Log in

Relevant bibliographies by topics / Plasmides Ri / Journal articles

To see the other types of publications on this topic, follow the link: Plasmides Ri.

Journal articles on the topic 'Plasmides Ri'

Author: Grafiati

Published: 4 June 2021

Last updated: 2 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Plasmides Ri.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Vilaine, Françoise, and Francine Casse-Delbart. "A new vector derived from Agrobacterium rhizogenes plasmids: a micro-Ri plasmid and its use to construct a mini-Ri plasmid." Gene 55, no. 1 (1987): 105–14. http://dx.doi.org/10.1016/0378-1119(87)90253-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Christensen, Bjarke B., Claus Sternberg, Jens Bo Andersen, et al. "Establishment of New Genetic Traits in a Microbial Biofilm Community." Applied and Environmental Microbiology 64, no. 6 (1998): 2247–55. http://dx.doi.org/10.1128/aem.64.6.2247-2255.1998.

Full text

Abstract:

ABSTRACT Conjugational transfer of the TOL plasmid (pWWO) was analyzed in a flow chamber biofilm community engaged in benzyl alcohol degradation. The community consisted of three species, Pseudomonas putida RI, Acinetobacter sp. strain C6, and an unidentified isolate, D8. Only P. putida RI could act as a recipient for the TOL plasmid. Cells carrying a chromosomally integrated lacI q gene and alacp-gfp-tagged version of the TOL plasmid were introduced as donor strains in the biofilm community after its formation. The occurrence of plasmid-carrying cells was analyzed by viable-count-based enumeration of donors and transconjugants. Upon transfer of the plasmids to the recipient cells, expression of green fluorescence was activated as a result of zygotic induction of the gfp gene. This allowed a direct in situ identification of cells receiving thegfp-tagged version of the TOL plasmid. Our data suggest that the frequency of horizontal plasmid transfer was low, and growth (vertical transfer) of the recipient strain was the major cause of plasmid establishment in the biofilm community. Employment of scanning confocal laser microscopy on fixed biofilms, combined with simultaneous identification of P. putida cells and transconjugants by 16S rRNA hybridization and expression of green fluorescence, showed that transconjugants were always associated with noninfected P. putida RI recipient microcolonies. Pure colonies of transconjugants were never observed, indicating that proliferation of transconjugant cells preferentially took place on preexisting P. putida RI microcolonies in the biofilm.

APA, Harvard, Vancouver, ISO, and other styles

3

Weisberg, Alexandra J., Edward W. Davis, Javier Tabima, et al. "Unexpected conservation and global transmission of agrobacterial virulence plasmids." Science 368, no. 6495 (2020): eaba5256. http://dx.doi.org/10.1126/science.aba5256.

Full text

Abstract:

The accelerated evolution and spread of pathogens are threats to host species. Agrobacteria require an oncogenic Ti or Ri plasmid to transfer genes into plants and cause disease. We developed a strategy to characterize virulence plasmids and applied it to analyze hundreds of strains collected between 1927 and 2017, on six continents and from more than 50 host species. In consideration of prior evidence for prolific recombination, it was surprising that oncogenic plasmids are descended from a few conserved lineages. Characterization of a hierarchy of features that promote or constrain plasticity allowed inference of the evolutionary history across the plasmid lineages. We uncovered epidemiological patterns that highlight the importance of plasmid transmission in pathogen diversification as well as in long-term persistence and the global spread of disease.

APA, Harvard, Vancouver, ISO, and other styles

4

Koch, Hans-Georg, and Jobst-Heinrich Klemme. "Improved Preparation Procedure for the Endogenous 115 kb Plasmid of Rhodobacter capsulatus AD 2 and Analysis of Restriction Pattern." Zeitschrift für Naturforschung C 49, no. 11-12 (1994): 888–90. http://dx.doi.org/10.1515/znc-1994-11-1227.

Full text

Abstract:

None of six published preparation procedures for circular bacterial plasmids was satisfactory to purify the endogenous plasmid of a nitrate-reducing strain (AD2) of the phototrophic bacterium Rhodobacter capsulatus. By modifying the method of N. T. Hu and B. L. Marrs (1979), Arch. Microbiol. 121, 61-69 , the 115 kb plasmid of the latter strain was prepared to a highly pure state. Digestion of the plasmid with restriction endonuclease Eco RI yielded 21 fragments with sizes ranging from 0.3 to 18.4 kb. Except for the three largest ones (18.4 kb, 16.9 kb and 11.2 kb), all fragments were cloned into the vector plasmid pU C 8, amplified in E. coli JM83 and characterized by H ind III restriction analysis.

APA, Harvard, Vancouver, ISO, and other styles

5

UCHIMIYA, HIROFUMI. "Dwarfism genes in Ri plasmid." Kagaku To Seibutsu 26, no. 9 (1988): 594–98. http://dx.doi.org/10.1271/kagakutoseibutsu1962.26.594.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Platt, D. J., J. S. Chesham, D. J. Brown, C. A. Kraft, and J. Taggart. "Restriction enzyme fingerprinting of enterobacterial plasmids: a simple strategy with wide application." Journal of Hygiene 97, no. 2 (1986): 205–10. http://dx.doi.org/10.1017/s0022172400065281.

Full text

Abstract:

SummaryRestriction enzyme fingerprints were generated from purified plasmid DNA from 324 clinical isolates that belonged to 7 enterobacterial genera and 88 single plasmids in Escherichia coli K12 according to the following strategy.Purified plasmid DNA was digested with PstI. The number of fragments detected in a 0·8 agarose gel was used to determine which 2 of 6 restriction enzymes including Pstl was most likely to provide a fingerprint comprising sufficient fragments to ensure specificity but sufficiently few to allow easy visual assessment and minimize coincidental matching. When PstI produced > 20 fragments, Eco RI and HindIII were used; when PstI generated < 6 fragments Bsp 1286 and AvaII were used and SmaI was employed when between 6 and 20 fragments were obtained from PstI digests. Using a minimum of 12 fragments from a combination of 2 enzymes as the criterion for characterizing a strain/plasmid, satisfactory 2-enzyme fingerprints were obtained from 87% of the strains and plasmids studied using PstI and no more than two additional enzymes per strain. Of the remaining 54 strains, 51 harboured only small plasmids (< 10 kb) and 3 produced satisfactory fingerprints when digested with a fourth enzyme.

APA, Harvard, Vancouver, ISO, and other styles

7

Long, C. M., C. M. Brajkovich, and J. F. Scott. "Alternative model for chromatin organization of the Saccharomyces cerevisiae chromosomal DNA plasmid TRP1 RI circle (YARp1)." Molecular and Cellular Biology 5, no. 11 (1985): 3124–30. http://dx.doi.org/10.1128/mcb.5.11.3124.

Full text

Abstract:

TRP1 RI circle (now designated YARp1, yeast acentric ring plasmid 1) is a 1,453-base-pair artificial plasmid composed exclusively of Saccharomyces cerevisiae chromosomal DNA. It contains both the TRP1 gene and ARS1 (a DNA sequence that permits extrachromosomal maintenance of recombinant plasmids). This high-copy-number, relatively stable plasmid was shown to be organized into nucleosomes comparable to typical yeast chromatin, containing a possible maximum of nine nucleosomes per circle. Therefore, YARp1 can be used to examine the structure of chromatin of both a chromosomally derived replicator and a functional gene. By mapping regions of micrococcal nuclease cleavage in chromatin versus purified DNA, we located the positions of protected regions on the circle with reference to six unique restriction sites. Measurements made on patterns of early digestion products indicated that a region of approximately 300 base pairs in the vicinity of ARS1 was strongly resistant to micrococcal nuclease. The remainder of the plasmid appeared to be associated with five positioned nucleosomes and two nonnucleosomal, partially protected regions on the bulk of the molecules. After similar extents of digestion, naked DNA did not exhibit an equivalent pattern, although some hypersensitive cleavage sites matched sites found in the chromatin. These results are consistent with the interpretation that the protected domains are aligned with respect to a specific site or sites on the small circular chromatin.

APA, Harvard, Vancouver, ISO, and other styles

8

Long, C. M., C. M. Brajkovich, and J. F. Scott. "Alternative model for chromatin organization of the Saccharomyces cerevisiae chromosomal DNA plasmid TRP1 RI circle (YARp1)." Molecular and Cellular Biology 5, no. 11 (1985): 3124–30. http://dx.doi.org/10.1128/mcb.5.11.3124-3130.1985.

Full text

Abstract:

TRP1 RI circle (now designated YARp1, yeast acentric ring plasmid 1) is a 1,453-base-pair artificial plasmid composed exclusively of Saccharomyces cerevisiae chromosomal DNA. It contains both the TRP1 gene and ARS1 (a DNA sequence that permits extrachromosomal maintenance of recombinant plasmids). This high-copy-number, relatively stable plasmid was shown to be organized into nucleosomes comparable to typical yeast chromatin, containing a possible maximum of nine nucleosomes per circle. Therefore, YARp1 can be used to examine the structure of chromatin of both a chromosomally derived replicator and a functional gene. By mapping regions of micrococcal nuclease cleavage in chromatin versus purified DNA, we located the positions of protected regions on the circle with reference to six unique restriction sites. Measurements made on patterns of early digestion products indicated that a region of approximately 300 base pairs in the vicinity of ARS1 was strongly resistant to micrococcal nuclease. The remainder of the plasmid appeared to be associated with five positioned nucleosomes and two nonnucleosomal, partially protected regions on the bulk of the molecules. After similar extents of digestion, naked DNA did not exhibit an equivalent pattern, although some hypersensitive cleavage sites matched sites found in the chromatin. These results are consistent with the interpretation that the protected domains are aligned with respect to a specific site or sites on the small circular chromatin.

APA, Harvard, Vancouver, ISO, and other styles

9

Ondřej, M., M. Hrouda, and P. Kostřica. "Potato transformation byAgrobacterium rhizogenes Ri plasmid." Biologia Plantarum 31, no. 4 (1989): 312–14. http://dx.doi.org/10.1007/bf02907293.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Sinkar, Vilas P., Frank F. White, and Milton P. Gordon. "Molecular biology of Ri-plasmid—A review." Journal of Biosciences 11, no. 1-4 (1987): 47–57. http://dx.doi.org/10.1007/bf02704657.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Ko, Kyung Soo, Hiroshi Noguchi, Yutaka Ebizuka, and Ushio Sankawa. "Oligoside production by hairy root cultures transformed by Ri plasmids." CHEMICAL & PHARMACEUTICAL BULLETIN 37, no. 1 (1989): 245–48. http://dx.doi.org/10.1248/cpb.37.245.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Morgan, A. J., P. N. Cox, D. A. Turner, et al. "Transformation of tomato using an Ri plasmid vector." Plant Science 49, no. 1 (1987): 37–49. http://dx.doi.org/10.1016/0168-9452(87)90018-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Kiyokawa, Kazuya, Shinji Yamamoto, Yukari Sato, et al. "Yeast transformation mediated by Agrobacterium strains harboring an Ri plasmid: comparative study between GALLS of an Ri plasmid and virE of a Ti plasmid." Genes to Cells 17, no. 7 (2012): 597–610. http://dx.doi.org/10.1111/j.1365-2443.2012.01612.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

O'Connell, Michael P., Michael F. Hynes, and Alfred Puehler. "Incompatibility between a Rhizobium Sym plasmid and a Ri plasmid of Agrobacterium." Plasmid 18, no. 2 (1987): 156–63. http://dx.doi.org/10.1016/0147-619x(87)90043-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Petersen, Steen G., Bjarne M. Stummann, Peter Olesen, and Knud W. Henningsen. "Structure and function of root-inducing (Ri) plasmids and their relation to tumor-inducing (Ti) plasmids." Physiologia Plantarum 77, no. 3 (1989): 427–35. http://dx.doi.org/10.1111/j.1399-3054.1989.tb05664.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Sawada, H., H. Ieki, and I. Matsuda. "PCR detection of Ti and Ri plasmids from phytopathogenic Agrobacterium strains." Applied and environmental microbiology 61, no. 2 (1995): 828–31. http://dx.doi.org/10.1128/aem.61.2.828-831.1995.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Kiyokawa, S., K. Kobayashi, Y. Kikuchi, H. Kamada, and H. Harada. "Root-Inducing Region of Mikimopine Type Ri Plasmid pRi1724." Plant Physiology 104, no. 2 (1994): 801–2. http://dx.doi.org/10.1104/pp.104.2.801.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

ISOHARA, TOSHIO. "Congenic method to plant cell.1.Agrobacterium infection system.Using Ti plasmid, Ri plasmid." Kagaku To Seibutsu 29, no. 10 (1991): 659–65. http://dx.doi.org/10.1271/kagakutoseibutsu1962.29.659.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Pate, M., M. Ocepek, I. Zdovc, et al. "Intermediately virulent Rhodococcus equi isolates from pigs in Slovenia: discovery of new plasmid types and assessment of genetic diversity by pulsed-field gel electrophoresis." Veterinární Medicína 54, No. 3 (2009): 111–17. http://dx.doi.org/10.17221/3050-vetmed.

Full text

Abstract:

The presence of large plasmids in 30 <I>Rhodococcus equi</I> strains isolated from pig lymph nodes with granulomatous changes was investigated. Plasmid DNAs were isolated and digested with the restriction endonucleases <I>Bam</I>HI, <I>Eco</I>RI, <I>Eco</I>T22I and <I>Hind</I>III for detailed comparison and estimation of plasmid sizes. A total of nine isolates were identified as intermediately virulent (VapB-positive), harbouring large plasmids of type 5 (<I>n</I> = 5) and four new variants that we tentatively designated as type 19 (<I>n</I> = 1), 20 (<I>n</I> = 1), 21 (<I>n</I> = 1) and 24 (<I>n</I> = 1). All isolates were subjected to genotyping with pulsed-field gel electrophoresis (PFGE). High genetic diversity was observed: 21 distinct genotypes were detected; five were found in multiple isolates and the others were unique. Isolates of the same plasmid type exhibited different PFGE profiles and vice versa. In a few cases, multiple strains from certain farms were analysed, the majority of which exhibited diverse PFGE profiles. Our findings demonstrate the presence of a wide variety of <I>R. equi</I> strains even in small confined environments such as farms. This is the first molecular epidemiology study of intermediately virulent <I>R. equi</I> isolates from Slovenian pigs.

APA, Harvard, Vancouver, ISO, and other styles

20

DESSAUX, Y., P. GUYON, S. K. FARRAND, A. PETIT, and J. TEMPE. "Agrobacterium Ti and Ri Plasmids Specify Enzymic Lactonization of Mannopine to Agropine." Microbiology 132, no. 9 (1986): 2549–59. http://dx.doi.org/10.1099/00221287-132-9-2549.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

UI, Sadaharu, Akio IKEDA, Akio MIMURA, Tuyoshi MOCHIZUKI, and Hiroshi KAMADA. "An Effective Culture of Ri Plasmid-induced Grape Hairy Roots." Plant Biotechnology 14, no. 1 (1997): 77–79. http://dx.doi.org/10.5511/plantbiotechnology.14.77.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

OONO, Yutaka, Takashi HANDA, Kiyoshi KANAYA, and Hirofumi UCHIMIYA. "The TL-DNA gene of Ri plasmids responsible for dwarfness of tobacco plants." Japanese journal of genetics 62, no. 6 (1987): 501–5. http://dx.doi.org/10.1266/jjg.62.501.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Yoshida, K., K. Futagami, and Y. Fujikoshi. "Statistical analysis of functional regions in Ti and Ri sequenced plasmids in Agrobacterium." Nucleic Acids Symposium Series 1, no. 1 (2001): 245–46. http://dx.doi.org/10.1093/nass/1.1.245.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Nakamura, Toshiki, Takashi Handa, Yutaka Oono, Kiyoshi Kanaya, Muneo Michikawa, and Hirofumi Uchimiya. "Organ-specific mRNA in transgenic tobacco plants possessing T-DNA of Ri plasmids." Plant Science 56, no. 3 (1988): 213–18. http://dx.doi.org/10.1016/0168-9452(88)90100-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Robaglia, C. "Vecteurs d'expression basés sur le système de transformation du plasmide Ri d'Agrobacterium rhizogenes." Biochimie 69, no. 3 (1987): 231–37. http://dx.doi.org/10.1016/0300-9084(87)90047-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

KIYOKAWA, Shigeto, Yukihisa SHIMADA, Yasuhiro KIKUCHI, Hiroshi KAMADA, and Hiroshi HARADA. "Genetic Transformation of Petunia hybrida by rol Genes of Ri Plasmid." Plant tissue culture letters 9, no. 2 (1992): 90–93. http://dx.doi.org/10.5511/plantbiotechnology1984.9.90.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

DAVEY, M. R., B. J. MULLIGAN, K. M. A. GARTLAND, E. PEEL, A. W. SARGENT, and A. J. MORGAN. "Transformation of Solarium and Nicotiana Species using an Ri Plasmid Vector." Journal of Experimental Botany 38, no. 9 (1987): 1507–16. http://dx.doi.org/10.1093/jxb/38.9.1507.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Ondřej, M., Růzena Bísková, and J. Vlasák. "Binary plant vector based on Ri plasmid and part of T-DNA of the Ti plasmid." Biologia Plantarum 28, no. 4 (1986): 265–69. http://dx.doi.org/10.1007/bf02902290.

Full text

APA, Harvard, Vancouver, ISO, and other styles

29

Li, Pei-Li, and Stephen K. Farrand. "The Replicator of the Nopaline-Type Ti Plasmid pTiC58 Is a Member of the repABC Family and Is Influenced by the TraR-Dependent Quorum-Sensing Regulatory System." Journal of Bacteriology 182, no. 1 (2000): 179–88. http://dx.doi.org/10.1128/jb.182.1.179-188.2000.

Full text

Abstract:

ABSTRACT The replicator (rep) of the nopaline-type Ti plasmid pTiC58 is located adjacent to the trb operon of this conjugal element. Previous genetic studies of this region (D. R. Gallie, M. Hagiya, and C. I. Kado, J. Bacteriol. 161:1034–1041, 1985) identified functions involved in partitioning, origin of replication and incompatibility, and copy number control. In this study, we determined the nucleotide sequence of a 6,146-bp segment that encompasses the rep locus of pTiC58. The region contained four full open reading frames (ORFs) and one partial ORF. The first three ORFs, oriented divergently from the traI-trb operon, are closely related to the repA, repB, andrepC genes of the octopine-type Ti plasmid pTiB6S3 as well as to other repA, -B, and -C genes from the Ri plasmid pRiA4b and three large plasmids fromRhizobium spp. The fourth ORF and the partial ORF are similar to y4CG and y4CF, respectively, of the Sym plasmid pNGR234a. The 363-bp intergenic region betweentraI and repA contained two copies of thetra box which is the cis promoter recognition site for TraR, the quorum-sensing activator of Ti plasmid conjugal transfer. Expression of the traI-trb operon from thetra box II-associated promoter mediated by TraR and its acyl-homoserine lactone ligand, AAI, was negatively influenced by an intact tra box III. On the other hand, the region containing the two tra boxes was required for maximal expression of repA, and this expression was enhanced slightly by TraR and AAI. Copy number of a minimal repplasmid increased five- to sevenfold in strains expressingtraR but only when AAI also was provided. Consistent with this effect, constitutive expression of the quorum-sensing system resulted in an apparent increase in Ti plasmid copy number. We conclude that Ti plasmid copy number is influenced by the quorum-sensing system, suggesting a connection between conjugal transfer and vegetative replication of these virulence elements.

APA, Harvard, Vancouver, ISO, and other styles

30

Owens, Lowell D., and Dean E. Cress. "Genotypic Variability of Soybean Response to Agrobacterium Strains Harboring the Ti or Ri Plasmids." Plant Physiology 77, no. 1 (1985): 87–94. http://dx.doi.org/10.1104/pp.77.1.87.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Ko, Kyung Soo, Yutaka Ebizuka, Hiroshi Noguchi, and Ushio Sankawa. "Production of secondary metabolites by hairy roots and regenerated plants transformed with Ri plasmids." CHEMICAL & PHARMACEUTICAL BULLETIN 36, no. 10 (1988): 4217–20. http://dx.doi.org/10.1248/cpb.36.4217.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Boulanger, Fran�oise, Andre Berkaloff, and Fran�ois Richaud. "Identification of hairy root loci in the T-regions of Agrobacterium rhizogenes Ri plasmids." Plant Molecular Biology 6, no. 4 (1986): 271–79. http://dx.doi.org/10.1007/bf00015233.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Sukhapinda, Kitisri, Rosa Spivey, and Elias A. Shahin. "Ri-plasmid as a helper for introducing vector DNA into alfalfa plants." Plant Molecular Biology 8, no. 3 (1987): 209–16. http://dx.doi.org/10.1007/bf00015029.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Chan, Agnes P., Yongwook Choi, Thomas H. Clarke, et al. "AbGRI4, a novel antibiotic resistance island in multiply antibiotic-resistant Acinetobacter baumannii clinical isolates." Journal of Antimicrobial Chemotherapy 75, no. 10 (2020): 2760–68. http://dx.doi.org/10.1093/jac/dkaa266.

Full text

Abstract:

Abstract Objectives To investigate the genomic context of a novel resistance island (RI) in multiply antibiotic-resistant Acinetobacter baumannii clinical isolates and global isolates. Methods Using a combination of long and short reads generated from the Oxford Nanopore and Illumina platforms, contiguous chromosomes and plasmid sequences were determined. BLAST-based analysis was used to identify the RI insertion target. Results Genomes of four multiply antibiotic-resistant A. baumannii clinical strains, from a US hospital system, belonging to prevalent MLST ST2 (Pasteur scheme) and ST281 (Oxford scheme) clade F isolates were sequenced to completion. A class 1 integron carrying aadB (tobramycin resistance) and aadA2 (streptomycin/spectinomycin resistance) was identified. The class 1 integron was 6.8 kb, bounded by IS26 at both ends, and embedded in a new target location between an α/β-hydrolase and a reductase. Due to its novel insertion site and unique RI composition, we suggest naming this novel RI AbGRI4. Molecular analysis of global A. baumannii isolates identified multiple AbGRI4 RI variants in non-ST2 clonal lineages, including variations in the resistance gene cassettes, integron backbone and insertion breakpoints at the hydrolase gene. Conclusions A novel RI insertion target harbouring a class 1 integron was identified in a subgroup of ST2/ST281 clinical isolates. Variants of the RI suggested evolution and horizontal transfer of the RI across clonal lineages. Long- and short-read hybrid assembly technology completely resolved the genomic context of IS-bounded RIs, which was not possible using short reads alone.

APA, Harvard, Vancouver, ISO, and other styles

35

Zambryski, P., J. Tempe, and J. Schell. "Transfer and function of T-DNA genes from Agrobacterium Ti and Ri plasmids in plants." Cell 56, no. 2 (1989): 193–201. http://dx.doi.org/10.1016/0092-8674(89)90892-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Inoguchi, Masahiko, Mariko Oka, Takahiro Shikada, and Jiro Kato. "Agropine synthase gene of Ri plasmid is different from the homologous gene of Ti plasmid in tissue-specificity." Journal of Plant Physiology 149, no. 1-2 (1996): 73–78. http://dx.doi.org/10.1016/s0176-1617(96)80176-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Nemoto, Keiichirou, Masamitsu Hara, Masashi Suzuki, et al. "Function of theauxandrolgenes of the Ri plasmid in plant cell division in vitro." Plant Signaling & Behavior 4, no. 12 (2009): 1145–47. http://dx.doi.org/10.4161/psb.4.12.9904.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Sinkar, V. P., F. Pythoud, F. F. White, E. W. Nester, and M. P. Gordon. "rolA locus of the Ri plasmid directs developmental abnormalities in transgenic tobacco plants." Genes & Development 2, no. 6 (1988): 688–97. http://dx.doi.org/10.1101/gad.2.6.688.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

MCINNES, E., M. R. DAVEY, B. J. MULLIGAN, K. DAVIES, A. W. SARGENT, and A. J.MORGAN. "Use of a Disarmed Ri Plasmid Vector in Analysis of Transformed Root Induction." Journal of Experimental Botany 40, no. 10 (1989): 1135–44. http://dx.doi.org/10.1093/jxb/40.10.1135.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Wetzler, L. M., E. C. Gotschlich, M. S. Blake, and J. M. Koomey. "The construction and characterization of Neisseria gonorrhoeae lacking protein III in its outer membrane." Journal of Experimental Medicine 169, no. 6 (1989): 2199–209. http://dx.doi.org/10.1084/jem.169.6.2199.

Full text

Abstract:

Protein III (PIII) is a highly conserved, antigenically stable gonococcal outer membrane protein that is closely associated with the major outer membrane protein, protein I (PI). We have previously reported the cloning of the PIII gene. This gene was inserted into the Eco RI site of the runaway plasmid pMOB45. The beta-lactamase (beta la) Bam HI restriction fragment from the gonococcal plasmid pFA3 was inserted at the Xba I site in the PIII gene. The plasmid construct was Hae III methylated and the PIII/beta la insert was excised with Eco RI and used to transform gonococcal strain F62. One beta la+, ampicillin-resistant transformant was isolated and designated 2D. A Western blot of 2D whole cell lysate was probed with affinity-purified polyclonal PIII antisera. No PIII reactivity was detected. Southern blot analysis was performed on F62 and 2D chromosomal DNA that were cut with Eco RI or Cla I. A PIII DNA probe hybridized with fragments 2.2 kb larger in strain 2D than strain F62. This corresponds to the size of the beta la insert. A beta la-specific probe hybridized with the same 2D restriction fragments as above, but did not react with any F62 fragments, confirming that homologous recombination had occurred. There were minimal phenotypic changes between 2D and its parent strain, F62. Chromosomal DNA from 2D was able to transform gonococcal strains F62, UU1, and Pgh 3-2, rendering these PIII-. 2D and other PIII- transformants can now be used to study the role of PIII in gonococcal physiology, metabolism, membrane structure, and pathogenesis. Moreover, we now have organisms from which we can purify gonococcal proteins without PIII contamination.

APA, Harvard, Vancouver, ISO, and other styles

41

Syukur, Sumaryati, Zozy Aneloi N, and Femilya Putri. "TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO." Jurnal Riset Kimia 2, no. 2 (2015): 156. http://dx.doi.org/10.25077/jrk.v2i2.156.

Full text

Abstract:

ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard. Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin

APA, Harvard, Vancouver, ISO, and other styles

42

KIYOKAWA, Shigeto, Yasuhiro KIKUCHI, Hiroshi KAMADA, and Hiroshi HARADA. "Detection of rol Genes of Ri Plasmids by PCR Method and Its Application to Confirmation of Transformation." Plant tissue culture letters 9, no. 2 (1992): 94–98. http://dx.doi.org/10.5511/plantbiotechnology1984.9.94.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Brevet, Jean, and Jacques Tempé. "Homology mapping of T-DNA regions on three Agrobacterium rhizogenes Ri plasmids by electron microscope heteroduplex studies." Plasmid 19, no. 2 (1988): 75–83. http://dx.doi.org/10.1016/0147-619x(88)90046-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

OONO, Yutaka, Kiyoshi KANAYA, and Hirofumi UCHIMIYA. "Early flowering in transgenic tobacco plants possessing the rolC gene of Agrobacterium rhyizogenes Ri plasmid." Japanese Journal of Genetics 65, no. 1 (1990): 7–16. http://dx.doi.org/10.1266/jjg.65.7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Matsuki, Rikyu, Haruko Onodera, Taeko Yamauchi, and Hirofumi Uchimiya. "Tissue-specific expression of the rolC promoter of the Ri plasmid in transgenic rice plants." Molecular and General Genetics MGG 220, no. 1 (1989): 12–16. http://dx.doi.org/10.1007/bf00260849.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Capone, Imerio, Maura Cardarelli, Maurizio Trovato, and Paolo Costantino. "Upstream non-coding region which confers polar expression to Ri plasmid root inducing gene rolB." Molecular and General Genetics MGG 216, no. 2-3 (1989): 239–44. http://dx.doi.org/10.1007/bf00334362.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Plessis, Anne, Christophe Robaglia, Annick Diolez, et al. "lacZ gene fusions and insertion mutagenesis in the TL-region of Agrobacterium rhizogenes Ri plasmid." Plasmid 14, no. 1 (1985): 17–27. http://dx.doi.org/10.1016/0147-619x(85)90028-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Golub, Efim T., and Helene A. Panzer. "The F factor of Escherichia coli carries a locus of stable plasmid inheritance stm, similar to the parB locus of plasmid RI." Molecular and General Genetics MGG 214, no. 2 (1988): 353–57. http://dx.doi.org/10.1007/bf00337735.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Zeng, L. H., Z. G. Chen, L. X. Lu, P. Zhou, and X. Q. Zheng. "IN VITRO TRANSFORMATION MEDIATED BY Ri PLASMID OF AGROBACTERIUM RHIZOGENES AND TRANSGENIC PLANT REGENERATION OF LONGAN." Acta Horticulturae, no. 558 (August 2001): 149–55. http://dx.doi.org/10.17660/actahortic.2001.558.20.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Yokoyama, Ryusuke, Tetsuro Hirose, Nobuharu Fujii, Evalour T. Aspuria, Atsushi Kato, and Hirofumi Uchimiya. "The rolC promoter of Agrobacterium rhizogenes Ri plasmid is activated by sucrose in transgenic tobacco plants." Molecular and General Genetics MGG 244, no. 1 (1994): 15–22. http://dx.doi.org/10.1007/bf00280182.

Full text

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!