Zaloguj się

Gotowe bibliografie tematyczne / Identity Testing in Number Fields

Spis treści

Artykuły w czasopismach

Gotowa bibliografia na temat „Identity Testing in Number Fields”

Autor: Grafiati

Data publikacji: 11 stycznia 2025

Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych

Wybierz rodzaj źródła:

Zobacz listy aktualnych artykułów, książek, rozpraw, streszczeń i innych źródeł naukowych na temat „Identity Testing in Number Fields”.

Przycisk „Dodaj do bibliografii” jest dostępny obok każdej pracy w bibliografii. Użyj go – a my automatycznie utworzymy odniesienie bibliograficzne do wybranej pracy w stylu cytowania, którego potrzebujesz: APA, MLA, Harvard, Chicago, Vancouver itp.

Możesz również pobrać pełny tekst publikacji naukowej w formacie „.pdf” i przeczytać adnotację do pracy online, jeśli odpowiednie parametry są dostępne w metadanych.

Artykuły w czasopismach na temat "Identity Testing in Number Fields"

1

Mérai, László. "Values of rational functions in small subgroups of finite fields and the identity testing problem from powers." International Journal of Number Theory 16, no. 02 (2019): 219–31. http://dx.doi.org/10.1142/s1793042120500128.

Pełny tekst źródła

Streszczenie:

Motivated by some algorithmic problems, we give lower bounds on the size of the multiplicative groups containing rational function images of low-dimensional affine subspaces of a finite field [Formula: see text] considered as a linear space over a subfield [Formula: see text]. We apply this to the recently introduced algorithmic problem of identity testing of “hidden” polynomials [Formula: see text] and [Formula: see text] over a high degree extension of a finite field, given oracle access to [Formula: see text] and [Formula: see text].

Style APA, Harvard, Vancouver, ISO itp.

2

Karpinski, Marek, László Mérai, and Igor E. Shparlinski. "Identity testing and interpolation from high powers of polynomials of large degree over finite fields." Journal of Complexity 49 (December 2018): 74–84. http://dx.doi.org/10.1016/j.jco.2018.07.006.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

3

MacKenzie, Tyler D. B., Manphool S. Fageria, Xianzhou Nie, and Mathuresh Singh. "Effects of Crop Management Practices on Current-Season Spread of Potato virus Y." Plant Disease 98, no. 2 (2014): 213–22. http://dx.doi.org/10.1094/pdis-04-13-0403-re.

Pełny tekst źródła

Streszczenie:

The current-season spread of Potato virus Y (PVY) was monitored in 19 fields under various management practices in New Brunswick, Canada, through the 2011 and 2012 growing seasons. The focus of this study was to evaluate the role of seedborne PVY inoculum, aphid vector abundance, and the numbers, timing, and types of insecticide and mineral oil sprays, and to confirm the reliability and forecasting capacity of midseason PVY testing. In each field, 100 to 110 virus-free plants were identified shortly after emergence and were assessed four times from early July to early September (after top-kill

Style APA, Harvard, Vancouver, ISO itp.

4

Agussalim, Muliana Djafar, and Andi Syam Rizal. "Analisis Potensi Debit Air Tanah Melalui Pumping Test Metode Step Draw Down pada Sumur Bor Irigasi di Desa Bonto Rannu, Kecamatan Kajang, Kabupaten Bulukumba, Sulawesi Selatan." JFT: Jurnal Fisika dan Terapannya 9, no. 2 (2022): 127–37. http://dx.doi.org/10.24252/jft.v9i2.32277.

Pełny tekst źródła

Streszczenie:

The rice fields in Bonto Rannu Village, Kajang District, Bulukumba Regency are dominated by rainfed rice fields. This species has limitations in the dry season because irrigation/agricultural irrigation completely depends on rainwater. Therefore, it is necessary to identify alternative irrigation sources to sustain farmers' farming activities in Bonto Rannu Village. This study aims to analyze the number of groundwater wells by testing in the form of a pump test (pumping test) with the step draw-down method. The optimum discharge (Qopt) of well 1 is 0.01876 m3/s or 67.53 m3/hour with an optimum

Style APA, Harvard, Vancouver, ISO itp.

5

Bazanova, E. M., A. V. Gorizontova, N. N. Gribova, T. M. Chikake, and A. V. Samosyuk. "Development and Prospects of National Intelligent System for Testing General Language Competencies Deployed Through Neural Network Solutions." Vysshee Obrazovanie v Rossii = Higher Education in Russia 32, no. 8-9 (2023): 147–66. http://dx.doi.org/10.31992/0869-3617-2023-32-8-9-147-166.

Pełny tekst źródła

Streszczenie:

The article presents the results of approbation of the intellectual system for testing general language competences (ISTOK) developed by testologists, linguists, specialists in methodology of teaching foreign languages and in artificial intelligence. This system includes a range of tests assessing language ability at levels from A2 to C1 of the Common European Framework of Reference (CEFR), as well as an adaptive placement test. All test materials are calibrated according to the CEFR. ISTOK is an adaptive testing system deployed through neural network solutions and providing assessment of rece

Style APA, Harvard, Vancouver, ISO itp.

6

Kotsiubivska, Kateryna, Olena Tymoshenko, Kostiantyn Bulyha, and Ihor Yarokhno. "Application of Pseudo-Random Numbers in System Design." Digital Platform: Information Technologies in Sociocultural Sphere 6, no. 1 (2023): 53–62. http://dx.doi.org/10.31866/2617-796x.6.1.2023.283945.

Pełny tekst źródła

Streszczenie:

The purpose of the article is to study and search for optimal strategies for modelling information systems using pseudo-random numbers to improve the performance of information systems and to determine the optimal parameters of random number distributions; to analyze efficient algorithms for generating pseudo-random numbers. The research methods are based on the application of a systematic approach to analyzing the benefits of using pseudorandom numbers in the design of information systems. Scientific novelty. The article analyses the advantages of stochastic modelling of information systems u

Style APA, Harvard, Vancouver, ISO itp.

7

Kurbanismailov, Z. M., A. T. Tarlanov, and E. M. Akimov. "The technique of point visualization of the electric field in space and time." Russian Technological Journal 9, no. 3 (2021): 58–65. http://dx.doi.org/10.32362/2500-316x-2021-9-3-58-65.

Pełny tekst źródła

Streszczenie:

Testing of electronic devices is an integral part of the technological process of any manufacturer of such equipment. In this case, an electronic device is understood as an energy-intensive unit such as a mobile phone, data center or spacecraft. One of the key stages of testing is to identify the effect of electric fields on various electronic components of the device. This stage often requires making a mock-up of some part of an unfinished device in order to fix interference with special equipment. This requires time, financial and human resource costs. In order to reduce these costs in the m

Style APA, Harvard, Vancouver, ISO itp.

8

Fajri, Muhammad. "Penerapan Digital Signature Untuk Identitas File Audio Dengan Metode Snefru." Management of Information System Journal 1, no. 1 (2022): 19–28. http://dx.doi.org/10.47065/mis.v1i1.397.

Pełny tekst źródła

Streszczenie:

In the era of information technology that is developing very rapidly, the use of signatures has been widely applied digitally through digital signatures. Digital signatures along with the times have led to the need for authentication of data or files that are used digitally. Its use also aims to avoid counterfeiting or interference. Currently, the use of digital signatures has been widely applied to software distribution, financial transactions, file transfers. The crime of falsifying audio files is a serious problem in various fields. Audio authenticity testing is important and significant in

Style APA, Harvard, Vancouver, ISO itp.

9

Nuthakki, Siddhartha, Sai Kalyana pranitha buddiga, and Sonika Koganti. "Exploring Deep Learning Models for Image Recognition: A Comparative Review." Signal & Image Processing : An International Journal 15, no. 3 (2024): 01–10. http://dx.doi.org/10.5121/sipij.2024.15301.

Pełny tekst źródła

Streszczenie:

Image recognition, which comes under Artificial Intelligence (AI) is a critical aspect of computer vision, enabling computers or other computing devices to identify and categorize objects within images. Among numerous fields of life, food processing is an important area, in which image processing plays a vital role, both for producers and consumers. This study focuses on the binary classification of strawberries, where images are sorted into one of two categories. We Utilized a dataset of strawberry images for this study; we aim to determine the effectiveness of different models in identifying

Style APA, Harvard, Vancouver, ISO itp.

10

Martin, R. R., I. E. Tzanetakis, J. E. Barnes, and J. F. Elmhirst. "First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada." Plant Disease 88, no. 5 (2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.

Pełny tekst źródła

Streszczenie:

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawber

Style APA, Harvard, Vancouver, ISO itp.

Więcej źródeł

Oferujemy zniżki na wszystkie plany premium dla autorów, których prace zostały uwzględnione w tematycznych zestawieniach literatury. Skontaktuj się z nami, aby uzyskać unikalny kod promocyjny!