação; 3) cada anúncio recebe uma denominação diferente, dependendo do suporte em que está inserido, o que indica que cada um deles corresponde a um gênero de facto
APA, Harvard, Vancouver, ISO, and other styles
17

Chen, Pei-Hong. "Nuclear receptor interaction protein, a coactivator of androgen receptors (AR), is regulated by AR and Sp1 to feed forward activate its own gene expression through AR protein stability." 2008. http://www.cetd.com.tw/ec/thesisdetail.aspx?etdun=U0001-0307200817063800.

Full text
APA, Harvard, Vancouver, ISO, and other styles
18

Chen, Pei-Hong, and 陳沛鴻. "Nuclear receptor interaction protein, a coactivator of androgen receptors (AR), is regulated by AR and Sp1 to feed forward activate its own gene expression through AR protein stability." Thesis, 2008. http://ndltd.ncl.edu.tw/handle/56767418531660865306.

Full text
Abstract:
博士
國立臺灣大學
微生物學研究所
96
Prostate cancer is the second-leading male-specific death in the world. The androgen-AR signaling has been considered as the primary cause in the prostate cancer progression. AR coactivators play a pivotal role in the AR signaling and are expressed abnormally in some prostate cancer tissues. Androgens act through the AR to target androgen response elements (AREs) in the promoter of AR target genes (e.g., p21, FGF8, etc.) which stimulate cell proliferation and ultimately tumor formation. Nuclear receptor interaction protein (NRIP) is recently found in our lab in the yeast-two hybrid system using C-terminus of AR as a bait. NRIP is an AR coactivator which can activate PSA transcription in an androgen-dependent manner. NRIP directly interacts with AR and is involved in cell proliferation and survival in AR-sensitive LNCaP cells, a prostate cancer cell line. Small interfering RNA (siRNA)-mediated knockdown of NRIP expression reduces the transcription of AR target genes and results in cell apoptosis. NRIP expression is increased in AR-regulated LNCaP cells in the presence of androgens. In this thesis, we further investigated the regulation mechanism of NRIP and the role for AR protein stability. We found that NRIP is a novel AR target gene and NRIP plays a role in the AR signaling and the prostate cancer cell line. The core promoter region of NRIP ranges from -413 to +94 upstream the transcription initiation site. The promoter DNA sequences are composed of hormone response elements (ARE, GRE) and three Sp1 binding sites (Sp1-1, Sp1-2, Sp1-3). NRIP is a TATA-less promoter with GC-rich elements which is regulated by Sp1. Transcription of NRIP is increased in the presence of androgens in LNCaP cells in a dose-dependent manner and induced in the AR-deficient 293T cells as AR expression plasmids are transduced. In chromatin immunoprecipitation (ChIP) assays, AR not only associates on the ARE within the NRIP promoter region but also indirectly on Sp1 binding site through interaction with Sp1. In addition, the activity of NRIP is induced by androgens in the ARE-containing promoter as well as the ARE-losing, Sp1 binding site-containing promoter, but not in the ARE and Sp1 double mutated promoter. This result indicates that androgen-AR activates NRIP promoter not only through ARE but Sp1 binding site. Knockdown of NRIP by siRNAs against NRIP gene (siNRIP) reduces the stability of the AR protein regardless of the presence of androgens. However, knockdown of NRIP has no effect on AR transcription and nuclear translocation. The expression of AR protein was restored in the NRIP-knockdowned LNCaP cells which are treated with proteasome inhibitor MG132, demonstrating that knockdown of NRIP contributes to AR degradation through proteasmoe activity. Knockdown of NRIP decreases the AR protein level and consequently results in cell growth arrest and apoptosis. NRIP forms a complex with AR and Sp1 which are recruited to the promoter of AR target genes of PSA and NRIP. The promoter activity and transcription of NRIP gene are increased with the transiently introduced NRIP expression plasmids in a dose-dependent and AR-dependent manner, suggesting NRIP regulates its own promoter through AR activity. Taken together, NRIP acts as an AR coactivator that stabilizes AR protein and enhances AR transcriptional activity in which NRIP autoregulates its own promoter through androgen-mediated AR transactivation.
APA, Harvard, Vancouver, ISO, and other styles
19

Ko, Kai-Liang, and 柯凱喨. "Analysis of the Tail-fiber Genes, g37 and g38, of Coliphage AR-1." Thesis, 1998. http://ndltd.ncl.edu.tw/handle/03019160865558973771.

Full text
APA, Harvard, Vancouver, ISO, and other styles
20

Jiang, Yuling, and 江郁玲. "The polymorphisms in INSL3, AR genes and their relationship with cryptorchidism in pigs." Thesis, 2012. http://ndltd.ncl.edu.tw/handle/38122212874056310133.

Full text
Abstract:
碩士
國立宜蘭大學
動物科技學系碩士班
100
Three- to four-week-old male piglets are castrated to prevent boar taint in post-puberty that will cause poor quality and low value of the pork. Cryptorchid pigs need to be castrated by abdominal surgery, which is associated with complications and viability loss. Between 1% and 12% of full-term male pigs suffer from cryptorchidism, which can have a serious affect on the pig industry. Cryptorchidism is a sex-limited abnormality. Thus, screening sows that carry the cryptorchid gene, and selectively removing them by culling, is one strategy for lowering the frequency of cryptorchidism in domesticated pig livestock. Insulin-like factor 3 (INSL3) and androgens are major hormones that regulate testis descent during the transabdominal phase and inguinoscrotal phase, respectively. Some studies indicate that INSL3 and androgen receptor (AR) gene CAG-repeat polymorphisms are associated with cryptorchidism in humans. The present study applied single-strand conformation polymorphism (SSCP) and high-resolution melting (HRM) to detect INSL3 and AR gene polymorphisms and their relationship with cryptorchidism in pigs. In Experiment 1, we used the porcine stress syndrome (PSS) gene as a model to establish the SSCP and HRM techniques; the results showed that we could correctly differentiate a single base variation by SSCP and HRM. In Experiment 2, we surveyed the percentage of porcine cryptorchidism and the influence of cryptorchidism on meat markets and pig farmers in Taiwan. The percentage of cryptorchidism was 0.23% in the meat markets and the influence of porcine cryptorchidism was greater than the meat markets for pig farmers. Experiments 3–6, utilized SSCP and HRM to examine the genomic DNA samples of healthy and cryptorchid pigs and screen for polymorphisms of INSL3 and AR gene CAG-repeats. There were no polymorphisms in exons 1 and 2 of INSL3, or in the AR gene CAG-repeat. However, two single-nucleotide polymorphisms (SNPs) were detected in the INSL3 promoter region (G-224A and A-164C). We analyzed the genotype and allele frequencies of 92 healthy and 92 cryptorchid boars. The GG and AG genotype frequencies of the G-224A SNP in healthy and cryptorchid pigs were 84% and 16%, respectively. This accounted for 0.92 and 0.08 gene frequencies for the G and A alleles. The A-164C genotype frequencies of AA, AC, and CC in healthy pigs were 26%, 34%, and 40%, respectively, which accounted for 0.43 and 0.57 gene frequencies for the A and C alleles. The frequencies of AA, AC, and CC were 21%, 45%, 34%, and the A and C allele frequencies were 0.44 and 0.56 in cryptorchid pigs. Furthermore, there were no differences in the frequencies of INSL3 genotypes and alleles between pig breeds. We also sequenced the INSL3 gene introns of 30 cryptorchid pigs and found no base variation. In conclusion, cryptorchid pigs do not exhibit significant variation in either the INSL3 or AR genes. This is in contrast to the case in humans, and suggests that, as yet, undiscovered genetic changes underlie testicular abnormalities in livestock pig breeds.
APA, Harvard, Vancouver, ISO, and other styles
21

Genz, Michael [Verfasser]. "Anwendungen des empirischen Likelihood-Schätzers der Fehlerverteilung in AR(1)-Prozessen / vorgelegt von Michael Genz." 2005. http://d-nb.info/974923125/34.

Full text
APA, Harvard, Vancouver, ISO, and other styles
22

Wolde, Eyerusalem Amare. "A critical analysis of policy implementation of the freedom of the press in Ethiopia under the rule of the Ethiopian People's Revolutionary Democratic Front (EPRDF)." Thesis, 2013. http://hdl.handle.net/10413/10653.

Full text
Abstract:
This study analyses the status of press freedom in Ethiopia under the rule of Ethiopian People’s Revolutionary Democratic Front (EPRDF). The study critically examines the implementation of the legal frameworks regarding freedom of expression and press. In order to understand the status of the press in the current democratic state of Ethiopia, the study employs an implementation analysis of press freedom by drawing from Francis Kasoma’s Theory of Independent Press in Africa. The study’s focus is limited to the Ethiopian private media during the EPRDF-led government. It is contended that due to its repressive nature, the EPRDF rule contributed to the expansion of the private press in Ethiopia. This was evident in the 1995 Constitution Article 29 and the 1992 press proclamation. The study noted that despite the constitutional provisions for press freedom in Ethiopia, as well as all the international statutes to which Ethiopia is signatory, the implementation of legal frameworks for press freedom under the EPRDF government were modest at best. The study argues that the EPRDF created two extreme situations under which the press operated in Ethiopia. These are independent versus dependent media. The independent (private) press has been dubbed oppositional to the government and hence persecuted, while the dependent (public) press has been enjoying relative freedom under the totalitarian auspices of the ruling party and the government. In both extremes the media has been constrained and had their freedom curtailed. The difference has been that the private press is overtly constrained, while the dependent press is apparently enabled, as long as it covers the positive side of the government. As such, the public space for media has been severely constrained in Ethiopia in such a manner that the traditional role of media to serve as a bridge between the society and the state is missing. The EPRDF created a situation in which both extremes fail to meet the ideals of press freedom as exemplified in economically advanced countries.
Thesis (M.Soc.Sc.)-University of KwaZulu-Natal, Pietermaritzburg, 2013.
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography