To see the other types of publications on this topic, follow the link: Polygamous relationships.
Journal articles on the topic 'Polygamous relationships'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Polygamous relationships.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Aggarwal, Pankaj, and Mengze Shi. "Monogamous versus Polygamous Brand Relationships." Journal of the Association for Consumer Research 3, no. 2 (2018): 188–201. http://dx.doi.org/10.1086/697078.
Full text
2
Sereikaite Motiejune, Gintare. "Polygamy in Islam: A Study on Its Religious Justifications and Empowerment of Women Within Islamic Teachings." QiST: Journal of Quran and Tafseer Studies 4, no. 1 (2025): 59–74. https://doi.org/10.23917/qist.v4i1.6948.
Full textAbstract:
This research article delves into the intricate dynamics of polygamy in Islam, emphasizing its potential as a support system among co-wives. Traditionally viewed with controversy, especially in Western societies, this study challenges such perceptions by highlighting how polygamous arrangements can foster mutual support, shared responsibilities, and companionship. By examining these relationships through religious, cultural, and social lenses, the study reveals how polygamy can empower women within the framework of Islamic teachings, transforming traditional familial roles and enhancing their agency. Women's choices to enter polygamous marriages often reflect a complex interplay of factors, combining strategic decision-making for financial or social stability with deeply rooted religious motivations and commitments. The research utilizes diverse narratives from a global Facebook group, allowing for a comprehensive exploration of polygamy's dynamics and benefits. This perspective underscores polygamy's role as a supportive alliance among women, contributing significantly to broader discussions on gender dynamics and marital structures within both Islamic and global contexts.
3
Stepulak, Marian Zdzisław. "Związki poligamiczne, poliandryczne i poliamoryczne a koncepcja chrześcijańskiego małżeństwa." Teologiczne Studia Siedleckie 21, no. 2024 (2024): 259–75. https://doi.org/10.5281/zenodo.14905741.
Full textAbstract:
<em><strong>Polygamous, polyandrous and polyamorous relationships and the concept of Christian marriage</strong></em> The main task of the article was to conduct a comparative analysis of polygamous, polyandrous and polyamorous relationships with the concept of Christian marriage. Polygamy, or polygamy, raises a lot of controversy. In polygamy, the most important are the physical aspects, but people who decide to create such relationships are also motivated by tradition, religious rituals and coercion from families. We can also talk about polyandrous relationships as a form of polygamy. These relationships arise when a woman has several husbands at the same time. Polyandry mainly concerns marginalized social groups. Another type of relationship is polyamorous relationships. They are based on romantic love and emotional closeness. Although sexual contacts are possible. Polyamory is supposed to free a person from the pressure of imposed norms and rules subordinated to monogamy, thereby ensuring freedom of choice and a sense of well-being. In this context, it should be emphasized that a Christian marriage has the following features: love, sacrifice, fidelity, mutual respect, forgiveness and prayer.
4
Motiejūnė, Gintarė Sereikaitė. "PSYCHOLOGICAL DYNAMICS AND COPING MECHANISMS OF WOMEN INVOLVED IN ISLAMIC POLYGAMOUS MARRIAGES." LIFE: International Journal of Health and Life-Sciences 9 (June 15, 2024): 34–50. http://dx.doi.org/10.20319/lijhls.2024.9.3450.
Full textAbstract:
This study explores the coping mechanisms and religious beliefs employed by women in polygamous relationships to manage emotional distress, and the extent to which this approach challenges or reinforces patriarchal structures within these relationships. Data collected a closed Facebook group for Muslim women only reveal that women in polygamous relationships often experience psychological and emotional distress. To cope, they commonly resort to religious faith, acceptance of fate, and compromise with co-wives. While these strategies help manage emotional distress, they can potentially reinforce patriarchal structures within these relationships. The research provides a nuanced perspective, arguing that these coping mechanisms can be seen both as a form of resistance against and an acceptance of patriarchal norms. The study also underscores the need for further research into factors such as stress levels, coping skills, and marital factors that can impact behavioral, emotional, and cognitive outcomes in polygamous marriages. To conclude, in polygamous relationships, women often use avoidance and religious justification as coping mechanisms. While these strategies provide temporary relief or spiritual comfort, they don't address the long-term psychological harm or inherent gender inequalities.
5
Razak, Muhammad Ajib Abd, Intan Hashimah Mohd Hashim, Syazwani Drani, and Nor Azzatunnisak Mohd Khatib. "EXPLORATION OF THE ADJUSTMENT PROCESS OF SECOND WIVES IN POLYGAMY RELATIONSHIPS." Journal of Southwest Jiaotong University 57, no. 6 (2022): 233–41. http://dx.doi.org/10.35741/issn.0258-2724.57.6.22.
Full textAbstract:
This study aimed to identify how Malaysian polygamous second wives adapt to a polygamous life. A total of seven women who were second wives were interviewed. In-depth, face-to-face interviews were conducted, which were then transcribed and analyzed using thematic analysis. The following four themes emerged: controlling self-conflict, learning a new environment, having a goal focus, and practicing discussion and mutual agreement. The study results highlight strategies for second wives to increase their cognitive and emotional resilience and better adapt them to the challenges of a polygamous life. The study findings provide a more comprehensive and in-depth understanding of the form of adaptation and the process of polygamous families in Malaysia, especially among second wives. This study also contributes to developing recommendations for ways and skills in family counseling dealing with polygamy. The implication of this study is to contribute knowledge, especially to the construction of psychometric test tools and new variables in conducting a survey-type study on a larger scale of respondents, which consisted of second wives.
6
Rezki, Muhammad, Sandy Aditya Pradana, and Latipun. "Journeying the Shoreline of Emotions: Unveiling the Lives of Wives in Challenging Polygamous Relationships." Social Science and Humanities Journal 8, no. 08 (2024): 4578–85. http://dx.doi.org/10.18535/sshj.v8i08.1266.
Full textAbstract:
The purpose of this study is to discuss the experiences of second wives in polygamous marriages and the psychological impact they endure while living in a polygamous relationship. The research method used is descriptive phenomenology, utilizing data analysis techniques. Participants were recruited from South Kalimantan and East Java through an online form using Google Forms. A total of four second wives participated in this study, with an age range of 23-45 years. Participants were selected using a snowball sampling method. Data were analyzed by repeatedly reading the transcripts and identifying key themes. The results of the study show that life in a polygamous marriage is full of challenges. The second wives feel that living in a polygamous marriage is a fate determined by God, and although they accept the marriage, they face issues such as feelings of dissatisfaction, vulnerability, jealousy, nagging tendencies, and irritating habits. The psychological impacts experienced by the subjects include frustration, annoyance, heartbreak, mental pressure, feelings of inferiority, anxiety, and restlessness. Communication in polygamous marriages plays a crucial role, where openness and good communication between partners can support a positive relationship, while the inability to be open and communicate can become a barrier.
7
Al-Krenawi, Alean, and Vered Slonim-Nevo. "The Psychosocial Profile of Bedouin Arab Women Living in Polygamous and Monogamous Marriages." Families in Society: The Journal of Contemporary Social Services 89, no. 1 (2008): 139–49. http://dx.doi.org/10.1606/1044-3894.3718.
Full textAbstract:
This study examining the psychosocial profile of Bedouin Arab Women living in polygamous and monogamous marriages found that women in polygamous marriages reported lower levels of self-esteem and higher levels of somatization, depression, anxiety, hostility, paranoid ideation, more problematic family functioning, less marital satisfaction, and more problematic mother–child relationships than women in monogamous marriages. The sample consisted of 315 women, 156 from polygamous and 159 from monogamous families. The respondents completed the Self-Esteem scale (SE), The Brief Symptom Inventory (BSI), The McMaster Family Assessment Device (FAD), The Enrich questionnaire and the Index of Parental Attitudes. The polygamous family structure and the economic difficulties widespread, apparently constitutes a substantial contribution to the polygamous household's impaired family functioning.
8
Al-Krenawi, Alean, and John R. Graham. "A Comparison of Family Functioning, Life and Marital Satisfaction, and Mental Health of Women in Polygamous and Monogamous Marriages." International Journal of Social Psychiatry 52, no. 1 (2006): 5–17. http://dx.doi.org/10.1177/00207640060061245.
Full textAbstract:
Background: A considerable body of research concludes that the polygamous family structure has an impact on children's and wives’ psychological, social and family functioning. Aims: The present study is among the first to consider within the same ethnoracial community such essential factors as family functioning, life satisfaction, marital satisfaction and mental health functioning among women who are in polygamous marriages and women who are in monogamous marriages. Method: A sample of 352 Bedouin-Arab women participated in this study: 235 (67%) were in a monogamous marriage and 117 (33%) were in a polygamous marriage. Results: Findings reveal differences between women in polygamous and monogamous marriages. Women in polygamous marriages showed significantly higher psychological distress, and higher levels of somatisation, phobia and other psychological problems. They also had significantly more problems in family functioning, marital relationships and life satisfaction. Conclusion: The article calls on public policy and social service personnel to increase public awareness of the significance of polygamous family structures for women's wellbeing.
9
Cieślewska, Anna. "Second Wife, Second Life: Polygyny among Migrants from Central Asia in Moscow." Oriente Moderno 100, no. 2 (2021): 225–47. http://dx.doi.org/10.1163/22138617-12340250.
Full textAbstract:
Abstract This article focuses on transnational polygamous marriages of migrants in Russia and how transnational polygynous practices influence people’s understanding of marriage, love and family. The paper shows how polygamous migrant marriages are negotiated between families, by presenting the perspective of individuals involved in such relationships in Russia. It argues that transborder relationships contribute to the transformation of social interactions. People function in two or sometimes more countries, creating opportunities for parallel partnering or other options that influence family networks in the migrants’ countries of origin.
10
Al-Krenawi, Alean, and Yaniv Kanat-Maymon. "Psychological symptomatology, self-esteem and life satisfactions of women from polygamous and monogamous marriages in Syria." International Social Work 60, no. 1 (2016): 196–207. http://dx.doi.org/10.1177/0020872814562478.
Full textAbstract:
This study is the first to examine and compare the psychological symptomatology, self-esteem and life satisfaction of women in polygamous and monogamous relationships in Syria. A convenience sample of 276 women was studied, of whom 163 were senior wives in polygamous marriages and 113 were wives in monogamous marriages. Findings revealed that senior wives in polygamous marriages experienced lower self-esteem, less life satisfaction and more mental health symptomatology than women in monogamous marriages. Many of the mental health symptoms were different; noteworthy were elevated somatization, depression, hostility and psychoticism. Implications for mental health practice, policy and further research are discussed.
11
CHUKWUEMEKA, ANONABA KINGSLEY. "Biblical Analysis of Marriage: Alternative Interpretations and Historical Bias on Polygamy." International Journal of Research 12, no. 5 (2025): 376–89. https://doi.org/10.5281/zenodo.15517626.
Full textAbstract:
Polygamy is the practice of having multiple spouses, and it has been a subject of debate and controversy in various religious and cultural contexts. This work examines the biblical narratives of polygamous figures, such as Abraham, Jacob, King David, and King Solomon, and aims to uncover the underlying motivations and implications of these accounts. The study begins by discussing the historical and cultural contexts in which polygamy was prevalent, shedding light on its social significance and the reasons behind its acceptance, then, delves into the biblical portrayal of polygamous relationships, examining the reasons for polygamy as presented in the texts, the consequences faced by the polygamous figures, and the religious teachings on the subject. Furthermore, the study investigates the potential influence of Christian bias on the interpretation and understanding of these biblical narratives, as Christian theologians and scholars often interpret these polygamous accounts in a way that aligns with their belief system, emphasizing the importance of monogamy and downplaying the significance of polygamy.
12
Nancy, Aggarwal, and Guj Ritika. "Second Wife: Missus But A Miss." Legal Vidya 2, no. 2 (2021): 37–50. https://doi.org/10.5281/zenodo.6966668.
Full textAbstract:
How does it feel to be someone's second? The practice of polygamy has come a long way, even during the ancient times polygamy did exist in the society because of the benefits associated with the polygamous relationships but at that time, women were more respected. After the introduction of the Hindu Marriage Act 1955, the practice of polygamy was abolished and monogamy became the rule but still, some people ignore the law and get into a polygamous relationship. At times, it happens that a man misguides or misrepresents his marital status or the competency of his partner to the other woman, to form a new polygamous relationship without her knowing it. Even though the law has given some rights to the second wife to claim maintenance thinking about the injustice that has happened to her, she is still treated as the vicious one in society even without having any fault of her own. Moreover, even though there are laws to protect a woman’s right but still proving that their marriage happened with all the prevailing customs becomes difficult. The humiliation is not just faced by the woman but also the children that are born out of that polygamous relationship. The paper will be an attempt to give a clear view about, the maintenance rights provided by law to the second wife, the problems a second wife faces in society, and how the children of the second wife although being a part of the family are never entitled to the ancestral property and the impact it has on the life of that woman.
13
Muhammad Noval Abdul Rozak, Sri Kusumo Habsari, and Eva Farhah. "Mononormativity Sentiment Towards Polygamous Ustadz on Social Media." DINIKA : Academic Journal of Islamic Studies 9, no. 2 (2024): 195–214. https://doi.org/10.22515/dinika.v9i2.9927.
Full textAbstract:
Mononormativity widely embraced by societies, often leads to negative sentiment toward non-monogamous relationships. Polygamy, as a form of non-monogamy, challenges this norm, particularly when practiced consensually, revealing a divergence from assumptions that label such relationships as destructive. In Indonesia, where Islam predominates, polygamy is conditionally legitimate under religious law and mutual agreement. However, it frequently faces public criticism and rejection, especially on social media. Religious figures like Ustadz Hanan Attaki, who practice polygamy, often become targets of this negative sentiment, revealing the tension between cultural norms, religious legitimacy, and societal perceptions. This study aims to analyze how mononormativity functions as a form of knowledge-power in constructing negative sentiments towards polygamists, especially ustadz, on social media. Utilizing primary data from social media comments and secondary data from online media and supporting articles, the research employs an explanatory sequential mixed method, where quantitative data supports qualitative insights. Combining sentiment analysis using NVivo and Foucaldian discourse analysis, the paper uncovers how societal norms and power structures shape and reinforce negative sentiments towards polygamists. The quantitative data provides a broad understanding of public opinion, while the qualitative analysis delves deeper into the discourses that perpetuate mononormativity. Through this integration, the study highlights the significant influence of mononormative discourse in shaping societal attitudes and maintaining power dynamics that marginalize non-monogamous relationships.
14
Ridwan, Muhammad Saleh, Wahidah Abdullah, and Idham Idham. "Public Perception of Polygamy in Makassar, Indonesia: Cultural Perspective and Islamic Law." Samarah: Jurnal Hukum Keluarga dan Hukum Islam 8, no. 1 (2024): 20. http://dx.doi.org/10.22373/sjhk.v8i1.15419.
Full textAbstract:
One of the issues in Islamic law that is often debated is the case of polygamy that occurs in society in Indonesia. The perception of people in Makassar City, South Sulawesi about polygamy is still very taboo. This assumption arises because of their erroneous understanding of polygamy. This article aimed to discuss the underlying factors of polygamous marriages in Makassar. The research used empirical methods with survey techniques, analyzed with Islamic law theory. The current research was designed as a survey which involved 80 participants, who consisted of 30 polygamous actors and 50 people from monogamous relationships. Instruments used in this study were a close-ended questionnaire and an open interview guideline with polygamists. The results showed that among the Makassarian community members who agreed with the practice of polygamy, there was a group of people who considered polygamy as a disgrace to the family or an act of demeaning women. It was reported that many polygamous actors conducted polygamy without any consent from their first wives. The survey also uncovered several factors that provoked polygamy practices in Makassar. These factors include female infertility, men’s sexual needs, the Prophet’s Sunnah, incurable diseases, and ignorance. Moreover, the majority of polygamous actors in Makassar chose not to register their second marriage at the Civil Registry office due to the state's convoluted bureaucracy and the law that prohibits government employees from being polygamous.
15
Kyomugisha, Elizabeth. "Voices of Plurality: Linguistic Diversity and Social Interactions in Ugandan Polygamous Marriages." F1000Research 14 (April 22, 2025): 453. https://doi.org/10.12688/f1000research.163648.1.
Full textAbstract:
Background Polygamy remains a significant marital institution in Uganda, where multilingualism intersects with family structure, gender roles, and social status. While legal and health implications of polygamous unions have been studied, little attention has been paid to the role of language in shaping intra-household dynamics. This study investigates how linguistic diversity within Ugandan polygamous marriages reflects and constructs social hierarchies, emotional relationships, and marital strategies. Methods This qualitative research analyzes 200 anonymized micro-narratives collected between 2023 and 2024 via the SIDINL Newsletters platform, spanning 20 Ugandan languages. Narrative analysis, sociolinguistic analysis, and discourse analysis were employed to examine language use in polygamous households. Stories were gathered from husbands, co-wives, children, and in-laws, transcribed, translated, and coded for themes such as hierarchy, emotional tone, and language switching. Results Linguistic choices, such as honorifics, metaphors, and strategic code-switching, consistently signaled status, emotional positioning, and power dynamics within polygamous families. Multilingualism was used not only to navigate household conflict and intimacy but also as a tool for forming polygamous unions, particularly in urban, border, or migratory contexts. Regional storytelling patterns revealed culturally specific framings of polygamy: moral and spiritual in the West, inheritance-based in the North, pragmatic in the East, and justice-oriented in the West Nile. Selective multilingualism emerged as a strategy where language fluency influenced marriage decisions and access to social capital. Conclusions Language functions as both a social instrument and a strategic resource in Ugandan polygamous marriages. It actively shapes family hierarchies, emotional dynamics, and mobility. Recognizing the role of language in household organization is essential for understanding marital structures in multilingual societies. These findings highlight the need for culturally grounded, linguistically sensitive approaches in both research and policy design.
16
May, R. M., and M. E. J. Woolhouse. "Biased sex ratios and parasite mating probabilities." Parasitology 107, no. 3 (1993): 287–95. http://dx.doi.org/10.1017/s0031182000079269.
Full textAbstract:
SummaryAn earlier paper (May, 1977) developed a theoretical framework for exploring the consequences of dioecy for the population dynamics of schistosomes, assuming an unbiased sex ratio. This paper extends the analysis to biased sex ratios, as have been reported in practice. We consider the relationships of the mean number and distribution of worms among hosts, the sex ratio, and the mating system (monogamous or polygamous) to: (i) the female mating probability, Φ the prevalence of mated female worms. Ω: and (iii) the mean number of mated female worms per host, ξ. Among other results, we show how high values of Φ are associated with male-biased sex ratios and polygamous mating; that Ω is independent of the mating system and is relatively unaffected by the sex ratio; and that ξ is maximal for unbiased sex ratios given monogamous mating, and for female-biased sex ratios if mating is polygamous. These results, together with the confounding effects of the mean number and distribution of worms, are described in detail in the main body of the paper.
17
Beaman, Lori G. "Response: Who Decides? Harm, Polygamy and Limits on Freedom." Nova Religio 10, no. 1 (2006): 43–51. http://dx.doi.org/10.1525/nr.2006.10.1.43.
Full textAbstract:
ABSTRACT: This essay considers the issue of polygamy in response to Stephen Kent's arguments in an article in this issue. Ultimately, disagreements about religious freedom often emanate not from completely divergent positions, but from differences about the interpretation of boundaries and where they should be drawn. Kent and I agree on several points: 1) no woman or girl should be forced to marry and/or have sexual relations against her will; 2) men who abuse women or children in the name of religion should not be protected under the guise of religious freedom; 3) women who report being abused in polygamous (or any) relationships should be taken seriously. Finally, and related to point two, a theological basis for the abusive behavior is not an automatic protection from sanction. Despite these agreements, there are significant points of departure between Kent and myself, including the characterization of polygamy as inherently abusive, the use of media reports as generalizable data, and the conceptualization of agency of women who choose to live in polygamous relationships.
18
Iswandi, Andi. "Poligami di Indonesia: Analisis Praktik Hukum Keluarga Islam." Qonuni: Jurnal Hukum dan Pengkajian Islam 3, no. 2 (2023): 110–20. http://dx.doi.org/10.59833/qonuni.v3i2.1662.
Full textAbstract:
This study aims to analyze the Islamic family law practices related to polygamy in the social, cultural, and legal context of Indonesia. The research method used is literature analysis and case studies to understand the implementation of polygamous practices and their impact on individuals, families, and society. The results show that polygamy in Islamic family law has complex implications. Although allowed in Islam, polygamy often causes controversy and conflict in contemporary society. The negative impacts of polygamous practices include injustice towards women and children, tension in family relationships, and complexity in inheritance arrangements and parental responsibilities. However, some views see polygamy as a solution to specific social problems, such as gender balance and protection for women without partners, as indicated by BPS data showing fewer men compared to women aged 60 and above, suggesting that men who wish to practice polygamy should marry older women. The analysis of Islamic family law practices related to polygamy emphasizes the need for a balance between understanding religious teachings, universal humanitarian values, and local socio-cultural contexts. This research underscores the importance of regulating polygamous practices within a fair legal framework that protects the rights of all parties involved to minimize negative impacts and maximize the social benefits of such practices.
19
Iswandi, Andi. "Poligami di Indonesia: Analisis Praktik Hukum Keluarga Islam." Qonuni: Jurnal Hukum dan Pengkajian Islam 3, no. 02 (2025): 1–11. https://doi.org/10.59833/qedf3975.
Full textAbstract:
This study aims to analyze the Islamic family law practices related to polygamy in the social, cultural, and legal context of Indonesia. The research method used is literature analysis and case studies to understand the implementation of polygamous practices and their impact on individuals, families, and society. The results show that polygamy in Islamic family law has complex implications. Although allowed in Islam, polygamy often causes controversy and conflict in contemporary society. The negative impacts of polygamous practices include injustice towards women and children, tension in family relationships, and complexity in inheritance arrangements and parental responsibilities. However, some views see polygamy as a solution to specific social problems, such as gender balance and protection for women without partners, as indicated by BPS data showing fewer men compared to women aged 60 and above, suggesting that men who wish to practice polygamy should marry older women. The analysis of Islamic family law practices related to polygamy emphasizes the need for a balance between understanding religious teachings, universal humanitarian values, and local socio-cultural contexts. This research underscores the importance of regulating polygamous practices within a fair legal framework that protects the rights of all parties involved to minimize negative impacts and maximize the social benefits of such practices.
20
Agofure, Joyce Onoromhenre, and Inuwa Mahmud. "Co-Wives in Conflict: Acrimonious Relationships in Bilƙisu Abubakar’s To Live Again." Tasambo Journal of Language, Literature, and Culture 3, no. 02 (2024): 40–49. http://dx.doi.org/10.36349/tjllc.2024.v03i02.005.
Full textAbstract:
This study examines Ɓilƙisu Abubakar’s novel To Live Again and explores the challenges women face in Hausa society, ranging from early/forced marriage, marital quagmire, rampant divorce, denial of educational rights, and girl-child hawking, among a plethora of other predicaments. Importantly, the author also uses her writings and exposes the different forms of maltreatment women suffer at the hands of their fellow women. Employing Chikwenye Okonjo Ogunyemi’s Womanism as the theoretical framework, this paper examines the presentation of acrimonious relationships amongst co-wives in the selected novel, where the author presents three sets of polygamous homes to depict intra-gender strife among women, finding that through manipulation, women like Khadija and Hajara have total control of their husband's house, which they use as a chance to oppress their innocent co-wives. However, the author presents female solidarity models in the novel to illustrate how women are supposed to relate to their fellow women without antagonism, malice, or rivalry, advocating that instead of intra-gender oppression, women should embrace sisterhood, an ideology that promotes solidarity, mutual love, and cooperation among women. By portraying the cruelties women inflict on one another within polygamous households and advocating for sisterhood as a solution, Abubaka’s To Live Again serves as a powerful commentary on the complexities of female relationships in Hausa society, challenging readers to reflect on societal pressures that lead women to harm one another and the need to embrace solidarity to promote a more equitable society.
21
Norkina, Ekaterina. "Polygamy among Mountain Jews of the Caucasus in XIX – the beginning of the XXth centuries." Judaic-Slavic Journal, no. 2 (4) (2020): 102–10. http://dx.doi.org/10.31168/2658-3364.2020.2.09.
Full textAbstract:
The research is devoted to the study of the traditions of polygamy in the mountain-Jewish community of the Caucasus in the XIX - early XX centuries. By the example of one case of polygamy among mountain Jews in Grozny in 1875, the author proposes to consider the existence of traditions from inside: the description and explanation by mountain Jews motivation of its preservation, the problems in polygamous families. The sources for the study are the correspondence and reports of representatives of imperial authority in the Caucasus, reflecting the spread of the tradition of polygamy among mountain Jews, the journals of the Rabbinical Commission of 1879, as well as ethnographic works explaining the origins and motives of maintaining polygamy. The presented case confirms complex intra-family relationships in polygamous families, the maintenance of the tradition of polygamy in several generations of the same family, the existence of marital relations between close relatives.
22
Awiah, Emmanuel Anebakwo, Simon Aabalekuu, Frederick Dun-Dery, et al. "Correlates of Hepatitis B infection in pregnant women attending antenatal clinics in Wa Municipality, Ghana." PLOS Global Public Health 4, no. 9 (2024): e0002447. http://dx.doi.org/10.1371/journal.pgph.0002447.
Full textAbstract:
Despite the availability of an effective vaccine against viral hepatitis B infection, it remains prevalent, highly transmissible especially through mother-to-child, life-threatening, and a major public health challenge. A positive Hepatitis B e-Antigen (HBeAg) mother has a 90% risk of transmitting the virus to the unborn child in the perinatal period. This study sought to determine the prevalence and risk of Hepatitis B infection among pregnant women in the Wa Municipality of Ghana. A cross-sectional study employing systematic random sampling was conducted among 183 consented pregnant women who went for antenatal care in nine health facilities in the Wa Municipality. A structured validated questionnaire was used to collect information about socio-demographic and obstetric characteristics, awareness of Hepatitis B Virus (HBV) transmission and its prevention. Blood samples (3.0 mls) were collected from each participant to test for HBV serum markers using a Wondfo One Step HBV rapid immunochromatographic assay (Catalog number W003) for the Hepatitis B surface antigen (HBsAg). We conducted descriptive statistics including the prevalence and used multivariable logistic regression to determine the risk of Hepatitis B among study participants. Data was analysed using Stata/SE 15. About 20.2% of the 183 pregnant women screened tested positive for HBsAg. Generally, compared with younger pregnant women, older (> = 25) pregnant women were >9 times less likely to test positive for both chronic Hepatitis B core antibody (HBcAb) and (HBeAg) Hepatitis B infections. However, pregnant women in polygamous relationship were more likely to test positive for both (HBcAb) and (HBsAg and HBeAg) Hepatitis B infections compared with those in monogamous relationship. In a multivariable analysis, pregnant women in a polygamous relationships were about 5 times more likely to test positive for HBsAg (AOR = 4.61, 95% CI: 2.06–9.89) and HBcAb (AOR = 4.89, 95% CI:1.52–6.81) and HBeAg (AOR = 4.62, 95% CI:1.21–6.39) compared with those in a monogamous relationship. This study highlights a high HBsAg prevalence among pregnant women with those in polygamous relationship and younger age more likely to test positive. Facility and community-based health services should emphasize the need for regular screening, education, and vaccination of pregnant women, especially those at high risk, to prevent mother-to-child transmission of viral hepatitis B.
23
Malalgoda, KI, KMS Weerasinghe, and RPCK Jayasinghe. "Navigating Marital Paradigms: Exploring Attitudes towards Monogamy and Polygamy in Colombo, Sri Lanka." International Journal of Research and Innovation in Social Science IX, no. IV (2025): 2628–38. https://doi.org/10.47772/ijriss.2025.90400195.
Full textAbstract:
This qualitative study investigates the perspectives on monogamous and polygamous relationships among individuals in Colombo, Sri Lanka, taking into account the impact of personal experiences, cultural norms, and societal expectations. The study conducts in-depth interviews with 60 participants from various cultural backgrounds, spanning ages 18 to 40 and 40 and above, to explore how individuals navigate the interplay between traditional values and contemporary influences in their intimate relationships. The results indicate a nuanced relationship among personal background, cultural influences, and social expectations, which collectively inform individuals’ views and decisions about marriage ideals. The narratives of participants reveal differing viewpoints, showcasing the vibrant cultural landscape of Colombo. While some maintain conventional principles of loyalty and dedication, others champion personal freedom and self-actualization. Furthermore, the study investigates how beliefs about monogamy and polygamy are passed down through generations within families and communities, highlighting the lasting impact of cultural heritage on relationship dynamics. The findings culminate in recommendations aimed at enhancing cultural sensitivity, fostering individual autonomy, and tackling systemic barriers to cultivate a more inclusive and equitable society. Further research is recommended to deepen understanding and inform targeted interventions for fostering healthy and respectful relationships within the community.
24
Cao, Yue, Naihuan Jing, and Yiling Wang. "Weighted monogamy and polygamy relations." Laser Physics Letters 21, no. 4 (2024): 045205. http://dx.doi.org/10.1088/1612-202x/ad2921.
Full textAbstract:
Abstract This research offers a comprehensive approach to strengthening both monogamous and polygamous relationships within the context of quantum correlations in multipartite quantum systems. We present the most stringent bounds for both monogamy and polygamy in multipartite systems compared to recently established relations. We show that whenever a bound is given (named it monogamy or polygamy), our bound indexed by some parameter s will always be stronger than the given bound. The study includes detailed examples, highlighting that our findings exhibit greater strength across all existing cases in comparison.
25
Guo, Jie. "The Male Dan at the Turn of the Twenty-First Century." Prism 18, no. 1 (2021): 70–88. http://dx.doi.org/10.1215/25783491-8922201.
Full textAbstract:
Abstract Reading the Taiwanese author Wu Jiwen's 1996 novel Fin-de-siècle Boylove Reader (Shijimo shaonian’ai duben), this essay considers the age-old figure of the male dan and the critical role it played in the emerging gay scene in the Sinophone world at the turn of the twenty-first century. Based on the Qing author Chen Sen's novel Precious Mirror for the Appreciation of Flowers (Pinhua baojian), Wu's version resorts to the figure of the male dan, often referred to as xianggong, to explore male same-sex intimacies, which were gaining increasing visibility in the 1990s Sinophone world. While scholars generally agree that the male dan in Wu's novel bears considerable resemblance to the figure of the contemporary gay man, some read the ending of Wu's novel, where the two protagonists, Mei Ziyu and Du Qinyan, part ways, as representing a compromise. I contend that this “unhappy ending” points to Wu's most radical departure from Chen's novel. The original novel's ending, where Ziyu lives happily ever after with both his wife and Qinyan, reaffirms the centrality of the “polygamous” patron-patronized relationship in the late imperial imagination of male-male relations. In contrast, the failed relationship between Ziyu and Qinyan in Wu's version points to the obsoleteness of the xiangong system, as well as the polygamous mode in the 1990s, which required new modes, categories, and symbols for the imagination of male same-sex relationships. Arguing that in this novel forces past and present, local and global converge, the author uses it to explore the larger question of how to approach the queer Sinophone.
26
Naisiko, Tabitha. "An Anthropological Discourse to Christian Views on Polygamy and Plural Relationships in Uganda." East African Journal of Traditions, Culture and Religion 4, no. 1 (2021): 8–15. http://dx.doi.org/10.37284/eajtcr.4.1.458.
Full textAbstract:
Marriage and family are prominent institutions in society because they define a person’s essence of life and identity, through providing means and conditions for survival, participation and sustenance. Marriage thus has forms that are inclusive, given the social realities in an area. However, as society changes, we realise that the institution is also changing to respond to new anthropological demands. This paper deals with the polygamous form of marriage and the accruing transitions as well as tensions in this institution. The paper gives a cross sectional analysis of the phenomenon, discussing its continuities and discontinuities. The paper is aimed at highlighting the anthropological basis of marriage so that society may not judge people at the periphery, but support and understand them as well as regulate the institution of marriage to be inclusive. In order to discuss the surrounding tensions, the discussion will concern polygamy and Plural relationships based on situation analysis in Uganda, personal reflections, literature and field data.
27
Asya M., Getagazova. "Some features of family and marriage relations in the Ingush society: history and modernity." Kavkazologiya 2025, no. 2 (2025): 173–88. https://doi.org/10.31143/2542-212x-2025-2-173-188.
Full textAbstract:
The article deals with the practice of polygamy among the Ingush people in the historical dynam-ics from the first evidence in the early XIX to the XXI century. The tasks of the author’s research include finding answers to questions such as: how much more or less common has polygyny be-come in the Ingush community when comparing the experience of the past (XIX century) to the present? How is the practice of creating polygamous marriages by men and women of Ingush na-tionality of different ages and varying degrees of education treated by people living in different areas: cities and villages? What are the causal relationships for Ingush newlyweds in polygamous marriages? The author also aimed to include information about the modern practices of forming polyg-amous families among the Ingush people in the scientific discourse and to explore the perception of the phenomenon of polygamy by representatives of the nation. To comprehensively address the claimed topic, the author employed various scientific re-search methods: historical and comparative methods, thematic interviews, in-depth interviews, and the method of observation. Based on the analysis of empirical data collected while preparing the material, the author demonstrates that, despite the processes of urbanization, modernization of culture, and recent re-Islamization of society, the culture and traditions of the Ingush people remain strongly influenced. Overall, polygamy has retained its presence in Ingush society. The study shows that the motiva-tions of Ingush newlyweds entering into polygamous marriages have changed over time. The author collected field material from 2022 to 2024 in various settlements of the Republic of Ingushetia, including the cities of Magas, Nazran, Sunzha, and Karabulak, as well as the rural settlements of Dolakovo, Ekazhevo, Plievo, Surkhakhi, Galashki, Sredni Achaluki, and Beini. The respondents were men and women of Ingush nationality aged 25 years and older. All respondents had secondary or higher education and varied social status, including unemployed individuals, en-trepreneurs, and specialists in various fields.
28
Okeke, Ethel Ngozi, and Abigail Obiageli Eruaga. "Dynamics of Submission in Lola Shoneyin’s The Secret Lives of Baba Segi’s Wives." CLAREP Journal of English and Linguistics 2 (October 10, 2020): 155–74. http://dx.doi.org/10.56907/g3xt00k4.
Full textAbstract:
Literature has remained a field of study which touches every aspect of human behaviour, belief and relationship. The hierarchal power structure inherent in the male-female binary finds one of its operational bases in traditional matrimonial institution where relationships are modelled on submission. Here, power relations rest on the foundation of male hegemony that demands submission from the women who are subjected to the man’s authority. This cultural situation is explored by Lola Shoneyin in The Secret Lives of Baba Segi’s Wives (2010) (henceforth, The Secret Lives), her first novel. In this novel, Shoneyin appropriates the literary medium to react to societal condition and engages a debate on one of the traditional institutions in Africa. At the centre of the novel is Chief Alao, alias Baba Segi the husband of four complex, wily and skilful women who navigate their patriarchal society with the wisdom and innocence of the Biblical serpent and dove respectively in order to maintain a harmonious marital home as well as ensure their own socio-economic survival in a male dominated society. This essay adopts the Patriarchal ideology and Chinweizu’s “Manipulative Female Power” in his book, The Anatomy of Female Power: A Masulinist Dissection of Matriarchy (1990), and argues that the author interrogates women’s submission in African traditional polygamous institution as a pretentious act that is intended to guarantee their survival and the well-being of those that subsist within the polygamous space. The essay contends that the author unmasks certain assumptions about the sexes, demystifying the revered ethos of power relations in indigenous marital institutions, and concludes that submission in such matrimonial setups is perceived as an act that promotes social cohesion.
29
Jankowiak, William. "Mormon Fundamentalist, Polygamous Marriage and What It May Tell Us about Being Human." Humans 2, no. 4 (2022): 190–218. http://dx.doi.org/10.3390/humans2040013.
Full textAbstract:
The research that forms this paper was conducted over six years 1993-1999 in a Mormon Fundamentalist community in Western USA. I wanted to understand if it was possible to love multiple individuals at the same time or if, instead, there was a preference for emotional involvement. I live inside the community dwelling with different families which enable me to view ordinary life and daily interactions that are often not noted in survey research. I supplement this approach by collecting the life history of people’s relationships and feelings toward one another. My results are present as a set of ethnographic narratives that highlight the emotional fulfillment and angst of individual experience trying to love more than one person at the same time. I found that the impulse to form dyadic love is relentless; women are the primary agents behind the push towards a more exclusive couple centered or dyad love intimacy; the “favorite” wife was readily identified in 52 out of 60 families. This presents something of a paradox: humans are both a pair-bond species who desire to form dyadic unions, even when they are not culturally sanctioned, and who have an adaptive cognitive capacity to create alternative ways of living.
30
Tugume, Benon. "FEMALE CHAUVINISTS AND MALE PATRIARCHS: A CRITICAL ANALYSIS OF GENDER RELATIONS IN AMA ATA AIDOO’S CHANGES: A LOVE STORY." Imbizo 7, no. 1 (2017): 91–100. http://dx.doi.org/10.25159/2078-9785/1928.
Full textAbstract:
This article examines gender relations in Ama Ata Aidoo’s Changes: A Love Story. The novel depicts a gender crisis among the educated and career-oriented women working in government offices in Accra. The focus is on women’s education, sexuality, marriage, and marital rape. The three women protagonists, Esi, Opokuya and Fusena, find the institution of marriage challenging and hold the view that it hampers their career development. Esi is highly educated compared to the other female characters. She is a female chauvinist, who feels too powerful to be controlled by a man. She finds herself in the most complicated situation in her marriage, because of her feminist views, which she acquired from Western education. Although she abhors the dominance of men over women, her sexuality naturally brings her into relationships with male patriarchs. Her views about love and marriage are superficial and irreconcilable with the realities of her society. She divorces her first husband because of marital rape and goes into a polygamous marriage, which she also finds unfulfilling. In this article, I argue that Esi’s problems in her first marriage are due to her uncompromising character and her inability to engage her husband in order to strike a balance between family obligations and career goals. In addition, I argue that Esi does not realise her expectations in the second marriage because she emotionally and selfishly goes into it without understanding the rules that govern polygamous marriages.
31
N. Makfiyati, Zakaria Syafe’i, and Ahmad Hidayat. "The Relationship Between Isbat Marriage Polygamy Sirri and Supreme Court Circular Letter (SEMA) Number 3 of. 2018." Journal of Law, Politic and Humanities 4, no. 6 (2024): 2044–54. https://doi.org/10.38035/jlph.v4i6.629.
Full textAbstract:
Following the issuance of SEMA Number 3 of 2018, polygamy has become a subject of considerable debate. This is due to the fact that the SEMA contains a sentence that allows for the application of isbat nikah for sirr polygamy marriages, despite the From the perspective of children's best interests, this is regarded as unacceptable by some legal practitioners and academics, who view it as contrary to the provisions of Marriage Law No. 1 of 1974 regarding marriage, as well as the prevailing Compilation of Islamic Law in Indonesia. This study aims to ascertain the position of isbat polygamy sirr in relation to the Marriage Law and the Compilation of Islamic Law, taking into account the provisions of SEMA Number 03 of 2018. Adopting a qualitative research approach with a normative legal perspective, the study draws primarily on library research, employing both a legal approach and a conceptual approach to data collection. Following an exhaustive investigation and deliberation, it can be concluded that the SEMA has effectively barred the possibility of obtaining an isbat nikah for polygamy sirr. The 3/2018 decree must be re-examined, particularly with regard to the relevance and suitability of the principles of benefit pertaining to women who are adversely affected by this action. The prohibition of this SEMA does not imply that the polygamous marriage in question is considered invalid. This is because the context of this SEMA solely pertains to the authority of judges. It can be interpreted that this SEMA acknowledges the religious validity of the marriage, thereby recognizing the legitimacy of the children produced from this union. The issuance of this SEMA, however, is a misstep as it has a detrimental impact on women in polygamous relationships.
32
Lawoko, Stephen, Koustuv Dalal, Luo Jiayou, and Bjarne Jansson. "Social Inequalities in Intimate Partner Violence: A Study of Women in Kenya." Violence and Victims 22, no. 6 (2007): 773–84. http://dx.doi.org/10.1891/088667007782793101.
Full textAbstract:
This study examines social inequalities in intimate partner violence (IPV) among women of reproductive age in Kenya. A sample comprising 3,696 women was retrieved from the Kenyan Demographic and Health Survey of 2003. The study design was cross-sectional. Chi-square tests and logistic regression were used to analyze the data. Results indicated that while high education among women reduced the risk of IPV exposure, both being employed and having a higher education/occupational status than her partner increased a woman’s vulnerability to IPV. Age differences between the partners, illiteracy, and lack of autonomy and access to information increased the likelihood of IPV. Finally, being in polygamous relationships was associated with IPV exposure. The findings indicate demographic, social, and structural differences in exposure to IPV with important implications for interventions.
33
Osman, Fatima. "Comment on the Single Marriage Statute: Implications for Customary Marriages." Potchefstroom Electronic Law Journal 24 (July 19, 2021): 1–18. http://dx.doi.org/10.17159/1727-3781/2021/v24i0a10471.
Full textAbstract:
The South African Law Reform Commission is currently canvassing views on a potential single marriage statute that would reconcile the several enactments currently regulating marriage in South Africa. This comment considers the implications of the proposed Bill for the regulation of customary marriages. It argues that the definition of a marriage / life partnership may be under-inclusive and must be expanded to included polygamous – rather than polygynous – relationships without a religious or cultural basis and life partnerships where the partners are not cohabitants. Furthermore, while the Bill is commended for requiring a husband to obtain the consent of existing wives before he enters into a further customary marriage, the Bill must give meaning to the notion of consent. Finally, the Bill must address existing issues within the Recognition of Customary Marriages Act 120 of 1998 which have invalidated a range of customary marriages too often at the expense of women.
34
Saumitou-Laprade, Pierre, Philippe Vernet, Arnaud Dowkiw, et al. "Polygamy or subdioecy? The impact of diallelic self-incompatibility on the sexual system in Fraxinus excelsior (Oleaceae)." Proceedings of the Royal Society B: Biological Sciences 285, no. 1873 (2018): 20180004. http://dx.doi.org/10.1098/rspb.2018.0004.
Full textAbstract:
How flowering plants have recurrently evolved from hermaphroditism to separate sexes (dioecy) is a central question in evolutionary biology. Here, we investigate whether diallelic self-incompatibility (DSI) is associated with sexual specialization in the polygamous common ash ( Fraxinus excelsior ), which would ultimately facilitate the evolution towards dioecy. Using interspecific crosses, we provide evidence of strong relationships between the DSI system and sexual phenotype. The reproductive system in F. excelsior that was previously viewed as polygamy (co-occurrence of unisexuals and hermaphrodites with varying degrees of allocation to the male and female functions) and thus appears to actually behave as a subdioecious system. Hermaphrodites and females belong to one SI group and functionally reproduce as females, whereas males and male-biased hermaphrodites belong to the other SI group and are functionally males. Our results offer an alternative mechanism for the evolution of sexual specialization in flowering plants.
35
Góngora-Gómez, Andrés Martín, Manuel II García-Ulloa, Diego García-Ulloa, et al. "Euceramus transversilineatus (Decapoda: Porcellanidae) living in the mantle lobe of the snail Melongena patula (Gastropoda: Melongenidae) in the south eastern Gulf of California: Inference of a biological association." Revista de Biología Marina y Oceanografía 55, no. 3 (2021): 250. http://dx.doi.org/10.22370/rbmo.2020.55.3.2589.
Full textAbstract:
There are abundant reports of symbiosis wherein crustaceans live inside or on mollusks; however, there are few published records of gastropods hosting decapods. This study examines the biological association between fifteen snails (124.86 ± 19.01) from the species Pacific crown conch Melongena patula and the porcelain crab Euceramus transversilineatus. Morphometric relationships of both invertebrates, as well as some sexual characteristics of the crab were conducted. These invertebrates were sampled in the Navachiste Lagoon, in the south eastern Gulf of California, Sinaloa, Mexico. It was found 86.6% of the snails housed at least a female or a male porcelain crab (17.82 ± 3.27 mm total body length) or a pair of them (heterosexual and same sex) with a sexual proportion of 2M:1F. There were no correlations between any of the crab and snail based on their analyzed morphometric relationships. For the crab males, the measurements of both chelae presented relationships with total body length, carapace length, and abdomen width however, no significant differences were observed between the mean width and chelae length of males, females or between sexes. Of the six females collected, four were gravid. Preliminary observations indicated that the porcelain crab E. transversilineatus is a commensal endosymbiont that coexist in short-term association with M. patula. Their population distribution suggests that E. transversilineatus are polygamous with a promiscuous mating pattern.
36
Turner, Jeffrey J. "Mormon, Muslim, and Sikh Migration to the West." Pacific Historical Review 92, no. 3 (2023): 469–90. http://dx.doi.org/10.1525/phr.2023.92.3.469.
Full textAbstract:
In 1891, the federal government excluded polygamous migrants from entering the United States. This clause, originally designed to stop Mormon migration to the West, had a strange career that filtered diverse religious migrants at American borders in the early twentieth century. Imperial expansion across the Pacific elided racial and religious undesirability in those who traveled to the American West. Inspectors brought these cultural assemblages with them when they asked migrants about their relationships with polygamy, and migrants navigated these encounters with various strategies of passing through the border. Drawing on numerous Boards of Special Inquiry, this article compares Mormon, Muslim, and Sikh migrant experiences with the polygamy question at the border and argues that, even though imperialists and immigration restrictionists policed the movement of insular and foreign people, religion facilitated imperial pathways for migrants to travel along to the American West. This article is part of a special issue of Pacific Historical Review, “Religion in the Nineteenth-Century American West.”
37
Aziz, Abdul. "Impact of Polygamy Practices in Urban Communities in Kramatjati, East Jakarta." Mazahib 24, no. 1 (2025): 131–55. https://doi.org/10.21093/mj.v24i1.8978.
Full textAbstract:
This study explores the dynamics of polygamous practices in the urban community of Kramatjati, East Jakarta, by assessing the impact of official permits and unofficial permits on family relationships and household harmony. The background of this issue discusses the influence of polygamy permits on family life in urban contexts, as well as the various challenges and conflicts that arise as a result of the practice. This article answers this question using an in-depth interview method with seven couples who practice polygamy, whether they have an official permit or not. The theories applied include family communication theory and conflict management. Research findings show that although official permits provide legitimacy, the success of polygamy practices in creating family harmony is highly dependent on internal management and the quality of communication between family members. Couples who have official permission but do not manage the relationship well experience significant tension and conflict, while well-managed couples show relatively stable harmony. In conclusion, formal permits are not enough to guarantee the welfare of the family; Effective management and open communication are the keys to achieving prosperity in the practice of polygamy. However, this does not mean that the researcher supports the practice of polygamy, but rather reflects the reality that occurs in the field.
38
Li, Min. "Gendered Manifestations of Para-social Interactions between Female Fans and Male Idols in China." International Journal of Education and Humanities 14, no. 2 (2024): 35–49. http://dx.doi.org/10.54097/d0awbe29.
Full textAbstract:
This study aims to reveal the gendered manifestations of para-social interactions between female fans and male idols in social media platforms in China, to clarify in which aspects they serve to reinforce the traditional gender order and in which aspects they deviate from the traditional gender norms, with a view to contributing positively to the optimisation of the relationship between female fans and male idols. Digital ethnography approach is used in this work, based on the Sina Weibo platform, to conduct a 15-day online observational study of seven Chinese male idols, namely Ma Jiaqi, Liu Yaowen, Song Yaxuan, Deng Jiaxin, Tang Yuzhe, Zhu Yilong, and Yang Yang, as well as their female fans. The blind consumption and unpaid labour of Chinese female fans for their male idols, as well as the polygamous "courtly love" relationship between the two, reaffirm and reinforce the traditional gender order. At the same time, the transformation of Chinese female fans from erotic objects to erotic subjects, their love for multiple male idols, their concern for ambiguous relationships between male idols, and their adherence to self-principle and subjectivity have rebelled against and even subverted traditional gender norms. However, the power to counteract the traditional gender order is not strong enough, and is still limited by factors such as exclusivity within the fan community, heterosexual hegemony, and idolatry that is as crazy and irrational as religious beliefs.
39
Mendonça Bertotti, Bárbara, Cynthia Gruendling Juruena, and Mohamed A. 'Arafa. "POLYGAMY AGAINST MORAL OR AGAINST LAW? A COMPARATIVE STUDY BETWEEN BRAZILIAN LAW AND ISLAMIC LAW." Revista do Direito, no. 63 (August 19, 2021): 26–48. http://dx.doi.org/10.17058/rdunisc.v0i63.15290.
Full textAbstract:
This article aims to investigate in a different way the concomitant relations of conjugality - here from the moment it is formalized matrimonialized as to its conformation as a situation of fact, not Authorized and not Islamic Law. The Brazilian and Islamic legal systems admit and protect polygamous relationships? The conclusion is that the right of reply is the right of police expression manifested in polygamy. In Brazil, the laws are not of the world of facts, being inclusive, in some cases, those of the right to the right, but there is still a strong tendency to legalize the legalization of polygamy, for strictly moral/religious reasons. Thus, contrary to common sense, it may be said that the Muslim is more monogamous than the Brazilian is. Still, it can be affirmed that, although Brazil declares itself secular, in practice there is no demarcated separation between State and religion. The Islamic communism is the rights of human religion. Paradoxically, would Brazil then be cloaked in the veil of Islam? The methodology used is exploratory, from a comparative perspective, taking the necessary precautions to differentiate between the two systems.
40
Raji, M. I. O., D. O. Balogun, M. L. Riskuwa, A. D. Ibrahim, and N. O. Adisa-Raji. "Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria." Sokoto Journal of Medical Laboratory Science 7, no. 4 (2023): 35–46. http://dx.doi.org/10.4314/sokjmls.v7i4.4.
Full textAbstract:
Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is a type of herpes virus with no clinical manifestation in majority of individuals. However, when it occurs in adulthood, it causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection of EBV co-infection among HIV positive women attending some selected hospitals in Sokoto, Nigeria. Questionnaires were administered on 80 consenting HIV positive women attending three selected hospitals in Sokoto to gather data on socio-demography and risk factors. Blood samples were aseptically collected by venipuncture from the HIV positive patients and EBV screening done using PCR analysis with primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 EBV (EBV-1) and primer +5' GGTAGCCTTAGGACATACTC (Forward), -5' TGGAGGGAGTCCTGTACTAT (Reverse) for Type 2 EBV (EBV-2). Result indicated that majority (63.75%) of the HIV positive women were in the age group of 21-30 years with EBV-1 having the highest occurrences of 60.7%. Co-infection of EBV among HIV positive women attending the selected hospitals in Sokoto, Nigeria was established with EBV-1 having the highest prevalence and in subjects in polygamous relationships.
41
Pimpão, Pedro, Antónia Correia, João Duque, and José Carlos Zorrinho. "Exploring effects of hotel chain loyalty program." International Journal of Culture, Tourism and Hospitality Research 8, no. 4 (2014): 375–87. http://dx.doi.org/10.1108/ijcthr-03-2014-0020.
Full textAbstract:
Purpose – The main purpose of this work is to evaluate the long-term effectiveness of a hotel’s chain loyalty program from a behavioral perspective. Design/methodology/approach – A Dirichlet model was estimated to assess purchase frequency and hotel choice within one of the biggest hotel chains in Portugal. The sample comprises hotels where a loyalty program was implemented, with a total of 176,099 reservations. Data were extracted from the customer relationship management (CRM) systems of the hotel group. Findings – The results suggest that instead of being loyal to a certain hotel, customers are loyal to the branded hotel chain. As the hotels are all part of the branded group, this polygamy is not only accepted but also very welcome. Research limitations/implications – The level of penetration and purchase frequency of CRM was measured. Nevertheless, a thorough understanding of these will be critical for the success of this program. Practical implications – This research is a step toward assessing hotel chain competitiveness, by improving and suggesting segmented groups of brands/hotels and to induce cross-selling products accepting polygamous loyalty as the only way to sustain long-term relationships with customers. Originality/value – This is one of the few research studies, if not the only one, to assess loyalty with tangible indicators, such as purchase frequency. Further, the results suggest that loyalty programs are more effective if multiple options are available and as such, cross-selling is perhaps the only way to fix customers.
42
Dalhatu, Halima Muazu, and Maryam Aliyu Muhammad. "Communication Patterns and Financial Stability as Predictors of Marital Adjustment among Polygamous Couples in Zaria, Kaduna State: Implications for Marital Counselling." African Journal of Humanities and Contemporary Education Research 15, no. 1 (2024): 293–310. http://dx.doi.org/10.62154/wmc54b06.
Full textAbstract:
This article investigates the dynamics of marital satisfaction in polygynous marriages within Zaria, Nigeria. It employs a mixed methods approach to explore how communication patterns and financial stability influence marital adjustment. Key findings reveal that effective communication, perceived fairness in resource allocation by the husband, and culturally supported conflict resolution strategies are all significant predictors of marital satisfaction in polygynous families. The study emphasizes the importance of open communication regarding finances, child-rearing practices, and emotional needs to foster trust and cooperation among spouses. It highlights the detrimental effects of favouritism and unequal treatment and the importance of emotional intelligence for navigating complex emotions inherent in polygynous structures. This research contributes to the existing body of knowledge, among others, by reinforcing the critical role of communication and fairness in promoting marital adjustment within polygynous marriages, establishing a positive association between financial stability and marital satisfaction in polygynous families, and demonstrating the link between personal satisfaction, particularly wives' perception of fairness and emotional support from their husbands, and overall marital adjustment. Based on the study's findings, the following practical recommendations are proposed to improve marital adjustment within Zarian polygynous families: Tailored counselling services designed to promote effective communication and conflict resolution skills among spouses; Educational programs for religious leaders and potential husbands on fostering fairness and healthy communication practices within polygynous marriages; Training for couples in emotional intelligence to equip them with the tools to navigate the complexities of polygynous relationships.
43
Ogunwale, Bolajoko Esther, Demilade Olusola Ibirongbe, Adenike Oluwafunmilayo Oyeneyin, et al. "Participation of male commercial motorcyclists in pregnancy and delivery care in Ibadan North Local Government Area, Nigeria." Int J Epidemiol Health Sci 5 (November 15, 2024): e81. https://doi.org/10.51757/IJEHS.5.2024.718404.
Full textAbstract:
<strong>Background: </strong>Male partners' involvement in pregnancy and delivery care is critical for improving mother and child health outcomes, especially in areas with high maternal death rates, such as Nigeria. This study investigates the role of male commercial motorcyclists in pregnancy and delivery care in Ibadan North Local Government Area, Nigeria. <strong>Material and methods: </strong>A descriptive cross-sectional study was carried out on 453 male commercial motorcyclists in Ibadan North Local Government Area. The participants were married men aged 18 and up, whose wives had given birth during the previous two years. Data was gathered using pre-tested semi-structured interviewer-administered questionnaires and analyzed with IBM SPSS version 22.0, which displayed descriptive statistics in tables and charts. The chi-square test and binary logistic regression were used to determine determinants of active participation in pregnancy and delivery care. <strong>Results: </strong>Approximately 67.8% of respondents were actively engaged in pregnancy and delivery care.Financial help for antenatal care (94.7%), delivery transport (87.2%), and attendance at antenatal sessions (59.8%) were the most commonly reported areas of engagement. Notably, 49.4% of dads were there throughout their child's delivery. Men in monogamous relationships are significantly more likely to be actively involved than those in polygamous relationships (OR: 2.43, 95% CI: 1.37-4.31). <strong>Conclusion: </strong>Two-thirds of respondents actively cared for their wives during pregnancy and delivery. To increase male engagement, interventions should promote supportive family situations and improve knowledge and attitudes towards maternal healthcare.
44
Omar, Nor Asiah, Rosidah Musa, and Muhamad Azrin Nazri. "Program Perceived Value and Program Satisfaction Influences on Store Loyalty: Insights from Retail Loyalty Progam." Gadjah Mada International Journal of Business 9, no. 3 (2007): 355. http://dx.doi.org/10.22146/gamaijb.5594.
Full textAbstract:
Investigations to determine whether program perceived value could influence program satisfaction, program card loyalty and store loyalty are critical to elucidate the roles and significance of the constructs and advancing management practice. Accordingly, in line with this research direction, this study aims to assess the effects of program perceived value offered by few leading retail superstores and departmental stores in Malaysia on its members’ loyalty towards the store. The data set utilized in this study has been obtained via quota sampling technique, where a sample of 153 retail loyalty programs’ members was analyzed. An integrative conceptual model was developed and tested using Structural Equation Modeling using AMOS program. The results exemplify that program perceived value is a strong driver of program satisfaction and program card loyalty. Unexpectedly, program perceived value is not a significant predictor of store loyalty but, it has an indirect effect on store loyalty mediated by program satisfaction. Continuous plea in marketing management is to make marketing instruments more efficient. In recent years introduction of customer relationship marketing instruments is strongly advocated, both in marketing theory and practice. Several researchers (e.g., Berry 1983; Berry and Parasuraman 1991; and Gronroos, 1994) have changed the focus of a marketing orientation from attracting short-term, discrete transactional customers to retaining long-lasting, intimate customer relationships. In fact Roberts, Varki, Brodie (2003), further suggested that it is best to describe relationship marketing as the formation of “bonds” between the company and the customer. Achieving an effective relationship in a consumer context is considered to be even more challenging than it is in a business-to-business context, given the generally more polygamous character of consumers as opposed to business customers (Keng and Ehrenberger 1984; Pressey and Matthews 1998).
45
Osman, Fatima. "Notes: Splitting hairs? Bwanya v The Master of the High Court." South African Law Journal 138, no. 3 (2021): 521–34. http://dx.doi.org/10.47348/salj/v138/i3a4.
Full textAbstract:
In Bwanya v The Master of the High Court 2021 (1) SA 138 (WCC), the Western Cape High Court ordered that the applicant, a partner in an opposite-sex partnership, was entitled to inherit from her deceased partner’s estate by ordering an amendment of the Intestate Succession Act 81 of 1987 to cater for unmarried opposite-sex partners. The court distinguished the case from Volks NO v Robinson 2005 (5) BCLR 446 (CC) — which precludes an unmarried partner from claiming maintenance from the deceased partner’s estate — on the basis that the case involved an inheritance claim as opposed to maintenance. The note argues that the failure of the court to deal with the central argument in Volks in respect of inheritance rights undermines the strength of the judgment. The Constitutional Court in confirmation proceedings should address this matter, and consider a softening of the doctrine of stare decisis to overrule the Volks case. Furthermore, the case opens the door to claims by other unmarried partners in polygamous relationships. While such claims involve policy considerations that are best addressed by the legislature, they are likely to come before the courts in the near future. Courts should recognise such claims in acknowledgment of the diversity in family formations in South Africa.
46
Coronas, Ahmad Abdullah, Abu Sanmas, Nirwan Umasugi, Harwis Harwis, and Fatum Abubakar. "PRAKTIK POLIGAMI TANPA IZIN DI BACAN TIMUR HALMAHERA SELATAN." Indonesian Journal of Shariah and Justice 3, no. 1 (2023): 49–71. http://dx.doi.org/10.46339/ijsj.v3i1.48.
Full textAbstract:

 
 
 The practice of polygamy without a permit in the East Bacan District, South Halmahera Regency. This study aims to find the main issues that underlie the occurrence of the practice of polygamy without a permit in the East Bacan District, South Halmahera Regency. This study is field research. The research method used is descriptive qualitative research, namely a type of research that provides a systematic and factual description of situations and events regarding factors, characteristics and relationships between phenomena, with theoretical, normative and empirical juridical approaches. This study concluded that the implementation of polygamy without a permit in East Bacan District was carried out through cases of premarital pregnancy and coupled with low public awareness regarding the importance of marriage procedures. The limited budget and human resources owned by the East Bacan District KUA in conducting outreach to the people of East Bacan District have triggered the lack of attention from the Office of the Religious Affairs Office of Bacan District to minimize the incidence of polygamy without a permit in East Bacan District. The implementation of polygamy without a permit in East Bacan District had legal impacts, including the weak legal status of marriage, the absence of birth certificates for children born in polygamous marriages without permission.
 
 
47
Luhova, Marіia. "PHILOSOPHICAL REFLECTIONS OF THE "CHILD" IN THE UKRAINIAN CULTURAL." Educational Discourse: collection of scientific papers, no. 42(10-12) (December 24, 2022): 57–64. http://dx.doi.org/10.33930/ed.2019.5007.42(10-12)-6.
Full textAbstract:
Children are an essential element in a traditional Ukrainian family. Marriage itself was the realization of the need for procreation, and families were mostly large, abortion was socially condemned. The process of education was implemented by means of folk pedagogy, which was considered the greatest source of wisdom. Each child had his own responsibilities in the household, according to age and physical capabilities. That is, a child in a Ukrainian family was a full-fledged member of a social group that was perceived as an equal. Global dynamic processes have brought new, non-traditional aspects to the Ukrainian family, which undoubtedly have an impact on the child: same-sex relationships, child-free, guest marriages, polygamous relationships, etc. Such tendencies are becoming more and more widespread among the countries of Europe and the USA, taking into account the dominance of tolerance, pluralism, and secularization of society. However, they have a great influence on the phenomenology of childhood, because they reduce the birth rate due to refusal or inability to have a child. Such conditions make the family unsustainable, and therefore lead to negative dynamics of self-reproduction and procreation. It is important today to teach the young generation the basics of national culture and its features, which are symbols of nationhood, unity and patriotism in the Ukrainian consciousness. Unique archetypes from Ukrainian folklore (from legends, fairy tales) combine with children's lullabies much more natively and organically and leave a positive impression on the formation of the child's personality. They have an impact not only on the patriotic attitude to the homeland, but also bring up the characteristics characteristic of the Ukrainian people: hard work, respect for parents and the elderly, humane attitude to the environment, high moral qualities, strength of spirit and willpower, dignity, honor and courage .
48
Kalu, Eziyi Iche, Chiedozie Kingsley Ojide, Adeola Fowotade, and Victor Ugochukwu Nwadike. "Sexual behavioral correlates with HSV-2 seroprevalence among pregnant women in Nigeria." Journal of Infection in Developing Countries 8, no. 08 (2014): 1006–12. http://dx.doi.org/10.3855/jidc.4336.
Full textAbstract:
Introduction: The burden of HSV-2 infection, the cause of most cases of genital herpes in Nigeria, varies from region to region; and so are the associated factors. This infection is known to be responsible for several negative pregnancy outcomes. There is currently no documented data on sexual behavioral factors associated with the occurrence of HSV-2 infection or seroprevalence among pregnant women in Nigeria. This study aimed at identifying the sexual behavioral correlates of HSV-2 seroprevalence among pregnant women in Benin City, Nigeria. Methodology: The cross-sectional study design was adopted and the study took place between November 2011 and June 2012. Four hundred and ten consenting ante-natal clinic patients in two major tertiary hospitals in Benin City were consecutively and prospectively included. Data sources were represented by questionnaires, the patient’s case records and laboratory investigations. Each patient’s serum was analyzed for HSV-2 antibody detection. Data analysis was performed using SPSS version 16. Results: Four hundred and ten patients were enrolled with average age 30.6 years. Seroprevalence of HSV-2 antibody was 47.3%. Sexual behavioral factors that were significantly associated with HSV-2 seroprevalence included early exposure to sexual intercourse, number of sex partners, involvement in polygamous marriages, involvement of husband in extra-marital affairs and hormonal contraceptive use. Conclusion: The prevalence of HSV-2 among pregnant women in Benin City is high. Public health campaigns aimed at: delaying onset of sexual activity; encouraging monogamous relationships; and emphasizing that hormonal contraceptives do not protect from STI’s, are recommended.
49
Dyshlevyi, Illia. "Psychology of personal choice and love in the postmodern societ." Psychological Journal, no. 10 (July 28, 2023): 6–14. http://dx.doi.org/10.31499/2617-2100.10.2023.285301.
Full textAbstract:
The relationship between personal choice and love is highly controversial in the postmodern society. Belief in «eternal» love and its narratives are considered naïve in the public discourse of the postmodern society. In the foreground there are temporal and momentary, sexual pleasures and short-termed love affairs that contradict the content of true love. In the postmodern society so-called free relationships become popular, they do not assume the loyalty of partners to each other. Genuine romantic (intimate) love is the feeling and state of devotion of one person to another, respect for human dignity of the loved one, acceptance of his or her being, constant care of partners for each other, mutual understanding and sense of duty of a person in the relations with a partner. True love also implies tolerance towards love relations among members of socially vulnerable groups of a society. The desire for true love is the most important manifestation of eudemonism in a human outlook. The psychology of personal choice regarding love is greatly simplified in the postmodern society. Hedonism (the pursuit of various pleasures) and epicureism (the craving for momentary delights) have actually replaced the notion of love. This is reflected in the image and lifestyle of many people. In the public discourse of the postmodern society these patterns of love are articulated, and true love is discribed in the narratives of intellectuals and actively reflexing people. In the modern Ukraine, the social and psychological well-being of socially vulnerable groups is quite complicated, as social stigmatization and discrimination towards members of these groups persist. Personal choice regarding love among members of socially vulnerable groups is extremely difficult in the modern Ukrainian society, since the realization of the right to be happy in this social environment is not simple. The main axis of the psychology of personal choice regarding love in the postmodern society is the adoption of an existential decision – to search for a companion of the whole life and to be monogamous, or to be polygamous and polyamorous, practicing many intimate relationships with different partners. The choice of a person in favor of the love for the whole life is very rare in the postmodern society, because its value for people is mainly lost in the course of socialization and social development.
50
Awolaran, Busola, Emmanuel Babalola, and Peter Onifade. "The relationships between Big Five Personality dimensions, harmful psychoactive substance use and academic motivation among undergraduates in Nigeria." BJPsych Open 7, S1 (2021): S234—S235. http://dx.doi.org/10.1192/bjo.2021.628.
Full textAbstract:
AimsThe aim of this study was to determine the relationships between personality traits, stress perception, academic motivation and harmful use (use related harmful consequences) of alcohol, tobacco and cannabis among undergraduates in Southwestern Nigeria.MethodThe study is a descriptive cross-sectional study conducted among students of randomly selected tertiary institutions in south western Nigeria. Ethical approval was obtained from the Research and Ethics Commitee of the Federal Neuropsychiatric Hospital Abeokuta Ogun State Nigeria. Permission to carry out the study was sought from the University authorities. A multi-stage cluster sampling selection of 850 respondents was done. Consenting students were administered socio-demographic questionnaire, WHO student's drug use questionnaire, the Big Five Personality Inventory (BFI-44), perceived stress scale-10 and academic motivation inventory.ResultSeven hundred and eighty one completed questionnaires were analysed yielding a response rate of 92%. There were 51% males and 49% females with a mean age of 23.3 years (SD = ±2.29), from monogamous family setting 591(75%) and high socio-economic class (65.8%). Of the respondents, 24.8% reported experience of use related harmful consequences such as engaging in quarrel or argument, unprotected sex and sex regretted the next day. There were significant associations between male gender (p=<0.001), urban residence (p = 0.028), polygamous family setting (p = 0.002), high socioeconomic status (p = 0.026) and use related harmful consequences.Multiple logistic regression showed that the odds of experiencing harmful consequences was less than 1 for agreeableness (OR = 0.515, df = 1, p = <0.001) and openness (OR = 0.634, df = 1, p = <0.028) but greater than 1 for extraversion (OR = 1.525, df = 1, p = <0.036) personality dimensions. This implies that for a unit increase in agreeableness and openness scores, there were decreased odds (8.6% and 79% respectively) of experiencing harmful consequences while there was increased odd (86%) of experiencing harmful consequences from a unit increase in extraversion score.Both binary and multiple regression analysis revealed that the odds of experiencing harmful consequences is greater than 1 for perceived stress score (OR = 1.079, p = <0.001) and less than 1 for academic motivation (OR = 0.975, p = <0.001). This means that perceived stress is positively associated with substance use and experience of harmful consequences while academic motivation is negatively associated with substance use and experience of harmful consequencesConclusionThere were associations between certain socio-demographic factors, personality dimensions, stress perception and academic motivation with substance use and experience of harmful consequences. Thus, clinicians and researchers should consider these factors when designing preventive and treatment strategies.