Acceder

Bibliografías temáticas / Cisplatin Biochemistry / Artículos de revistas

Siga este enlace para ver otros tipos de publicaciones sobre el tema: Cisplatin Biochemistry.

Artículos de revistas sobre el tema "Cisplatin Biochemistry"

Autor: Grafiati

Publicado: 4 de junio de 2021

Última modificación: 1 de febrero de 2022

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros

Elija tipo de fuente:

Consulte los 50 mejores artículos de revistas para su investigación sobre el tema "Cisplatin Biochemistry".

Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.

También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.

Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.

1

Elferink, F., W. J. van der Vijgh, I. Klein, and H. M. Pinedo. "Interaction of cisplatin and carboplatin with sodium thiosulfate: reaction rates and protein binding." Clinical Chemistry 32, no. 4 (1986): 641–45. http://dx.doi.org/10.1093/clinchem/32.4.641.

Texto completo

Resumen

Abstract Toxicity of cisplatin can be decreased by concomitant administration of sodium thiosulfate, which perhaps chemically inactivates this platinum compound. We studied the disappearance of cisplatin and carboplatin in aqueous solutions of thiosulfate at 37 degrees C by means of liquid chromatography. At initial concentrations that were similar to therapeutic concentrations in plasma, both drugs disappeared, with half-lives of 66 and 537 min for cisplatin and carboplatin, respectively. At higher thiosulfate concentrations, as found in urine, the respective half-lives were 3.7 and 33.8 min.

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Wang, Wenyu, Jihye Im, Soochi Kim, et al. "ROS-Induced SIRT2 Upregulation Contributes to Cisplatin Sensitivity in Ovarian Cancer." Antioxidants 9, no. 11 (2020): 1137. http://dx.doi.org/10.3390/antiox9111137.

Texto completo

Resumen

Cisplatin resistance remains a significant obstacle for improving the clinical outcome of ovarian cancer patients. Recent studies have demonstrated that cisplatin is an important inducer of intracellullar reactive oxygen species (ROS), triggering cancer cell death. Sirtuin 2 (SIRT2), a member of class III NAD+ dependent histone deacetylases (HDACs), has been reported to be involved in regulating cancer hallmarks including drug response. In this study, we aimed to identify the role of SIRT2 in oxidative stress and cisplatin response in cancer. Two ovarian cancer cell lines featuring different s

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

Fujimoto, T., H. Maeda, K. Kubo, et al. "Enhanced Anti-tumour Effect of Cisplatin with Low-voltage Electrochemotherapy in Hamster Oral Fibrosarcoma." Journal of International Medical Research 33, no. 5 (2005): 507–12. http://dx.doi.org/10.1177/147323000503300505.

Texto completo

Resumen

The aim of this study was to determine the effects of low-voltage electrochemotherapy with intraperitoneal cisplatin on hamster oral fibrosarcoma. Oral fibrosarcoma was transplanted sub-mucosally into the cheek pouch mucosa of 100 hamsters. After transplantation, the hamsters were randomly divided into four equal groups. These groups received no treatment (D-E-); 2 mg/kg body weight cisplatin treatment without electroporation (D+E-); electroporation without cisplatin treatment (D-E+);or 2 mg/kg body weight cisplatin treatment followed by electroporation (D+E+). Electrical pulse treatment toget

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Murray, Vincent. "Nucleosomes and Cisplatin." Chemistry & Biology 17, no. 12 (2010): 1271–72. http://dx.doi.org/10.1016/j.chembiol.2010.12.002.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Yi, Junyeong, Tae Su Kim, Jhang Ho Pak, and Jong Woo Chung. "Protective Effects of Glucose-Related Protein 78 and 94 on Cisplatin-Mediated Ototoxicity." Antioxidants 9, no. 8 (2020): 686. http://dx.doi.org/10.3390/antiox9080686.

Texto completo

Resumen

Cisplatin is a widely used chemotherapeutic drug for treating various solid tumors. Ototoxicity is a major dose-limiting side effect of cisplatin, which causes progressive and irreversible sensorineural hearing loss. Here, we examined the protective effects of glucose-related protein (GRP) 78 and 94, also identified as endoplasmic reticulum (ER) chaperone proteins, on cisplatin-induced ototoxicity. Treating murine auditory cells (HEI-OC1) with 25 μM cisplatin for 24 h increased cell death resulting from excessive intracellular reactive oxygen species (ROS) accumulation and caspase-involved apo

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Mapuskar, Kranti A., Emily J. Steinbach, Amira Zaher, et al. "Mitochondrial Superoxide Dismutase in Cisplatin-Induced Kidney Injury." Antioxidants 10, no. 9 (2021): 1329. http://dx.doi.org/10.3390/antiox10091329.

Texto completo

Resumen

Cisplatin is a chemotherapy agent commonly used to treat a wide variety of cancers. Despite the potential for both severe acute and chronic side effects, it remains a preferred therapeutic option for many malignancies due to its potent anti-tumor activity. Common cisplatin-associated side-effects include acute kidney injury (AKI) and chronic kidney disease (CKD). These renal injuries may cause delays and potentially cessation of cisplatin therapy and have long-term effects on renal function reserve. Thus, developing mechanism-based interventional strategies that minimize cisplatin-associated k

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Xing, Jing-Jing, Jin-Gang Hou, Ying Liu, et al. "Supplementation of Saponins from Leaves of Panax quinquefolius Mitigates Cisplatin-Evoked Cardiotoxicity via Inhibiting Oxidative Stress-Associated Inflammation and Apoptosis in Mice." Antioxidants 8, no. 9 (2019): 347. http://dx.doi.org/10.3390/antiox8090347.

Texto completo

Resumen

Background: Although kidney injury caused by cisplatin has attracted much attention, cisplatin-induced cardiotoxicity is elusive. Our previous studies have confirmed that saponins (ginsenosides) from Panax quinquefolius can effectively reduce acute renal injuries. Our current study aimed to identify the potential effects of saponins from leaves of P. quinquefolius (PQS) on cisplatin-evoked cardiotoxicity. Methods: Mice were intragastrically with PQS at the doses of 125 and 250 mg/kg daily for 15 days. The mice in cisplatin group and PQS + cisplatin groups received four times intraperitoneal in

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Kohda, Yuka, Yoshiko Kawai, Noriaki Iwamoto, et al. "Serum thymic factor, FTS, attenuates cisplatin nephrotoxicity by suppressing cisplatin-induced ERK activation." Biochemical Pharmacology 70, no. 9 (2005): 1408–16. http://dx.doi.org/10.1016/j.bcp.2005.08.002.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Rodríguez-Ulloa, Arielis, Yassel Ramos, Aniel Sánchez-Puente, et al. "The Combination of the CIGB-300 Anticancer Peptide and Cisplatin Modulates Proteins Related to Cell Survival, DNA Repair and Metastasis in a Lung Cancer Cell Line Model." Current Proteomics 16, no. 4 (2019): 338–49. http://dx.doi.org/10.2174/1570164616666190126104325.

Texto completo

Resumen

Background: CIGB-300 is a pro-apoptotic peptide that abrogates CK2-mediated phosphorylation, and can elicit synergistic interaction in vitro and in vivo when combined with certain anticancer drugs. Objective: The combination of CIGB-300 with cisplatin is studied through data mining and expressionbased proteomics to reveal the molecular basis of this interaction. Cisplatin resistance-associated proteins, which have also been reported as CK2 substrates, were first identified by bioinformatic analyses. Methods: Data from these analyses suggested that the cisplatin resistance phenotype could be di

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Bushau-Sprinkle, Adrienne M., Michelle T. Barati, Yuxuan Zheng, et al. "Na/H Exchange Regulatory Factor 1 Deficient Mice Show Evidence of Oxidative Stress and Altered Cisplatin Pharmacokinetics." Antioxidants 10, no. 7 (2021): 1036. http://dx.doi.org/10.3390/antiox10071036.

Texto completo

Resumen

(1) Background: One third of patients who receive cisplatin develop an acute kidney injury. We previously demonstrated the Na/H Exchange Regulatory Factor 1 (NHERF1) loss resulted in increased kidney enzyme activity of the pentose phosphate pathway and was associated with more severe cisplatin nephrotoxicity. We hypothesized that changes in proximal tubule biochemical pathways associated with NHERF1 loss alters renal metabolism of cisplatin or response to cisplatin, resulting in exacerbated nephrotoxicity. (2) Methods: 2–4 month-old male wild-type and NHERF1 knock out littermate mice were trea

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Dabrowski, Tomasz, and Bartlomiej Kwiatkowski. "Sensitivity of Vi phages III to gamma-radiation in the presence of cisplatin." Acta Biochimica Polonica 52, no. 2 (2005): 545–50. http://dx.doi.org/10.18388/abp.2005_3471.

Texto completo

Resumen

In this study we determined Vi bacteriophage III sensitivity to native cisplatin, gamma radiation ((60)Co) or to irradiated cisplatin, and checked the possibility of enhanced Vi bacteriophage III inactivation under combined exposure to cisplatin and gamma radiation. We used highly purified phage suspensions in 0.9% NaCl solution or phosphate-buffered saline. Phage suspensions were titrated using a double agar layer method. Our study implies that survival of Vi bacteriophage III shows an exponential inverse correlation with cisplatin concentration in the incubation medium and the time of phage

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Song, Lin, Zhilei Cui, and Xuejun Guo. "Comprehensive analysis of circular RNA expression profiles in cisplatin-resistant non-small cell lung cancer cell lines." Acta Biochimica et Biophysica Sinica 52, no. 9 (2020): 944–53. http://dx.doi.org/10.1093/abbs/gmaa085.

Texto completo

Resumen

Abstract Platinum-based drugs such as cisplatin are widely used in combination chemotherapy for non-small cell lung cancer (NSCLC) owing to their high clinical response rate; however, acquired resistance to cisplatin is eventually inevitable. Circular RNAs (circRNAs) are involved in the development of diverse types of cancers, but their connection to cisplatin-resistance in NSCLC has not been studied. In the present study, two cisplatin-resistant NSCLC cell lines (A549/DDP and PC9/DDP) were established by gradually increasing concentrations of cisplatin in the media. The resulting cell lines p

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Nanji, A. A., D. J. Stewart, and N. Z. Mikhael. "11 cisplatin induced hyperuricemia." Clinical Biochemistry 18, no. 3 (1985): 202. http://dx.doi.org/10.1016/s0009-9120(85)80121-1.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Sun, Tianyu, Jingge Zhang, Bo Deng, et al. "FOXO1 and FOXO3a sensitize non-small-cell lung cancer cells to cisplatin-induced apoptosis independent of Bim." Acta Biochimica et Biophysica Sinica 52, no. 12 (2020): 1348–59. http://dx.doi.org/10.1093/abbs/gmaa129.

Texto completo

Resumen

Abstract Low sensitivity to chemotherapy has been a major challenge in the treatment of non-small-cell lung cancer (NSCLC). It is of great clinical significance to discover its mechanisms to improve cell sensitivity to chemotherapeutic drugs. The forkhead box subfamily O (FOXO) transcriptional factors are downstream factors of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway and are reported to play pro-apoptotic roles in a variety of cells including NSCLC cells. But their roles and mechanisms in mediating cell response to chemotherapy remain to be discovered. We proposed

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

Garrido, Nuria, Acisclo Pérez-Martos, Mercedes Faro, et al. "Cisplatin-mediated impairment of mitochondrial DNA metabolism inversely correlates with glutathione levels." Biochemical Journal 414, no. 1 (2008): 93–102. http://dx.doi.org/10.1042/bj20071615.

Texto completo

Resumen

Cisplatin accumulates in mitochondria, which are a major target for this drug in cancer cells. Thus alterations in mitochondrial function have been implicated in cancer cell resistance to chemotherapeutic agents. Moreover, cisplatin toxic side effects seem to be associated with mitochondrial injury in vivo and in vitro. In order to clarify the potential effect of cisplatin in mtDNA (mitochondrial DNA) maintenance and expression, we have analysed rat liver mtDNA and mtRNA (mitochondrial RNA) synthesis as well as their stability under the influence of in vivo treatment or in vitro exposure to ci

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Zhang, Jiangnan, Tingting Zhao, Changyuan Wang, et al. "Catalpol-Induced AMPK Activation Alleviates Cisplatin-Induced Nephrotoxicity through the Mitochondrial-Dependent Pathway without Compromising Its Anticancer Properties." Oxidative Medicine and Cellular Longevity 2021 (January 15, 2021): 1–13. http://dx.doi.org/10.1155/2021/7467156.

Texto completo

Resumen

Nephrotoxicity is a common complication of cisplatin chemotherapy and, thus, limits the clinical application of cisplatin. In this work, the effects of catalpol (CAT), a bioactive ingredient extracted from Rehmannia glutinosa, on cisplatin-induced nephrotoxicity and antitumor efficacy were comprehensively investigated. Specifically, the protective effect of CAT on cisplatin-induced injury was explored in mice and HK-2 cells. In vivo, CAT administration strikingly suppressed cisplatin-induced renal dysfunction, morphology damage, apoptosis, and inflammation. In vitro, CAT induced activation of

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

Dolgova, Nataliya V., Sergiy Nokhrin, Corey H. Yu, Graham N. George, and Oleg Y. Dmitriev. "Copper chaperone Atox1 interacts with the metal-binding domain of Wilson's disease protein in cisplatin detoxification." Biochemical Journal 454, no. 1 (2013): 147–56. http://dx.doi.org/10.1042/bj20121656.

Texto completo

Resumen

Human copper transporters ATP7B (Wilson's disease protein) and ATP7A (Menkes' disease protein) have been implicated in tumour resistance to cisplatin, a widely used anticancer drug. Cisplatin binds to the copper-binding sites in the N-terminal domain of ATP7B, and this binding may be an essential step of cisplatin detoxification involving copper ATPases. In the present study, we demonstrate that cisplatin and a related platinum drug carboplatin produce the same adduct following reaction with MBD2 [metal-binding domain (repeat) 2], where platinum is bound to the side chains of the cysteine resi

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Liu, Hung-Ting, Tse-En Wang, Yu-Ting Hsu, et al. "Nanoparticulated Honokiol Mitigates Cisplatin-Induced Chronic Kidney Injury by Maintaining Mitochondria Antioxidant Capacity and Reducing Caspase 3-Associated Cellular Apoptosis." Antioxidants 8, no. 10 (2019): 466. http://dx.doi.org/10.3390/antiox8100466.

Texto completo

Resumen

Cisplatin is a potent anti-cancer drug, however, its accompanied organ-toxicity hampers its clinical applications. Cisplatin-associated kidney injury is known to result from its accumulation in the renal tubule with excessive generation of reactive oxygen species. In this study, we encapsulated honokiol, a natural lipophilic polyphenol constituent extracted from Magnolia officinalis into nano-sized liposomes (nanosome honokiol) and examined the in vivo countering effects on cisplatin-induced renal injury. We observed that 5 mg/kg body weight. nanosome honokiol was the lowest effective dosage t

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Manguinhas, Rita, Ana S. Fernandes, João G. Costa, et al. "Impact of the APE1 Redox Function Inhibitor E3330 in Non-Small Cell Lung Cancer Cells Exposed to Cisplatin: Increased Cytotoxicity and Impairment of Cell Migration and Invasion." Antioxidants 9, no. 6 (2020): 550. http://dx.doi.org/10.3390/antiox9060550.

Texto completo

Resumen

Elevated expression levels of the apurinic/apyrimidinic endonuclease 1 (APE1) have been correlated with the more aggressive phenotypes and poor prognosis of non-small cell lung cancer (NSCLC). This study aimed to assess the impact of the inhibition of the redox function of APE1 with E3330 either alone or in combination with cisplatin in NSCLC cells. For this purpose, complementary endpoints focusing on cell viability, apoptosis, cell cycle distribution, and migration/invasion were studied. Cisplatin decreased the viability of H1975 cells in a time- and concentration-dependent manner, with IC50

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

Mao, Pingping, Mary P. Hever, Lynne M. Niemaszyk, et al. "Serine/Threonine Kinase 17A Is a Novel p53 Target Gene and Modulator of Cisplatin Toxicity and Reactive Oxygen Species in Testicular Cancer Cells." Journal of Biological Chemistry 286, no. 22 (2011): 19381–91. http://dx.doi.org/10.1074/jbc.m111.218040.

Texto completo

Resumen

Testicular cancer is highly curable with cisplatin-based therapy, and testicular cancer-derived human embryonal carcinoma (EC) cells undergo a p53-dominant transcriptional response to cisplatin. In this study, we have discovered that a poorly characterized member of the death-associated protein family of serine/threonine kinases, STK17A (also called DRAK1), is a novel p53 target gene. Cisplatin-mediated induction of STK17A in the EC cell line NT2/D1 was prevented with p53 siRNA. Furthermore, STK17A was induced with cisplatin in HCT116 and MCF10A cells but to a much lesser extent in isogenic p5

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Dolgova, Nataliya V., Doug Olson, Svetlana Lutsenko, and Oleg Y. Dmitriev. "The soluble metal-binding domain of the copper transporter ATP7B binds and detoxifies cisplatin." Biochemical Journal 419, no. 1 (2009): 51–59. http://dx.doi.org/10.1042/bj20081359.

Texto completo

Resumen

Wilson disease ATPase (ATP7B) has been implicated in the resistance of cancer cells to cisplatin. Using a simple in vivo assay in bacterial culture, in the present study we demonstrate that ATP7B can confer resistance to cisplatin by sequestering the drug in its N-terminal metal-binding domain without active drug extrusion from the cell. Expression of a protein fragment containing four N-terminal MBRs (metal-binding repeats) of ATP7B (MBR1–4) protects cells from the toxic effects of cisplatin. One MBR1–4 molecule binds up to three cisplatin molecules at the copper-binding sites in the MBRs. Th

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Pasalic, Leonardo, Campbell Heather, Shane Thomas, and Vivien M. Chen. "Cisplatin Fails To Stimulate Production Of Reactive Oxygen Species and Release Of Neutrophil Extracellular Traps By Human Neutrophils In Vitro." Blood 122, no. 21 (2013): 4714. http://dx.doi.org/10.1182/blood.v122.21.4714.4714.

Texto completo

Resumen

Background Cisplatin is a commonly used antineoplastic agent for treatment of a broad range of cancers. Cisplatin-based treatment has been associated with a significant risk of venous thromboembolism. The mechanisms through which cisplatin contributes to a prothrombotic state remain unclear. Neutrophil extracellular traps (NETs) consist of web-like DNA–histone core decorated with granule proteins and are released from activated neutrophils in a process dependent on reactive oxygen species (ROS), in particular hypochlorous acid (HOCl). Recently, NETs have been shown to play an important role in

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Ferrarelli, Leslie K. "Synthetic lethality with cisplatin." Science Signaling 11, no. 544 (2018): eaav1294. http://dx.doi.org/10.1126/scisignal.aav1294.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Kumburovic, Igor, Dragica Selakovic, Tatjana Juric, et al. "Antioxidant Effects ofSatureja hortensisL. Attenuate the Anxiogenic Effect of Cisplatin in Rats." Oxidative Medicine and Cellular Longevity 2019 (July 29, 2019): 1–15. http://dx.doi.org/10.1155/2019/8307196.

Texto completo

Resumen

Numerous adverse effects of cisplatin-based therapy are usually accompanied by enhanced oxidative damage and cell apoptosis in various tissues. Even neurotoxic manifestations of cisplatin administration, such as the anxiogenic effect, appear along with the increased oxidative stress and apoptotic indicators in certain brain regions. Thirty-five Wistar albino male rats were divided into seven groups: control, cisplatin (received a single dose of cisplatin: 7.5 mg/kg), three groups with oral administration ofSatureja hortensisL. methanolic extract (SH) (low: 50 mg/kg, middle: 100 mg/kg, and high

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Kim, Ye-Ri, Tae-Jun Kwon, Un-Kyung Kim, In-Kyu Lee, Kyu-Yup Lee, and Jeong-In Baek. "Fursultiamine Prevents Drug-Induced Ototoxicity by Reducing Accumulation of Reactive Oxygen Species in Mouse Cochlea." Antioxidants 10, no. 10 (2021): 1526. http://dx.doi.org/10.3390/antiox10101526.

Texto completo

Resumen

Drug-induced hearing loss is a major type of acquired sensorineural hearing loss. Cisplatin and aminoglycoside antibiotics have been known to cause ototoxicity, and excessive accumulation of intracellular reactive oxygen species (ROS) are suggested as the common major pathology of cisplatin- and aminoglycoside antibiotics-induced ototoxicity. Fursultiamine, also called thiamine tetrahydrofurfuryl disulfide, is a thiamine disulfide derivative that may have antioxidant effects. To evaluate whether fursultiamine can prevent cisplatin- and kanamycin-induced ototoxicity, we investigated their preve

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

Zheng, Lei, Li Li, Yun Lu, Fangfang Jiang, and Xiu-An Yang. "SREBP2 contributes to cisplatin resistance in ovarian cancer cells." Experimental Biology and Medicine 243, no. 7 (2018): 655–62. http://dx.doi.org/10.1177/1535370218760283.

Texto completo

Resumen

This study is to investigate transcription factors involved in cisplatin resistance in ovarian cancer cells. The transcriptome of cisplatin resistant and sensitive A2780 epithelial ovarian cancer cells was obtained from GSE15372. Ovarian transcriptome data GSE62944 was downloaded from TCGA and applied for transcription regulatory network analysis. The analysis results were confirmed using quantitative polymerase chain reaction. The roles of SREBP2 in cisplatin-resistant cells were investigated by RNA inference and cell viability analysis. Transcription regulatory network analysis found that 12

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Xiao, Fangxing, Xiaobin Yao, Qianhong Bao, Danzhen Li, and Yi Zheng. "Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL." Bioinorganic Chemistry and Applications 2012 (2012): 1–10. http://dx.doi.org/10.1155/2012/649640.

Texto completo

Resumen

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interactio

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

Tinker, N. D., H. L. Sharma, and C. A. McAuliffe. "[82Br]cisplatin derivative: A potential biological model for cisplatin." Journal of Labelled Compounds and Radiopharmaceuticals 28, no. 8 (1990): 971–76. http://dx.doi.org/10.1002/jlcr.2580280811.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Wang, Tse-En, Yu-Hua Lai, Kai-Chien Yang, Sung-Jan Lin, Chih-Lin Chen, and Pei-Shiue Tsai. "Counteracting Cisplatin-Induced Testicular Damages by Natural Polyphenol Constituent Honokiol." Antioxidants 9, no. 8 (2020): 723. http://dx.doi.org/10.3390/antiox9080723.

Texto completo

Resumen

Cisplatin, despite its anti-cancer ability, exhibits severe testicular toxicities when applied systemically. Due to its wide application in cancer treatment, reduction of its damages to normal tissue is an imminent clinical need. Here we evaluated the effects of honokiol, a natural lipophilic polyphenol compound, on cisplatin-induced testicular injury. We showed in-vitro and in-vivo that nanosome-encapsulated honokiol attenuated cisplatin-induced DNA oxidative stress by suppressing intracellular reactive oxygen species production and elevating gene expressions of mitochondrial antioxidation en

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Ahmad, Sarfraz, Amina Hussain, Aroosha Hussain, et al. "Quantification of Berberine in Berberis vulgaris L. Root Extract and Its Curative and Prophylactic Role in Cisplatin-Induced In Vivo Toxicity and In Vitro Cytotoxicity." Antioxidants 8, no. 6 (2019): 185. http://dx.doi.org/10.3390/antiox8060185.

Texto completo

Resumen

Cisplatin is amongst the most potent chemotherapeutic drugs with applications in more than 50% of cancer treatments, but dose-dependent side effects limit its usefulness. Berberis vulgaris L. (B. vulgaris) has a proven role in several therapeutic applications in the traditional medicinal system. High-performance liquid chromatography was used to quantify berberine, a potent alkaloid in the methanolic root extract of B. vulgaris (BvRE). Berberine chloride in BvRE was found to be 10.29% w/w. To assess the prophylactic and curative protective effects of BvRE on cisplatin-induced nephrotoxicity, h

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

Tang, Zuxiong, Jun He, Jiayue Zou, Shufei Yu, Xiaoming Sun, and Lei Qin. "Cisplatin-resistant HepG2 cell-derived exosomes transfer cisplatin resistance to cisplatin-sensitive cells in HCC." PeerJ 9 (April 13, 2021): e11200. http://dx.doi.org/10.7717/peerj.11200.

Texto completo

Resumen

Backgrounds Cancer cell resistance to chemotherapy drugs such as Gemcitabine, Oxaliplatin, Cisplatin, Doxorubicin, and 5-fluorouracil account for the main reason of chemotherapy failure for HCC patients, especially for those with advanced HCC or metastasis patients. This emerging resistance limits the effectiveness and clinical application of these chemotherapy drugs. Previous studies reported that drug-resistant tumor cell-derived exosomes could transfer their resistance property to tumor sensitive cells in some cancer, including lung and gastric cancer. This study sought to explore whether H

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Peters, Richard H., and Robert K. Stuart. "Synergism between 4-hydroperoxycyclophosphamide and cisplatin: importance of incubation sequence and measurement of cisplatin accumulation." Biochemical Pharmacology 39, no. 3 (1990): 607–9. http://dx.doi.org/10.1016/0006-2952(90)90070-2.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Xue, Danfeng, Shu-Ting Pan, Xiongming Zhou, et al. "Plumbagin Enhances the Anticancer Efficacy of Cisplatin by Increasing Intracellular ROS in Human Tongue Squamous Cell Carcinoma." Oxidative Medicine and Cellular Longevity 2020 (March 26, 2020): 1–21. http://dx.doi.org/10.1155/2020/5649174.

Texto completo

Resumen

Cisplatin is widely used in the treatment of tongue squamous cell carcinoma (TSCC), but its clinical efficacy is limited by drug resistance and toxic side effects. Hence, a novel compound capable of enhancing the anticancer effect of cisplatin while reducing the side effects is urgently needed. We have previously shown that plumbagin (PLB), an anticancer phytochemical, is able to inhibit the growth of TSCC in vitro and in vivo. The objective of this study was to investigate the effect of PLB in reversing the resistance of TSCC to cisplatin as well as its molecular mechanisms. Here, we found th

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

KAMARAJAN, Pachiyappan, Nian-Kang SUN, and Chuck C. K. CHAO. "Up-regulation of FLIP in cisplatin-selected HeLa cells causes cross-resistance to CD95/Fas death signalling." Biochemical Journal 376, no. 1 (2003): 253–60. http://dx.doi.org/10.1042/bj20030659.

Texto completo

Resumen

Cisplatin-selected cervix carcinoma HeLa cell lines induced less apoptosis, and weaker activation by cisplatin or Fas-activating antibody, of mitochondrial-associated caspase-9 and death receptor-mediated caspase-8 than did parental cells. Furthermore, less DISC (death-inducing signalling complex) was formed in cisplatin-selected cell lines than in parental cells. Ac-IETD-CHO (acetyl-Ile-Glu-Thr-Asp-aldehyde), which has a certain preference for inhibiting caspase-8, or Fas-antagonistic antibody, significantly inhibited cisplatin-induced apoptosis in both parental and cisplatin-selected HeLa ce

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

Kim, Jung-Yeon, Jungmin Jo, Jaechan Leem, and Kwan-Kyu Park. "Inhibition of p300 by Garcinol Protects against Cisplatin-Induced Acute Kidney Injury through Suppression of Oxidative Stress, Inflammation, and Tubular Cell Death in Mice." Antioxidants 9, no. 12 (2020): 1271. http://dx.doi.org/10.3390/antiox9121271.

Texto completo

Resumen

Emerging evidence suggests that epigenetic mechanisms such as histone modification are crucially involved in the pathophysiology of acute kidney injury (AKI). The histone acetyltransferase p300 regulates several biological processes through the acetylation of histones or transcription factors. However, the role of p300 in cisplatin-induced AKI remains poorly understood. Therefore, we investigated the effects of garcinol, a potent p300 inhibitor, on cisplatin-induced AKI and explored the mechanisms. Administration of garcinol significantly reversed the upregulation of p300 and increased acetyla

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

Salatino, Alessandro, Ilenia Aversa, Anna Martina Battaglia, et al. "H-Ferritin Affects Cisplatin-Induced Cytotoxicity in Ovarian Cancer Cells through the Modulation of ROS." Oxidative Medicine and Cellular Longevity 2019 (October 31, 2019): 1–13. http://dx.doi.org/10.1155/2019/3461251.

Texto completo

Resumen

Reactive oxygen species (ROS) mediates cisplatin-induced cytotoxicity in tumor cells. However, when cisplatin-induced ROS do not reach cytotoxic levels, cancer cells may develop chemoresistance. This phenomenon can be attributed to the inherited high expression of antioxidant protein network. H-Ferritin is an important member of the antioxidant system due to its ability to store iron in a nontoxic form. Altered expression of H-Ferritin has been described in ovarian cancers; however, its functional role in cisplatin-based chemoresistance of this cancer type has never been explored. Here, we inv

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Dmitriev, Oleg Y. "Mechanism of tumor resistance to cisplatin mediated by the copper transporter ATP7BThis paper is one of a selection of papers published in a Special Issue entitled CSBMCB 53rd Annual Meeting — Membrane Proteins in Health and Disease, and has undergone the Journal’s usual peer review process." Biochemistry and Cell Biology 89, no. 2 (2011): 138–47. http://dx.doi.org/10.1139/o10-150.

Texto completo

Resumen

The Wilson disease protein (ATP7B) is a copper-transporting ATPase that is responsible for regulating copper homeostasis in human tissues. ATP7B is associated with cancer resistance to cisplatin, one of the most widely used anticancer drugs. This minireview discusses the possible mechanisms of tumor resistance to cisplatin mediated by ATP7B. Cisplatin binds to the N-terminal cytosolic domain of ATP7B, which contains multiple copper-binding sites. Active platinum efflux catalyzed by ATP7B is unlikely to significantly contribute to cisplatin resistance in vivo. Transient platinum sequestration i

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

Sarkhosh‐Inanlou, Roya, Morteza Molaparast, Adel Mohammadzadeh, and Vahid Shafiei‐Irannejad. "Sanguinarine enhances cisplatin sensitivity via glutathione depletion in cisplatin‐resistant ovarian cancer (A2780) cells." Chemical Biology & Drug Design 95, no. 2 (2019): 215–23. http://dx.doi.org/10.1111/cbdd.13621.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

Zou, Wei, Xiangdong Ma, Hong Yang, Wei Hua, Biliang Chen, and Guoqing Cai. "Hepatitis B X-interacting protein promotes cisplatin resistance and regulates CD147 via Sp1 in ovarian cancer." Experimental Biology and Medicine 242, no. 5 (2017): 497–504. http://dx.doi.org/10.1177/1535370216685007.

Texto completo

Resumen

Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues,

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

Liu, Yupeng, Hui Wu, Fan Zhang, Jun Yang, and Jingchun He. "Resveratrol upregulates miR-455-5p to antagonize cisplatin ototoxicity via modulating the PTEN–PI3K–AKT axis." Biochemistry and Cell Biology 99, no. 3 (2021): 385–95. http://dx.doi.org/10.1139/bcb-2020-0459.

Texto completo

Resumen

Resveratrol is a non-flavonoid polyphenol compound that exists in many plants, and is considered an antitoxin. This study explores the effects from the regulation of miR-455-5p by resveratrol on cisplatin-induced ototoxicity via the PTEN–PI3K–AKT signaling pathway. For this, House Ear Institute–Organ of Corti 1 (HEI-OC1) cells were transfected with miR-455-5p inhibitor and treated with cisplatin and resveratrol, then cell proliferation, apoptosis, and oxidative stress were evaluated. A mouse model of hearing loss was established, and these mice were treated with cisplatin, resveratrol, or cisp

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

Xiao, Yang. "Effect of hTR Antisense Oligodeoxynucleotides on Telomerase Acitvity and Ciplatin -Sensitivity of Primary Acute Leukemia Cells." Blood 104, no. 11 (2004): 4359. http://dx.doi.org/10.1182/blood.v104.11.4359.4359.

Texto completo

Resumen

Abstract BACKGROUND: Between the three key components part of human telomerase, human telomerase RNA (hTR) and human telomerase reverse transcriptase (hTERT) have significant correlation with telomerase activity. The previous study has identified that the telomerase activity of K562 and HL-60 cells was special suppresssed significantly by phosphorothoate antisense oligodeoxynucleotide (ASODN) complementary to the initiator codon of hTR. This study was designed to evalutae the effection of hTR ASODN on telomerase activity and apoptosis of primary acute leukemic cells. To research whether hTR AS

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

Lin, Shyh-Horng, Ming-Han Li, Kai-An Chuang, et al. "Chlorella sorokiniana Extract Prevents Cisplatin-Induced Myelotoxicity In Vitro and In Vivo." Oxidative Medicine and Cellular Longevity 2020 (January 25, 2020): 1–14. http://dx.doi.org/10.1155/2020/7353618.

Texto completo

Resumen

Cisplatin chemotherapy causes myelosuppression and often limits treatment duration and dose escalation in patients. Novel approaches to circumvent or lessen myelotoxicity may improve clinical outcome and quality of life in these patients. Chlorella sorokiniana (CS) is a freshwater unicellular green alga and exhibits encouraging efficacy in immunomodulation and anticancer in preclinical studies. However, the efficacy of CS on chemoprotection remains unclear. We report here, for the first time, that CS extract (CSE) could protect normal myeloid cells and PBMCs from cisplatin toxicity. Also, cisp

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

Alkahtani, Saad, Saud Alarifi, Gadah Albasher, et al. "Poly Lactic-Co-Glycolic Acid- (PLGA-) Loaded Nanoformulation of Cisplatin as a Therapeutic Approach for Breast Cancers." Oxidative Medicine and Cellular Longevity 2021 (June 28, 2021): 1–8. http://dx.doi.org/10.1155/2021/5834418.

Texto completo

Resumen

Despite recent advancements in cisplatin (cis-diamminedichloroplatinum II) and other platinum-based chemotherapeutic drugs for treating solid tumors, their uses are limited by either in terms of toxicity and/or acquired drug resistance. These side effects have a dangerous problem with higher dose for severe patients. To overcome the low therapeutic ratio of the free drug, a polymeric nanoparticle drug delivery system has been explored promoting delivery of cisplatin to tumors. Recently, the applications of nanoparticles (NPs) have been underlined for encouraging the effects of chemotherapeutic

Los estilos APA, Harvard, Vancouver, ISO, etc.

44

Martelli, Laura, Francesco Di Mario, Eugenio Ragazzi, et al. "Different accumulation of cisplatin, oxaliplatin and JM216 in sensitive and cisplatin-resistant human cervical tumour cells." Biochemical Pharmacology 72, no. 6 (2006): 693–700. http://dx.doi.org/10.1016/j.bcp.2006.06.008.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

45

Plumb, J. A., N. Steele, P. W. Finn, and R. Brown. "Epigenetic approaches to cancer therapy." Biochemical Society Transactions 32, no. 6 (2004): 1095–97. http://dx.doi.org/10.1042/bst0321095.

Texto completo

Resumen

Histone deacetylation and DNA methylation have a central role in the control of gene expression, including transcriptional repression of tumour suppressor genes. Loss of DNA mismatch repair due to methylation of the hMLH1 gene promoter results in resistance to cisplatin in vitro and in vivo. The cisplatin-resistant cell line A2780/cp70 is 8-fold more resistant to cisplatin than the non-resistant cell line, and has the hMLH1 gene methylated. Treatment with an inhibitor of DNA methyltransferase, DAC (2-deoxy-5′-azacytidine), results in a partial reversal of DNA methylation, re-expression of MLH1

Los estilos APA, Harvard, Vancouver, ISO, etc.

46

Metzler-Nolte, Nils. "Book Review: Cisplatin. Chemistry and Biochemistry of a Leading Anticancer Drug. By Bernhard Lippert." Angewandte Chemie International Edition 40, no. 1 (2001): 258–59. http://dx.doi.org/10.1002/1521-3773(20010105)40:1<258::aid-anie258>3.0.co;2-x.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

47

Metzler-Nolte, Nils. "Buchbesprechung: Cisplatin. Chemistry and Biochemistry of a Leading Anticancer Drug. Herausgegeben von Bernhard Lippert." Angewandte Chemie 113, no. 1 (2001): 266–67. http://dx.doi.org/10.1002/1521-3757(20010105)113:1<266::aid-ange266>3.0.co;2-j.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

48

Raudenska, Martina, Jan Balvan, Michaela Fojtu, Jaromir Gumulec, and Michal Masarik. "Unexpected therapeutic effects of cisplatin." Metallomics 11, no. 7 (2019): 1182–99. http://dx.doi.org/10.1039/c9mt00049f.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

49

Raeisi, Elham, Mathias Hossain Aazami, Seyed Mahmud Reza Aghamiri, et al. "Bromelain-based chemo-herbal combination effect on human cancer cells: in-vitro study on AGS and MCF7 proliferation and apoptosis." Current Issues in Pharmacy and Medical Sciences 33, no. 3 (2020): 155–61. http://dx.doi.org/10.2478/cipms-2020-0028.

Texto completo

Resumen

AbstractAim. Chemo-herbal combinations promise new clinical anticancer therapeutic modalities. The current study investigated and compared the in vitro effects of a bromelain-based chemo-herbal combination to/with cisplatin or 5-FU, with regard to the proliferation and apoptosis of human gastric AGS and breast MCF7 cell lines.Material and methods. AGS and MCF7 cells were either treated with different concentrations of bromelain, cisplatin or 5-FU; or with bromelain-cisplatin and bromelain-5-FU combinations for 48h. Cell proliferative inhibition and inductive apoptosis were appraised using MTT

Los estilos APA, Harvard, Vancouver, ISO, etc.

50

Kou, Wen, Hongyan Qin, Shahbaz Hanif, and Xinan Wu. "Nephrotoxicity Evaluation on Cisplatin Combined with 5-HT3 Receptor Antagonists: A Retrospective Study." BioMed Research International 2018 (May 30, 2018): 1–5. http://dx.doi.org/10.1155/2018/1024324.

Texto completo

Resumen

Objective. 5-HT3 receptor antagonist (ondansetron) has been reported to have nephrotoxic effect when combined with cisplatin in mice; however, little evidence exists in explaining its nephrotoxic effects on patients. The aim of this present study was to investigate whether 5-HT3 receptor antagonist could enhance or aggravate the incidence of cisplatin-induced nephrotoxicity in patients. Methods. We retrospectively reviewed 600 tumor patients which were treated with cisplatin (⩾60 mg/m2) as a first-time chemotherapy and combined with 5-HT3 receptor antagonist (i.e., ondansetron, tropisetron, or

Los estilos APA, Harvard, Vancouver, ISO, etc.

Ofrecemos descuentos en todos los planes premium para autores cuyas obras están incluidas en selecciones literarias temáticas. ¡Contáctenos para obtener un código promocional único!