Bibliographies thématiques / Carbon – Kivu, Lake (Congo and Rwanda)

Sommaire

Articles de revues
Thèses
Livres
Chapitres de livres

Littérature scientifique sur le sujet « Carbon – Kivu, Lake (Congo and Rwanda) »

Auteur : Grafiati

Publié le 4 juin 2021

Mis à jour le 8 février 2022

Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres

Choisissez une source :

Consultez les listes thématiques d’articles de revues, de livres, de thèses, de rapports de conférences et d’autres sources académiques sur le sujet « Carbon – Kivu, Lake (Congo and Rwanda) ».

À côté de chaque source dans la liste de références il y a un bouton « Ajouter à la bibliographie ». Cliquez sur ce bouton, et nous générerons automatiquement la référence bibliographique pour la source choisie selon votre style de citation préféré : APA, MLA, Harvard, Vancouver, Chicago, etc.

Vous pouvez aussi télécharger le texte intégral de la publication scolaire au format pdf et consulter son résumé en ligne lorsque ces informations sont inclues dans les métadonnées.

Articles de revues sur le sujet "Carbon – Kivu, Lake (Congo and Rwanda)"

MEYER, KIRSTIN S., et NEIL CUMBERLIDGE. « A revision of the freshwater crabs (Crustacea : Decapoda : Brachyura : Potamonautidae) of the Lake Kivu drainage basin in Central and East Africa ». Zootaxa 3011, n^o 1 (1 septembre 2011) : 45. http://dx.doi.org/10.11646/zootaxa.3011.1.5.

Texte intégral

Résumé :

The taxonomy of the freshwater crabs living in the rivers draining from the mountains in the eastern Democratic Republic of the Congo and Rwanda into Lake Kivu is revised. Four species are recognized: Potamonautes perparvus (Rathbun, 1921), P. minor Bott, 1955, P. gonocristatus Bott, 1955, and P. semilunaris Bott, 1955. Updated diagnoses, illustrations, and distribution maps are provided for the species. The four species are compared to each other, and an identification key to all eight species found in Lake Kivu and its drainage basin is included.

Styles APA, Harvard, Vancouver, ISO, etc.

Karamage, Fidele, Hua Shao, Xi Chen, Felix Ndayisaba, Lamek Nahayo, Alphonse Kayiranga, James Omifolaji, Tong Liu et Chi Zhang. « Deforestation Effects on Soil Erosion in the Lake Kivu Basin, D.R. Congo-Rwanda ». Forests 7, n^o 12 (17 novembre 2016) : 281. http://dx.doi.org/10.3390/f7110281.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Hubert, J. G., A. Pinel-Galzi, D. Dibwe, E. Cinyabuguma, A. Kaboré, D. Fargette, D. Silué, E. Hébrard et Y. Séré. « First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo ». Plant Disease 97, n^o 12 (décembre 2013) : 1664. http://dx.doi.org/10.1094/pdis-06-13-0650-pdn.

Texte intégral

Résumé :

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Styles APA, Harvard, Vancouver, ISO, etc.

LlirÃ¯Â¿Â½s, Marc, Frederic Gich, Anna Plasencia, Jean-Christophe Auguet, FranÃ¯Â¿Â½ois Darchambeau, Emilio O. Casamayor, Jean-Pierre Descy et Carles Borrego. « Vertical Distribution of Ammonia-Oxidizing Crenarchaeota and Methanogens in the Epipelagic Waters of Lake Kivu (Rwanda-Democratic Republic of the Congo) ». Applied and Environmental Microbiology 76, n^o 20 (27 août 2010) : 6853–63. http://dx.doi.org/10.1128/aem.02864-09.

Texte intégral

Résumé :

ABSTRACT Four stratified basins in Lake Kivu (Rwanda-Democratic Republic of the Congo) were sampled in March 2007 to investigate the abundance, distribution, and potential biogeochemical role of planktonic archaea. We used fluorescence in situ hybridization with catalyzed-reported deposition microscopic counts (CARD-FISH), denaturing gradient gel electrophoresis (DGGE) fingerprinting, and quantitative PCR (qPCR) of signature genes for ammonia-oxidizing archaea (16S rRNA for marine Crenarchaeota group 1.1a [MCG1] and ammonia monooxygenase subunit A [amoA]). Abundance of archaea ranged from 1 to 4.5% of total DAPI (4′,6-diamidino-2-phenylindole) counts with maximal concentrations at the oxic-anoxic transition zone (∼50-m depth). Phylogenetic analysis of the archaeal planktonic community revealed a higher level of richness of crenarchaeal 16S rRNA gene sequences (21 of the 28 operational taxonomic units [OTUs] identified [75%]) over euryarchaeotal ones (7 OTUs). Sequences affiliated with the kingdom Euryarchaeota were mainly recovered from the anoxic water compartment and mostly grouped into methanogenic lineages (Methanosarcinales and Methanocellales). In turn, crenarchaeal phylotypes were recovered throughout the sampled epipelagic waters (0- to 100-m depth), with clear phylogenetic segregation along the transition from oxic to anoxic water masses. Thus, whereas in the anoxic hypolimnion crenarchaeotal OTUs were mainly assigned to the miscellaneous crenarchaeotic group, the OTUs from the oxic-anoxic transition and above belonged to Crenarchaeota groups 1.1a and 1.1b, two lineages containing most of the ammonia-oxidizing representatives known so far. The concomitant vertical distribution of both nitrite and nitrate maxima and the copy numbers of both MCG1 16S rRNA and amoA genes suggest the potential implication of Crenarchaeota in nitrification processes occurring in the epilimnetic waters of the lake.

Styles APA, Harvard, Vancouver, ISO, etc.

Mwanjalolo Jackson-Gilbert, Majaliwa, Tenywa Makooma Moses, Karuturi P. C. Rao, Bernard Musana, Fungo Bernard, Bahiga Leblanc, Jumaine Mkangya et al. « Soil Fertility in relation to Landscape Position and Land Use/Cover Types : A Case Study of the Lake Kivu Pilot Learning Site ». Advances in Agriculture 2015 (2015) : 1–8. http://dx.doi.org/10.1155/2015/752936.

Texte intégral

Résumé :

This study determined the change and distribution of land-uses/covers along the landscape, and evaluated the nutrient status of the top soil layer in the Lake Kivu Pilot Learning Site (LKPLS) benchmarked micro-catchments. Soil physical and chemical properties were quantified using triplicate soil samples collected from each land-use/cover at two depths (0–15 and 15–30 cm) in three LK PLS Learning Innovation Platform (IP) sites (Bufundi in Uganda, Mupfuni-Shanga in D.R. Congo, Gataraga in Rwanda). Small scale agriculture has increased in all the benchmarked micro-catchments at the expense of other land-uses/covers. In the settlement areas land-use/cover distribution along the landscape varied across sites and countries; the major one being eucalyptus woodlots, wetland, and perennials and annuals crops in Bufundi; annuals and perennials crops in Mupfuni-Shanga; and annuals crops in Gataraga. Perennial crops tended to occur at the footslope and valley bottoms, while the annuals occurred at the upper backslopes and summits. Available P and K were relatively higher and C/N ratio (7.28) was the lowest in Mupfuni Shanga. Annual crops had the lowest available P and N across site (P<0.05). The key nutrients N, P and K were below the critical values for plant growth for Bufundi.

Styles APA, Harvard, Vancouver, ISO, etc.

Hategekimana, F., J. D. Ndikuryayo, E. Habimana, T. Mugerwa, Kakonkwe Christian et R. Digne Ed Rwabuhungu. « Lake Kivu Water Chemistry Variation with Depth Over Time, Northwestern Rwanda ». Rwanda Journal of Engineering, Science, Technology and Environment 3, n^o 1 (8 mai 2020). http://dx.doi.org/10.4314/rjeste.v3i1.5.

Texte intégral

Résumé :

The water of East African rift lakes contains large amounts of dissolved chemicals such as carbon dioxide, methane greatly and others like phosphate, silicate, Sulfate, Sulfide, Iron, Ammonia, Alkalinity etc. Lake Kivu is a large, deep rift basin lake located in the western branch of the East African rift zone that contains a methane gas deposit of great economic interest with two main sources: Inorganic carbon dioxide CO2 + 4H2 = CH4 + 2H2O and Organic methanogenesis CH3COOH =CH4 + CO2. Lake Kivu is a stratified, meromictic lake bordering Rwanda and the Democratic Republic of the Congo (DRC). The lake has a surface area of 2,370 Km2, a volume of 580 Km3 and a maximum water depth of 485 m. To characterize the vertical variation of Lake Kivu water chemistry, 8 samples of water were collected using Niskin bottles in Lake Kivu near Gisenyi town. Water samples were therefore collected at different depths: 0 m, 40 m, 90 m, 240 m, 290 m, 340 m, 340 m, and 390 m. Hatch kits were used to analyze water chemistry of samples taken of Sulfate, Sulfide, Iron, Ammonia, Alkalinity, Silica, PO4,andphosphorus.The results revealed that alkalinity increases in the monimolimnion part due to the precipitation of calcium carbonate in the upper levels of the water column and dissolution in the monimolimnion. The conductivity, dissolved oxygen, temperature and pH weremeasured by CTD Sonde. Water column data from these studies showed increasing concentrations with depth. The divide between the mixolimnion and monomolimnion is estimated at a depth of around 40 m. Higher amounts of silica observed closer to the shoreline is likely a result of an influx of siliciclastic sediment and increased silica with depth is likely a result of the dissolution of diatoms below the photic zone. Keywords: Monimolimnion, mixolimnion, water stratification, chemicals agents.

Styles APA, Harvard, Vancouver, ISO, etc.

« Rwanda - DR Congo : Lake Kivu Transport Project ». Africa Research Bulletin : Economic, Financial and Technical Series 55, n^o 3 (mai 2018) : 22083C. http://dx.doi.org/10.1111/j.1467-6346.2018.08270.x.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Thèses sur le sujet "Carbon – Kivu, Lake (Congo and Rwanda)"

Rwabuhungu, Rwatangabo Digne. « Etude du comportement biogéochimique du carbone dans le lac Kivu au nord-ouest du Rwanda ». Doctoral thesis, Universite Libre de Bruxelles, 2008. http://hdl.handle.net/2013/ULB-DIPOT:oai:dipot.ulb.ac.be:2013/210422.

Texte intégral

Résumé :

Résumé

Le Rift Est-Africain comprend plusieurs grands lacs, dont le lac Kivu situé entre 1°34’

et 2°30’ de latitude Sud et compris entre 28°50’ et 29°23’ de longitude Est. Ce lac,

localisé au nord-ouest du Rwanda à la frontière avec la République Démocratique du

Congo, présente une spécificité unique au monde: ses eaux profondes contiennent

une gigantesque quantité de gaz dissous (3/4 de dioxyde de carbone (CO2), 1/4 de

gaz méthane (CH4)).

Les études antérieures indiquent que les eaux du lac Kivu présentent une structure

stratifiée particulière qui se décline en 13 couches dans le bassin principal. Nous

avons établi une nouvelle stratification, en quatre couches de la colonne d’eau dans

ce bassin sur base des données physico-chimiques mais aussi, en tenant compte

tout particulièrement du comportement biogéochimique du carbone. Cette structure

simplifiée permettra une meilleure évaluation de l’impact environnemental et une

gestion durable de l’exploitation du gisement de gaz méthane du lac Kivu.

Un suivi détaillé de plusieurs paramètres physico-chimiques, biogéochimiques ainsi

que des éléments majeurs, mineurs et en trace, présents dans le bassin principal du

lac, dans sa partie rwandaise en un point fixe au large de Kibuye, durant la petite

saison sèche, apporte un éclairage plus précis de leur distribution dans la colonne

d’eau. Une étude de la variation spatio-temporelle de ces paramètres est réalisée

aussi bien à Kibuye qu’à Gisenyi et ce durant les différentes saisons pour, entre

autres, servir de base de données nécessaire à toute comparaison ultérieure.

L’origine des gaz dissous dans le lac Kivu a fait l’objet de plusieurs études et

hypothèses. Les deux principaux gaz dissous du lac ont un élément biogéochimique

en commun: le carbone. Par des mesures isotopiques et par comparaison avec le

système limnologique du lac Tanganyika voisin, la correspondance de l’allure

générale de la distribution comparée du carbone inorganique dissous (DIC), de

l’alcalinité totale et du δ13CDIC dans les deux lacs indique notamment que les

processus à l’origine du gaz méthane du lac Kivu ne sont pas liés au magmatisme, ni

à des phénomènes thermocatalytiques. Nous pensons que le carbone, et par

conséquent le gaz méthane du lac Kivu, est d’origine phytoplanctonique.

L’explication par une étude hydrogéologique et pédologique de l’origine de la

stratification pérenne de la colonne d’eau du lac Kivu constitue un point de vue

intéressant. Une autre perspective serait, celle visant à établir par des données

biogéochimiques, le taux de régénération du gaz méthane du lac Kivu afin d’en

déterminer la durée d’exploitabilité réelle.
Doctorat en Sciences
info:eu-repo/semantics/nonPublished

Styles APA, Harvard, Vancouver, ISO, etc.

Losseau-Hoebeke, Michèle. « The biology of four haplochromine species of Lake Kivu (Zaïre) with evolutionary implications ». Thesis, Rhodes University, 1992. http://hdl.handle.net/10962/d1005082.

Texte intégral

Résumé :

Four species were selected within the littoral of Tshegera Island, and include H. astatodon, H. olivaceus, H. crebridens and H. paucidens. These species, identified on basis of the SMRS, express their individuality most strongly with respect to dentition, breeding colours, normal habitat and preferred breeding territory. All four species are maternal mouthbrooders. This reproductive strategy is characterized by complete division of labour and polygamy. Breeding males compete for optimal territories and ready to spawn females. They are characterized by fast growth, large size and overall low condition factor. Females invest in few but large yolked ova and go through a fasting period while incubating the eggs. Females are generally characterized by slower growth, smaller size and higher condition factor when compared to males. In females the energy turnover during gonadal development and subsequent mouthbrooding is high, but the energy expenditure low. Mean fecundity varies between 25 and 36 eggs per brood and mean egg size between 2.6 and 2.7 rnrn. The right ovary, although small, is functional. Breeding of variable intensity goes on throughout the year. The main dry season corresponds to synchronized breeding. During the other months of the year species breed asynchronously. Both types of breeding are related to food availability for adults and offspring. The major breeding peak which starts in July coincides to improved body condition in both sexes. In similarity with the East African flocks, the Lake Kivu haplochromines display subdivision within the major trophic groups and invasion of the major lacustrine habitats. They are nevertheless morphologically and ecologically generalized. They tend to be plesiomorphic with low diversification within each trophic group, have a lake wide distribution (eurytopic) and incline to be altricial within their specialized reproductive guild. The evolutionary status of the Lake Kivu haplochromines may be explained by survival of members of an ancestral fauna in an isolated bay during the Recent volcanic events which destroyed life in the Main Basin. The Lake Kivu flock, therefore, is a relict and is believed not to have evolved within the confines of the present-day lake.

Styles APA, Harvard, Vancouver, ISO, etc.

Walemba, Kabungulu Mutoka Ambrose. « Geology, geochemistry, and tectono-metallogenic evolution of neuproterozoic gold deposits in the Kadubu area, Kivu, Democratic Republic of Congo ». Thesis, 2014. http://hdl.handle.net/10539/15209.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Livres sur le sujet "Carbon – Kivu, Lake (Congo and Rwanda)"

Melkebeke, Sven Van. Dissimilar Coffee Frontiers : Mobilizing Labor and Land in the Lake Kivu Region, Congo and Rwanda. BRILL, 2020.

Trouver le texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Chapitres de livres sur le sujet "Carbon – Kivu, Lake (Congo and Rwanda)"

Vaselli, Orlando, Dario Tedesco, Emilio Cuoco et Franco Tassi. « Are Limnic Eruptions in the CO2–CH4-Rich Gas Reservoir of Lake Kivu (Democratic Republic of the Congo and Rwanda) Possible ? Insights from Physico-Chemical and Isotopic Data ». Dans Advances in Volcanology, 489–505. Berlin, Heidelberg : Springer Berlin Heidelberg, 2015. http://dx.doi.org/10.1007/978-3-642-36833-2_22.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Nous offrons des réductions sur tous les plans premium pour les auteurs dont les œuvres sont incluses dans des sélections littéraires thématiques. Contactez-nous pour obtenir un code promo unique!