Zaloguj się

Gotowe bibliografie tematyczne / Identity Testing in Number Fields / Artykuły w czasopismach

Kliknij ten link, aby zobaczyć inne rodzaje publikacji na ten temat: Identity Testing in Number Fields.

Artykuły w czasopismach na temat „Identity Testing in Number Fields”

Autor: Grafiati

Data publikacji: 11 stycznia 2025

Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych

Wybierz rodzaj źródła:

Sprawdź 50 najlepszych artykułów w czasopismach naukowych na temat „Identity Testing in Number Fields”.

Przycisk „Dodaj do bibliografii” jest dostępny obok każdej pracy w bibliografii. Użyj go – a my automatycznie utworzymy odniesienie bibliograficzne do wybranej pracy w stylu cytowania, którego potrzebujesz: APA, MLA, Harvard, Chicago, Vancouver itp.

Możesz również pobrać pełny tekst publikacji naukowej w formacie „.pdf” i przeczytać adnotację do pracy online, jeśli odpowiednie parametry są dostępne w metadanych.

Przeglądaj artykuły w czasopismach z różnych dziedzin i twórz odpowiednie bibliografie.

1

Mérai, László. "Values of rational functions in small subgroups of finite fields and the identity testing problem from powers." International Journal of Number Theory 16, no. 02 (2019): 219–31. http://dx.doi.org/10.1142/s1793042120500128.

Pełny tekst źródła

Streszczenie:

Motivated by some algorithmic problems, we give lower bounds on the size of the multiplicative groups containing rational function images of low-dimensional affine subspaces of a finite field [Formula: see text] considered as a linear space over a subfield [Formula: see text]. We apply this to the recently introduced algorithmic problem of identity testing of “hidden” polynomials [Formula: see text] and [Formula: see text] over a high degree extension of a finite field, given oracle access to [Formula: see text] and [Formula: see text].

Style APA, Harvard, Vancouver, ISO itp.

2

Karpinski, Marek, László Mérai, and Igor E. Shparlinski. "Identity testing and interpolation from high powers of polynomials of large degree over finite fields." Journal of Complexity 49 (December 2018): 74–84. http://dx.doi.org/10.1016/j.jco.2018.07.006.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

3

MacKenzie, Tyler D. B., Manphool S. Fageria, Xianzhou Nie, and Mathuresh Singh. "Effects of Crop Management Practices on Current-Season Spread of Potato virus Y." Plant Disease 98, no. 2 (2014): 213–22. http://dx.doi.org/10.1094/pdis-04-13-0403-re.

Pełny tekst źródła

Streszczenie:

The current-season spread of Potato virus Y (PVY) was monitored in 19 fields under various management practices in New Brunswick, Canada, through the 2011 and 2012 growing seasons. The focus of this study was to evaluate the role of seedborne PVY inoculum, aphid vector abundance, and the numbers, timing, and types of insecticide and mineral oil sprays, and to confirm the reliability and forecasting capacity of midseason PVY testing. In each field, 100 to 110 virus-free plants were identified shortly after emergence and were assessed four times from early July to early September (after top-kill

Style APA, Harvard, Vancouver, ISO itp.

4

Agussalim, Muliana Djafar, and Andi Syam Rizal. "Analisis Potensi Debit Air Tanah Melalui Pumping Test Metode Step Draw Down pada Sumur Bor Irigasi di Desa Bonto Rannu, Kecamatan Kajang, Kabupaten Bulukumba, Sulawesi Selatan." JFT: Jurnal Fisika dan Terapannya 9, no. 2 (2022): 127–37. http://dx.doi.org/10.24252/jft.v9i2.32277.

Pełny tekst źródła

Streszczenie:

The rice fields in Bonto Rannu Village, Kajang District, Bulukumba Regency are dominated by rainfed rice fields. This species has limitations in the dry season because irrigation/agricultural irrigation completely depends on rainwater. Therefore, it is necessary to identify alternative irrigation sources to sustain farmers' farming activities in Bonto Rannu Village. This study aims to analyze the number of groundwater wells by testing in the form of a pump test (pumping test) with the step draw-down method. The optimum discharge (Qopt) of well 1 is 0.01876 m3/s or 67.53 m3/hour with an optimum

Style APA, Harvard, Vancouver, ISO itp.

5

Bazanova, E. M., A. V. Gorizontova, N. N. Gribova, T. M. Chikake, and A. V. Samosyuk. "Development and Prospects of National Intelligent System for Testing General Language Competencies Deployed Through Neural Network Solutions." Vysshee Obrazovanie v Rossii = Higher Education in Russia 32, no. 8-9 (2023): 147–66. http://dx.doi.org/10.31992/0869-3617-2023-32-8-9-147-166.

Pełny tekst źródła

Streszczenie:

The article presents the results of approbation of the intellectual system for testing general language competences (ISTOK) developed by testologists, linguists, specialists in methodology of teaching foreign languages and in artificial intelligence. This system includes a range of tests assessing language ability at levels from A2 to C1 of the Common European Framework of Reference (CEFR), as well as an adaptive placement test. All test materials are calibrated according to the CEFR. ISTOK is an adaptive testing system deployed through neural network solutions and providing assessment of rece

Style APA, Harvard, Vancouver, ISO itp.

6

Kotsiubivska, Kateryna, Olena Tymoshenko, Kostiantyn Bulyha, and Ihor Yarokhno. "Application of Pseudo-Random Numbers in System Design." Digital Platform: Information Technologies in Sociocultural Sphere 6, no. 1 (2023): 53–62. http://dx.doi.org/10.31866/2617-796x.6.1.2023.283945.

Pełny tekst źródła

Streszczenie:

The purpose of the article is to study and search for optimal strategies for modelling information systems using pseudo-random numbers to improve the performance of information systems and to determine the optimal parameters of random number distributions; to analyze efficient algorithms for generating pseudo-random numbers. The research methods are based on the application of a systematic approach to analyzing the benefits of using pseudorandom numbers in the design of information systems. Scientific novelty. The article analyses the advantages of stochastic modelling of information systems u

Style APA, Harvard, Vancouver, ISO itp.

7

Kurbanismailov, Z. M., A. T. Tarlanov, and E. M. Akimov. "The technique of point visualization of the electric field in space and time." Russian Technological Journal 9, no. 3 (2021): 58–65. http://dx.doi.org/10.32362/2500-316x-2021-9-3-58-65.

Pełny tekst źródła

Streszczenie:

Testing of electronic devices is an integral part of the technological process of any manufacturer of such equipment. In this case, an electronic device is understood as an energy-intensive unit such as a mobile phone, data center or spacecraft. One of the key stages of testing is to identify the effect of electric fields on various electronic components of the device. This stage often requires making a mock-up of some part of an unfinished device in order to fix interference with special equipment. This requires time, financial and human resource costs. In order to reduce these costs in the m

Style APA, Harvard, Vancouver, ISO itp.

8

Fajri, Muhammad. "Penerapan Digital Signature Untuk Identitas File Audio Dengan Metode Snefru." Management of Information System Journal 1, no. 1 (2022): 19–28. http://dx.doi.org/10.47065/mis.v1i1.397.

Pełny tekst źródła

Streszczenie:

In the era of information technology that is developing very rapidly, the use of signatures has been widely applied digitally through digital signatures. Digital signatures along with the times have led to the need for authentication of data or files that are used digitally. Its use also aims to avoid counterfeiting or interference. Currently, the use of digital signatures has been widely applied to software distribution, financial transactions, file transfers. The crime of falsifying audio files is a serious problem in various fields. Audio authenticity testing is important and significant in

Style APA, Harvard, Vancouver, ISO itp.

9

Nuthakki, Siddhartha, Sai Kalyana pranitha buddiga, and Sonika Koganti. "Exploring Deep Learning Models for Image Recognition: A Comparative Review." Signal & Image Processing : An International Journal 15, no. 3 (2024): 01–10. http://dx.doi.org/10.5121/sipij.2024.15301.

Pełny tekst źródła

Streszczenie:

Image recognition, which comes under Artificial Intelligence (AI) is a critical aspect of computer vision, enabling computers or other computing devices to identify and categorize objects within images. Among numerous fields of life, food processing is an important area, in which image processing plays a vital role, both for producers and consumers. This study focuses on the binary classification of strawberries, where images are sorted into one of two categories. We Utilized a dataset of strawberry images for this study; we aim to determine the effectiveness of different models in identifying

Style APA, Harvard, Vancouver, ISO itp.

10

Martin, R. R., I. E. Tzanetakis, J. E. Barnes, and J. F. Elmhirst. "First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada." Plant Disease 88, no. 5 (2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.

Pełny tekst źródła

Streszczenie:

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawber

Style APA, Harvard, Vancouver, ISO itp.

11

Coe, Dan A., and Larry D. Bradley. "The First Half Billion Years (z > 9): Results from the Frontier Fields." Proceedings of the International Astronomical Union 11, A29B (2015): 804–7. http://dx.doi.org/10.1017/s174392131600689x.

Pełny tekst źródła

Streszczenie:

AbstractWe present z > 9 candidates identified in Hubble Frontier Fields imaging of the first four clusters and blank parallel fields (two-thirds of the complete program). Based on the deeper Hubble imaging, we revise the redshift estimate of the CLASH z ~ 9.6 candidate MACS1149-JD to z = 9.2+0.2-0.5 (95% C.L.). We identify a new possible fainter z ~ 9 companion 3” away (~1 kpc in the source plane). And we discover a new z ~ 9.2 candidate in the MACS1149 parallel field. Combined with previously published candidates at z ~ 9.8 and 9.1 (in A2744 and its parallel field, respectively), these fi

Style APA, Harvard, Vancouver, ISO itp.

12

Priemyshev, V. S., and A. S. Shayakhmetova. "THE INFLUENCE OF ELEMENTS OF CULTIVATION TECHNOLOGY ON THE SOWING QUALITIES AND YIELD OF SPRING RAPESEED GRAIN IN THE CONDITIONS OF NORTHERN KAZAKHSTAN." Vestnik of M. Kozybayev North Kazakhstan University, no. 1 (61) (April 9, 2024): 109–16. http://dx.doi.org/10.54596/2958-0048-2024-1-109-116.

Pełny tekst źródła

Streszczenie:

Rapeseed plays a key role in various fields, including the food and feed industry, technical applications, as well as in agrotechnical and environmental terms. The diversity of agricultural production highlights the economic benefits and relevance of introducing new promising varieties and hybrids of oilseeds, including spring rapeseed. In this process, the research and selection of suitable varieties and hybrids plays a key role.The article is aimed at conducting a comparative analysis of varieties and hybrids of spring rapeseed through competitive variety testing in order to identify their p

Style APA, Harvard, Vancouver, ISO itp.

13

Szymanski, Michael D., David W. Perry, Nicole M. Gage, et al. "Magnetic source imaging of late evoked field responses to vowels: toward an assessment of hemispheric dominance for language." Journal of Neurosurgery 94, no. 3 (2001): 445–53. http://dx.doi.org/10.3171/jns.2001.94.3.0445.

Pełny tekst źródła

Streszczenie:

Object. The goal of this study was to determine whether the late neuromagnetic field elicited by simple speech sounds, which is detected by magnetoencephalography, may be used to estimate hemispheric dominance for language and to guide or constrain the intraoperative search for essential language sites. If sufficiently robust, a noninvasive method for assessing hemispheric dominance for language could reduce the necessity for amobarbital testing and the extent of intraoperative cortical stimulation—based mapping, both of which carry the risk of morbidity. Methods. Fifteen patients undergoing s

Style APA, Harvard, Vancouver, ISO itp.

14

Qiu, Yue, Yinqian Kang, Hao Liu, and Ibtesam Hilmi. "Current and Future Applications of Machine Perfusion and Other Dynamic Preservation Strategies in Liver Transplantation." OBM Transplantation 08, no. 03 (2024): 1–23. http://dx.doi.org/10.21926/obm.transplant.2403224.

Pełny tekst źródła

Streszczenie:

Machine perfusion (MP) techniques, which simulate physiological conditions to allow for the assessment and preservation of organ viability, are currently applied in various solid organ transplantation fields. Owing to the growing demand for liver transplants and the scarcity of available donor livers, MP offers a practical solution for recovering high-risk grafts and increasing the number of potentially usable donor organs. Furthermore, testing and administering novel therapies to allografts may also become advantageous. Therefore, it has become essential to examine the role of MP in liver tra

Style APA, Harvard, Vancouver, ISO itp.

15

Stølum, Hans-Henrik, and Steve Kaye. "The Identification of Fault Pattern Fractals for Improved Oil and Gas Recovery: A New Process to Identify and Describe Fault Sets Using Non-Linear Methods." Energy Exploration & Exploitation 10, no. 4-5 (1992): 354–78. http://dx.doi.org/10.1177/014459879201000411.

Pełny tekst źródła

Streszczenie:

Unexpected faults are a serious production problem in numerous, complex and compartmentalised oil and gas fields, and are often the single most important restraint on recovery. Fractal mathematics has demonstrated a surprising degree of order in many natural, apparently random systems. It has been shown that fault patterns exhibit a similar order which could be used to indicate the presence of structures missed in the original interpretation of the seismic data and to predict faults below the approximate 20 m limit of seismic resolution. The potential for greater clarity and resolution opened

Style APA, Harvard, Vancouver, ISO itp.

16

Park, Kyungmin, Seung-Ho Lee, Jongwoo Kim, et al. "Multiplex PCR-Based Nanopore Sequencing and Epidemiological Surveillance of Hantaan orthohantavirus in Apodemus agrarius, Republic of Korea." Viruses 13, no. 5 (2021): 847. http://dx.doi.org/10.3390/v13050847.

Pełny tekst źródła

Streszczenie:

Whole-genome sequencing of infectious agents enables the identification and characterization of emerging viruses. The MinION device is a portable sequencer that allows real-time sequencing in fields or hospitals. Hantaan orthohantavirus (Hantaan virus, HTNV), harbored by Apodemus agrarius, causes hemorrhagic fever with renal syndrome (HFRS) and poses a critical public health threat worldwide. In this study, we aimed to evaluate the feasibility of using nanopore sequencing for whole-genome sequencing of HTNV from samples having different viral copy numbers. Amplicon-based next-generation sequen

Style APA, Harvard, Vancouver, ISO itp.

17

Baev, A. R., N. V. Levkovich, A. L. Mayorov, and M. V. Asadchaya. "Scattering of Elastic Waves by an Inhomogeneous Boundary in the Acoustic Testing of Permanent Joints." Devices and Methods of Measurements 10, no. 4 (2019): 360–72. http://dx.doi.org/10.21122/2220-9506-2019-10-4-360-372.

Pełny tekst źródła

Streszczenie:

Improving the reliability and testing performance of permanent joints оf different materials made by welding, spraying, gluing, soldering and other methods is an important production task, for which the ultrasonic method is the simplest and most effective. The purpose of this work was to expand the technical possibilities and increase the sensitivity of ultrasonic testing of adhesion defects of materials joints based on the establishment of laws governing the formation of a scattering field of elastic waves from an inhomogeneous boundary in three-dimensional space and issuing recommendations f

Style APA, Harvard, Vancouver, ISO itp.

18

Herviyanti, H., A. Maulana, D. Rezki, et al. "Identification of Insecticide Residues in Inceptisols at The Central of Horticultural Production, Banuhampu Agam West Sumatra." IOP Conference Series: Earth and Environmental Science 1297, no. 1 (2024): 012056. http://dx.doi.org/10.1088/1755-1315/1297/1/012056.

Pełny tekst źródła

Streszczenie:

Abstract The high persistence of insecticides in soil and their toxicity to farmers and agricultural land are serious problems with insecticide application. This study was to identify and characterize insecticide residues on Inceptisol in the center of horticultural production, Banuhampu Agam West Sumatra. The determination of soil samples was carried out by purposive random sampling with a quantitative survey method. Sample testing using randomized completely block design (RCBD) with four slope levels and three points of sampling : 0-8%; 8-15%; 15-25%, and 25-45% in fields at a depth of 0-20

Style APA, Harvard, Vancouver, ISO itp.

19

Zmuidinaite, Raminta, Fady I. Sharara, and Ray K. Iles. "Current Advancements in Noninvasive Profiling of the Embryo Culture Media Secretome." International Journal of Molecular Sciences 22, no. 5 (2021): 2513. http://dx.doi.org/10.3390/ijms22052513.

Pełny tekst źródła

Streszczenie:

There have been over 8 million babies born through in vitro fertilization (IVF) and this number continues to grow. There is a global trend to perform elective single embryo transfers, avoiding risks associated with multiple pregnancies. It is therefore important to understand where current research of noninvasive testing for embryos stands, and what are the most promising techniques currently used. Furthermore, it is important to identify the potential to translate research and development into clinically applicable methods that ultimately improve live birth and reduce time to pregnancy. The c

Style APA, Harvard, Vancouver, ISO itp.

20

Lee, Nam Hee. "Medical licensing examination (uigwa) and the world of the physician officers (uigwan) in Korea’s Joseon Dynasty." Journal of Educational Evaluation for Health Professions 12 (May 7, 2015): 16. http://dx.doi.org/10.3352/jeehp.2015.12.16.

Pełny tekst źródła

Streszczenie:

Physicians for ordinary people in Joseon Dynasty (1392-1910) do not need to pass national medical licensing examination. They had done their job after enough period of apprenticeship. Only physician officers were licensed as technical civil servants. These physician officers were middle class, located socially between the nobility and the commoner. They had to pass a national licensing examination to be considered for high-ranking physician officers, that is, those at the rank above the 6th level out of a total of 9 ranks, where the first rank was highest. Royal physicians also had to pass thi

Style APA, Harvard, Vancouver, ISO itp.

21

Alzahrani, Abdullah I. A., Manel Ayadi, Mashael M. Asiri, Amal Al-Rasheed, and Amel Ksibi. "Detecting the Presence of Malware and Identifying the Type of Cyber Attack Using Deep Learning and VGG-16 Techniques." Electronics 11, no. 22 (2022): 3665. http://dx.doi.org/10.3390/electronics11223665.

Pełny tekst źródła

Streszczenie:

Malware is malicious software (harmful program files) that targets and damage computers, devices, networks, and servers. Many types of malware exist, including worms, viruses, trojan horses, etc. With the increase in technology and devices every day, malware is significantly propagating more and more on a daily basis. The rapid growth in the number of devices and computers and the rise in technology is directly proportional to the number of malicious attacks—most of these attacks target organizations, customers, companies, etc. The main goal of these attacks is to steal critical data and passw

Style APA, Harvard, Vancouver, ISO itp.

22

Prinzi, Andrea, Donna Curtis, Sarah Parker, and Sonja Ziniel. "672. The Pediatric Endotracheal Aspirate Culture Survey (Petacs): Examining Practice Variation Across Pediatric Microbiology Laboratories in the United States." Open Forum Infectious Diseases 7, Supplement_1 (2020): S391. http://dx.doi.org/10.1093/ofid/ofaa439.865.

Pełny tekst źródła

Streszczenie:

Abstract Background In the absence of evidence-based laboratory guidelines, the workup and interpretation of tracheal aspirate (TA) cultures remains controversial and confusing within the fields of clinical microbiology, infectious diseases, and critical care. Methods Between January 22 and February 24, 2020, we conducted a national, web-based survey of microbiology laboratory personnel in free-standing pediatric hospitals and adult hospitals containing pediatric facilities regarding the laboratory practices used for TA specimens. We hypothesized that there would be substantial center-level va

Style APA, Harvard, Vancouver, ISO itp.

23

Kovtunenko, Lyubov’ V., Elena I. Meshcheryakova, and Yuliya G. Khlopovskikh. "Pedagogical Aspects Related to the Prevention of Professional Marginalism as a Dangerous Psychological Phenomenon in Educational Process at Departmental Universities." Penitentiary science 15, no. 3 (2021): 684–90. http://dx.doi.org/10.46741/2686-9764-2021-15-3-684-690.

Pełny tekst źródła

Streszczenie:

Introduction: the article analyzes professional marginalism, which became increasingly widespread in recent years. Preventing marginalism becomes an urgent issue for representatives of various scientific fields: sociologists, psychologists, and teachers. At the same time, there is still an insufficient amount of studies on the problems associated with the prevention of professional marginalism as a dangerous psychological phenomenon, despite their high social, national and personal significance. The development of professional marginalism is especially dangerous among employees of law enforcem

Style APA, Harvard, Vancouver, ISO itp.

24

Cherkasova, E. A., and V. V. Rzaeva. "Influence of the predecessor and the seeding rates on the rape productivity." IOP Conference Series: Earth and Environmental Science 839, no. 2 (2021): 022037. http://dx.doi.org/10.1088/1755-1315/839/2/022037.

Pełny tekst źródła

Streszczenie:

Abstract The aim of the research is to identify the optimal seeding rate of varieties and hybrids of spring rape for seeds in the conditions of Northern Kazakhstan. The subject of the research is varieties and hybrids of spring rape. On the experimental fields of the Esil state grain-feed variety seed-trial ground, located in the Republic of Kazakhstan, North Kazakhstan region, the Esil district, the village of Yavlenka, in 2019-2020, a competitive test of spring rape was carried out, represented by 5 varieties: Geros, Maikudyk, Hunter, Makhaon and 3 hybrids: Caliber, Builder, GEN0009. The stu

Style APA, Harvard, Vancouver, ISO itp.

25

Ahmad, Muhammad, Usman Sardar, Ildar Batyrshin, Muhammad Hasnain, Khan Sajid, and Grigori Sidorov. "Elegante: A Machine Learning-Based Threads Configuration Tool for SpMV Computations on Shared Memory Architecture." Information 15, no. 11 (2024): 685. http://dx.doi.org/10.3390/info15110685.

Pełny tekst źródła

Streszczenie:

The sparse matrix–vector product (SpMV) is a fundamental computational kernel utilized in a diverse range of scientific and engineering applications. It is commonly used to solve linear and partial differential equations. The parallel computation of the SpMV product is a challenging task. Existing solutions often employ a fixed number of threads assignment to rows based on empirical formulas, leading to sub-optimal configurations and significant performance losses. Elegante, our proposed machine learning-powered tool, utilizes a data-driven approach to identify the optimal thread configuration

Style APA, Harvard, Vancouver, ISO itp.

26

Marín, María José. "Evaluation of five single-word term recognition methods on a legal English corpus." Corpora 9, no. 1 (2014): 83–107. http://dx.doi.org/10.3366/cor.2014.0052.

Pełny tekst źródła

Streszczenie:

Specialised texts are characterised by, amongst other features, the presence of terminology which conveys domain-specific concepts that are essential for the specialist who is interested in analysing such texts. Automatic Term Recognition methods (ATR) are employed to identify those terms automatically, which is especially helpful in view of the large size of corpora nowadays. However, they tend to concentrate on the identification of Multi-Word Terms (MWTs) neglecting Single-Word Terms (SWTs) to a certain extent. This might be related to the greater number of the former found in fields such a

Style APA, Harvard, Vancouver, ISO itp.

27

Kostyleva, Liliya Yu, Oleg V. Loginovskiy, Evgeniya A. Retc, and Igor M. Yachikov. "Possibilities of using mathematical models for thermal nondestructive testing of defects in multilayer bimetallic plates." Bulletin of the South Ural State University. Ser. Computer Technologies, Automatic Control & Radioelectronics 22, no. 1 (2022): 53–64. http://dx.doi.org/10.14529/ctcr220104.

Pełny tekst źródła

Streszczenie:

There is an actual task of delamination detection in multilayer bimetallic materials. Various methods of nondestructive testing (NDT) are used to solve it, including the method of transient thermal NDT. This method consists in remote registration, visualization and analysis of thermal (temperature) fields, which depend on thermophysical and geometric characteristics, thermal effect capacity and internal structure features of the object. The internal structure defects cause the appearance of abnormal temperature zones on the object surface. Their analysis allows us to judge the presence of chan

Style APA, Harvard, Vancouver, ISO itp.

28

Pulyaevsky, M. S., N. E. Vedernikov, A. T. Akhmadishin, and A. G. Vakhromeev. "ANALYSIS OF THE EFFECTIVENESS OF STIMULATION METHODS AT THE TRIZ FACILITY — PREOBRAZHENSK PETROLEUM PRODUCT HORIZON, EASTERN SIBERIA." Petroleum Engineering 21, no. 6 (2023): 179–87. http://dx.doi.org/10.17122/ngdelo-2023-6-179-187.

Pełny tekst źródła

Streszczenie:

The history of prospecting and exploration of oil and gas fields within the Nepsko-Botuoba Anteklisa (NBA) and the eponymous oil and gas region (OGR) of the Leno-Tunguska Oil and Gas Province of the Siberian Platform dates back more than half a century. The base object of exploration for a long time remained the terrigenous deposits of the Venda reservoir. A number of large, medium and small hydrocarbon deposits are associated with them. The beginning of a systematic study of the northern regions of the Irkutsk region was the receipt of oil inflow from the Markov reference well in 1962. In 197

Style APA, Harvard, Vancouver, ISO itp.

29

Thomas, Olubusola O., Rajagopal S. Raghavan, and Thomas N. Dixon. "Effect of Scaleup and Aggregation on the Use of Well Tests To Identify Geological Properties." SPE Reservoir Evaluation & Engineering 8, no. 03 (2005): 248–54. http://dx.doi.org/10.2118/77452-pa.

Pełny tekst źródła

Streszczenie:

Summary This paper discusses specific issues encountered when pressure tests are analyzed in reservoirs with complex geological properties. These issues relate to questions concerning the methodology of scaleup, the degree of aggregation, and the reliability of conventional methods of analysis. The paper shows that if we desire to use pressure-transient analysis to determine more complex geological features such as connectivity and widths of channels, we need a model that incorporates reservoir heterogeneity. This complexity can lead to significantly more computational effort in the analysis o

Style APA, Harvard, Vancouver, ISO itp.

30

Phadke, Abhishek, F. Antonio Medrano, Chandra N. Sekharan, and Tianxing Chu. "Designing UAV Swarm Experiments: A Simulator Selection and Experiment Design Process." Sensors 23, no. 17 (2023): 7359. http://dx.doi.org/10.3390/s23177359.

Pełny tekst źródła

Streszczenie:

The rapid advancement and increasing number of applications of Unmanned Aerial Vehicle (UAV) swarm systems have garnered significant attention in recent years. These systems offer a multitude of uses and demonstrate great potential in diverse fields, ranging from surveillance and reconnaissance to search and rescue operations. However, the deployment of UAV swarms in dynamic environments necessitates the development of robust experimental designs to ensure their reliability and effectiveness. This study describes the crucial requirement for comprehensive experimental design of UAV swarm system

Style APA, Harvard, Vancouver, ISO itp.

31

Gazdecki, Michal. "Factors of business relationships change in agribusiness input distribution channel." IMP Journal 12, no. 3 (2018): 567–82. http://dx.doi.org/10.1108/imp-01-2018-0011.

Pełny tekst źródła

Streszczenie:

Purpose The purpose of this paper is to identify factors of change in business relationships among companies operating in agribusiness input distribution channel. Design/methodology/approach This study, based on a qualitative approach applying network perspective, is focused on agri-markets for plant protection products. Primary data were collected via individual in-depth interviews with among managers of trade companies operating on agri-inputs products market. Findings Although relation between input producers and trade companies on agri-inputs market is affected by a large number of factors

Style APA, Harvard, Vancouver, ISO itp.

32

Baev, A. R., A. I. Мitkovets, M. V. Asadchaya, and A. L. Mayorov. "Impulsively-Laser Excitation and Propagation of Ultrasonic Waves through Nanomagnetic Fluid." Devices and Methods of Measurements 12, no. 3 (2021): 211–19. http://dx.doi.org/10.21122/2220-9506-2021-12-3-211-219.

Pełny tekst źródła

Streszczenie:

Magnetic fluids belong to the class of nanomaterials with a high gain of light absorption, aggregative and sedimentation stability as well as controllability by external fields, which is of interest to use in the field of optoacoustics. The purpose of the work was to experimentally study the effect of the optoacoustic transformation in a magnetic fluid, depending on the concentration of magnetic colloidal particles, boundary conditions, intensity of the laser as well as to identify the possibilities of using the magnetic fluid as an element of the optoacoustic transformation in a number of app

Style APA, Harvard, Vancouver, ISO itp.

33

Tasrif, Arifin, Yuliar Yuliar, Dwiwanti Sulistyowati, Endang Krisnawati, Bayu Adirianto, and Dwi Sugiharti. "Potential Antagonists Trichoderma viride as Biofungicide, Plant Spacing, and Agricultural Lime Application to Suppress Anthracnose on Chili." Jurnal Perlindungan Tanaman Indonesia 28, no. 1 (2024): 46. http://dx.doi.org/10.22146/jpti.87342.

Pełny tekst źródła

Streszczenie:

Anthracnose caused by Colletotrichum capsici and C. gloesporium on chili is a disease that can reduce chili yields up to 80%. Control with fungicide has not been able to provide maximum results, because Colletotrichum can spread due to splashing of water, especially in the rainy season. The use of antagonistic fungi against Colletotrichum spp. has been widely published but is still limited to the laboratory and greenhouse scale, while field conditions are unpredictable. This study aims to identify the potency of Trichoderma viride that can be used as a biofungicide to control anthracnose in ch

Style APA, Harvard, Vancouver, ISO itp.

34

Philipp, Robert, Andreas Mladenow, Christine Strauss, and Alexander Voelz. "Revealing Challenges within the Application of Machine Learning Services – A Delphi Study." Journal of Data Intelligence 2, no. 1 (2021): 1–29. http://dx.doi.org/10.26421/jdi2.1-1.

Pełny tekst źródła

Streszczenie:

Over the past years, Machine Learning has been applied to an increasing number of problems across numerous industries. However, the steady rise in the application of Machine Learning has not come without challenges since companies often lack the expertise or infrastructure to build their own Machine Learning systems. These challenges led to the emergence of a new paradigm, called Machine Learning as a Service. Scientific literature has mainly analyzed this topic in the context of platform solutions that provide ready-to-use environments for companies. We recently have developed a platform-inde

Style APA, Harvard, Vancouver, ISO itp.

35

Wahyudi, Rizki, Muhammad Iqbal, and Lussy Dwi Oktaviana. "Recording dan Pencarian Silsilah Kambing Perah Menggunakan Algoritme Depth First Search." Jurnal Teknologi Informasi dan Ilmu Komputer 9, no. 1 (2022): 1. http://dx.doi.org/10.25126/jtiik.2022913349.

Pełny tekst źródła

Streszczenie:

<p class="Abstrak">Perkembangan teknologi informasi telah merata hampir ke semua bidang, salah satunya bidang peternakan. Keuntungan teknologi informasi diantaranya dapat memberikan kemudahan dalam aktifitas. Perkumpulan Peternak Akar Rumput merupakan perkumpulan peternak yang melakukan kegiatan budidaya kambing secara intensif. Kegiatan budidaya kambing perah dilakukan dengan memuliabiakan kambing Saanen, serta melakukan kawin silang/<em>cross</em> <em>breeding</em> dengan kambing lokal. Jumlah total anggota Perkumpulan yang aktif sebanyak 186 Anggota dan jumlah

Style APA, Harvard, Vancouver, ISO itp.

36

Pope, Barbara L. "Immunopharmacology: A new frontier." Canadian Journal of Physiology and Pharmacology 67, no. 6 (1989): 537–45. http://dx.doi.org/10.1139/y89-087.

Pełny tekst źródła

Streszczenie:

Immunopharmacology is a hybrid science which has been founded upon the principles, theory, and technical developments of both immunology and pharmacology, but which has a unique identity incorporating both basic and applied areas of research. Basic immunopharmacological research is concerned with the underlying mechanisms by which endogenous and synthetic chemicals interact with the cells of the immune system. Important areas of research include the actions of chemicals such as lymphokines, cytokines, complement, kinins, autacoids, drugs, and even neuropeptides on immune function. Applied immu

Style APA, Harvard, Vancouver, ISO itp.

37

Zielińska, Monika A., Agata Białecka, Barbara Pietruszka, and Jadwiga Hamułka. "Vegetables and fruit, as a source of bioactive substances, and impact on memory and cognitive function of elderly." Postępy Higieny i Medycyny Doświadczalnej 71, no. 1 (2017): 0. http://dx.doi.org/10.5604/01.3001.0010.3812.

Pełny tekst źródła

Streszczenie:

The phenomenon of population aging is not only associated with an increase in the number and proportion of older people in society, but also with an increase in the incidence of cognitive impairment. This can impair the functioning of the elderly in everyday life, work and social life participation and impair their quality of life. Hence, it is important to identify the protective factors. Neurodegenerative changes are closely linked to inflammatory processes and oxidative stress. Diet is of great importance, with particular attention being paid to the adequate intake of fruits and vegetables,

Style APA, Harvard, Vancouver, ISO itp.

38

Silvestre, R., M. Untiveros, and W. J. Cuellar. "First Report of Potato yellowing virus (Genus Ilarvirus) in Solanum phureja from Ecuador." Plant Disease 95, no. 3 (2011): 355. http://dx.doi.org/10.1094/pdis-09-10-0624.

Pełny tekst źródła

Streszczenie:

A bacilliform virus, named Potato yellowing virus (PYV), causing chlorosis of leaves was reported in 1992 in potato (Solanum tuberosum) fields in Peru (1) and symptomless wild potatoes (S. fernandezianum) in Chile (4). PYV is reported as an alfamo-like virus (1) (family Bromoviridae) but no sequence information is available for this virus, making its taxonomic position inside the Bromoviridae uncertain (currently this family is organized into five genera: Alfamovirus, Bromovirus, Cucumovirus, Ilarvirus, and Oleavirus). Herein we report the presence of PYV in native potatoes (Solanum phureja) c

Style APA, Harvard, Vancouver, ISO itp.

39

Xicola, Rosa Munoz, Vinit Singh, Thomas Rafter, et al. "Abstract A138: Decreasing disparities in inherited cancer syndrome identification through a systems approach, The At-Risk Cancer Genetic Syndrome Identification (ARCAGEN-ID) system." Cancer Epidemiology, Biomarkers & Prevention 33, no. 9_Supplement (2024): A138. http://dx.doi.org/10.1158/1538-7755.disp24-a138.

Pełny tekst źródła

Streszczenie:

Abstract Three percent of cancers are due to inherited cancer-predisposing syndromes, the most common ones being Hereditary Breast and Ovarian cancer syndrome and Lynch syndrome. Surveillance and preventive measures among diagnosed individuals lead to early detection, prevention of future cancers, and appropriate treatment modalities ultimately resulting in lower cancer mortality. Thus, identifying these individuals through genetic testing is of most importance. While guidelines have been drafted to identify people who need to be ruled out based on personal and family history of cancer, less t

Style APA, Harvard, Vancouver, ISO itp.

40

PRIYA, K., and Dr P. JAGADEESAN. "EFFECTS OF SOCIAL MEDIA MARKETING ON SUBSEQUENT FMCG PERFORMANCE." International Journal of Scientific Research in Modern Science and Technology 2, no. 8 (2023): 63–75. http://dx.doi.org/10.59828/ijsrmst.v2i8.137.

Pełny tekst źródła

Streszczenie:

Aim of the study: This study help the FMCG businesses to performance and identify their role in social media marketing.  Design/ Methodology: A one sample t-test is utilized for analysis used for hypothesis testing and anova is used to examine the respondent’s educational background and performance in the Fmcg business performance. Findings: The finding of the study to the proper effectiveness of social media marketing (SMM) and customer’s happiness with FMCG items. The creative use of a variety of social media platforms for marketing their goods and business performance. Additiona

Style APA, Harvard, Vancouver, ISO itp.

41

Wiśniewski, Bernard. "On the need of reaching the origins of security – an introduction to the discussion." Internal Security Special Issue (June 4, 2019): 105–18. http://dx.doi.org/10.5604/01.3001.0013.2182.

Pełny tekst źródła

Streszczenie:

This article presents basic issues concerning security research in the past, called reaching the origins of security. Reaching the origins is not a concept that finds its rightful place in security research. It has been used and thus fixed permanently in other areas, therefore, the issues discussed in this article concern problems from many fields of knowledge. Security testing covers a number of processes, including retrospective ones, the essence of which is a scientific look into the past. Reaching the origins, all in all, makes it possible to identify the sources of danger and the requirem

Style APA, Harvard, Vancouver, ISO itp.

42

Khan, Nizamuddin, Ajay Singh, and Rajeev Agrawal. "Enhancing Feature Extraction Technique Through Spatial Deep Learning Model for Facial Emotion Detection." Annals of Emerging Technologies in Computing 7, no. 2 (2023): 9–22. http://dx.doi.org/10.33166/aetic.2023.02.002.

Pełny tekst źródła

Streszczenie:

Automatic facial expression analysis is a fascinating and difficult subject that has implications in a wide range of fields, including human–computer interaction and data-driven approaches. Based on face traits, a variety of techniques are employed to identify emotions. This article examines various recent explorations into automatic data-driven approaches and handcrafted approaches for recognising face emotions. These approaches offer computationally complex solutions that provide good accuracy when training and testing are conducted on the same datasets, but they perform less well on the mos

Style APA, Harvard, Vancouver, ISO itp.

43

Diwan, Sinan, and Abdul Syukor Mohamad. "Machine Learning Empowered Software Prediction System." Wasit Journal of Computer and Mathematics Science 1, no. 3 (2022): 54–64. http://dx.doi.org/10.31185/wjcm.61.

Pełny tekst źródła

Streszczenie:

Prediction of software defects is one of the most active study fields in software engineering today. Using a defect prediction model, a list of code prone to defects may be compiled. Using a defect prediction model, software may be made more reliable by identifying and discovering faults before or during the software enhancement process. Defect prediction will play an increasingly important role in the design process as the scope of software projects grows. Bugs or the number of bugs used to measure the performance of a defect prediction procedure are referred to as "bugs" in this context. Def

Style APA, Harvard, Vancouver, ISO itp.

44

Buchmann, Johannes, and H. C. Williams. "On principal ideal testing in algebraic number fields." Journal of Symbolic Computation 4, no. 1 (1987): 11–19. http://dx.doi.org/10.1016/s0747-7171(87)80049-4.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

45

Goto, Yusuke, Gakuji Yaegashi, Kazuhiro Fukunari, and Tohru Suzuki. "An Importance of Long-Term Clinical Analysis to Accurately Diagnose Calves Persistently and Acutely Infected by Bovine Viral Diarrhea Virus 2." Viruses 13, no. 12 (2021): 2431. http://dx.doi.org/10.3390/v13122431.

Pełny tekst źródła

Streszczenie:

Bovine viral diarrhea virus (BVDV) infection results in a wide variety of clinical manifestations and is a pathogen that is able to cause huge economic losses in the cattle industry worldwide. It is important to identify cattle that are persistently infected (PI) by BVDV within the herd as early as possible because PI animals are the main reservoir of the virus. In contrast, cattle who are acutely infected (AI) with BVDV show various clinical signs, but most cattle show either mild symptoms or are asymptomatic. In general, AI and PI animals can be distinguished by repeat testing within an inte

Style APA, Harvard, Vancouver, ISO itp.

46

Tăucean, Ilie, Matei Tămășilă, Larisa Ivascu, Șerban Miclea, and Mircea Negruț. "Integrating Sustainability and Lean: SLIM Method and Enterprise Game Proposed." Sustainability 11, no. 7 (2019): 2103. http://dx.doi.org/10.3390/su11072103.

Pełny tekst źródła

Streszczenie:

Sustainability and leanness are organizational approach concepts for more efficient activities and increased competitiveness. This paper presents a study and an application of the concepts of sustainability and lean, with the purpose to capitalize on the benefits of the two concepts’ tools when used together in an industry and education activity. A literature review was carried out to evaluate qualitatively and empirically the concepts of sustainability, lean, and enterprise games, and the possibility to integrate the first two concepts into a new tool applied into an enterprise game. An onlin

Style APA, Harvard, Vancouver, ISO itp.

47

Ivanyos, Gábor, Marek Karpinski, Miklos Santha, Nitin Saxena, and Igor E. Shparlinski. "Polynomial Interpolation and Identity Testing from High Powers Over Finite Fields." Algorithmica 80, no. 2 (2017): 560–75. http://dx.doi.org/10.1007/s00453-016-0273-1.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

48

Rossmann, Tobias. "Primitivity testing of finite nilpotent linear groups." LMS Journal of Computation and Mathematics 14 (March 1, 2011): 87–98. http://dx.doi.org/10.1112/s1461157010000227.

Pełny tekst źródła

Streszczenie:

AbstractWe describe a practical algorithm for primitivity testing of finite nilpotent linear groups over various fields of characteristic zero, including number fields and rational function fields over number fields. For an imprimitive group, a system of imprimitivity can be constructed. An implementation of the algorithm in Magma is publicly available.

Style APA, Harvard, Vancouver, ISO itp.

49

Miller, David, and Sundas Ali. "Testing the national identity argument." European Political Science Review 6, no. 2 (2013): 237–59. http://dx.doi.org/10.1017/s1755773913000088.

Pełny tekst źródła

Streszczenie:

The national identity argument holds that a shared national identity is necessary to motivate citizens in democratic societies to pursue a number of goals, especially social justice. We review the empirical evidence for and against this claim, looking particularly at how national identities have been measured. We distinguish between studies that aim to compare the relative strength of identities cross-nationally and those that look at individual differences within one nation. We separate four dimensions of national identity: national attachment, national pride, critical vs. uncritical patrioti

Style APA, Harvard, Vancouver, ISO itp.

50

Aguilar, E., V. G. Sengoda, B. Bextine, K. F. McCue, and J. E. Munyaneza. "First Report of “Candidatus Liberibacter solanacearum” on Tobacco in Honduras." Plant Disease 97, no. 10 (2013): 1376. http://dx.doi.org/10.1094/pdis-04-13-0453-pdn.

Pełny tekst źródła

Streszczenie:

In April of 2012, tobacco (Nicotiana tabacum L.) plants with symptoms resembling those associated with viral infection were observed in commercial fields in the Department of El-Paraíso, Honduras. Symptoms on affected plants included apical leaf curling and stunting, overall chlorosis and plant stunting, young plant deformation with cabbage-like leaves, wilting, and internal vascular necrosis of stems and leaf petioles. All cultivars grown were affected, with disease incidence ranging from 5 to 80% of symptomatic plants per field. The fields were also heavily infested with the psyllid Bacteric

Style APA, Harvard, Vancouver, ISO itp.

Oferujemy zniżki na wszystkie plany premium dla autorów, których prace zostały uwzględnione w tematycznych zestawieniach literatury. Skontaktuj się z nami, aby uzyskać unikalny kod promocyjny!