To see the other types of publications on this topic, follow the link: Tomato yellow leaf curl virus.
Journal articles on the topic 'Tomato yellow leaf curl virus'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Tomato yellow leaf curl virus.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Riley, David G., and Rajagopalbabu Srinivasan. "Integrated Management of Tomato Yellow Leaf Curl Virus and its Whitefly Vector in Tomato." Journal of Economic Entomology 112, no. 4 (2019): 1526–40. http://dx.doi.org/10.1093/jee/toz051.
Full textAbstract:
AbstractWhitefly-transmitted Tomato yellow leaf curl virus (Family Geminiviridae; Genus Begomovirus) severely restricts tomato production in the Southeastern United States. Whitefly and tomato yellow leaf curl virus management studies typically investigate control tactics individually, but successful management of this pest complex more often relies on a combination of tactics. This study examined the individual and combined effects of tomato yellow leaf curl virus-resistant cultivars, insecticides, and metallic reflective mulch on whiteflies, tomato yellow leaf curl virus disease incidence, and marketable tomato yields using split-split plot trials over 3 yr. Reflective mulch significantly reduced whitefly adults and nymphs and tomato yellow leaf curl virus symptom severity in all 3 yr of the study. Reflective mulch treatments also provided greater marketable tomato yield in 2 out of 3 yr. Imidacloprid and cyantraniliprole treatments reduced whitefly adults and nymphs’ establishment and marginally increased yields, but there was no significant insecticide effect on tomato yellow leaf curl virus incidence/symptom severity compared with the non-treated check. Virus-resistant tomato cultivars did not influence whitefly populations, but provided consistent reduction in virus disease incidence. Interactions between host plant resistance and insecticide treatments ranged from strongly additive in the standard white plastic mulch treatment to only marginally additive in the reflective mulch treatments in terms of enhancing tomato yields. tomato yellow leaf curl virus-resistant tomato cultivars and reflective mulch provided the bulk of the protection against tomato yellow leaf curl virus disease incidence. However, it was the combination of all the best tactics (reflective mulch, cyantraniliprole, ‘Security’ hyb. tomato yellow leaf curl virus-resistant) that provided the maximum increase in marketable tomato yield (2.8-fold) over the least effective combination (white mulch, no whitefly insecticide, ‘FL47’ hyb. tomato yellow leaf curl virus-susceptible).
2
Rakita, Mina. "Tomato yellow leaf curl virus significance and control measures in tomato." Biljni lekar 49, no. 5 (2021): 594–601. http://dx.doi.org/10.5937/biljlek2105594r.
Full textAbstract:
Tomato yellow leaf curl virus is one of the most harmful viruses which damages tomato plants and causes significant yield losses. After its first appearance in the 1930s, it started to spread all over the world via infected tomato seedlings and vector, a whitefly Bemisia argentifolii. In order to stop the infections and preserve the health of cultivated plants, different measures are being conducted starting with maintaining the field and indoor space hygiene and quarantine measures, all the way to the vector suppression measures. Apart from that, there have been efforts in breeding resistant tomato plants. Sources of the resistance to the virus have been found in some wild tomato species. Additional research is needed so as to improve the existing methods of protection against TYLCV and create new resistant plants. It is also crucial to take into consideration the fact that more aggressive and virulent virus strains are likely to appear due to recombination events, as well as vector varieties resistant to insecticides.
3
Inoue-Nagata, Alice K., Jesús Navas-Castillo, Paulo C. T. de Melo, and Antônio C. de Ávila. "Busca por Tomato yellow leaf curl virus e Tomato yellow leaf curl Sardinia virus em tomateiros." Horticultura Brasileira 22, no. 4 (2004): 799–800. http://dx.doi.org/10.1590/s0102-05362004000400027.
Full textAbstract:
A doença causada pelo complexo de vírus do tomato yellow leaf curl (TYLC) é muito séria em tomateiro, principalmente na América Central e Europa, e é causada por um complexo de begomovírus monopartidos. A doença torna-se predominante, mesmo em áreas com a presença de outros begomovírus. No Brasil, os problemas advindos da infecção por begomovírus uram entre os principais fatores de perdas e oneração de custos. A introdução do complexo TYLC representa uma grande ameaça para os produtores. Este estudo visou a realização de testes de detecção baseados em reação de polimerase em cadeia (PCR) e hibridização específicos em amostras suspeitas coletadas no estado de São Paulo. Um total de 46 amostras com sintomas lembrando aqueles causados pelo complexo TYLC foram coletados no município de Campinas. Todas as amostras foram negativas para detecção de Tomato yellow leaf curl virus e Tomato yellow leaf curl Sardinia virus, as duas espécies mais importantes do completo TYLC. Este resultado sugeriu que as duas espécies de vírus ainda não foram introduzidas no Brasil ou que ainda não apresentam uma larga distribuição.
4
Kwak, Hae-Ryun, Su-Bin Hong, Hee-Seong Byun, et al. "Incidence and Molecular Identification of Begomoviruses Infecting Tomato and Pepper in Myanmar." Plants 11, no. 8 (2022): 1031. http://dx.doi.org/10.3390/plants11081031.
Full textAbstract:
In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.
5
Navas-Castillo, J., S. Sánchez-Campos, E. Noris, D. Louro, G. P. Accotto, and E. Moriones. "Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus." Journal of General Virology 81, no. 11 (2000): 2797–801. http://dx.doi.org/10.1099/0022-1317-81-11-2797.
Full textAbstract:
The complete genome sequences (2791 and 2793 nt) of isolates of Tomato yellow leaf curl virus-Is (TYLCV-Is) from Spain (SP72/97) and Portugal (Port2/95) were determined. These isolates are closely related to TYLCV-Is isolates reported in Japan (Japan-A and Japan-S) and Israel (Israel/Mild). Comparison of all sequenced isolates of TYLCV-Is showed that part of the genome comprising the intergenic region and the 5′-end of the rep gene of the Iran and Israel isolates was not closely related to that of other isolates. Phylogenetic analyses suggest that the Israel and Iran isolates may have chimeric genomes that have arisen by recombination between TYLCV-Is-like and tomato leaf curl virus (ToLCV)-like ancestors. The TYLCV-Is donors of the Iran and the Israel genomes were closely related to each other and to other known TYLCV-Is isolates. However, the ToLCV donors differed from each other, although both were related to ToLCV isolates from India (Bangalore-2 and Bangalore-4).
6
Sidik, E. A., S. Hartono, S. Sulandari, et al. "Molecular detection of Pepper yellow leaf curl virus, Tomato leaf curl virus, Tomato yellow leaf curl virus, and Mungbean yellow mosaic virus on eggplant, tomato, and pepper at different altitudes in East Java, Indonesia." IOP Conference Series: Earth and Environmental Science 1230, no. 1 (2023): 012117. http://dx.doi.org/10.1088/1755-1315/1230/1/012117.
Full textAbstract:
Abstract The genus Begomovirus causes yellow disease is the most damaging and threatening for eggplant, tomato, and pepper production worldwide. Begomoviruses (Family Geminiviridae) are transmitted circulative persistent manner by Bemisia tabaci. This study aims to determine the variation of infection of several species of Begomoviruses in tomato, eggplant, and pepper at different altitudes in East Java. Molecular detection of infection Begomoviruses were discovered using PCR and four pairs of specific primers. Samples were collected at different altitudes in East Java (Kencong, Karangploso, and Pujon). The PCR was successfully applied to detect Pepper yellow leaf curl virus, Tomato leaf curl virus, and Tomato yellow leaf curl virus from tomato, eggplant, and pepper in Kencong. Tomato, eggplant, and pepper from all locations were not infected by Mungbean yellow mosaic virus. Symptoms of Begomovirus infection found in the samples from Kencong were more varied than those found in Karangploso and Pujon. The phylogenetic analysis’ findings revealed that the TYLCV Kencong shared the highest homologies with TYLCKaV pepper and eggplant from Indonesia; PepYLCV Kencong shared with PepYLCV Ageratum conyzoides from Indonesia; and ToLCV Kencong shared with ToLCNDV cucumber from Central Java. The molecular detection has shown that there are different combinations of Begomovirus infection at altitudes.
7
Morilla, Gabriel, Björn Krenz, Holger Jeske, Eduardo R. Bejarano, and Christina Wege. "Tête à Tête of Tomato Yellow Leaf Curl Virus and Tomato Yellow Leaf Curl Sardinia Virus in Single Nuclei." Journal of Virology 78, no. 19 (2004): 10715–23. http://dx.doi.org/10.1128/jvi.78.19.10715-10723.2004.
Full textAbstract:
ABSTRACT Since 1997 two distinct geminivirus species, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), have caused a similar yellow leaf curl disease in tomato, coexisted in the fields of southern Spain, and very frequently doubly infected single plants. Tomatoes as well as experimental test plants (e.g., Nicotiana benthamiana) showed enhanced symptoms upon mixed infections under greenhouse conditions. Viral DNA accumulated to a similar extent in singly and doubly infected plants. In situ tissue hybridization showed TYLCSV and TYLCV DNAs to be confined to the phloem in both hosts, irrespective of whether they were inoculated individually or in combination. The number of infected nuclei in singly or doubly infected plants was determined by in situ hybridization of purified nuclei. The percentage of nuclei containing viral DNA (i.e., 1.4% in tomato or 6% in N. benthamiana) was the same in plants infected with either TYLCSV, TYLCV, or both. In situ hybridization of doubly infected plants, with probes that discriminate between both DNAs, revealed that at least one-fifth of infected nuclei harbored DNAs from both virus species. Such a high number of coinfected nuclei may explain why recombination between different geminivirus DNAs occurs frequently. The impact of these findings for epidemiology and for resistance breeding concerning tomato yellow leaf curl diseases is discussed.
8
Ren, Yanxiang, Xiaorong Tao, Dawei Li, Xiuling Yang, and Xueping Zhou. "ty-5 Confers Broad-Spectrum Resistance to Geminiviruses." Viruses 14, no. 8 (2022): 1804. http://dx.doi.org/10.3390/v14081804.
Full textAbstract:
The selection of resistant crops is an effective method for controlling geminivirus diseases. ty-5 encodes a messenger RNA surveillance factor Pelota with a single amino acid mutation (PelotaV16G), which confers effective resistance to tomato yellow leaf curl virus (TYLCV). No studies have investigated whether ty-5 confers resistance to other geminiviruses. Here, we demonstrate that the tomato ty-5 line exhibits effective resistance to various geminiviruses. It confers resistance to two representative begomoviruses, tomato yellow leaf curl China virus/tomato yellow leaf curl China betasatellite complex and tomato leaf curl Yunnan virus. The ty-5 line also exhibits partial resistance to a curtovirus beet curly top virus. Importantly, ty-5 confers resistance to TYLCV with a betasatellite. Southern blotting and quantitative polymerase chain reaction analyses showed that significantly less DNA of these geminiviruses accumulated in the ty-5 line than in the susceptible line. Moreover, knockdown of Pelota expression converted a Nicotiana benthamiana plant from a geminivirus-susceptible host to a geminivirus-resistant host. Overall, our findings suggest that ty-5 is an important resistance gene resource for crop breeding to control geminiviruses.
9
Smeda, John R., Hugh A. Smith, and Martha A. Mutschler. "The amount and chemistry of acylsugars affects sweetpotato whitefly (Bemisia tabaci) oviposition and development, and tomato yellow leaf curl virus incidence, in field grown tomato plants." PLOS ONE 18, no. 11 (2023): e0275112. http://dx.doi.org/10.1371/journal.pone.0275112.
Full textAbstract:
The objectives of this study were to ascertain the impact of endogenous production of trichome-exuded acylsugars on insects and insect transmitted virus by evaluating tomato lines and their hybrids bred for acylsugar production under field settings on whiteflies and the whitefly-transmitted tomato yellow leaf curl virus. Specifically, we utilized a diverse array of tomato lines and hybrids bred for changes in acylsugar amount or type, grown in three field trials under natural whitefly and virus pressure, to investigate whether the amount of accumulated acylsugars and or the chemical profile of the acylsugars were associated with greater resistance to whiteflies and reduced incidence of tomato yellow leaf curl virus. There was considerable variation in the abundance of whitefly eggs and nymphs and incidence of tomato yellow leaf curl virus across experiments and between entries. Increasing amount of acylsugars accumulated by the tomato entries was associated with a reduction in the abundance of whitefly eggs and nymphs and a reduction in the incidence of tomato yellow leaf curl virus. Additionally, we identified lines with changes in several acylsugar fatty acids that were associated with decreased abundance of whitefly eggs and nymphs and reduced incidence of tomato yellow leaf curl virus. These results inform the utility of acylsugars as a host plant defense system for improving resistance to whiteflies and their transmitted viruses, with potential for reducing insecticides as a control method for whiteflies and provide breeding targets for optimization of existing acylsugar tomato lines to create lines with the most efficacious amount and chemistry of acylsugars.
10
Zi-Fu, He, Yu Hao, Mao Ming-Jie, Luo Fang-Fang, Lin Yi-Han, and Wang Sui-Tao. "Tomato yellow leaf curl disease in Guangdong is caused by Tomato leaf curl Taiwan virus." Chinese Journal of Agricultural Biotechnology 4, no. 2 (2007): 127–31. http://dx.doi.org/10.1017/s1479236207001611.
Full textAbstract:
AbstractA yellow leaf curl disease with chlorotic and yellowish leaves, upward leaf curling and stunting symptoms was observed on tomato in Shantou city of Guangdong province. A virus isolate BS was obtained from a diseased tomato plant. The complete DNA-A sequence of the virus isolate BS was determined to be 2740 nucleotides long, with all the characteristic features of begomovirus genome organization. BS DNA-A encoded six potential open reading frames (ORFs), with two (AV1 and AV2) in virus sense and four (AC1, AC2, AC3 and AC4) in complementary sense, and contained an intergenic region of 269 nucleotides. The results of BLAST searches showed that BS DNA-A had higher sequence identity with reported begomoviruses in Asia than with those in America and Africa. Further sequence comparisons indicated that BS was most closely related to the isolate of Tomato leaf curl Taiwan virus (ToLCTWV-[Taiwan]) with a sequence identity of 97.7%. Nucleotide sequence identities of AV1, AV2, AC1, AC2, AC3, AC4 and intergenic region (IR) between BS and ToLCTWV-[Taiwan] were 98.6, 98.0, 98.0, 97.5, 96.3, 98.6 and 96.6%, respectively, while that of the six ORF-encoded proteins between BS and ToLCTWV-[Taiwan] were 97.7, 99.1, 97.5, 95.6, 91.8 and 99.0%, respectively. Phylogenetic analysis based on the DNA-A sequences has also indicated that BS is most closely related to ToLCTWV-[Taiwan], forming a branch with ToLCTWV-[Taiwan], Tomato leaf curl Guangdong virus and Tomato yellow leaf curl Guangdong virus. The above results demonstrate that BS is an isolate of ToLCTWV.
11
Trisno, Jumsu, Sri Hendrastuti Hidayat, Jamsari Jamsari, Trimuri Habazar, and Ishak Manti. "Identifikasi Molekuler Begomovirus Penyebab Penyakit Kuning Keriting pada Tanaman Cabai (Capsicum annum L.) di Sumatera Barat." Jurnal Natur Indonesia 13, no. 1 (2012): 41. http://dx.doi.org/10.31258/jnat.13.1.41-46.
Full textAbstract:
Pepper plants showing Begomovirus-like symtoms, consisting of yellowing, leaf curling, and distortion, werecollected from fields located in the Padang, West Sumatra. The aim of this research is to identification ofbegomovirus associated with yellow leaf curl diseases on pepper. Total DNA was extracted from infected leaftissue according to Doyle and Doyle (1999) with slight modification. Polymerase chain reaction (PCR) was used toamplify the coat protein region of the virus using universal degenerate primers pAV494 and pAC1048. The PCRamplified DNA product (approx. 560 bp) was sequenced. The nucleotide and amino acid sequences and BLASTsearch revealed highest homology with pepper yellow leaf curl Indonesia virus isolated pepper, tomato andAgeratum conyzoides from Java, but differences from those of tomato yellow leaf curl virus. The isolate was thententatively called pepper yellow leaf curl Indonesia virus-Padang (PYLCIV-Pdg).
12
Green, S. K., W. S. Tsai, S. L. Shih, et al. "Molecular Characterization of Begomoviruses Associated with Leafcurl Diseases of Tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam." Plant Disease 85, no. 12 (2001): 1286. http://dx.doi.org/10.1094/pdis.2001.85.12.1286a.
Full textAbstract:
Production of tomato (Lycopersicon esculentum) in Bangladesh, Malaysia, Myanmar, Vietnam, and Laos has been severely affected by yellow leaf curl disease. Tomato leaf samples were collected from symptomatic tomato plants from farmers' fields in the five countries from 1997 to 1999. DNA was extracted from all samples, four from Vietnam, two each from Malaysia, Laos, and Myanmar, and seven from Bangladesh. Virus DNA was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v 1978/PAR1c 715(1), which amplifies the top part of DNA A. All samples gave the expected 1.4-kb PCR product. The PCR product of one sample per country was cloned and sequenced. Based on the sequences of the 1.4-kb DNA products amplified by the first primer pair, specific primers were designed to complete each of the DNA A sequences. Computer-assisted sequence comparisons were performed with begomovirus sequences available in the laboratory at the Asian Vegetable Research and Development Center, Shanhua, Tainan, and in the GenBank sequence database. The five DNA species resembled DNA A of begomoviruses. For the detection of DNA B two degenerate primer pairs were used, DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (DNABLC1: 5′-GTVAATGGRGTDCACTTCTG-3′, DNABLC2: 5′-RGTDCACTT CTGYARGATGC-3′, DNABLV2: 5′-GAGTAGTAGTGBAKGTTGCA-3′), which were specifically designed to amplify DNA B of Asian tomato geminiviruses. Only the virus associated with yellow leaf curl of tomato in Bangladesh was found to contain a DNA B component, which was detected with the DNABLC1/DNABLV2 primer pair. The DNA A sequence derived from the virus associated with tomato yellow leaf curl from Myanmar (GenBank Accession No. AF206674) showed highest sequence identity (94%) with tomato yellow leaf curl virus from Thailand (GenBank Accession No. X63015), suggesting that it is a closely related strain of this virus. The other four viruses were distinct begomoviruses, because their sequences shared less than 90% identity with known begomoviruses of tomato or other crops. The sequence derived from the virus associated with tomato yellow leaf curl from Vietnam (GenBank Accession No. AF264063) showed highest sequence identity (82%) with the virus associated with chili leaf curl from Malaysia (GenBank Accession No. AF414287), whereas the virus associated with yellow leaf curl symptoms in tomato in Bangladesh (GenBank Accession No. AF188481) had the highest sequence identity (88%) with a tobacco geminivirus from Yunnan, China (GenBank Accession No. AF240675). The sequence derived from the virus associated with tomato yellow leaf curl from Laos (GenBank Accession No. AF195782) had the highest sequence identity (88%) with the tomato begomovirus from Malaysia (GenBank Accession No. AF327436). This report provides further evidence of the great genetic diversity of tomato-infecting begomoviruses in Asia. Reference: M. R. Rojas et al. Plant Dis. 77:340, 1993.
13
Rojas, M. R., T. Kon, E. T. Natwick, J. E. Polston, F. Akad, and R. L. Gilbertson. "First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California." Plant Disease 91, no. 8 (2007): 1056. http://dx.doi.org/10.1094/pdis-91-8-1056a.
Full textAbstract:
Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.
14
Glick, E., Y. Levy, and Y. Gafni. "The viral etiology of tomato yellow leaf curl disease – a review." Plant Protection Science 45, No. 3 (2009): 81–97. http://dx.doi.org/10.17221/26/2009-pps.
Full textAbstract:
Tomato yellow leaf curl disease (TYLCD) is one of the most devastating plant diseases in the world. As a result of its continuing rapid spread, it now afflicts more than 30 tomato growing countries in the Mediterranean basin, southern Asia, Africa, and South, Central and North America. The disease is caused by a group of viral species of the genus <I>Begomovirus,</I> family Geminiviridae (geminiviruses), referred to as <I>Tomato yellow leaf curl virus</I> (TYLCV). These are transmitted by an insect vector, the whitefly<I> Bemisia tabaci</I>, classified in the family Aleyrodidae. The genome of TYLCV generally consists of a single circular single-stranded (ss) DNA molecule, with only one exception in which two components were identified. It encodes six open reading frames, only one of which codes for the coat protein (CP) that represents a building block of the viral particle. TYLCV, like all other members of the Geminiviridae, has geminate particles, apparently consisting of two incomplete T = 1 icosahedra joined together to produce a structure with 22 pentameric capsomers and 110 identical CP subunits. Close to 50 years of intensive research into TYLCV epidemics has been conducted to find solutions to the severe problem caused by this virus. To date, breeding for resistance appears to be the best approach to controlling this disease, although only partially resistant varieties are commercially available. Since the virus consists of a ssDNA that replicates in the host-cell nucleus, the molecular mechanisms involved in its nuclear import have been the focus of our studies in recent years and results, as well as prospects, are discussed in this review. In addition, we describe our recent finding of a suppressor of gene silencing encoded by one of the TYLCV-Isr genes. This paper provides an overview of the most outstanding achievements in TYLCV research that may lead to more effective control strategies.
15
Лозовая, Е. Н., Ю. Н. Приходько, Т. С. Живаева та Ю. А. Шнейдер. "Диагностика бегомовирусов методом ПЦР". Plant Health and Quarantine, № 2 (15 червня 2020): 41–54. http://dx.doi.org/10.69536/fkr.2020.91.31.001.
Full textAbstract:
Род Begomovirus включает более 190 видов вирусов, являющихся вредоносными патогенами овощных и полевых культур. Широко распространенный в Европе бегомовирус желтой курчавости листьев томата (Tomato yellow leaf curl virus, TYLCV) является карантинным объектом для Российской Федерации, ЕАЭС и ЕОКЗР. Идентификация бегомовирусов до видового уровня сопряжена с определенными трудностями, обусловленными высокой идентичностью их генома. В статье приводятся результаты испытания 19 пар универсальных и специфических праймеров для диагностики бегомовирусов: вируса желтой курчавости листьев томата TYLCV, вируса желтой курчавости листьев томата Сардиния (Tomato yellow leaf curl Sardinia virus, TYLCSV) и Нью-Дели вируса курчавости листьев томата (Tomato leaf curl New Delhi virus, ToLCNDV) методами классической ПЦР и ПЦР в реальном времени.
16
Pietersen, Gerhard, and Marie F. Smith. "Tomato yellow leaf curl virus Resistant Tomatoes Show Resistance to Tomato curly stunt virus." Plant Disease 86, no. 5 (2002): 528–34. http://dx.doi.org/10.1094/pdis.2002.86.5.528.
Full textAbstract:
A new disease of tomatoes (Lycopersicon esculentum) in South Africa has caused severe yield losses. The causative virus, Tomato curly stunt virus (ToCSV) is distantly related to Tomato yellow leaf curl virus (TYLCV). Thirty-two tomato accessions resistant to TYLCV and 8 local cultivars were assessed for their responses to ToCSV infection. Natural infection in a field trial and a screen-house trial with controlled ToCSV-inoculation were conducted. Symptoms were rated using a severity index (SI). Yield parameters were determined in the screenhouse trial to support SI evaluations. Average SI's obtained demonstrate that TYLCV-tolerant tomato accessions, with a few exceptions, have milder symptoms of ToCSV infection than TYLCV-susceptible, sensitive accessions. None of the accessions were immune, with some virus detected in all plants. Yield losses due to ToCSV infection of TYLCV-tolerant tomato accessions were not significant (P > 0.10) with some exceptions. However, TYLCV-sensitive accessions and 8 local cultivars had significant (P < 0.10) yield losses of 49 to 100%. TYLCV-tolerant cultivars may be useful for control of ToCSV, but require evaluation prior to release or use in breeding programs in South Africa.
17
Ahmed, Mohamed Soliman, and Elsayed Mohamed Maged. "Tomato yellow leaf curl virus: Diagnosis and metabolites." African Journal of Biotechnology 17, no. 7 (2018): 198–205. http://dx.doi.org/10.5897/ajb2017.16315.
Full text
18
Papayiannis, L. C., T. A. Iacovides, N. I. Katis, and J. K. Brown. "Differentiation of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus using real-time TaqMan® PCR." Journal of Virological Methods 165, no. 2 (2010): 238–45. http://dx.doi.org/10.1016/j.jviromet.2010.02.003.
Full text
19
Parrella, G., A. G. Nappo, M. Giorgini, and A. Stinca. "Urtica membranacea: A New Host for Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in Italy." Plant Disease 100, no. 2 (2016): 539. http://dx.doi.org/10.1094/pdis-07-15-0742-pdn.
Full text
20
Kim, Tack-Soo, Seung-Kook Choi, Min-Jung Ko, et al. "Ultra-rapid Real-time PCR for the Detection of Tomato yellow leaf curl virus." Research in Plant Disease 18, no. 4 (2012): 298–303. http://dx.doi.org/10.5423/rpd.2012.18.4.298.
Full text
21
Hamed, H. H., A. Z. Hegazi, T. G. Anany, and A. F. E. Afsah. "Age-related Induced Resistance Effect on Tomato Seedlings for Producing Tomato Yellow Leaf Curl Virus (TYLCV)-Free Plants and High-quality Seeds." Asian Journal of Agricultural and Horticultural Research 10, no. 3 (2023): 28–42. http://dx.doi.org/10.9734/ajahr/2023/v10i3229.
Full textAbstract:
Egypt is facing a major problem in the field of tomato seed production, as infection with the yellow tomato leaf curl virus (TYLCV) is one of the most important factors in the success of this important production process, which has an impact on national food security, in addition to facing the steady increase in the costs of importing tomato seeds in particular vegetable crop seeds in general. Therefore, the main objective of the current study is to study plant age-related induced resistance (ARIR) against tomato yellow leaf curl virus (TYLCV) in tomato plants. Several research points were studied, respectively: first, the effect of plant age on resistance to TYLCV virus in tomato plants that is transmitted by whitefly. Second, the detection and identification of tomato yellow leaf curl virus (TYLCV) in seeds obtained from seedlings of different ages (35 and 90 days old). Third, study the behavior of the whitefly in terms of the number of eggs and larvae, the percentage of the number of infected plants that showed symptoms of infection with the virus, and its relationship to the age of the seedlings. The results of this study proved that the age of the plant is closely related to the ability of the plant to withstand infection with the tomato yellow leaf curl virus (TYLCV). The DNA of the tomato yellow leaf curl virus (TYLCV) was identified from a sample of seeds obtained from plants obtained from 35-day-old seedlings. On the contrary, the DNA of tomato yellow leaf curl virus (TYLCV) was not detected in the seed sample obtained from plants produced from 90-day-old seedlings that were cultivated and adapted inside the nursery. The results also showed that in both protocols, using or without insecticides did not prevent the white fly from laying eggs and producing larvae on the plants. The increase was also gradual in the numbers of eggs and larvae of the white fly, as this activity peaked in the third week of transferring the seedlings to the open field, then those numbers decreased after the third week. This study also demonstrated the effect of positive seedling age (90 days old) on morphological traits related to vegetative growth, fruit production, and seed yield. Among the important benefits obtained was the ability to obtain seeds free of TYLCV in tomato plants, as well as the ability to remove nursery plants that showed early symptoms of the virus, and thus reduce the economic losses caused by the whitefly through the spread of the virus in the open fields.
22
Mugiira, R. B., S. S. Liu, and X. Zhou. "Tomato yellow leaf curl virus and Tomato leaf curl Taiwan virus Invade South-east Coast of China." Journal of Phytopathology 156, no. 4 (2008): 217–21. http://dx.doi.org/10.1111/j.1439-0434.2007.01345.x.
Full text
23
Elbaz, Mounira, Monaam Timoumi, and Peter Hanson. "Behavior of new entries and developed tomato hybrids carrying Ty-2 genes." Tunisian Journal of Plant Protection 17, no. 1 (2022): 1–14. http://dx.doi.org/10.52543/tjpp.17.1.1.
Full textAbstract:
Tomato yellow leaf curl disease (TYLCD) is a serious problem hampering tomato production worldwide. In the Mediterranean Basin, disease incidence and severity are higher in the dry season increasing whitefly (Bemisia tabaci) populations. Effectiveness of resistance to Tomato yellow leaf curl virus (TYLCV) depends on both tomato host resistance and TYLCV complex species. So far, six different Ty tomato resistance genes have been identified. Two main TYLCV complex species, Tomato yellow leaf curl virus-Israel (TYLCV-Is) and Tomato yellow leaf curl Sardinia virus (TYLCSV), have been identified in Tunisia. The present work aimed to evaluate entries heterozygous for Ty-2 gene to help predict hybrid performance. Two tomato entries homozygous for the Ty-2 TYLCV resistance gene, one tomato hybrid homozygous for Ty-2 and two heterozygous hybrids were included, besides two susceptible tomato entries. Resistance response to TYLCD was recorded based on disease incidence and severity levels. Data analysis was performed according to presence/absence of Ty-2 gene and taking into account homozygosity and heterozygosity of Ty-2. Generalized linear model analysis was applied to check significance of individual factors' effects (i.e. effect of tomato entries or tomato groups of entries based on presence or absence of homozygous/heterozygous Ty-2 gene, block unit within the field trial and the year of the trial) on the dependent variables (disease incidence and severity). Further multicomparison tests gave evidence on significant effect of Ty-2 homozygous gene tomato entries on TYLCD incidence and severity levels. The results were discussed with special focus on the relevance use of heterozygous hybrid tomato varieties.
24
Wu, J. B., F. M. Dai, and X. P. Zhou. "First Report of Tomato yellow leaf curl virus in China." Plant Disease 90, no. 10 (2006): 1359. http://dx.doi.org/10.1094/pd-90-1359c.
Full textAbstract:
Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (2). In China, however, there has as yet been no report of this virus, although other begomoviruses have been reported infecting tomato (1,3). A yellow mosaic disease was observed on tomato with 90% disease incidence during March 2006 in fields of Sunqiao, Shanghai Province, China. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) tests indicated that tomato plants were not infected by Tomato mosaic virus or Cucumber mosaic virus. Tomato plants were found to be infested with Bemisia tabaci, suggesting a begomovirus etiology. The disease agent was transmitted to tomato by whiteflies and produced yellow mosaic and stunting symptoms that were identical to those observed in the field. Total DNA was isolated from eight collected leaf samples. Polymerase chain reaction (PCR) was performed with begomovirus degenerate primers PA and PB (3), and an amplicon of the expected size (~500 bp) was obtained in all eight samples but not from healthy leaf samples. The PCR products from two samples (SH1 and SH2) were cloned and sequenced. All residues in the sequences were confirmed by comparison of duplicate clones. Alignment of the sequences showed that they shared 97.4% nucleotide sequence identity (GenBank Accession No. AM282874–75), suggesting that they were infected by an identical virus. Overlapping primers Full/F (5′-AGCCCAATACATTGGGCC ACGA-3′) and Full/R (5′-CGTAAGTTTCCTCAACGGACTGC-3′) were then designed to amplify the full length DNA-A of SH2. The sequence was determined to be 2,781 nucleotides long (GenBank Accession No. AM282874). A comparison with other begomoviruses shows SH2 DNA-A has the highest nucleotide sequence identity (99.8%) with TYLCV isolate Tosa from Japan (GenBank Accession No. AB192966). The above results indicate that the virus associated with yellow mosaic disease of tomato in Shanghai is an isolate of TYLCV. To our knowledge, this is the first report of TYLCV in China and the first report of a begomovirus in Shanghai. References: (1) X. F. Cui et al. J. Virol. 78:13966, 2004. (2) E. Moriones and J. Navas-Castillo. Virus Res. 71:123, 2000. (3) Z. H. Li et al. Arch. Virol. 149:1721, 2004.
25
Melzer, M. J., D. Y. Ogata, S. K. Fukuda, et al. "First Report of Tomato yellow leaf curl virus in Hawaii." Plant Disease 94, no. 5 (2010): 641. http://dx.doi.org/10.1094/pdis-94-5-0641b.
Full textAbstract:
Tomato yellow leaf curl disease, caused by the begomovirus Tomato yellow leaf curl virus (TYLCV; family Geminiviridae), is an economically important disease of tomato (Solanum lycopersicum L.) that can be very destructive in tropical and subtropical regions (1). In October 2009, tomato plants showing stunted new growth, interveinal chlorosis, and upward curling of leaf margins were reported by a residential gardener in Wailuku, on the island of Maui. Similar symptoms were observed in approximately 200 tomato plants at a University of Hawaii research farm in Poamoho, on the island of Oahu in November 2009. The similarity between these symptoms and those of tomato yellow leaf curl disease and the presence of whiteflies (Bemisia spp.), the vector of TYLCV, suggested the causal agent was a geminivirus such as TYLCV. Total nucleic acids were extracted from a tomato plant sample from Wailuku and Poamoho and used in a PCR assay with degenerate primers PAR1c715 and PAL1v1978 for geminivirus detection (4). The ~1.5-kbp amplicon expected to be produced from a geminivirus template was generated from the symptomatic tomato plant samples but not from a greenhouse-grown control tomato plant. The amplicons were cloned by the pGEM-T Easy vector (Promega, Madison, WI). Three clones from each sample were sequenced, revealing 97 to 99% nucleotide identity to TYLCV sequences in GenBank and a 98.9% nucleotide identity between the Wailuku (Accession No. GU322424) and Poamoho (Accession No. GU322423) isolates. A multiplex PCR assay for the detection and discrimination between the IL and Mld clades of TYLCV was also performed on these isolates (2). A ~0.8-kbp amplicon was generated from both isolates confirming the presence of TYLCV and their inclusion into the TYLCV-IL clade (2). Seven symptomatic and three asymptomatic tomato plant samples from Poamoho were tested for TYLCV using a squash-blot hybridization assay (3) utilizing a digoxigenin-labeled probe derived from the ~1.5-kbp PCR amplicon. All symptomatic tomato plants and one asymptomatic tomato plant were found to be infected with TYLCV. How the virus entered Hawaii and how long it has been present is unknown. The most plausible route is through infected plant material such as an asymptomatic alternative host rather than viruliferous whiteflies. It appears TYLCV is not a recent introduction into Hawaii since the Wailuku gardener observed similar disease symptoms for a few years before submitting samples for testing. In January 2010, TYLCV was also detected in two commercial tomato farms on Oahu, posing a serious threat to the state's $10 million annual tomato crop. References: (1) H. Czosnek and H. Laterrot. Arch. Virol. 142:1392, 1997. (2) P. Lefeuvre et al. J. Virol. Methods 144:165, 2007. (3) N. Navot et al. Phytopathology 79:562, 1989. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.
26
Blawid, R., D. T. Van, and E. Maiss. "Transreplication of a Tomato yellow leaf curl Thailand virus DNA-B and replication of a DNAß component by Tomato leaf curl Vietnam virus and Tomato yellow leaf curl Vietnam virus." Virus Research 136, no. 1-2 (2008): 107–17. http://dx.doi.org/10.1016/j.virusres.2008.04.025.
Full text
27
Gunaeni, Neni, and Eti Purwati. "Uji Ketahanan terhadap Tomato Yellow Leaf Curl Virus pada Beberapa Galur Tomat." Jurnal Hortikultura 23, no. 1 (2013): 65. http://dx.doi.org/10.21082/jhort.v23n1.2013.p65-71.
Full textAbstract:
Infeksi virus tomato yellow leaf curl virus (TYLCV) merupakan salah satu penyebab rendahnya produksi tomat di Indonesia. TYLCV termasuk ke dalam kelompok Gemini virus yang ditularkan oleh kutukebul (whitefly = Bemisia tabaci). Pengendalian virus TYLCV yang aman dan menguntungkan ialah dengan penggunaan varietas tahan yang merupakan salah satu cara pengendalian hayati penyakit virus. Cara ini mempunyai kelebihan dibandingkan pengendalian menggunakan pestisida dan kultur teknis. Penelitian bertujuan untuk mengetahui tingkat ketahanan 30 galur tomat terhadap virus TYLCV. Penelitian dilakukan di Rumah Kasa Balai Penelitian Tanaman Sayuran di Lembang pada ketinggian 1250 m dpl.. Penelitian dilakukan dari Bulan Agustus sampai dengan Desember 2008. Penelitian menggunakan rancangan acak kelompok yang diulang tiga kali. Hasil penelitian menunjukkan bahwa tiga galur tomat termasuk ke dalam kelompok agak tahan (moderate resistance) yaitu Mirah, 5048, dan 1927 dengan intensitas serangan virus berkisar 11,85–18,98%. Delapan galur tomat termasuk ke dalam kelompok agak rentan (moderate susceptible) yaitu 1176, 823, CL-6064, 1941, 2208, 4377, 4507, dan 1184 dengan intensitas serangan virus berkisar antara 20,55–29,81%. Empat belas galur tomat termasuk ke dalam kelompok rentan (susceptible) yaitu CLN 2026 – 3, CLN – 399, LV 3644, Oval, 5016, 1450, 1923, 1426, 3075, 2204, 4574, 2245, 4968, dan 4491 dengan intensitas serangan virus berkisar 30,92–49,94%. Lima galur tomat termasuk ke dalam kelompok sangat rentan (highly susceptible) yaitu 1217, TKU, 4444, 5014, dan PETO#86 dengan intensitas serangan virus berkisar 51,85–69,14%. Virus TYLCV berpengaruh terhadap pertumbuhan tanaman dan bobot buah tomat.
28
Ara, MR, MMH Masud, and AM Akanda. "Detection of Plant Viruses in Some Ornamental Plants That Act as Alternate Hosts." Agriculturists 10, no. 2 (2012): 46–54. http://dx.doi.org/10.3329/agric.v10i2.13141.
Full textAbstract:
A study was conducted at the Bangabandhu Sheikh Mujibur Rahman Agricultural University (BSMRAU), Salna, Gazipur to detect virus infecting ornamental plants. Enzyme-linked Immunosorbant Assay (ELISA) and symptomalogy were used for detection. Five viruses namely TPVV (Tomato Purple Vein Virus), CMV-Y (Cucumber Mosaic Virus-Y), OYVCMV (Okra Yellow Vein clearing Mosaic Virus), MYMV (Mung bean Yellow Mosaic Virus), TYLCV (Tomato Yellow Leaf Curl Virus) were detected on Tagetes erecta (Marigold), Salvia splendens (Salvia), Dahlia hybrida (Dahlia), Helichrysum bracteatum (Straw flower), Impatiens balsamina (Garden balsam). CMV-Y caused mosaic of Dahlia and Leaf Curl of Marigold. MYMV caused Yellow Mosaic of Dahlia hybrid, while TYLCV caused mosaic of Helichrysum bracteatum. OYVCMV produced leaf chlorosis on Salvia splendens, and chlorotic spots on Impatiens balsamina. TPVV caused purple leaf on Tagetes erecta DOI: http://dx.doi.org/10.3329/agric.v10i2.13141 The Agriculturists 2012; 10(2) 46-54
29
Huang, Ya-Yu, Wei-Hua Li, Kyeong-Yeoll Lee, Wen-Shi Tsai, and Chi-Wei Tsai. "Effects of Acquisition Time and Viral Load of Source Plants on Infections of Two Tomato Begomoviruses in Bemisia tabaci." Agriculture 15, no. 11 (2025): 1195. https://doi.org/10.3390/agriculture15111195.
Full textAbstract:
Tomato yellow leaf curl disease poses one of the most severe threats to tomato production worldwide. This disease is associated with a group of closely related tomato yellow leaf curl viruses. These viruses can be transmitted by the sweet potato whitefly (Bemisia tabaci) in a persistent-circulative mode. Virus particles can infect the midgut and filter chamber of whiteflies feeding on infected plants, circulate in the hemolymph, and eventually infect the primary salivary gland (PSG) of whiteflies. Later, the whiteflies feed on healthy plants, and viral particles are introduced into the plants through their saliva. Virus–vector interactions play a crucial role in the efficiency and dynamics of virus transmission. In this study, we assessed the effects of the acquisition time and viral load of source plants on infections of two tomato begomoviruses, tomato yellow leaf curl Thailand virus (TYLCTHV) and tomato leaf curl Taiwan virus (ToLCTV), in B. tabaci Middle East–Asia Minor 1. We found that more viruses were acquired and accumulated in the whitefly midgut and PSG before reaching a plateau when the acquisition time increased and when the source plant had a higher viral load. The midgut and PSG acquired and accumulated more TYLCTHV than ToLCTV with the same acquisition time and regardless of the viral loads in coinfected source plants. These results not only help us to understand virus–vector interactions but also help in developing integrated disease management strategies.
30
Monci, F., J. Navas-Castillo, and E. Moriones. "Evidence of a Naturally Occurring Recombinant Between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in Spain." Plant Disease 85, no. 12 (2001): 1289. http://dx.doi.org/10.1094/pdis.2001.85.12.1289a.
Full textAbstract:
Tomato yellow leaf curl virus (TYLCV, formerly TYLCV-Is) and Tomato yellow leaf curl Sardinia virus (TYLCSV, formerly TYLCV-Sar) are geminivirus species of the genus Begomovirus that cause the disease known as tomato yellow leaf curl. In Spain, TYLCV and TYLCSV have coexisted in field and greenhouse tomato (Lycopersicon esculentum) crops since 1996 (2). TYLCV is also the causal agent of the leaf crumple disease of common bean (Phaseolus vulgaris) (1), a species that TYLCSV is unable to infect (2). Analysis of field samples from common bean plants affected by leaf crumple disease collected in Almería (southeastern Spain) during 1999 showed that, unexpectedly, several samples hybridized with TYLCV- and TYLCSV-specific probes prepared to the intergenic region (IR) as previously described (1). Polymerase chain reactions (PCR) performed with total nucleic acids extracted from one of these samples (ES421/99) using primer pairs specific to the IR of TYLCV (MA-30/MA-31) or TYLCSV (MA-14/MA-15) (1) gave no amplification product. However, the combination of MA-30 (5′ end of TYLCV IR) and MA-15 (3′ end of TYLCSV IR) produced a PCR DNA product of the expected size (351 bp). Direct DNA sequencing of this product (GenBank Accession No. AF401478) indicated the presence of a chimeric IR in ES421/99. Comparison of the obtained sequence with those available for isolates reported from Spain showed that the 5′ side (149 nt) from the stem-loop structure conserved in the IR of all geminiviruses was 99% identical to the corresponding region of TYLCV (GenBank Accession No. AF071228) and only 62% identical to TYLCSV (GenBank Accession No. Z25751). In contrast, the 3′ side (124 nt) from the stem-loop was 98% identical to the corresponding region of TYLCSV and only 57% identical to TYLCV. The 33-nt region involved in the stem-loop was 100% identical to TYLCV and showed one nucleotide change in the loop with respect to TYLCSV. Therefore, this DNA sequence data showed evidence of the occurrence in ES421/99 of a natural recombination between TYLCV and TYLCSV. The biological and epidemiological consequences of the presence of this new interspecific recombinant have yet to be determined. References: (1) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (2) S. Sánchez-Campos et al. Phytopathology 89:1038, 1999.
31
Khan, A. J., S. Akhtar, A. K. Singh, and R. W. Briddon. "A Distinct Strain of Tomato leaf curl Sudan virus Causes Tomato Leaf Curl Disease in Oman." Plant Disease 97, no. 11 (2013): 1396–402. http://dx.doi.org/10.1094/pdis-02-13-0210-re.
Full textAbstract:
Tomato leaf curl disease (ToLCD) is a significant constraint for tomato production in the Sultanate of Oman. The disease in the north of the country has previously been shown to be caused by the monopartite begomoviruses (family Geminiviridae) Tomato yellow leaf curl virus and Tomato leaf curl Oman virus. Many tomato plants infected with these two viruses were also found to harbor a symptom enhancing betasatellite. Here an analysis of a virus isolated from tomato exhibiting ToLCD symptoms originating from south and central Oman is reported. Three clones of a monopartite begomovirus were obtained. One of the clones was shown to be infectious to tomato and Nicotiana benthamiana and to induce symptoms typical of ToLCD. Analysis of the cloned sequences show them to correspond to isolates of Tomato leaf curl Sudan virus (ToLCSDV), a virus that occurs in Sudan and Yemen. However, the sequences showed less than 93% nucleotide sequence identity to previously characterized ToLCSDV isolates, indicating that the viruses represent a distinct strain of the species, for which we propose the name “Oman” strain (ToLCSDV-OM). Closer analysis of the sequences showed them to differ from their closest relative, the “Tobacco” strain of ToLCSDV originating from Yemen, in three regions of the genome. This suggests that the divergence of the “Oman” and “Tobacco” strains has occurred due to recombination. Surprisingly, ToLCSDV-OM was not found to be associated with a betasatellite, even though the isolates of the other ToLCSDV strains have been shown to be. The significance of these findings and the possible reasons for the distinct geographic distributions of the tomato-infecting begomoviruses within Oman are discussed.
32
Valverde, R. A., P. Lotrakul, A. D. Landry, and J. E. Boudreaux. "First Report of Tomato yellow leaf curl virus in Louisiana." Plant Disease 85, no. 2 (2001): 230. http://dx.doi.org/10.1094/pdis.2001.85.2.230d.
Full textAbstract:
Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.
33
Ingram, D. M., and A. Henn. "First Report of Tomato yellow leaf curl virus in Mississippi." Plant Disease 85, no. 12 (2001): 1287. http://dx.doi.org/10.1094/pdis.2001.85.12.1287c.
Full textAbstract:
Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.
34
Kon, Tatsuya, Sri H. Hidayat, Shu Hase, Hideki Takahashi та Masato Ikegami. "The Natural Occurrence of Two Distinct Begomoviruses Associated with DNAβ and a Recombinant DNA in a Tomato Plant from Indonesia". Phytopathology® 96, № 5 (2006): 517–25. http://dx.doi.org/10.1094/phyto-96-0517.
Full textAbstract:
Two begomoviruses (Java virus-1 and Java virus-2), two satellite DNAs (DNAβ01 and DNAβ02), and a recombinant DNA (recDNA) were cloned from a single tomato plant from Indonesia with leaf curl symptoms, and the role of these satellite DNAs in the etiology of begomovirus disease was investigated. The genome organizations of the two viruses were similar to those of other Old World monopartite begomoviruses. Comparison of the sequences with other begomoviruses revealed that Java virus-1 was a newly described virus for which the name Tomato leaf curl Java virus (ToLCJAV) is proposed. Java virus-2 was a strain of Ageratum yellow vein virus (AYVV) (AYVV-[Java]). ToLCJAV or AYVV-[Java] alone did not induce leaf curl symptoms in tomato plants. However, in the presence of DNAβ02, both ToLCJAV and AYVV-[Java] induced leaf curl symptoms in tomato plants. In the presence of DNAβ01, these viruses induced mild leaf curl symptoms in tomato plants. The recDNA had a chimeric sequence, which arose from recombination among ToLCJAV, AYVV-[Java], DNAβ01, and DNAβ02; it was replicated only in the presence of AYVV-[Java] in tomato plants.
35
Dai, F. M., R. Zeng, W. J. Chen, and J. P. Lu. "First Report of Tomato yellow leaf curl virus Infecting Cowpea in China." Plant Disease 95, no. 3 (2011): 362. http://dx.doi.org/10.1094/pdis-08-10-0608.
Full textAbstract:
Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (1). In China, this virus was first found in 2006 on tomato in Shanghai (2). In October 2008, chlorotic yellow leaves of cowpea (Vigna sinensis) were observed in Qingpu, Shanghai, China with 15 to 20% incidence in plants in high tunnels. Large populations of whiteflies were observed in association with the diseased cowpea. The disease agent was transmitted to cowpea (and tomato) by whiteflies, which resulted in chlorotic yellow leaves on cowpea (yellow leaf curl symptoms on tomato) that were identical to those observed in the field. On the basis of the suspected insect vector, symptomology, and severe epidemics of tomato yellow leaf curl disease (TYLCD) in Shanghai in recent years, Tomato yellow leaf curl virus was suspected as the causal agent. Total DNA was extracted from four symptomatic cowpea samples. PCR was performed with specific primers V416 (5′-CAAGGCACAAACAAGCGACG-3′) and C1287 (5′-CTCAACTTCCGAATTTGGACGAC-3′) to amplify a 872-bp DNA fragment of the viral coat protein (CP) gene and an amplicon of the expected size was obtained in all four samples but not from healthy leaf samples. The PCR products were sequenced and the sequences were identical among samples. Primers TYLCV-F (5′-CAGGAGGCAGCCAAGTATGAG-3′) and TYLCV-R (5′-ACTAATGCCTGTTCYTTCATTCC-3′) (Y = C or T/U) were designed on the basis of the sequence (Accession No. HM804856) and reported (Accession No. FM163463) CP gene to amplify the full-length viral DNA of cowpea isolate (CN:SH:Cowpea:08). The sequence was determined to be 2,781 nucleotides long (Accession No. GU434143). A comparison of the sequence with those in GenBank shows that the cowpea isolate has the highest nucleotide sequence identity (99%) with TYLCV isolate XH2 from tomato in Xinghua, Jiangsu, China (Accession No. GU111505). To our knowledge, this is the first report of TYLCV infecting cowpea in China and also the first report in the world. References: (1) H. Czosnek and H. Laterrot. Arch. Virol. 142:1391, 1997. (2) J. B. Wu et al. Plant Dis. 90:1359, 2006.
36
Shteinberg, Moshik, Ritesh Mishra, Ghandi Anfoka, et al. "Tomato Yellow Leaf Curl Virus (TYLCV) Promotes Plant Tolerance to Drought." Cells 10, no. 11 (2021): 2875. http://dx.doi.org/10.3390/cells10112875.
Full textAbstract:
A growing body of research points to a positive interplay between viruses and plants. Tomato yellow curl virus (TYLCV) is able to protect tomato host plants against extreme drought. To envisage the use of virus protective capacity in agriculture, TYLCV-resistant tomato lines have to be infected first with the virus before planting. Such virus-resistant tomato plants contain virus amounts that do not cause disease symptoms, growth inhibition, or yield loss, but are sufficient to modify the metabolism of the plant, resulting in improved tolerance to drought. This phenomenon is based on the TYLCV-dependent stabilization of amounts of key osmoprotectants induced by drought (soluble sugars, amino acids, and proteins). Although in infected TYLCV-susceptible tomatoes, stress markers also show an enhanced stability, in infected TYLCV-resistant plants, water balance and osmolyte homeostasis reach particularly high levels. These tomato plants survive long periods of time during water withholding. However, after recovery to normal irrigation, they produce fruits which are not exposed to drought, similarly to the control plants. Using these features, it might be possible to cultivate TYLCV-resistant plants during seasons characterized by water scarcity.
37
Kasrawi, M. A., and A. Mansour. "BREEDING TOMATOES RESISTANT TO TOMATO YELLOW LEAF CURL VIRUS." HortScience 28, no. 5 (1993): 506c—506. http://dx.doi.org/10.21273/hortsci.28.5.506c.
Full textAbstract:
Over a 2-year period, disease incidence and severity caused by tomato-yellow-leaf-curl-virus (TYLCV) in lines of tomato (Lycopersicon esculentum) derived from interspecific hybridization with wild species of L. pimpinellifoliuim, L. hirsutum and L. peruvianum ranged from non to intermediate. The average fruit weight of these lines ranged from 25 to 90 grams. Crosses between TYLCV-resistant lines derived from the same wild species produced progenies similar to their parents in the level of resistance. However, progenies of 2-wild species combination showed little higher in levels of resistance than their parents. Analysis of F1, F2 and backcross populations from crosses of the most promising TYLCV-resistant lines with the susceptible cultivar showed that resistance appeared to be incomplete dominant and controlled by few genes.
38
Morilla, G., D. Janssen, S. García-Andrés, E. Moriones, I. M. Cuadrado, and E. R. Bejarano. "Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus." Phytopathology® 95, no. 9 (2005): 1089–97. http://dx.doi.org/10.1094/phyto-95-1089.
Full textAbstract:
Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.
39
Kashina, B. D., R. B. Mabagala, and A. A. Mpunni. "First report of Ageratum conyzoides L. and Sida acuta Burm F. as new weed hosts of Tomato yellow leaf curl Tanzania virus." Plant Protection Science 39, No. 1 (2011): 18–22. http://dx.doi.org/10.17221/3822-pps.
Full textAbstract:
Tomato farms in the Dodoma region of Tanzania where a high incidence of Tomato yellow leaf curl Tanzania virus has been reported were visited to survey for weed hosts. Weeds exhibiting symptoms of infection by the virus were collected and identified. Lysates of leaf samples of the weed species were prepared and clarified by centrifugation. The clarified sap was dotted on nylon membranes and hybridised with a DIG-labelled probe. The putative viral DNA was extracted from the samples by phenol-chloroform procedures, and amplified by polymerase chain reaction methods using a primer pair designed to amplify a 1.2 kb fragment of the virus. Strong hybridisation signals were observed when sap from Ageratum conyzoides and Sida acuta were hybridised to the labelled probe. Similarly, the expected fragment size was obtained after amplification of DNA from both samples. It is concluded that these weeds are new hosts of Tomato yellow leaf curl Tanzania virus. An extensive search for yet undiscovered weed hosts is advocated, while the practice of farm sanitation is encouraged to eliminate reservoirs of the virus and vector. &nbsp;
40
Davino, Salvatore, Laura Miozzi, Stefano Panno, Luis Rubio, Mario Davino, and Gian Paolo Accotto. "Recombination profiles between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in laboratory and field conditions: evolutionary and taxonomic implications." Journal of General Virology 93, no. 12 (2012): 2712–17. http://dx.doi.org/10.1099/vir.0.045773-0.
Full textAbstract:
Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus have co-existed in Italian tomato crops since 2002 and have reached equilibrium, with plants hosting molecules of both species plus their recombinants being the most frequent case. Recombination events are studied in field samples, as well as in experimental co-infections, when recombinants were detected as early as 45 days following inoculation. In both conditions, recombination breakpoints were essentially absent in regions corresponding to ORFs V2, CP and C4, whereas density was highest in the 3′-terminal portion of ORF C3, next to the region where the two transcription units co-terminate. The vast majority of breakpoints were mapped at antisense ORFs, supporting speculation that the rolling-circle replication mechanism, and the existence of sense and antisense ORFs on the circular genome, may result in clashes between replication and transcription complexes.
41
LI, Chang-Bao, Yan-Ling CUI, Li-Ying ZHANG, and Chuan-You LI. "Molecular detection of tomato yellow leaf curl virus (TYLCV)." Hereditas (Beijing) 34, no. 3 (2012): 366–70. http://dx.doi.org/10.3724/sp.j.1005.2012.00366.
Full text
42
Czosnek, H. "Isolation of Tomato Yellow Leaf Curl Virus, a Geminivirus." Phytopathology 78, no. 5 (1988): 508. http://dx.doi.org/10.1094/phyto-78-508.
Full text
43
Prasad, Ashish, Namisha Sharma, Gunaseelen Hari-Gowthem, Mehanathan Muthamilarasan, and Manoj Prasad. "Tomato Yellow Leaf Curl Virus: Impact, Challenges, and Management." Trends in Plant Science 25, no. 9 (2020): 897–911. http://dx.doi.org/10.1016/j.tplants.2020.03.015.
Full text
44
Mabvakure, Batsirai, Darren P. Martin, Simona Kraberger, et al. "Ongoing geographical spread of Tomato yellow leaf curl virus." Virology 498 (November 2016): 257–64. http://dx.doi.org/10.1016/j.virol.2016.08.033.
Full text
45
Barrera, Janet, and Mariecel Fuentes. "The Effects of Different Fertilizer on the Resistance of Tomato in Tomato Yellow Leaf Curl Virus (TYLCV)." International Journal of Multidisciplinary: Applied Business and Education Research 3, no. 7 (2022): 1244–48. http://dx.doi.org/10.11594/ijmaber.03.07.03.
Full textAbstract:
The study aims to determine the resistance and evaluate the cost effectiveness of different organic fertilizer in tomato against Tomato Yellow Leaf Curl Virus (TYLCV). Four types of treatments were used, namely: Canaan Organic Fertilizer, Idol Organic Fertilizer, Synthetic Fertilizer and no fertilizer applied as control group. This study found that Treatment 4 (Synthetic Fertilizer) shows the highest height, least symptoms of TYLCV (yellowing and curling of leaves), and highest yield of tomatoes among the other treatments. Tomatoes applied with different fertilizers had no effect on the resistance against the Tomato yellow leaf curl virus. Once B. tabacci is present on the tomato host, there is a great chance of disease incidence.
46
Ling, K. S., A. M. Simmons, R. L. Hassell, A. P. Keinath, and J. E. Polston. "First Report of Tomato yellow leaf curl virus in South Carolina." Plant Disease 90, no. 3 (2006): 379. http://dx.doi.org/10.1094/pd-90-0379c.
Full textAbstract:
Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.
47
Pico, B., M. Ferriol, M. J. D. iez, and F. Nuez. "Developing tomato breeding lines resistant to tomato yellow leaf curl virus." Plant Breeding 118, no. 6 (1999): 537–42. http://dx.doi.org/10.1046/j.1439-0523.1999.00427.x.
Full text
48
Kasrawi, M. A., and A. Mansour. "Genetics of resistant to tomato yellow leaf curl virus in tomato." Journal of Horticultural Science 69, no. 6 (1994): 1095–100. http://dx.doi.org/10.1080/00221589.1994.11516550.
Full text
49
Sacco Botto, Camilla, Slavica Matić, Amedeo Moine, et al. "Tomato Yellow Leaf Curl Sardinia Virus Increases Drought Tolerance of Tomato." International Journal of Molecular Sciences 24, no. 3 (2023): 2893. http://dx.doi.org/10.3390/ijms24032893.
Full textAbstract:
Drought stress is one of the major physiological stress factors that adversely affect agricultural production, altering critical features of plant growth and metabolism. Plants can be subjected simultaneously to abiotic and biotic stresses, such as drought and viral infections. Rewarding effects provided by viruses on the ability of host plants to endure abiotic stresses have been reported. Recently, begomoviruses causing the tomato yellow leaf curl disease in tomatoes were shown to increase heat and drought tolerance. However, biological bases underlying the induced drought tolerance need further elucidation, particularly in the case of tomato plants. In this work, tomato plants infected by the tomato yellow leaf curl Sardinia virus (TYLCSV) were subjected to severe drought stress, followed by recovery. Morphological traits, water potential, and hormone contents were measured in leaves together with molecular analysis of stress-responsive and hormone metabolism-related genes. Wilting symptoms appeared three days later in TYLCSV-infected plants compared to healthy controls and post-rehydration recovery was faster (2 vs. 4 days, respectively). Our study contributes new insights into the impact of viruses on the plant’s adaptability to environmental stresses. On a broader perspective, such information could have important practical implications for managing the effects of climate change on agroecosystems.
50
Wu, Hsin-Yu, Wei-Hua Li, Sung-Hsia Weng, Wen-Shi Tsai, and Chi-Wei Tsai. "Differential Effects of Two Tomato Begomoviruses on the Life History and Feeding Preference of Bemisia tabaci." Insects 14, no. 11 (2023): 870. http://dx.doi.org/10.3390/insects14110870.
Full textAbstract:
Tomato yellow leaf curl disease, caused by a group of closely related tomato yellow leaf curl viruses, is a major threat to tomato cultivation worldwide. These viruses are primarily transmitted by the sweet potato whitefly (Bemisia tabaci) in a persistent-circulative manner, wherein the virus circulates in the body of B. tabaci and infects its tissues. The complex relationship between viruses and whiteflies significantly influences virus transmission, with studies showing varying effects of the former on the life history and feeding preference of the latter. Whether these effects are direct or indirect, and whether they are negative, neutral, or positive, appears to depend on the specific interactions between virus and whitefly species. The tomato yellow leaf curl Thailand virus (TYLCTHV) and the tomato leaf curl Taiwan virus (ToLCTV) are two prevalent begomoviruses in fields in Taiwan. This study examined the direct and indirect effects of TYLCTHV and ToLCTV on the life history traits (longevity, fecundity, nymph survival, and nymph developmental time) and feeding preference of B. tabaci Middle East–Asia Minor 1 (MEAM1). The results revealed that TYLCTHV had no effects on these life history traits or the feeding preference of MEAM1 whiteflies. Although ToLCTV did not directly affect the longevity and fecundity of MEAM1 whiteflies, their fecundity and the nymph developmental time were negatively affected by feeding on ToLCTV-infected plants. In addition, ToLCTV infection also altered the feeding preference of MEAM1 whiteflies. The different effects of virus infection may contribute to the lower prevalence of ToLCTV compared to TYLCTHV in fields in Taiwan.