Tesis: "Platinum compounds Therapeutic use"

1

Todd, Jean Ann. "Platinum(II) complexes containing 1,2- and 1,7-carborane ligands for boron neutron capture therapy." Title page, contents and abstract only, 2001. http://web4.library.adelaide.edu.au/theses/09PH/09pht634.pdf.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Du, Plessis-Stoman Debbie. "A combination of platinum anticancer drugs and mangiferin causes increased efficacy in cancer cell lines." Thesis, Nelson Mandela Metropolitan University, 2010. http://hdl.handle.net/10948/d1016160.

Texto completo

Resumen

This thesis mainly deals with some biochemical aspects regarding the efficacy of novel platinum anticancer compounds alone and in combination with mangiferin, as part of a broader study in which both chemistry and biochemistry are involved. Various novel diamine and N-S donor chelate compounds of platinum II and IV have been developed in which factors such as stereochemistry, ligand exchange rate and biocompatibility were considered as additional parameters. In the first order testing, each of these compounds was tested with reference to their “killing” potential by comparing their rate of killing, over a period of 48 hours with those of cisplatin and oxaliplatin. Numerous novel compounds were tested in this way, using the MTT cell viability assay and the three cancer cell lines MCF7, HT29 and HeLa. Although only a few could be regarded as equal to or even better than cisplatin, CPA7 and oxaliplatin, the testing of these compounds on cancer cells provided useful knowledge for the further development of novel compounds. Three of the better compounds, namely Yol 25, Yol 29.1 and Mar 4.1.4 were selected for further studies, together with oxaliplatin and CPA7 as positive controls, to obtain more detailed knowledge of their anticancer action, both alone and when applied in combination with mangiferin. In addition to the above, resistant cells were produced for each of the three different cell lines tested and all the selected compounds, both in the presence and absence of mangiferin. The effects of these treatments on the activation of NFĸB when applied to normal and resistant cell lines were also investigated. All the compounds induced apoptosis in the cell lines tested as well as alter the DNA cycle at one or more phase. Additionally, combination of these compounds with mangiferin enhanced the above-mentioned effects. Mangiferin decreases the IC50 values of the platinum drugs by up to 3.4 times and, although mangiferin alone did not induce cell cycle arrest, the presence of mangiferin in combination with oxaliplatin and Yol 25 shows an earlier and greatly enhanced delay in the S-phase, while cells treated with CPA7, Yol 29.1 and Mar 4.1.4 in combination with mangiferin showed a later, but greatly enhanced delay in the S-phase. It was also found that mangiferin acts as an NFĸB inhibitor when applied in combination with these drugs, which, in turn, reduces the occurrence of resistance in the cell lines. Resistance to oxaliplatin was counteracted by the combination with mangiferin in HeLa and HT29, but not in MCF7 cells, while resistance to CPA7 was only counteracted in the MCF7 cell line. Yol 25 and Mar 4.1.4 did not seem to induce resistance in HeLa and MCF7 cells, but did in HT29 cells, whereas Yol 29.1 caused resistance in HeLa and HT29 cells, but not in MCF7 cells. Finally, an effort was made to evaluate the different compounds by comparing them with respect to their properties relating to anticancer action with and without the addition of mangiferin.

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

Thomas, Donald S. "Molecular modelling and NMR studies of multinuclear platinum anticancer complexes." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0009.

Texto completo

Resumen

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Moniodis, Joseph John. "Studying the DNA binding of a non-covalent analogue of the trinuclear platinum anticancer agent BBR3464." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0008.

Texto completo

Resumen

[Truncated abstract] The Phase II clinical candidate, [(trans-Pt(NH3)2Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) shows a unique binding profile when compared to the anticancer agent cis-[Pt(NH3)2Cl2] (cisplatin) and dinuclear platinum complexes of the general formula [(trans-Pt(NH3)2Cl)2(H2N(CH2)nNH2)]2+. There is evidence that the increased efficacy of 1,0,1/t,t,t results from the presence of the charged central linker, which can alter the mode of binding to DNA. This alternate binding mode may be due to an electrostatic and hydrogen bonding association of the central platinum moiety in the minor groove that occurs prior to covalent binding (termed “pre-association”) . . . This research shows that 0,0,0/t,t,t is an adequate model to study the pre-association process of 1,0,1/t,t,t and that it binds in the minor groove of DNA. Therefore it is likely that 1,0,1/t,t,t pre-associates in the minor groove of DNA prior to covalent binding. This work supports the conclusions reached in NMR studies of the binding of 1,0,1/t,t,t with the 1,4-GG sequence (Qu et al. JBIC. 8, 19-28 (2003)), which showed simultaneous binding in the major and minor groove. The findings of the current work may also explain the observed binding mode of 1,0,1/t,t,t, which can bind to DNA in both the 3',3' and 5',5' directions (Kasparkova et al. JBC. 277, 48076-48086 (2002)). These unique binding characteristics are thought to be responsible for the increased efficacy of 1,0,1/t,t,t, and in light of the current results the observed binding mode most likely stems from the electrostatic pre-association of the central platinum moiety.

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Zhang, Jingjing, and 张晶晶. "The anti-cancer properties of cyclometalated gold(III) complexes and organogold(III) supramolecular polymers." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2014. http://hdl.handle.net/10722/208171.

Texto completo

Resumen

Prompted by the successful clinical application of cisplatin in cancer therapy, worldwide efforts have been devoted to develop new metal-based drugs for anticancer treatment. Gold(III) complexes at first received attention as anti-cancer drug candidates because of their square-planar geometry which resembles that of platinum(II) complexes. Subsequent studies revealed that various gold(III) complexes displayed promising anti-cancer activities with different biological mechanisms. Although some achievements have been obtained in the development of anti-cancer gold(III) complexes, challenges including the improvement of bioavailability, stability and selectivity, elucidation of the action mechanisms, and the development of novel delivery approaches of gold(III) complexes to reduce systematic toxicity, remain to be exploited. A panel of anti-cancer complexes [AuIII(R-C^N)(L)]n+ (wherein HC^N is 2-phenylpyridine, L is biguanide or biuret) have been identified and described in Chapter 3. Biguanide or biuret have been employed to improve the solubility of the complexes in aqueous solutions. Meanwhile, the lipophilicity could readily be adjusted by varying the R group to obtain a balance between lipophilicity and aqueous solubility. Among the synthesized complexes, the cationic complexes, [AuIII(butyl-C^N)biguanide]Cl (3.1) and [AuIII(C^N)biguanide]Cl (3.2) are soluble in aqueous solutions with solubility over 5 mg/mL. Besides, introduction of butyl groups to 3.1 and [AuIII(butyl-C^N)biuret] (3.3) resulted in higher cellular uptake of gold, which might enhance their cytotoxic activities (IC50 values: 1.5–17 μM) compared with 3.2 and [AuIII(C^N)biuret] (3.4) (IC50 values: 9.4–47.3 μM). Moreover, 3.1 was also found to induce cell cycle arrest in S-phase and endoplasmic reticulum (ER) damage in human cervical epithelial carcinoma (HeLa) cells, and display significant anti-angiogenic activity at its sub-cytotoxic concentrations. In Chapter 4, a series of gold(III) complexes with dithiocarbamate and 2-phenylpyridine ligands to target deubiquitinases (DUBs), have been designed. These complexes achieved significant inhibition on purified DUBs. Notably, [AuIII(2-(4-nbutylphenyl) pyridyl)(diethyldithiocarbamate)]PF6 (4.1) inhibited both the purified (IC50 values: 46–223 nM) and cell-based DUBs activities with high efficiency. Its interaction with DUB UCHL1 and peptides which are present in several types of DUBs and contain active cysteine residue were confirmed by mass spectrometric analysis. All complexes displayed significant cytotoxicities, and those containing diethyldithiocarbamate ligand displayed specific cytotoxicity on breast cancer cells. Accumulation of a tumor suppressor p53, cell-cycle arrest, and apoptotic cell death were induced in breast cancer cells by 4.1. Besides, 4.1 also showed anti-angiogenic effects. These biological activities might be related with DUBs inhibition. In Chapter 5, a cytotoxic complex [AuIII(C^N^C)(4-dpt)](CF3SO3) (5.1, HC^N^CH = 2,6-diphenylpyridine; 4-dpt = 2,4-diamino-6-(4-pyridyl)-1,3,5-triazine) has been designed to self-assemble into supramolecular polymers (5.1-SP) in acetonitrile. In physiologically relevant solutions, 5.1-SP displayed a sustained-release property of the anti-angiogenic ligand 4-dpt, and in the presence of glutathione (GSH), [AuIII(C^N^C)-GSH] adduct(s) were also gradually released. The supramolecular polymers 5.1-SP also showed selective cytotoxicity toward cancerous cells, and could act as drug-carriers of other cytotoxic agents to achieve sustained-release behavior. published_or_final_version Chemistry Doctoral Doctor of Philosophy

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Wong, Lai-Ming Ella, and 黃禮明. "Iron and ruthenium complexes with nitrogen and oxygen donor ligands for anti-cancer and anti-viral studies." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2006. http://hub.hku.hk/bib/B3587742X.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Brynne, Niclas. "Consequences of CYP2D6 polymorphism for the disposition and dynamics of tolterodine : a novel drug in the treatment of urinary bladder overactivity /." Stockholm, 1998. http://diss.kib.ki.se/1998/91-628-3205-0/.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Tian, Songhai, and 田松海. "Proteomic and pharmacological analyses of the mechanism of actions of anticancer gold(I) complexes." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2014. http://hdl.handle.net/10722/206471.

Texto completo

Resumen

Gold complexes have a long history of being used as therapeutic agents, especially in applications against immune diseases such as rheumatoid arthritis. In 1979, an oral gold(I) drug – auranofin (AuRF, brand name as Ridaura®) – was demonstrated to exhibit anticancer properties. Since then, a considerable number of gold(I) complexes have been reported to show remarkable anticancer activities, but the understanding of their mechanism of actions is limited. In the present study, AuRF and several other anticancer gold(I)-phosphine complexes including AuPEt ([Au(triethylphosphine)Cl]) were demonstrated to induce autophagy – a cellular catabolic process of macromolecules and organelles through lysosomal degradation. The induced autophagy involved the accumulation of autophagosomes, which was mediated by the enhancement of autophagy initiation rather than by the blockage of autophagosomes maturation. Moreover, the AuRF and AuPEt induced autophagy was demonstrated to have a pro-survival effect for the cancer cells. To better explore the mechanism of actions of AuRF and other anticancer gold(I) complexes, a subcellular fractionation-based proteomic approach has been developed and optimized. This approach combined the use of subcellular fractionation, protein extraction, HPLC-LTQ-Orbitrap mass spectrometry, and bottom-up protein identification and quantification. By using this approach, the proteome coverage was increased, the complexities of the sub-proteomes were reduced, and the low-abundant organelle proteins were enriched. The nuclear sub-proteomes of AuRF-treated or AuPEt-treated cells were analyzed to identify the significantly regulated transcription regulators and the signaling pathways involved. The analysis delineates the possible AuRF-activated anticancer pathways involving up-regulation of the tumor suppressor cyclin-dependent kinase inhibitor 2A (〖p14〗^ARF), inhibition of the E2F transcription activity, blocking of the translocation of E3 ubiquitin-protein ligase (MDM2) from nucleus to cytoplasm and induction of the tumor suppressor p53. Furthermore, the KeyNode-based pathway analysis was applied to analyze the whole proteomes obtained from merging the sub-proteomes. Alongside the p53 pathway and E2F network, the regulation of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR, the rate-limiting enzyme of cholesterol biosynthesis) is one of the most up-regulated pathways of AuRF treatment. AuRF also showed significant inhibition to HMGCR activity in vitro with an IC50 value at the micromolar level. The effects of AuRF and AuPEt on the high mobility group box-1 protein (HMGB1), which exhibits distinct functions dependent on its cellular locations, were investigated. Treatment of cells with AuRF or AuPEt resulted in down-regulation of nuclear HMGB1, which is associated with p53-dependent cytotoxicities. The cytoplasmic HMGB1, which can induce autophagy, was found to be up-regulated. The levels of secreted HMGB1, which exhibits pro-inflammatory properties, were reduced, possibly contributing to anti-rheumatoid arthritis actions of AuRF. Collectively, the pharmacological and proteomic analyses in this research of AuRF and other anticancer gold(I) complexes supplement the current knowledge of their mechanism of actions. published_or_final_version Chemistry Doctoral Doctor of Philosophy

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Vezmar, Marko. "Pharmacological effects of quinoline-related compounds in human tumour cells overexpressing the multidrug resistance protein (MRP)." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 1997. http://www.collectionscanada.ca/obj/s4/f2/dsk2/tape16/PQDD_0003/MQ37175.pdf.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Wei, Lai, and 魏来. "Induction of LTB4 12-hydroxydehydrogenase (LTB4DH) by Radix Astragali and Radix Paeoniae Rubra: a study of theactive compounds and related biological functions." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2009. http://hub.hku.hk/bib/B44683443.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Boukes, Gerhardt Johannes. "The in vitro biological activities of three Hypoxis species and their active compounds." Thesis, Nelson Mandela Metropolitan University, 2010. http://hdl.handle.net/10948/1228.

Texto completo

Resumen

The African potato is used as an African traditional medicine for its nutritional and medicinal properties. Most research has been carried out on H. hemerocallidea, with very little or nothing on other Hypoxis spp. The main aim of this project was to provide scientific data on the anticancer, anti-inflammatory and antioxidant properties of H. hemerocallidea, H. stellipilis and H. sobolifera chloroform extracts and their active compounds. The hypoxoside and phytosterol contents of the three Hypoxis spp. were determined using TLC, HPLC and GC. H. hemerocallidea and H. sobolifera chloroform extracts contained the highest amounts of hypoxoside and β-sitosterol, respectively. For the anticancer properties, cytotoxicity of the Hypoxis extracts and its purified compounds were determined against the HeLa, HT-29 and MCF-7 cancer cell lines (using MTT), and PBMCs (using CellTiter-Blue®). H. sobolifera had the best cytotoxicity against the three cancer cell lines, whereas H. stellipilis stimulated HeLa and HT-29 cancer cell growth. IC50 values of hypoxoside and rooperol were determined. DNA cell cycle arrest (using PI staining) occurred in the late G1/early S (confirmed by increased p21Waf1/Cip1 expression) and G2/M phases after 15 and 48 hrs, respectively, when treated with Hypoxis extracts and rooperol. H. sobolifera and rooperol activated caspase-3 and -7 (using fluorescently labelled antibodies) in HeLa and HT-29 cancer cells, and caspase-7 in MCF-7 cancer cells after 48 hrs. Annexin V binding to phosphatidylserines in rooperol treated U937 cells confirmed early apoptosis after 15 hrs. The TUNEL assay showed DNA fragmentation in the three cancer cell lines when treated with H. sobolifera and rooperol for 48 hrs. A shift pass the G2/M phase has led to the investigation of endoreduplication, which was confirmed by cell/nucleus size, and anti-apoptotic proteins (Akt, phospho-Akt, phospho-Bcl-2 and p21Waf1/Cip1). U937 cell differentiation to monocyte-macrophages was optimized using PMA and 1,25(OH)2D3, which was confirmed by morphological and biochemical changes. For the anti-inflammatory properties, Hypoxis extracts and rooperol significantly increased NO production in monocyte-macrophages (pre-loaded with DAF-2 DA) and phagocytosis of pHrodoTM E. coli BioParticles®. The treatments had no effect on COX-2 expression in monocyte-macrophages. The phytosterols significantly increased IL-1β and IL-6 secretion xv (using the FlowCytomix Multiplex human Th1/Th2 10plex Kit I) in the PBMCs of one donor. For the antioxidant properties, Hypoxis extracts and rooperol significantly increased ROS production in undifferentiated and differentiated U937 cells, which were pre-loaded with DCFH-DA. Hypoxis extracts and purified compounds had ferric reducing activities, but only rooperol had ferric reducing activities significantly greater than ascorbic acid. β-sitosterol, campesterol and cholesterol significantly increased SOD activity in Chang liver cells, while H. stellipilis, H. sobolifera and rooperol decreased SOD activity. Anticancer, anti-inflammatory and antioxidant properties of the Hypoxis extracts may be attributed to the β-sitosterol content, because Hypoxis chloroform extracts contained very little or no hypoxoside. Unidentified compounds, and synergistic and additive effects of the compounds may have contributed to the biological effects. This study confirms previous reports that rooperol is the active compound. Results provide scientific data on the medicinal properties of one of the most frequently used medicinal plants in South Africa.

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Durairajan, Siva Sundara Kumar. "Biological screening and isolation of immunomodulatory compounds from endophytic fungi from Tripterygium wilfordii." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2004. http://hub.hku.hk/bib/B31245274.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Keter, Frankline Kiplangat. "Pyrazole and pyrazolyl palladium(II) and platinum(II) complexes: synthesis and in vitro evaluation as anticancer agents." Thesis, University of the Western Cape, 2004. http://etd.uwc.ac.za/index.php?module=etd&amp.

Texto completo

Resumen

The use of metallo-pharmaceuticals, such as the platinum drugs, for cancer treatment illustrates the utility of metal complexes as therapeutic agents. Platinum group metal complexes therefore offer potential as anti-tumour agents to fight cancer. This study was aimed at synthesizing and evaluating the effects of palladium(II) and platinum(II) complexes as anticancer agents.

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Li, Ting. "Study on the immunomodulatory property and mechanism of active compounds derived from chinese medicinal herbs." HKBU Institutional Repository, 2010. https://repository.hkbu.edu.hk/etd_ra/1400.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

Zheng, Chunyan, and 鄭春艷. "Therapeutic role of arsenic trioxide in small cell lung cancer : in vitro and in vivo models." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2015. http://hdl.handle.net/10722/208574.

Texto completo

Resumen

Small cell lung cancer (SCLC) is characterized by prompt response to chemotherapy and radiotherapy but relapsing with drug resistance and distant metastasis, leading to poor overall prognosis. New anticancer agents and regimens are drastically needed for SCLC treatment. Arsenic trioxide (ATO), a traditional Chinese medicine used as a poison for thousands of years, has been tested in many hematological and solid cancers both in vitro and in vivo, with promising effects. In order to establish the scientific ground for future clinical application of ATO in SCLC, this study aimed to investigate the anticancer effect and mechanism of ATO in SCLC using in vitro and in vivo models, either as a single agent or in combination with standard chemotherapy. In addition, an ATO-acquired resistant cell line (H841-AR) derived from SCLC cell line H841 was used to explore potential mechanisms of ATO resistance and cross-resistance to other chemotherapeutic drugs. In the first part of this study, ATO was shown to exert cytotoxic effect in all of the chosen SCLC cell lines. Various cellular mechanisms were triggered upon ATO exposure: redox status disturbances (hydrogen peroxide (H2O2) generation, glutathione (GSH) depletion and thioredoxin 1 (Trx1) down-regulation), mitochondrial membrane depolarization (MMD), DNA damage, apoptosis and necroptosis. In concert with this, Bcl-2 was down-regulated accompanied by MMD, release of AIF and SMAC, DNA degradation, XIAP inhibition and caspases activation. Adoption of N-acetyl-L-cysteine (NAC) and buthionine sulfoximine (BSO) demonstrated GSH depletion and reactive oxygen species (ROS) generation played the pivotal role to mediate cytotoxic effect of ATO in SCLC. In the second part of this study, when combined with chemotherapeutic agents, ATO displayed synergistic and antagonistic interaction with cisplatin and etoposide respectively in SCLC cell line models. The beneficial combination of ATO and cisplatin was also substantiated by tumor xenograft models. Augmented GSH depletion and suppressed drug efflux mechanism were found to explain the synergistic effects. In the last part of this study, H841-AR was generated as an acquired multi-drug resistant (ATO, cisplatin and etoposide) cell line to investigate the potential resistance mechanisms and possible future drug combinations. Comparing H841-AR cells with parental H841 cells using cDNA microarray, a long list of genes was altered in ATO-resistant cells. At least 20 up-regulated and 45 down-regulated genes were short-listed as candidates with a cut-off at 5-fold change. Interestingly, qPCR data has shown that 5 selected up-regulated genes in H841-AR cells were also highly expressed in DMS79 cells with intrinsic ATO resistance compared to the relatively sensitive cell lines, indicating that these genes might be associated with ATO resistance in SCLC. In summary, ATO was shown to be an active anticancer agent in SCLC, either alone or in combination with cisplatin. The major mechanisms of action of ATO and its synergism with cisplatin in SCLC were elucidated. Genetic data derived from an acquired resistant (to ATO, cisplatin and etoposide) SCLC cell line may help to uncover the mechanisms of resistance to ATO, allowing possible future drug combinations. published_or_final_version Medicine Doctoral Doctor of Philosophy

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Chen, Lin Min. "Angiogenic activities of Drynaria fortunei-derived extract and isolated compounds on zebrafish in vivo and human umbilical vein endothelial cells in vitro." Thesis, University of Macau, 2017. http://umaclib3.umac.mo/record=b3690926.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

歐楊嘉慧 and Ka-wai Au-Yeung. "Role of Chinese medicinal compounds in the regulation of stress-activated protein kinase in ischaemic/reperfused rat heart." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2000. http://hub.hku.hk/bib/B31223916.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Scrivens, Paul James. "Regulation and chemotherapeutic targeting of human Cdc25A phosphatase." Thesis, McGill University, 2007. http://digitool.Library.McGill.CA:80/R/?func=dbin-jump-full&object_id=103293.

Texto completo

Resumen

The Cdc25 phosphatases are highly conserved from yeast through humans and play pivotal roles in regulating the activities of cyclin-dependent kinases (Cdks). Cdc25A is one of three human Cdc25 family members, and has previously been shown to be overexpressed in numerous cancers and to transform rodent fibroblasts. Cdc25A therefore represents a rational target for chemotherapeutic development. Further, a thorough understanding of its biology and regulation in normal and transformed cells may facilitate the development of strategies to specifically interfere with the proliferation of cancerous cells. In this work I describe experiments which demonstrate that bisperoxoVanadium compounds, and specifically bpV(Me2Phen), inhibit Cdc25A phosphatase in vitro and in vivo. Further, these compounds cause cell-cycle arrest, are cytotoxic to cancer cells, and slow the growth of tumours in mouse models. With respect to the fundamental biology of Cdc25A, I have identified a sequence element (NLS) responsible for nuclear localization of Cdc25A phosphatase. An analysis of this sequence demonstrated high conservation of flanking phosphoacceptor sites, notably Serine 292. S292 was predicted to be a consensus PKA or CamKII substrate. Using site-directed mutagenesis I have shown that S292 is the sole site of PKA phosphorylation in vitro. The functional importance of S292 phosphorylation was investigated via transfections of phospho-mimetic mutants of S292 (S292E) expressed as GFP-fusion proteins; these studies indicate that S292 phosphorylation may promote nuclear localization. Studies by other groups have indicated that S292 is a phosphorylation site for inhibitory kinases, namely Chk1 and Chk2 (4). I generated a phospho-specific antibody to this site and demonstrate by immunofluorescence and western blotting an unexpected pattern of S292 phosphorylation associated with nuclear bodies and the mitotic apparatus. I provide evidence to suggest that these sites represent local fine-tuning of Cdc25A, allowing Cdk activity to be controlled at the level of specific subcellular structures. These studies highlight the complexity of Cdc25 regulation and indicate a previously unappreciated degree of control of their activity such that these enzymes exist in multiple discrete pools within a given cell.

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Lam, Wing-moon Raymond, and 林榮滿. "Strontium apatite nanoparticle bioactive bone cement: from biomaterial development to pre-clinicalevaluations." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2009. http://hub.hku.hk/bib/B43759968.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

Wang, Zhiyu, and 王志宇. "Identification and characterization of bioactive compounds in Spatholobus suberectus targeting on LDH-A in breast cancer." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2012. http://hub.hku.hk/bib/B48329423.

Texto completo

Resumen

Although clinical outcomes of some cancer have been greatly improved by advancements made in surgery, chemo or radiotherapy and development of novel strategies such as molecular targeted therapy, Traditional Chinese Medicine (TCM) is particularly appreciated for cancer therapy in China based on its 5,000-year-old history, well established theoretical system and numerous exciting case reports. However, due to lack of quality assurance, laboratory evidences and well-designed clinical trials, TCM always encounters much skepticism and pessimism by the West. The study aims to identify the bioactive compounds in a Chinese herb Spatholobus suberectus (SS, 雞血藤) by targeting on lactate dehydrogenase A (LDH-A) in breast cancer. Glycolysis inhibition has been considered as important strategy to block cancer energy metabolism and therefore suppressing cancer growth. LDH-A has been demonstrated to be up-regulated in various cancer cells. In our study, 46 breast cancer specimens were collected to study the relation between LDH-A expression and clinicopathological characteristics including menopause, tumor size, node involvement, differentiation and pathological subtypes classified by estrogen receptor (ER), progesterone receptor (PR) and Her-2. LDH-A expression was found to be correlated significantly with breast cancer size and independent with other clinicopathological factors. LDH-A silencing in breast cancer cell lines MDA-MB-231 and MCF-7 resulted in an inhibited breast cancer cell proliferation, elevated intracellular oxidative stress, induction of mitochondiral pathway apoptosis and limited tumorigenic ability, indicating that LDH-A inhibition might offer a promising therapeutic strategy for breast cancer. SS is historically recommended to invigorate blood circulation and has been prescribed to treat diseases relating to blood stasis syndromes including menstrual abnormalities, anemia, numbness of the limbs, arthritis and cancer, etc. Our following study revealed that SS aqueous extracts could significantly inhibited breast cancer LDH-A expression and activity in both in vitro and in vivo models built by MDA-MB-231 and MCF-7 cell lines. Bioactivity guided fractionation based on LDH-A activity, apoptosis and LDH-A expression further identified epigallocatechin (EGC) as the key compound responsible for the inhibited LDH-A expression. Mechanistic studies found that the inhibitory effect of EGC on LDH-A expression was mainly through promoting Hypoxia inducible factor-1α (HIF-1α) proteasome degradation rather than inhibiting transcription activity, which might be correlated with decreased binding between HIF-1α and Hsp90. Consistent with in vitro findings, EGC was also demonstrated effecitve in suppressing breast cancer growth in vivo correlating to down-regulation of LDH-A, HIF-1α and triggerment of apoptosis. This study provides preliminary laboratory evidences for applying SS in breast cancer therapy. However, further research is needed to evaluate its metabolism, the synergistic effects with chemotherapeutic agents and clinical efficiency. published_or_final_version Chinese Medicine Doctoral Doctor of Philosophy

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Mngeni, Nasipi Zamanala. "Bioactive compounds from selected medicinal plants used in antidiabetic treatment." Thesis, Cape Peninsula University of Technology, 2017. http://hdl.handle.net/20.500.11838/2665.

Texto completo

Resumen

Thesis (MTech (Chemistry))--Cape Peninsula University of Technology, 2017. The continued use and popularity of plant-based traditional medicine demands scientific validation of the therapeutic potential of the medicinal plants used in disease management and treatment. These medicinal plants are to be evaluated for phytochemical constituents and pharmacologically screened for their bioactivity and include the isolation and identification of their bioactive compounds. The diabetes tea and its eight individual plants constituents were collected from Sing Fefur Herbs in McGregor, Western Cape. The plant material was ground to a fine powder form using a milling machine. The powdered plant material was sequentially extracted with hexane, 1:1 DCM, DCM:MeOH, MeOH and water. The antioxidant activity of the tea and its plants was evaluated with comparison to the antioxidant activity of brewed rooibos tea in literature. The concentration of antioxidants in the plants and the tea were found to be significantly high. The ORAC assay results of the water extracts were significantly higher than that of rooibos tea in all plants. Salvia africana-caerulea water extract ORAC results were 14147.10±1.02 μmol TE/g and this is 10 times better than the brewed rooibos tea results of 1402±44.1 μmol TE/g. The alpha-amylase enzyme inhibition assay showed no significant results while the alpha-glucosidase enzyme inhibition assays showed significant results in some of the extracts. The highest inhibitory activity towards alpha-glucosidase was found in the Urtica urens hexane extract and the Thymus vulgaris hexane extract (69.66% and 68.43%, respectively). This observation suggests that alpha-glucosidase enzyme is inhibited mostly by the less polar or medium polarity chemical components of the plant extracts. The crude plant extracts that showed significant activity in the antidiabetic bioassays were further subjected to cytotoxicity assay to ascertain the safety of extracts. The T. vulgaris DCM extract, Salvia officinalis DCM extract and Salvia officinalis hexane extract showed a cell growth inhibition of 54.91%, 62.14% and 63.87% at 100 μg/ml, respectively. The Salvia africana-caerulea DCM extract showed a cell growth inhibition of 59.10% at 50 μg/ml and 62.14% at 100 μg/ml. In the cytotoxicity analysis Salvia africana-caerulea DCM extract is the only extract that showed cell viability below 50% for both concentrations. Phytochemical screening of selected methanolic and aqueous extracts of the diabetes tea and the Salvia africana-caerulea showed the presence of alkaloids, sugars, flavonoids, glycosides, proteins & amino acids, phenolics & tannins and saponins. Furthermore isolation, purification and analysis of two Salvia africana-caerulea crude extracts (DCM and DCM:MeOH) were done in order to try and obtain pure compounds. The compound characterization was done through the use of chromatographic techniques. Thin layer chromatography (TLC), flash chromatography and column chromatography resulted in the generation of 29 fractions. Spectroscopic techniques utilized for chemical structural elucidation for compounds of interest included Liquid chromatography mass spectrometry and Nuclear Magnetic Resonance Spectroscopy. Of all the fractions generated, DM 23 was the purest and its structural elucidation was attempted.

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Davison, Candace. "The effect of synthetically-derived xanthone compounds on the suppression of the progression of breast cancer and the associated complications." Thesis, Nelson Mandela University, 2017. http://hdl.handle.net/10948/13889.

Texto completo

Resumen

Breast cancer is the most frequently diagnosed cancer in women worldwide.A treatment regime, both effective and safe and can only be achieved once more effective chemotherapeutic agents are discovered or identified. These “drugs” must selectively induce cell death such as apoptosis or necroptosis in the cancer cells. Apoptotic cell death allows a cell to “commit suicide” in genetically- controlled or programmed mechanism(s). The microenvironment of the tumour is important since a nurturing malignant environment is required for tumour maintenance, progression and ultimately the development of metastasis. Due to the correlation of the tumour microenvironment to aggressive tumour progression, emphasis should be placed on the constituents of the tumour’s microenvironment. In recent years, the understanding of intracellular pathways in cancer cells has increased rapidly, contributing to the development of drugs with more specific targets such as growth factors, signalling molecules, cell adhesion proteins, proteases, cell-cycle proteins, modulators of apoptosis and molecules that promote angiogenesis and metastasis. The main aim of this study was thus to identify a few potential or active compounds from a library of synthetically-derived compounds as possible alternative breast cancer treatment candidates.

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Garrett, Ian Ross. "Studies of the effect of metal containing drugs on acute and chronic inflammation /." Title page, table of contents and summary only, 1986. http://web4.library.adelaide.edu.au/theses/09PH/09phg2386.pdf.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Lum, Ching-tung, and 林菁潼. "Treatment of hepatocellular carcinoma with a novel gold compound." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2005. http://hub.hku.hk/bib/B30699927.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Liu, Wai-ching, and 廖惠清. "Strontium incorporated materials in orthopaedics: gentamicin release in bone cement and scaffolds with highmechanical properties for tissue engineering." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2012. http://hub.hku.hk/bib/B47234672.

Texto completo

Resumen

Strontium (Sr) is not only widely studied for its compound as a drug for treating osteoporosis, but there is also a growing interest of its addition in orthopaedic biomaterials. Over the years, the development of orthopaedic biomaterials has already advanced to a new era in the search of resorbable and/or bioactive materials. Due to its anabolic and anti-resportive properties of Sr on bone regeneration as a drug, strontium has been extensively investigated for its potential in other orthopaedic applications. The purposes of this study were to investigate strontium containing hydroxyapatite (Sr-HA) bone cement for the delivery of gentamicin and the effects of Sr incorporation in coral and borosilicate glass as bone engineering scaffolds. 　　　　　　Three types of Sr incorporated materials are reported here, in which these include an applied study of the drug elution property of previously published bone cement and two initial studies of the biological properties of newly developed coral and borosilicate scaffolds. Firstly, the gentamicin release, bioactivity and mechanical property of bioactive bone cement filler based on Sr-HA were compared to a commercially available gentamicin-loaded poly(methyl methacrylate) (PMMA). Over the study period of 30 days, the cumulative gentamicin release from Sr-HA bone cement was much greater than PMMA bone cement (+ 34%); better bioactivity of Sr-HA was also confirmed with the apatite formation after simulated body fluid immersion. Goniopora, a highly interconnected porous coral, was hydrothermally converted to coralline hydroxyapatite (CHA) or coated with hydroxyapatite and incorporated with Sr. As the first report of incorporating Sr into coral with the structure remained, about 4-16% Sr was detected on CHA. Sr-HA coated coral was studied in vitro and in vivo (ovariectomized rat model) resulting in better cell proliferation and higher scaffold volume retention (+40%). Finally, the development of Sr incorporated borosilicate (SrB) glass scaffold explored a new material for bone tissue engineering, but more importantly, it introduced a phenomenal idea of the stimulatory effect of a local alkaline microenvironment on bone regeneration. Detections of an exceedingly high pH (~ pH 8.6) condition on the material surface and release of Sr, Si and B ions during the degradation of scaffold SrB were confirmed to stimulate osteoblasts and facilitate apatite formation. Although new bone was observed on both scaffolds, higher bone area/tissue area (B.Ar/T.Ar) on scaffold SrB indicated more new bone formation over borosilicate scaffold without Sr addition. 　　　　　　The significance of this study is to explore and develop three orthopaedic biomaterials advancing the stimulatory effects of Sr on bone regeneration. The drug elution properties of Sr-HA bone cement provides a fascinating alternative for treating osteomyelitis. Furthermore, by incorporating Sr into CHA and borosilicate scaffold, it brings out the importance on the readiness of the Sr release of the materials in order to deliver the stimulatory effects. Subsequently, a localized pH micro-environment arisen by material degradation is emphasized as a controlling factor in bone regeneration on biomaterials. published_or_final_version Orthopaedics and Traumatology Doctoral Doctor of Philosophy

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

Liebman, Katherine May. "New 4-Aminoquinoline Compounds to Reverse Drug Resistance in P. falciparum Malaria, and a Survey of Early European Antimalarial Treatments." PDXScholar, 2014. http://pdxscholar.library.pdx.edu/open_access_etds/2114.

Texto completo

Resumen

Intermittent fevers caused by Plasmodium parasites have been known for millennia, and have caused untold human suffering. Today, millions of people are afflicted by malaria each year, and hundreds of thousands die. Historically, the most successful synthetic antimalarial drug was chloroquine, as it was safe, inexpensive, and highly efficacious. However, plasmodial resistance to chloroquine now greatly limits its utility. Previously in our laboratories it has been shown that attachment of a "reversal agent moiety" to the side chain of chloroquine can result in the restoration of activity against chloroquine-resistant strains of P. falciparum malaria. In the first part of the work presented here, a study has been made of the importance of the quinoline ring substitution pattern to the activity of such reversed chloroquines. The compounds presented here include those bearing a substituent in the 2-, 5, 6-, 7-, and/or 8- position, and include those with chloro, bromo, iodo, fluoro, nitro, trifluoromethyl, methyl, and methoxy substituents. For reversed chloroquines, 2-, 5-, and 8- substituents have been found to decrease in vitro antiplasmodial activity against P. falciparum relative to 7-chloro substitution, whereas 6- and 7- substituted compounds with various substituents have in many cases similar activity to that of 7-chloro substituted compounds. Little difference has been observed between 6- and 7- substitution, or between chlorine and a methyl group in position 6. In most cases these effects on activity are directionally similar to those observed for chloroquine analogs without an attached reversal agent, but the magnitude of the effect is generally smaller, suggesting that the activities of reversed chloroquines are less affected by modifications to the quinoline ring system than is true for chloroquine analogs without an attached reversal agent. The second portion of this work presents an asymmetrical bis-quinoline (PL241) that is highly active against P. falciparum malaria, with an IC50 of less than 0.1 nM for all strains tested. Mechanistic studies have been performed in which the substitution patterns of the two quinoline rings of PL241 are modified in ways that indicate that either ring system is equally capable of participating in the antimalarial activity of these compounds. The excellent in vitro antiplasmodial activity of PL241 makes this a compound of great interest for further development as a potential antimalarial drug. In the third part of this work, a survey has been made of antimalarial treatments recommended in the European medical literature from the time of Pliny the Elder (active in the first century A.D.) through the advent of modern malaria chemotherapy in the early twentieth century. In the fifteen primary sources utilized in this study, 251 distinct substances - primarily plants - were identified as having likely been used in the treatment of malaria. Of the 38 substances that were described in three or more sources, at least fifteen have been examined by other workers for antiplasmodial activity; in many cases, they were found to have antiplasmodial activity in vitro or in vivo. However, the majority of the phytotherapies for malaria identified in this project have not yet been tested against Plasmodium species, and may provide valuable leads in the search for new compounds active against drug-resistant malaria.

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Nyambe, Mutenta Nsokolo. "An investigation of the potential anti-diabetic (insulinomimetic) activity of anti-oxidant compounds derived from Sargassum heterophyllum." Thesis, Rhodes University, 2014. http://hdl.handle.net/10962/d1021020.

Texto completo

Resumen

In Africa, non-communicable diseases such as diabetes mellitus have been generally neglected. This problem has worsened over the years owing to continuous threats from infectious diseases such as HIV/AIDS, tuberculosis and malaria. Despite this, statistics have shown that by 2030, the African region will have the highest proportional increase in diabetes prevalence. Over 80% of all diabetic deaths occur in developing countries probably not only due to poor equity of access to medication but also due to limited efficacy and side effects associated with the commonly available anti-diabetic agents. Therefore, this creates the desperate need for the development of new anti-diabetic agents that are more efficacious and can be sourced from within the continent. With oxidative stress as a suggested mechanism underlying the cause of diabetes mellitus and diabetic complications, the discovery of natural anti-oxidants that prevent free radical mediated damage is important for developing new treatment strategies. Marine algae have been identified as good sources for natural anti-oxidants. Unfortunately, very few studies have embarked on the discovery of marine-derived anti-oxidant compounds with potential anti-diabetic activity. In this project, we investigated the potential anti-oxidant activity of the South African endemic algae Stypopodium multipartitum, Dictyopterus ligulata, Cystophora fibriosa, Bifurcariopsis capensis, Sargassum sp. and Sargassum heterophyllum. From these studies, Sargassum heterophyllum yielded prenylated compounds, the main compound being sargahydroquinoic acid (3.6) and the carotenoid metabolite fucoxanthin (3.8), which are in part responsible for the radical scavenging activity of the crude extract. Sargahydroquinoic acid (3.6) and fucoxanthin (3.8) also exhibited significant anti-inflammatory activity. Sargaquinoic acid (3.1), sargachromenoic acid (3.9) and sarganaphthoquinoic acid (3.10) were then semi-synthesized from sargahydroquinoic acid (3.6) and their in-vitro cytotoxicity profiles evaluated using Chang Liver, HT-29, Caco-2 and 3T3-L1 cell lines prior to antidiabetic testing. From the semi-synthetic derivatives, sargachromenoic acid (3.9) exhibited the most potent anti-oxidant activity (IC₅₀ = 6.99 μg/mL). After the evaluation of antidiabetic activity using 3T3-L1 preadipocyte differentiation, sarganaphthoquinoic acid (3.10) showed the most potent insulinomimetic activity at 1.19 μM by inducing a PPARγ response similar to that of rosiglitazone at 1 μM.

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

Ni, Guoxin, and 倪國新. "In vivo studies of strontium-containing hydroxyapatite bioactive bone cement in primary and revision hip replacement." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2006. http://hub.hku.hk/bib/B36596577.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Wang, Ting, and 王挺. "A comparative study on initial prothesis stability fixed by strontium-containing hydroxyapatite comparing with polymethyl methacrylate bonecement." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2009. http://hub.hku.hk/bib/B44193269.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Tong, Pak-ho, and 湯柏豪. "The cytotoxic effect of arsenic trioxide on human neuroblastoma cell lines and its relationship to MYCN gene status." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2009. http://hdl.handle.net/10722/210315.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

Hickey, James Laurence. "Synthetic approaches towards gold (I) and silver (I) complexes of functionalised N-heterocyclic carbene ligands." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2009. http://theses.library.uwa.edu.au/adt-WU2009.0090.

Texto completo

Resumen

This work focuses on the design and synthesis of Au(I) and Ag(I) complexes from ligand systems that aim to combine both N-heterocyclic carbene (NHC) and phosphine ligand types. A number of synthetic approaches towards both the ligands and the prepared metal complexes have been developed, with a concerted effort on achieving the desired Au(I) or Ag(I) complexes with minimal reaction steps and synthetic style. The thesis body is divided into two main sections. The first section addresses the preparation of suitable ligand precursors of potential Au(I) and Ag(I) complexes in the form of halo- and phosphino-functionalised imidazolium salts. Several series of haloalkylimidazolium salts were prepared that encompass a range of halogens (Cl, Br, I), alkyl substituents (Me, i-Pr, t-Bu, n-Bu), differing alkyl linker length (n = 0-3), and a variety of organic spacers employed to bridge multi-imidazolium moieties. Novel bidentate and multidentate phosphinoalkylimidazolium salts were synthesised from the various haloalkylimidazolium salts, via the substitution of a halide with nucleophilic diphenylphosphide. A new approach towards rare methylene bridged phosphinomethylimidazolium salts was achieved from the reactions of halomethylimidazolium salts with diphenylphosphine. The second section investigates the preparation of Au(I) and Ag(I) complexes from the halo- and phosphino-functionalised imidazolium salts. A series of dicationic 10, 12, and 14-membered metallacyclic Ag(I) complexes were prepared from the bidentate phosphinoalkylimidazolium salts. The dinuclear Ag(I) metallacycles combine two phosphino-functionalised NHC ligands that are bridged by two coordinated Ag(I) ions in an exclusively head-to-head arrangement. A dinuclear Ag(I) metallacycle was investigated for transmetallation potential to a Au(I) complex and found to selectively transmetallate at the Ag(I) coordinated to the NHC ligands to form a bimetallic metallacycle. Unexpected phosphine oxidation of a 10-membered dinuclear Ag(I) metallacycle resulted in complex disproportionation to an isolable and rare silver(I) trimer. Metal-NHC complexes from haloalkylimidazolium salts have not been reported previously, a novel approach to the synthesis of a series of Au(I) complexes from haloalkylimidazolium salts and a respective gold source was developed and is reported herein. Different synthetic approaches towards Au(I) complexes with the phosphinoalkylimidazolium salts explored a variety of ways to generate the NHC from an imidazolium in the presence of the phosphine. A one-pot, high yielding synthesis of a dinuclear Au(I) complex from PPh3 was also devised, with controlled assembly of the complex resulting in a similar head-to-head ligand arrangement to the dinuclear Ag(I) metallacycles. As an aside, a family of mononuclear [Au(R2NHC)2]+ complexes (R = Me, i-Pr, t- Bu, n-Bu, Cy) prepared previously in our research group, was expanded because of the promising antimitochondrial activity shown by [Au(i-Pr2NHC)2]+. Two new [Au(R2NHC)2]+ complexes with simple alkyl chain functionality were prepared with fine-tuned lipophilicity in close proximity to that of [Au(i-Pr2NHC)2]+.

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Halpern, Melissa Dale. "The in vivo and in vitro effects of diethyldithiocarbamate on autoimmune New Zealand Black/White F₁ hybrid, MRL/Mp-lpr/lpr and related and normal murine strains." Diss., The University of Arizona, 1989. http://hdl.handle.net/10150/184940.

Texto completo

Resumen

New Zealand Black/White F₁ hybrid (NZB/W) and MRL/Mp-lpr/lpr (MRL/lpr) mice spontaneously develop a Systemic Lupus Erythematosus-like autoimmune disease. While the primary immunologic defect in the NZB/W is due to B cells, in the MRL/lpr it is a result of T cell abnormalities. Diethyldithiocarbamate (DTC), an agent suggested to enhance T cell function, was used to treat both strains. Weekly treatment of NZB/W mice with 25 mg/kg DTC had no significant effect upon survival or autoantibody levels but did induce changes in cell surface antigen expression. MRL/lpr mice treated with DTC displayed normalization of cell surface antigen expression (particularly increased expression of Lyt-2, macrophage markers and Lyt-2⁺/L3T4⁺ thymocytes), decreased lymphoproliferation and thymic atrophy, decreased serum autoantibody levels and kidney deposition of C3 and IgM, restored responses to mitogens and significantly prolonged survival. To determine both the influence of MRL background and lpr genes and to better understand on what cell populations DTC effects, changes in cell surface antigen expression were examined in DTC treated MRL-+/+, Balb/c, and Balb/lpr strains. The only consistent similarities observed between all strains tested were DTC induced changes in Mac-1 splenocyte surface antigen expression. In vitro studies showed DTC to have variable effects upon the mitogenic responses of lymphoid cells to phytohemagluttinin, but DTC alone stimulated both MRL/lpr and Balb/lpr lymphocytes. DTC stimulated the null cell population that predominates in lpr gene-bearing mice, but all observed in vitro effects of DTC were dependent upon the adherent cell population included in culture. DTC had no apparent direct effects upon adherent cells alone however. These studies have shown that DTC is capable of positive effects upon one autoimmune murine strain, the MRL/lpr, but not the NZB/W. DTC appears to affect macrophages, but other cell populations are required to obtain full activity of this compound. The variable effects of DTC emphasize the need to define the immunopathology of individual patients with autoimmune disease before initiating treatment with immunomodulative therapy.

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Horn, Je'nine. "The analysis of 6- and 24-hour iodine-131 thyroid uptake in patients with Graves' disease at Universitas Hospital." Thesis, [Bloemfontein?] : Central University of Technology, Free State, 2007. http://hdl.handle.net/11462/102.

Texto completo

Resumen

Thesis (M.Tech.)(Nuclear Medicine) -- Central University of Technology, free State, 2007 In the South African Health Services (SAHS) it is each health worker’s responsibility to find ways to reduce health care cost and improve health service to the public. The measurement of radioactive iodine uptake (RAIU) by the thyroid gland for diagnostic purposes has been used as early as the 1940s. The 24-hour (hr) iodine-131 (131I) uptake measurement is traditionally used for the calculation of the 131I administered activity for therapy dosage. This entails that the patient’s hospitalisation is prolonged, which increases the costs. The literature also indicates that the 24-hr 131I uptake value can be discarded and only the 6-hr 131I uptake measurement is needed to calculate administered activity for therapeutic dosages for Graves’ patients. Therefore, if it can be confirmed that the 6-hr 131I uptake measurement alone is needed, the SAHS could decrease hospitalisation costs. The overall goal of the investigation was to analyse the 6-hr and 24-hr 131I uptake measurements of patients with Graves’ disease at the Universitas Hospital. The aim was to determine the relationship between the 6-hr and 24- hr RAIU values to establish the therapeutic dosage for Graves’ disease. To achieve the aim, three objectives were set. First, to serve as a background to the investigation, a literature survey relating to the RAIU measurements of patients with Graves’ disease was made. Second, a retrospective analysis was performed by collecting the 6-hr and 24-hr 131I uptake measurements of patients with proven Graves’ disease at the Universitas Nuclear Medicine Department (UNMD). Finally, the data obtained from the retrospective analysis was analysed, summarised and compared to answer the investigation questions. The investigation group included patients with confirmed Graves’ disease who had undergone both the 6- and 24-hr 131I RAIU at the Universitas Hospital from the beginning of 2004 to the end of 2005. Graves’ disease is confirmed by the following factors at the UNMD, namely: Suppressed TSH, elevated T4 and T3 values, an increased uptake on the 99mTc-pertechnetate scan and increased 6- and 24-hr 131I RAIU values. The UNMD statistics show that 178 patients were diagnosed with Graves’ disease during this period. The patients of the investigation group included both male and female patients from different races, ranging from 15-75 years. In order to increase the validity of the investigation, all factors that could influence the accuracy of the 131I thyroid uptake test were excluded. After the exclusion and inclusion criteria had been applied, the final investigation group was made up of 124 Graves’ disease patients. The data obtained from the patient files was noted on the different data sheets (see Appendix A) for further analysis. The information from these data sheets was then used to obtain the investigation results. The Department of Biostatistics of the University of the Free State (UFS) was consulted for recommendations regarding the management of data and the processing of results. All values were summarised by means and Standard Deviations (SD) or percentiles. Mean or median differences were calculated with a 95% Confidence Interval (CI). A regression analysis was made between the 6-hr and 24-hr 131I RAIU values. The highest RAIU value is the best to calculate the therapeutic dosage, as this gives a true reflection of the thyroid function of a Graves’ disease patient. In the investigation group the median of the 24-hr 131I RAIU values was higher than the 6-hr 131I RAIU values. The findings showed that the 24-hr 131I RAIU in most of the investigation group was the highest value and most effective to calculate the 131I therapeutic dosage. At a time when research-based practice is taking on an increasingly important role, it is essential for nuclear medicine departments to make evidence-based recommendations. This investigation found that the correlation between the 6-hr and 24-hr RAIU clearly justified the cost spent on Graves’ disease patients who must stay overnight for the 24-hr 131I RAIU procedure.

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

Dilika, Fikile. "The medicinal value of Amaryllidaceae and Asteraceae species used in male circumcision." Thesis, Connect to this title online, 2002. http://upetd.up.ac.za/thesis/available/etd-04112007-153554/.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

"Drug action mechanism of platinum antitumour compounds: a DFT study." 2004. http://library.cuhk.edu.hk/record=b6073739.

Texto completo

Resumen

Pang Siu Kwong. "August 2004." Thesis (Ph.D.)--Chinese University of Hong Kong, 2004. Includes bibliographical references (p. 181-191) Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Mode of access: World Wide Web. Abstracts in English and Chinese.

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

Mukaya, Hembe Elie. "Macromolecular antineoplastic iron and platinum co-ordination compounds." Thesis, 2014.

Buscar texto completo

Resumen

A thesis submitted to the Faculty of Science, University of the Witwatersrand, Johannesburg, in fulfillment of the requirements for the degree of Doctor of Philosophy of Science. Johannesburg, 2013 Chemotherapy, while representing a vital component of cancer treatment modalities, has so far not fulfilled basic expectations with unsatisfactory cure rates and frequent relapse due to limited effectiveness of the therapeutic drugs, severe side effects and resistance problems. The platinumcontaining drugs used in present clinical practice are no exception to this generalized finding. While highly effective against a small number of malignancies, they generally share in the deficiencies of other anticancer agents. To address this issue, intense research is being undertaken to develop novel platinum-compounds offering enhanced therapeutic effectiveness. To accomplish this, several new avenues of development are being pursued world-wide, and one of these involving the binding of monomeric anticancer drug systems to water-soluble, biocompatible and biodegradable polymeric carriers, was utilized in the current research. As part of the ongoing research, this dissertation demonstrates the preparation of several water-soluble polymeric carriers bearing pre-synthesized monomers aimed to anchor the platinum drug. The monomers of interest were aspartic acid, p-aminobenzoic acid and p-aminosalicylic acid derivatives; while the water-soluble carriers were polyaspartamides, prepared by an aminolytic ring-opening process of polysuccinimide. The platination agents were conjugated to the polymer backbone both via amine and via leaving-group ligands, such as dihydroxylato, dicarboxylato and carboxylatohydroxylato. In order to demonstrate the multidrug-binding capacity of the carriers, platinum complexes were co-conjugated to polymeric conjugates containing ferrocene. The in vitro studies against a human breast cancer (MCF-7) cell line showed IC50 values ranging from 48.92 μg.mL-1 to 281.37 μg.mL-1 for the platinum conjugates, 13.18 μg.mL-1 to 149.67 μg.mL-1 for ferrocene conjugates and 6.22 μg.mL-1 to 83.86 μg.mL-1 for platinum/ferrocene co-conjugates; and these values were on average 4 fold more active than the parent drug. The results of these preliminary tests provide proof of the principle that polymer-drug conjugates can play a role in future cancer therapy.

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Keter, Frankline Kiplangat. "Palladium, platinum and gold complexes: a synthetic approach towards the discovery of anticancer agents." Thesis, 2010. http://hdl.handle.net/10210/3074.

Texto completo

Resumen

Ph.D. Ligands bis(pyrazolyl)acetic acid (L1) and bis(3,5-dimethylpyrazolyl)acetic acid (L2) were synthesised by reacting pyrazoles and dibromoacetic acid under phase transfer conditions, by using benzyltriethylammonium chloride as the catalyst. Ligands L1 and L2 were characterised by a combination of 1H, 13C{1H} NMR, IR spectroscopy and microanalysis. Esterification of L1 and L2 led to formation of bis(pyrazolyl)ethyl acetate (L3) and bis(3,5-dimethylpyrazolyl)ethyl acetate (L4). Ligands L3 and L4 were also characterised by a combination of 1H, 13C{1H} NMR, IR spectroscopy and microanalysis. Subsequently, new pyrazolyl palladium(II) and platinum(II) compounds, [PdCl2(L1)] (1), [PdCl2(L2)] (2), [PtCl2(L1)] (3a) and [PtCl2(L2)] (4) were prepared by reacting bis(pyrazolyl)acetic acid ligands (L1-L2) with K2[PdCl4] or K2[PtCl4] respectively. The structures of complex 1 and 2 reveal distorted square planar geometries. The bond angles of N-Pd-N, N-Pd-Cl, N-Pd-Cl, for 1 and 2 are between 85.8(3)o and 90.81(4)o). The platinum compound, K2[Pt4Cl8(L1)2(deprotonated-L1)2].2H2O (3b), crystallised from aqueous solutions containing 3a when such solutions were left to stand overnight. Each platinum coordination environment consists of two cis-Cl ligands and one K2-N^N(L1) unit (L1 = bis(pyrazolyl)acetic acid), with two ligand moieties in 3b that are deprotonated with two K+ counter ions. Reaction of bis(pyrazolyl)acetic acid ligands (L1-L2) with [HAuCl4].4H2O gave gold(III) complexes [AuCl2(L1)]Cl (5a) and [AuCl2(L2)]Cl (6a). The spectroscopic, mass spectroscopy and microanalysis data were used to confirm the formation of the desired complexes. However, attempts to crystallise 5a and 6a led to formation of [AuCl2(pz)(pzH)] (5b) and [AuCl2(3,5-Me2pz)(3,5-Me2pzH)] (6b). This was confirmed by the structural characterisation of 5b, which has a distorted square-planar geometry. When complexes 1-6a were screened for their anti-tumour activity against CHO-22 cells, they showed no appreciable biological activities against CHO-22 cells. Substitution reactions of complexes 1-6a with L-cysteine performed to probe any relationship between the observed antitumour activities and the rates of ligand substitution of these complexes were inconclusive. Dithiocarbamate ligands L5-L8 were synthesised as potassium salts by introducing a CS2 group in positions 1 of pyrazole, 3,5-dimethylpyrazole, indazole and imidazole. The reaction of L5-L8 with [AuCl(PPh3)], [Au2Cl2(dppe)], [Au2Cl2(dppp)] and [Au2Cl2(dpph)], led to isolation of complexes [Au(L)(PPh3)] (13-16), [Au2(L)2(dppe)] (17a-19), [Au2(L)2(dppp)] (20-22) and [Au2(L)2(dpph)] (23-25) (dppe = bis(diphenylphosphino)ethane, dppp = bis(diphenylphosphino)propane, dpph = bis(diphenylphosphino)hexane; L = anions of L5-L8). The mononuclear molecular structure of 15 features a near linear geometry with a P(1)-Au(1)-S(1) angle of 175.36(2) o. The binuclear gold(I) complexes 20-22 and 23-25 have two P-Au-S moieties as evident in the solid state structure of 25. Attempts to crystallise complex 17a led to the formation of a gold(I) cluster complex [Au18S8(dppe)6]2+ (17b) as confirmed by X-ray crystallography. Cluster 17b features weak Au···Au interactions (2.9263(7)-3.1395(7) Å). Complexes 13-16 and 20-25 were tested in vitro for anticancer activity on HeLa cells. The activities of gold(I) complexes 13-16 were comparable to that of cisplatin. Dinuclear gold(I) complexes 20-25 also showed appreciable antitumour activity against HeLa cells. However, the dpph gold(I) compounds (23-25) were highly active, with 24 showing the highest activity against HeLa cells (IC50 = 0.1 μM). The tumour specificity (TS) factors for 23 and 24 were 31.0 and 70.5, respectively.

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

"Quantitative structure activity relationship (QSAR) of platinum drugs." 2006. http://library.cuhk.edu.hk/record=b5896517.

Texto completo

Resumen

Leung Chung Wai. Thesis (M.Phil.)--Chinese University of Hong Kong, 2006. Includes bibliographical references (leaves 142-146). Abstracts in English and Chinese. ABSTRACT (ENGISH) --- p.iii ABSTRACT (CHINESS) --- p.v ACHKNOWLEDGEMENTS --- p.vii TABLE OF CONTENTS --- p.viii Chapter CHAPTER 1 --- Introduction and Background Chapter 1.1 --- Introduction of Platinum Drugs --- p.1 Chapter 1.2 --- Mechanism of Action of Cisplatin --- p.3 Chapter 1.3 --- Structure-Activity Relationships of the Platinum Drug 、 --- p.4 Chapter 1.4 --- QS AR Parameters --- p.9 Chapter 1.4.1 --- Chemical Hardness: Descriptor of Chemical Reactivity --- p.9 Chapter 1.4.2 --- Possible Reaction Pathway of Platinum Drugs --- p.12 Chapter 1.4.2.1 --- Proposed DNA Binding Pathway of Platinum Drugs --- p.13 Chapter 1.4.2.1.1 --- Hydrolysis Pathway --- p.13 Chapter 1.4.2.1.2 --- DNA Binding Pathway Involving the S-containing Biomolecules (Methionine Pathways) --- p.16 Chapter 1.4.2.1.3 --- Conclusion --- p.21 Chapter 1.5 --- Thesis Scope --- p.22 Chapter CHAPTER 2 --- Theory and Methodology Chapter 2.1 --- Introduction --- p.24 Chapter 2.2 --- Density Functional Theory (DFT) --- p.24 Chapter 2.2.1 --- Kohn-Sham Theorem --- p.25 Chapter 2.2.2 --- Exchange-Correlation Energy Functional --- p.27 Chapter 2.3 --- Basis Set --- p.27 Chapter 2.3.1 --- Relativistic Effective Core Potential --- p.27 Chapter 2.3.2 --- Double-Zeta --- p.28 Chapter 2.3.3 --- Polarized Basis Set --- p.29 Chapter 2.4 --- Solvation Model --- p.30 Chapter 2.4.1 --- Continuum Model --- p.30 Chapter 2.4.1.1 --- Simple Solvation Model --- p.31 Chapter 2.4.1.1.1 --- Electrostatic Component --- p.31 Chapter 2.4.1.1.2 --- Dispersion-Repulsion Interaction --- p.33 Chapter 2.4.1.1.3 --- Cavitatoin Energy --- p.35 Chapter 2.4.1.2 --- Polarized Continuum Model --- p.36 Chapter 2.5 --- Methodology --- p.39 Chapter 2.5.1 --- Calculation of DFT Global Reactivity Index --- p.39 Chapter 2.5.1.1 --- Calculation for the Reaction Intermediates --- p.41 Chapter 2.5.2 --- Calculation of the Reaction Pathways --- p.42 Chapter CHAPTER 3 --- Results and Discussion Chapter 3.1 --- Introduction --- p.49 Chapter 3.2 --- Optimized Structure against Experimental Geometry --- p.49 Chapter 3.3 --- Kohn-Sham Orbitals --- p.54 Chapter 3.3.1 --- Location of the HOMO and LUMO --- p.55 Chapter 3.4 --- Results of the DFT Reactivity Parameter --- p.57 Chapter 3.5 --- Chemical Structure of the Drugs in the QSAR --- p.64 Chapter 3.6 --- QSAR Analysis --- p.67 Chapter 3.6.1 --- The Overall QSAR Plot of the Platinum Drugs --- p.68 Chapter 3.6.1.1 --- Empirical Applicability of the QSAR on the Platinum(IV) Drugs --- p.70 Chapter 3.6.1.2 --- Detail QASR Study According to the Type of Platinum Drug --- p.71 Chapter 3.6.1.2.1 --- QSAR Study of the non-“trans-DACH´ح Platinum Drugs --- p.72 Chapter 3.6.1.2.1.1 --- "QSAR Equation of the non-""trαns-DACH"" Platinum Drugs" --- p.75 Chapter 3.6.1.2.2 --- QSAR Analysis for the Pt-trαns-DACH Drugs --- p.77 Chapter 3.6.1.2.2.1 --- "QSAR Study of trans-S,S-DACH Platinum Drugs" --- p.79 Chapter 3.6.1.2.2.2 --- "QSAR Study of trans-R,R-DACH Platinum Drugs" --- p.80 Chapter 3.6.1.3 --- Summary --- p.81 Chapter 3.7 --- QSAR Study of the Important Intermediates Using Chemical Hardness --- p.82 Chapter 3.7.1 --- Optimized Structure for the Intermediates --- p.84 Chapter 3.7.2 --- QSAR of the Dichloride Pt-Drugs Using Chemical Hardness of Parent Compounds --- p.90 Chapter 3.7.3 --- QSAR of the Dichloride Pt-Drugs Using Chemical Hardness of Hydrolysis Intermediates --- p.91 Chapter 3.7.4 --- QSAR of the Dichloride Pt-Drugs Using Chemical Hardness of Cyclic-Methionine Intermediates --- p.93 Chapter 3.7.5 --- Conclusion --- p.95 Chapter CHAPTER 4 --- Results and Discussion Chapter 4.1 --- Introduction --- p.96 Chapter 4.2 --- Study Scheme --- p.97 Chapter 4.3 --- Optimized Structures --- p.98 Chapter 4.4 --- Comments on the Reliability of the Calculation Model --- p.103 Chapter 4.4.1 --- Reaction Profile in the Gas Phase --- p.104 Chapter 4.4.2 --- Reaction Profiles Using Simple Solvation Model --- p.105 Chapter 4.4.2.1 --- Defects of the Simple Solvation Model --- p.107 Chapter 4.4.3 --- Reaction Profile Using PCM-UAHF Solvation Model --- p.109 Chapter 4.4.3.1 --- Selection of the Reaction Parameters for the QSAR Study --- p.112 Chapter 4.5 --- QSAR Study of Platinum Drugs Using the Reaction Parameters (AG and ΔG+) --- p.121 Chapter 4.5.1 --- QSAR Analysis Using ΔG+(hydrolysis) --- p.121 Chapter 4.5.2 --- QSAR Analysis Using ΔG(hydrolysis) --- p.123 Chapter 4.5.3 --- QSAR Analysis Using ΔG+(guanine) --- p.125 Chapter 4.5.4 --- QSAR Analysis Using ΔG(guanine) --- p.127 Chapter 4.5.5 --- Further investigation of the Bidentate Pt-drugs DNA Binding --- p.129 Chapter 4.5.5.1 --- Calculation Model --- p.129 Chapter 4.5.5.2 --- Bidentate Pt-Drugs Reactions --- p.130 Chapter 4.5.5.3 --- Selection of the Calculated Model for the QSAR Study --- p.133 Chapter 4.5.5.4 --- QSAR Analysis Using ΔG+(guanine) for the Platinum Drugs with Bidentate Caboxylate Ligands --- p.136 Chapter 4.5.5.5 --- QSAR Analysis Using ΔG(guanine) for the Platinum Drugs with Bidentate Carboxylate Ligands --- p.137 Chapter 4.5.6 --- Conclusion --- p.138 Chapter CHAPTER 5 --- Conclusion Remarks and Future Works Chapter 5.1 --- Conclusion --- p.140 Chapter 5.2 --- Future Works --- p.141 REFERENCES --- p.142

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

"Synthesis and evaluation of nitrogen-and phosphorus-donor platinum and gold complexes as anti-cancer agents." Thesis, 2010. http://hdl.handle.net/10210/3086.

Texto completo

Resumen

Ph.D. Chapter 1 presents a brief overview on the development of platinum, ruthenium and gold anti-cancer complexes. The clinical success of cisplatin has been a tremendous impetus for the design of metal-based antitumor drugs. Its mechanism of action is therefore briefly discussed, as well as the toxic side effects of its clinical use and the cellular resistance to the drug. It is its side effects and drug resistance that have stimulated the development of cisplatin analogues and other metal based anti-cancer agents. Compounds showing most promise are ruthenium complexes which are structurally different but have the same stability and show similar modes of binding to DNA. The last part of the introduction deals with the development of gold(I) and gold(III) complexes, the main topics of the research described in this thesis. Chapter 2 reports on the attempted preparation of dppf and dippf gold(III) complexes. However, the reaction of these diphosphines with H[AuCl4] and Na[AuCl4] all led to isolation of gold(I) complexes (dppf)Au2X2 (X = Cl (1), Br (3)) and (dippf)Au2X2 (X = Cl (2), Br (4)). In an attempt to oxidize the gold(I) complexes, (dppf)Au2Br2 (3) and (dippf)Au2Br2 (4) were reacted with excess bromine yielding two new complexes (C5H4Br3)(PR2)AuBr (R = Ph, 5; R = i-Pr, 6). This bromination reaction could be extended to the ligands and bromination of the free diphosphinoferrocene ligands produced the expected brominated cyclopentenes (C5H4Br3)(PR2) (R = Ph, 7; R = i-Pr, 8) in good yields. However, these could not be complexed to gold due to reduced basicity of 7 and 8. When the bromination was performed under wet aerobic conditions the oxidized pseudo-centrosymmetric product, [doppf][FeBr4] (9) {doppf = 1,1’-bis(oxodiphenylphosphino)ferrocene, was obtained as the major product. Solid-state structures of 1, 2, 4, 6, and 9 were established by means of single-crystal X-ray crystallography. Chapter 3 reports on the use of chiral Josiphos and Walphos diphosphine ligands to form palladium, platinum and gold complexes. The platinum complexes were prepared by reacting the ligands with [PtCl2(cod)] while the palladium complexes were prepared from [PdCl2(NCMe)2]. The complexes obtained had the general formula [MCl2(P-P)], where M = Pd, Pt, and P-P = Josiphos or Walphos ligand, and were obtained in good yields. The X-ray structures of a palladium(II) and a platinum(II) complex of the same Josiphos ligand were determined. The Josiphos complexes 12 and 14 show good solubility in common solvents. Furthermore, the complexes remained soluble and stable in a 40:60 water:DMSO mixture. The Walphos complexes 13 and 15 rapidly precipitated under the same conditions. In line with this limited solubility 13 and 15 showed minimal cytotoxic effects when compared to their Josiphos counterparts 12 and 14 whose cytotoxic effects (in terms of IC50 values ) were six to seven times less than cisplatin. Reaction of the Walphos ligand and H[AuCl4] in a 1:1 ratio gave a dinuclear gold(I) complex 18 while the same reaction with Josiphos gave a mixture of intractable materials. However a 1:1 reaction of the Josiphos with AuCl(tht) gave a mononuclear three-coordinate gold(I) complex 16. A P^N chiral ligand comprising of a diphenylphosphine and a pyrazole moiety was also prepared and was complexed with AuCl(tht) to give a phosphine bound gold(I) complex 19. The structure of this complex was determined by X-ray studies. From the studies it became evident that apart from increasing the basicity of compound the pyrazolyl moiety remains dangling and the complex shows bond parameters similar to those observed with monophosphine ferrocenyl complexes. Chapter 4 reports on the bidentate and monodentate gold(III) complexes based on the (pyrazolylmethyl)pyridine ligands together with their platinum(II) complexes. The denticity of the complexes depended on the position of the pyrazolyl moiety relative to the pyridine nitrogen. When ortho-substituted ligands were reacted in a 1:1 ratio with H[AuCl4] in a mixture of water and ethanol at room temperature, bidentate cationic complexes of the general formula [AuCl2(PyCH2R2pz)][X], where R = Me (20), X = AuCl4-; R = Ph (21), X = Cl-; t-Bu (22), X= Cl- and p-tol (23), X = AuCl4-, were obtained. When para-substituted ligands were used under same reaction conditions, neutral monodentate complexes [AuCl3(PyCH2R2pz)], where R = Me (24) and R = Ph (25), were obtained. Platinum(II) complexes were obtained using K2[PtCl4] in a mixture of water and ethanol under reflux, and affords neutral complexes of the type [PtCl2(PyCH2R2pz)], where R = Me (27), Ph (28), t-Bu (29) and p-tol (30). When acetone was used instead of ethanol monoacetonylplatinum(II) complex (29a) was formed and on prolonged heating formation of the diacetonyl complex (28b) was observed. Both the platinum and the gold complexes were evaluated for their anti-cancer potency. The gold(III) complexes were devoid of any activity while the platinum complex 30 showed activity 8 times lower than cisplatin. The structures of 23, 25, 28, 29 and 29a were determined from single-crystal X-ray diffraction studies. In Chapter 5, tridentate complexes based on bis(pyrazolylethyl)amine are reported. These were prepared with the aim of improving water-solubility and cytotoxicity of the resulting complexes. New synthetic methods for preparation of the ligands NH(CH2CH2pz)2 (R = Me (L7), H (L8), t-Bu (L9)) under mild reaction conditions were developed albeit the yields obtained were generally low. The reaction of these ligands with H[AuCl4] gave corresponding tridentate dicationic gold(III) complexes [NH(CH2CH2pz)2][X]2 (R = Me (31), H (32), X = AuCl4 , and R = t-Bu (33), X = Cl-). Despite the ligands stabilizing the gold(III) ion, they showed no solubility in water. In an attempt to make the ligand system water soluble, a thiocarbamate analogue with pyrazolyl groups replaced by hydroxyl groups was prepared. However the resulting gold(III) complex [Au{CS2N(CH2CH2OH)2}2][AuCl2] (34) was found to be only soluble in DMSO.

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

Fountain, Mark Edward 1960. "Synthesis and studies of gadolinium texaphyrin conjugates and model platinum therapeutic agents." 2008. http://hdl.handle.net/2152/17855.

Texto completo

Resumen

The experimental cancer therapeutic agent gadolinium texaphyrin (MGd) is a cationic paramagnetic expanded porphyrin currently being tested as an X-Ray sensitizing (XRS) agent, and is a compound with demonstrated tumor localization. Additionally MGd shows promise as a chemotherapeutic agent, both as a stand-alone agent, and showing activity in vitro with ascorbate via a novel ROS generating mechanism.3 This dissertation reports the synthesis, characterization, and cell studies of novel MGdfluorophore, and platinum therapeutic conjugates. Also discussed are cationic Pt agents having cytotoxic activity. In this research we set out to answer three questions: i) can fluorescent conjugates of MGd be synthesized, with observable subcellular localization, different from that of MGd, ii) can MGd-Pt conjugates with observable Pt release be synthesized?, and iii) can Pt compounds containing a cationic moiety be tuned to have efficacy comparable to traditional Pt therapeutic agents? Two MGd-xanthene fluorophore conjugates were synthesized with the goal of using them to probe sub-cellular distribution. The anionic (FITC), and cationic (Rhodamine), fluorophore conjugates demonstrated nuclear and mitochondrial localization, respectively. In an ongoing project designed to reduce non-specific agent toxicity, a platinumreleasing MGd therapeutic conjugate was synthesized. The MGd-amidopropylmalonato-Pt conjugate demonstrated efficacy equivalent to carboplatin, a classical “non-selective” agent as inferred from in-vitro studies with A549 lung cancer cells. Aqueous stability studies of this conjugate gave results in agreement with hydrolytic loss of Pt, reversible with added Pt-diaquo. Finally, Pt complexes of amino-1-benzylpyridinium salts were synthesized and found to demonstrate significant cytotoxicity in screening studies. This latter positive development led to the suggestion that complexes of this type could consititute a new class of lipophilic-quaternary-cation Pt therapeutic agents. It is hoped that this series of putative Pt anti-cancer agents will prove useful as both stand-alone therapeutic agents and as the basis for producing conjugate with biolocalizing properties. text

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

"Quantitative structure activity and property study of platinum drugs." Thesis, 2008. http://library.cuhk.edu.hk/record=b6074538.

Texto completo

Resumen

Chemical hardness (eta), calculated by density functional theory (DFT), was firstly used as one of the chemical reactivity descriptors to set up the one descriptor 2D-QSAR model of platinum drugs. In this simple but promising model, the antitumour activities (log GI50) evaluated by National Cancer Institute (NCI) of structure-based groups containing normal sp 3 nitrogen and R,R-diamminecyclohexane (R,R-DACH) as the ligand showed good correlation. It was also demonstrated that silane and stereoisomers of DACH groups showed special patterns. This study also made use of the COMPARE program from NCI to evaluate the activity profile and the analysis of the data revealed these distinct patterns are influenced by the mechanism of the drugs. Computer-aided drug design (CADD) techniques have been applied to establish quantitative structure-activity relationships (QSAR) and quantitative structure- property relationships (QSPR) models. Although these techniques are widely used in organic drugs, new metal-based drugs were hindered from development for lack of metal parameters, such as potent new platinum drugs as a major group of drugs used in cancer treatment. The purpose of the present study, therefore, is to generate novel platinum parameters based on previous work and then set up the simple QSAR/QSPR model with predictive abilities. Finally, two 3D-QSAR and 3D-QSPR models obtained using Sybyl software. One was for demethylcantharidin (DMC) analogues as phosphatase 2A (PP2A) inhibitors. The other was describing the hydrophobicity of platinum drugs. In this research, the platinum atom was introduced to Sybyl and thus made it possible for the first time to use comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) methods to investigate platinum drugs. All 3D models indicated good predictive ability and thus provided an effective method to design new potent platinum drugs. To clarify the pattern of stereoisomers of the DACH group, new platinum parameters was introduced to the AMBER software successfully. Moreover, stereoisomers of the DACH group which formed 1,2-GG intrastrand cross-links with DNA were studied by molecular dynamics (MD) simulations using AMBER. The calculated binding energies between R,R-DACH-Pt, S,S-DACH-Pt and cis-DACHPt moieties and DNA revealed a strong correlation with antitumour activities. The result provided more clues to understand the biological interactions of chiral platinum drugs. DNA structure analysis indicated that DNA tolerated the distortion resulted in the different Pt-DNA adducts and various local and global structure distortions were found. Natural bond orbital (NBO) analysis of hydrogen bonding on Pt-DNA adducts at a AGGC site revealed that R,R-DACH-Pt moiety alleviated the repulsion by unwinding the DNA, whereas the S,S-DACH-Pt adduct avoided the interaction by distorting the H bonds of binding site basepairs. Hence, the structural differences of chiral platinum drug led to its distinct activity. Yang, Lifeng. "June 2008." Advisers: Steve C. F. Au Yeung; Yee-Ping Ho. Source: Dissertation Abstracts International, Volume: 70-03, Section: B, page: 1541. Thesis (Ph.D.)--Chinese University of Hong Kong, 2008. Includes bibliographical references (p. 159-172). Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Electronic reproduction. [Ann Arbor, MI] : ProQuest Information and Learning, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Abstracts in English and Chinese. School code: 1307.

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

"Anticancer activity and mechanistic study of a series of platinum complexes integrating demethylcantharidin with isomers of 1,2-diaminocyclohexane." Thesis, 2006. http://library.cuhk.edu.hk/record=b6074234.

Texto completo

Resumen

Aim. The aim of this study was to synthesize and characterize novel analogues of [DACH-Pt-DMC] by using different stereoisomers of DACH; and to investigate any differences in in vitro activity of these complexes in human hepatocellular carcinoma (HCC), colorectal carcinoma (CRC) cell lines and acquired cisplatin or oxaliplatin resistant sub-lines, and to compare that of oxaliplatin and other established Pt-based anticancer agents. Mechanistic roles of DACH-Pt- and DMC components of the TCM-Pt complexes on affecting HCT 116 human CRC cell line were investigated by flow cytometry, COMET assay and cDNA microarray analysis. Background. Demethylcantharidin (DMC), a modified component of the traditional Chinese medicine (TCM), integrated with a platinum (Pt) moiety created a series of TCM-Pt complexes [Pt(C8H8O 5)(NH2R)2] 1-5 which demonstrated superior antitumor activity and circumvention of cisplatin resistance in vitro. Compound 5, derived from the 1,2-diaminocyclohexane (DACH) ligand (where R=trans-C6H10) had the most potent antitumor activity and closest structural resemblance to oxaliplatin (R,R-DACH-Pt complex) which is the first Pt-based anticancer drug to demonstrate convincing clinical activity against colorectal cancer and has a mechanism of action and resistance that is clearly different from that of cisplatin and carboplatin. Conclusion. This study is the first to examine the mechanism of anticancer activity of new complexes that integrate DMC with different isomers of DACH. It has shown that both DACH-Pt- and DMC components contribute significantly to the compounds' potent anticancer activity, but likely with different mechanisms of action. The DACH-Pt- component appears to dictate the cell cycle distribution, whereas the DMC component appears to enhance cytotoxicity by inducing more DNA damage in HCT 116 colorectal cancer cells. Methods. DMC was reacted with appropriate DACH-Pt-(NO3) 2 intermediates, which were prepared from treatment of K2PtCl 4 with stereoisomeric DACH (RR-, SS- & cis-), followed by reaction with silver nitrate. Proton NMR, high-resolution MS, polarimetry and circular dichroism (CD) spectroscopy were used to characterize their chemical structures and optical activities. In vitro antitumor activity (IC50 of 72hr drug exposure time) were assessed by a standard MTT assay. Cell cycle analysis by flow cytometry was determined at 0, 6, 12, 18, 24, 48 and 72 h after drug treatment (cisplatin, carboplatin, oxaliplatin, DMC, compound 1 or trans-DACH-Pt-DMC analogues) at IC50 and 5 x IC50 concentrations with three to four replicates. Comet assay was performed with a fluorescent microscope and used to examine DNA damage after drug treatments (50muM of cisplatin, carboplatin, oxaliplatin, DMC, compound 1 or R,R-DACH-Pt-DMC) for 3hr. cDNA microarray was performed on Affymetrix Human Genome U133A Set and used to analyze gene expression profiles in HCT 116 exposed to trans-(+/-)-DACH-Pt-DMC or oxaliplatin at their IC50 for 72hr. Results. The in vitro results showed that the trans-analogues were consistently the most potent amongst all the compounds tested in both HCC and CRC cell lines: the trans-(+)(1R,2R)-DACH-Pt-DMC complex, in particular, was the most effective stereoisomer. All of the stereoisomeric DACH-Pt-DMC complexes and oxaliplatin were apparently able to circumvent cisplatin resistance in Huh-7 and SK-Hep1 sub-lines, but cross resistant with oxaliplatin in HCT 116 oxaliplatin resistant sub-line. Flow cytometric analysis revealed the novel trans-DACH-Pt-DMC analogues and oxaliplatin behaved similarly: that is, the compounds at 5 x IC50 concentrations all caused a significant decrease in the S-phase population within 18h and at the same time induced G2/M arrest, and without obvious sub-G 1 phase accumulation, but distinct from that of cisplatin, carboplatin or DMC. Comet assay showed that trans-(+)-(1R,2 R)-DACH-Pt-DMC caused the most significant DNA damage at an equivalent molar concentration. Microarray analysis suggested that the mechanistic role of the DMC ligand can induce the cell cycle to accelerate from the G 1 to S-phase and cause M-phase arrest. Yu Chun Wing. "July 2006." Advisers: Yee-ping Ho; Chik Fun Steve Au-Yeung. Source: Dissertation Abstracts International, Volume: 68-03, Section: B, page: 1586. Thesis (Ph.D.)--Chinese University of Hong Kong, 2006. Includes bibliographical references (p. 191-232). Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Electronic reproduction. [Ann Arbor, MI] : ProQuest Information and Learning, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Abstracts in English and Chinese. School code: 1307.

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

"In vitro evaluation of potential drug combination in cancer therapy: demethylcantharidin and platinum drug." 2007. http://library.cuhk.edu.hk/record=b5893106.

Texto completo

Resumen

Ng, Po Yan. Thesis submitted in: November 2006. Thesis (M.Phil.)--Chinese University of Hong Kong, 2007. Includes bibliographical references (leaves 109-120). Abstracts in English and Chinese. Acknowledgement --- p.i Abstract --- p.ii 摘要 --- p.iii Table of Contents --- p.iv List of Figures --- p.viii List of Tables --- p.xi List of Abbreviation --- p.xii Chapter Chapter 1 --- Introduction Chapter 1.1 --- A General Introduction to the Development and Clinical Activities of Platinum Drugs --- p.1 Chapter 1.1.1 --- Platinum Drugs used in a Clinical Setting --- p.4 Chapter 1.1.2 --- Platinum Drugs under Clinical Trials --- p.5 Chapter 1.1.3 --- Platinum Compounds with Dual Mechanisms --- p.7 Chapter 1.2 --- Platinum Drug Antitumor Mechanism --- p.9 Chapter 1.3 --- Limitations of Platinum Drugs --- p.12 Chapter 1.3.1 --- Toxicity --- p.12 Chapter 1.3.2 --- Drug Resistance or Cross Resistance --- p.15 Chapter 1.3.2.1 --- Reduced Drug Accumulation or Increased Drug Efflux --- p.16 Chapter 1.3.2.2 --- Drug Inactivation --- p.18 Chapter 1.3.2.3 --- Enhanced DNA Repair --- p.19 Chapter 1.4 --- Why Combinational Therapy? --- p.21 Chapter 1.4.1 --- Antimetabolites --- p.20 Chapter 1.4.2 --- Topoisomerase Inhibitors --- p.22 Chapter 1.4.3 --- Tubulin-Active Antimitotic Agents --- p.24 Chapter 1.4.4 --- Demethylcantharidin as a potential candidate for drug combination --- p.28 Chapter 1.5 --- Study Objectives --- p.31 Chapter Chapter 2 --- Materials and Methods Chapter 2.1 --- Cell Lines --- p.33 Chapter 2.2 --- Cancer Cell Preparation Chapter 2.2.1 --- Chemicals and Reagents --- p.33 Chapter 2.2.2 --- Cell Culture Practice --- p.34 Chapter 2.2.2.1 --- Subcultures --- p.35 Chapter 2.2.2.2 --- Cryopreservation --- p.37 Chapter 2.2.2.3 --- Thawing Cryopreservated Cells --- p.38 Chapter 2.2.3 --- Development of Drug-Resistant Cell Lines --- p.39 Chapter 2.3 --- Growth Inhibition Assay Chapter 2.3.1 --- Evaluation of Cytotoxicity in vitro --- p.40 Chapter 2.3.2 --- Drug Pretreatment --- p.43 Chapter 2.3.3 --- Drug Pre-sensitization with Concurrent Treatment --- p.44 Chapter 2.4 --- Calculations for Drug Combinations --- p.46 Chapter 2.5 --- Statistical Analysis --- p.49 Chapter Chapter 3 --- Results and Discussions Chapter 3.1 --- In vitro Cytotoxicity and Evaluation of Drug Resistance --- p.50 Chapter 3.2 --- Role of Leaving Ligand in a Platinum Complex --- p.58 Chapter 3.3 --- Priority in Selecting the Most Effective Drug Combination --- p.66 Chapter 3.4 --- Drug Combination Studies Chapter 3.4.1 --- Drug Combination Prescreening --- p.68 Chapter 3.4.1.1 --- Comparison of the effectiveness of the three Drug Combinations --- p.72 Chapter 3.4.1.2 --- Rationale for Drug Combination Studies presented in Section 3.4.2 & 3.4.3 --- p.73 Chapter 3.4.2 --- Drug Pre-sensitization Studies in Colorectal Cancer Cell Lines --- p.74 Chapter 3.4.2.1 --- Comparison of Drug Pre-sensitization Treatment in Sensitive Colorectal Cancer Cell Lines --- p.84 Chapter 3.4.2.2 --- Comparison of Drug Pre-sensitization Treatment in Sensitive and Oxaliplatin Resistant HCT116 Colorectal Cancer Cell Lines --- p.87 Chapter 3.4.3 --- Drug Pre-sensitization Studies in Liver Cancer Cell Lines --- p.89 Chapter 3.4.3.1 --- Comparison of Drug Pre-sensitization Treatment in Sensitive Liver Cancer Cell Lines --- p.99 Chapter 3.4.3.2 --- Comparison of Drug Pre-sensitization Treatment in Sensitive and Cisplatin Resistant SK-Hepl Liver Cancer Cell Line --- p.101 Chapter 3.5 --- Possible Explanation to the Observed Drug Combination Effect --- p.103 Chapter 3.6 --- General Protocols for Drug Combinations --- p.105 Chapter Chapter 4 --- Conclusions Reference --- p.109 Appendices --- p.121 Chapter I a. --- "Raw Data of Pre-screening for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.122 Chapter I b. --- "Raw Data of Pre-screening for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.123 Chapter II a. --- "Raw Data of Pre-screening for SK-Hepl (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.124 Chapter II b. --- "Raw Data of Pre-screening for SK-Hepl ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.125 Chapter III a. i) --- "Isobolograms for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.126 Chapter III a. ii) --- "Raw Data for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.127 Chapter III b. i) --- "Isobolograms for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.128 Chapter III b. ii) --- "Raw Data for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.129 Chapter IV a. i) --- "Isobolograms for HCT1160xaR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.130 Chapter IV a. ii) --- "Raw Data for HCT1160xaR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.131 Chapter IV b. i) --- "Isobolograms for HCT1160xaR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.132 Chapter IV b. ii) --- "Raw Data for HCT1160xaR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.133 Chapter V a. i) --- "Isobolograms for HT29 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.134 Chapter V a. ii) --- "Raw Data for HT29 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.135 Chapter V b. i) --- "Isobolograms for HT29 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.136 Chapter V b. ii) --- "Raw Data for HT29 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.137 Chapter VI a. i) --- Isobolograms for Hep G2 (Cisplatin and [Pt(DMC)(NH3)2]) --- p.138 Chapter VI a. ii) --- Raw Data for Hep G2 (Cisplatin and [Pt(DMC)(NH3)2]) --- p.139 Chapter VI b. i) --- "Isobolograms for Hep G2 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.140 Chapter VI b. ii) --- "Raw Data for Hep G2 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.141 Chapter VII a. i) --- "isobolograms for SK Hep 1 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.142 Chapter VII a. ii) --- "Raw Data for SK Hep 1 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.143 Chapter VII b.i) --- "Isobolograms for SK Hep 1 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.144 Chapter VII b. ii) --- "Raw Data for SK Hep 1 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.145 Chapter VIII a. i) --- "Isobolograms for SK Hep ICisR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.146 Chapter VIII a. ii) --- "Raw Data for SK Hep ICisR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.147 Chapter VIII b. i) --- "Isobolograms for SK Hep ICisR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.148 Chapter VIII b. ii) --- "Raw Data for SK Hep ICisR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.149

Los estilos APA, Harvard, Vancouver, ISO, etc.

44

Woodhouse, Susan Louise. "Multinuclear platinum (II) complexes containing carboranes for potential use in boron neutron capture therapy / by Susan Louise Woodhouse." 2004. http://hdl.handle.net/2440/22042.

Texto completo

Resumen

"January 2004" Bibliography: leaves 163-184. v, 184 leaves : ill. (some col.), photos ; 30 cm. Title page, contents and abstract only. The complete thesis in print form is available from the University Library. Thesis (Ph.D.)--University of Adelaide, School of Chemistry and Physics, Discipline of Chemistry, 2004

Los estilos APA, Harvard, Vancouver, ISO, etc.

45

Lynch, Mark James. "Metal complexes as potential anticancer agents." Phd thesis, 1994. http://hdl.handle.net/1885/141415.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

46

"Novel traditional Chinese medicine-platinum compound that bypasses mitotic DNA damage checkpoints in cancer cells." Thesis, 2010. http://library.cuhk.edu.hk/record=b6074932.

Texto completo

Resumen

Aim: Cisplatin is the first platinum drug that shows promising anti-tumor effect clinically. Oxaliplatin, a third-generation platinum drug that incorporates a diaminocyclohexane (DACH) structural entity, can overcome cisplatin resistance. R,R-5, a novel platinum compound that integrates the DACH entity with a demethylcantharidin (DMC) component that is derived from a traditional Chinese medicine (TCM) , can also overcome cisplatin resistance. The principal objectives of this study was to investigate in detail, the effect of these compounds at the antephase and G2 checkpoints of the cell cycle, and to establish the relationship (if any) between different structural entities with checkpoint activation. The ultimate aim of the study was to ascertain the potential for the development of novel checkpoint abrogators as anti-tumor agents. Background: A common procedure in current cancer chemotherapy is to induce genomic stress in cancer cells, leading to irreparable DNA damage and eventually cell death. However, there are several DNA repair mechanisms in cancer cells to maintain genomic stability, which require cell cycle checkpoints to stop cell proliferation for DNA damage repair, thereby avoiding errors in cellular events like DNA replication, transcription and mitosis. Among these cell cycle checkpoints, antephase and G2 checkpoints are two gate checkpoints for mitosis. Abrogation of G2 checkpoint has been reported to give rise to synergistic cytotoxic effect with DNA damaging agents, representing a means of circumventing drug resistance in chemotherapy. Conclusions: Acute stress to cisplatin can activate the MMR/c-Abl/MEKK1/p38MAPK pathway, leading to the activation of antephase checkpoint, and stop cells from entering mitosis immediately. DACH-containing platinum compound oxaliplatin fails to activate this antephase checkpoint. However, both cisplatin and oxaliplatin can activate the G2 checkpoint, which can be abrogated by DMC. In contrast, RR-5 can bypass both the antephase and G2 checkpoints. In summary, novel TCM-platinum compound R,R-5 can bypass mitotic DNA damage checkpoints in cancer cells and thus has the potential for further development as an anti-cancer drug. Methods: Microarray analysis was used to detect gene transcription profiles after drug treatments. The activation of mitotic checkpoints was inspected by counting mitotic cells and utilizing flow cytometry. Using Western blotting, the activation of certain key players in the antephase and G2 checkpoint was revealed. MTT assays were performed to show the outcome of checkpoint activation. Results: In HCT116 cells, 35 genes that facilitate G2/M transition were found to be up-regulated after R,R-5 treatment compared with oxaliplatin in the microarray analysis, implying the bypass of mitotic checkpoints by R,R-5 rather than oxaliplatin. Acute stress (2 hour) of cisplatin activated the antephase checkpoint, resulting in a rapid decrease in mitotic index and phosphorylation of histone H1, which avoided mitotic catastrophe and promoted cell survival in HeLa cells. Further experiments demonstrated that this antephase checkpoint could be abrogated by c-Abl and p38MAPK inhibitors, or siRNAs against c-Abl or MEKK1, suggesting that this checkpoint may be controlled by an MMR/c-Abl/MEKK1/p38MAPK pathway. In contrast, oxaliplatin and R,R-5 did not activate this antephase checkpoint. Moreover, after 24 hour oxaliplatin treatment in HeLa cells, the mitotic index and CDK1 activity were decreased, which could be restored by concomitant treatment with ATM/ATR inhibitor and DMC. This indicated the activation of G2 checkpoint by oxaliplatin and implied that DMC can abrogate oxaliplatin-activated G2 checkpoint by restoring CDK1 activity. Cisplatin could also activate G2 checkpoint, whereas R,R-5 apparently bypassed this G2 checkpoint. Guan, Huaji. Adviser: Vincent Hon Leung Lee. Source: Dissertation Abstracts International, Volume: 72-04, Section: B, page: . Thesis (Ph.D.)--Chinese University of Hong Kong, 2010. Includes bibliographical references (leaves 212-249). Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Electronic reproduction. Ann Arbor, MI : ProQuest Information and Learning Company, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Electronic reproduction. Ann Arbor, MI : ProQuest Information and Learning Company, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Abstract also in Chinese.

Los estilos APA, Harvard, Vancouver, ISO, etc.

47

"Induction of apoptosis in selected human cancer cells by organoselenium compounds, ruthenium compounds and selenium containing ruthenium complexes." 2013. http://library.cuhk.edu.hk/record=b5884433.

Texto completo

Resumen

Liu, Yanan. Thesis (Ph.D.)--Chinese University of Hong Kong, 2013. Includes bibliographical references (leaves 87-98). Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. Abstracts also in Chinese.

Los estilos APA, Harvard, Vancouver, ISO, etc.

48

Ariaratnam, Vimala. "Asymmetric synthesis of chiral glycerol derivatives with use of platinum (II) phosphine complexes." Phd thesis, 1990. http://hdl.handle.net/1885/138986.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

49

Md, Yusof Enis Nadia Binti. "Synthesis, structural characterisation and cytotoxicity study of tin(iv) compounds containing ons schiff bases." Thesis, 2019. http://hdl.handle.net/1959.13/1420998.

Texto completo

Resumen

Research Doctorate - Doctor of Philosophy (PhD) There is an urgent need for substantial investigation of non-platinum drugs with higher activity and improved selectivity to address the problem associated with the use of platinum-based compounds as therapeutic agents. In light of this, diphenyltin(IV), dimethyltin(IV) and tin(IV) compounds were synthesised from the Schiff bases of three series of dithiocarbazate (S-2-methylbenzyldithiocarbazate (S1), S-4-methylbenzyl dithiocarbazate (S2), S-benzyldithiocarbazate (S3)) and two series of thiosemicarbazides (4-methyl-3-thiosemicarbazide and 4-phenyl-3-thiosemicarbazide) with aldehydes, 2-hydroxy-3-methoxybenzaldehyde (oVa) or 2,3-dihydroxybenzaldehyde (catechol). The tin(IV) compounds formed were found to have a general formula of [R2Sn(ONS)] and [Sn(ONS)₂] (where R = Me and Ph). The compounds were fully characterised by physicochemical and spectroscopic methods. The spectroscopic results supported the coordination geometry in which the Schiff bases behaved as tridentate ONS donor ligands coordinating via azomethine nitrogen, thiolo sulphur and phenoxide oxygen atoms. A total of 11 crystal structures of the expected compounds were solved in this work. In order to verify the experimental data, the compounds were optimised using the density functional theory (DFT) method with the B3LYP hybrid exchange correlation functional with LanL2DZ pseudopotential on tin and 6-311G(d,p) Pople basis set for all other atoms. Diphenyltin(IV) compounds showed the most promising cytotoxicity with IC50 values ranging between 0.016 – 4.40 μM against a panel of twelve cancer cell lines (RT-112, EJ-28 (bladder), HT29 (colon), U87, SJ-G2, SMA (glioblastoma), MCF-7 (breast), A2780 (ovarian), H460 (lung), A431 (skin), Du145 (prostate), BE2-C (neuroblastoma) and MIA (pancreatic)). The three diphenyltin(IV) compounds of the oVa series were able to induce the production of Reactive Oxygen Species (ROS) and acted as a cell apoptosis inducer. Good binding interactions for all the diphenyltin(IV) compound series were observed and supported by molecular docking analysis, where hydrogen, electrostatic and hydrophobic binding interactions were observed. This highlights the important of two phenyl groups coordinated directly to the tin ion to enhance the cytotoxicity by strong π-π stacking interactions to biomacromolecules. Diphenyltin(IV) compounds could bring hope in the field of drug development against various diseases including cancers.

Los estilos APA, Harvard, Vancouver, ISO, etc.

50

Fonteh, Pascaline Nanga. "Chrysotherapy: evaluating gold compounds for anti-HIV activity." Thesis, 2009. http://hdl.handle.net/10210/2505.

Texto completo

Resumen

M.Sc. Background: The continuous emergence of drug resistant strains of HIV as a result of errors made by reverse transcriptase coupled with undesirable side effects of available drugs, latency problems, cost etc, warrants the continuous search for new drug candidates. Chrysotherapy which is the use of gold compounds for the treatment of various ailments has been practiced since 2500 BC. The use of gold compounds such as auranofin for the treatment of rheumatoid arthritis has lead to remission of this disease. Gold compounds such as auranofin not only prevented the progression of arthritis but also increased the CD4+ count of an HIV positive patient who was not on antiretrovirals. These compounds have been implicated in the treatment of cancers, autoimmune diseases and microorganism infections. Objectives: In this work, novel gold compounds were evaluated with the aim of identifying lead compound(s) that can eventually serve as anti-HIV agents. Materials and Methods: Eleven gold (I) phosphine complexes, four of their corresponding ligands (compound without gold atom), and a gold (III) complex were tested for the ability to inhibit reverse transcriptase (RT) and protease (PR) in direct enzyme assays. Uptake of the compounds by host cells was evaluated with inductively coupled plasma atomic emission spectrometry (ICP-AES). Potential toxicity of the gold compounds was screened for by viability dyes and flow cytometry assays. To determine inhibition of whole virus by other mechanisms in addition to RT or PR, p24 production by infected cells was evaluated. Prior to all these analysis, stability of compounds in solution was determined by 31P nuclear magnetic resonance (NMR) and UV-visible spectroscopy. Results: The compounds were shown to be stable in solution over a one week period and were taken up by both continuous cell lines and primary cells. Eight of the gold compounds significantly inhibited HIV-1 reverse transcriptase at concentrations of 25 and 250 μM while four compounds and the four ligands did not. In a fluorogenic assay against HIV-1 PR, four of the gold compounds demonstrated inhibitory activity. The gold compounds were toxic to cells lines but not to primary cells. One of the complexes (EK231) significantly reduced p24 (p=0.0042) production at a concentration of 25 μM. Conclusion: Data provided here suggests that the therapeutic benefits of these gold containing compounds as potential HIV-1 reverse transcriptase and protease inhibitors should be considered.

Los estilos APA, Harvard, Vancouver, ISO, etc.

Tesis sobre el tema "Platinum compounds Therapeutic use"

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros