Zaloguj się

Gotowe bibliografie tematyczne / Streptococcus agalactiae biochemical characteristics / Artykuły w czasopismach

Kliknij ten link, aby zobaczyć inne rodzaje publikacji na ten temat: Streptococcus agalactiae biochemical characteristics.

Artykuły w czasopismach na temat „Streptococcus agalactiae biochemical characteristics”

Autor: Grafiati

Data publikacji: 3 czerwca 2025

Data aktualizacji: 31 lipca 2025

Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych

Wybierz rodzaj źródła:

Sprawdź 50 najlepszych artykułów w czasopismach naukowych na temat „Streptococcus agalactiae biochemical characteristics”.

Przycisk „Dodaj do bibliografii” jest dostępny obok każdej pracy w bibliografii. Użyj go – a my automatycznie utworzymy odniesienie bibliograficzne do wybranej pracy w stylu cytowania, którego potrzebujesz: APA, MLA, Harvard, Chicago, Vancouver itp.

Możesz również pobrać pełny tekst publikacji naukowej w formacie „.pdf” i przeczytać adnotację do pracy online, jeśli odpowiednie parametry są dostępne w metadanych.

Przeglądaj artykuły w czasopismach z różnych dziedzin i twórz odpowiednie bibliografie.

1

Kawamura, Yoshiaki, Yoko Itoh, Noriko Mishima, Kiyufumi Ohkusu, Hiroaki Kasai, and Takayuki Ezaki. "High genetic similarity of Streptococcus agalactiae and Streptococcus difficilis: S. difficilis Eldar et al. 1995 is a later synonym of S. agalactiae Lehmann and Neumann 1896 (Approved Lists 1980)." International Journal of Systematic and Evolutionary Microbiology 55, no. 2 (2005): 961–65. http://dx.doi.org/10.1099/ijs.0.63403-0.

Pełny tekst źródła

Streszczenie:

The genetic relationship between Streptococcus agalactiae and Streptococcus difficilis was studied. S. difficilis was originally described as serologically non-typable but was later reported to be a group B, type Ib streptococcus. Upon comparative analysis of five gene sequences, it was found that S. agalactiae and S. difficilis are closely related. Sequence similarity values between these two species were 100·0 % for 16S rRNA, 99·6 % for gyrB, 98·6 % for sodA, 99·5 % for gyrA and 99·8 % for parC genes. These data strongly suggest that S. agalactiae and S. difficilis are synonyms. The biochemi

Style APA, Harvard, Vancouver, ISO itp.

2

Jobin, T., P. Harikrishna, B. Sreenath, L. Gian, L. Goncalo, and J. Siju. "Identification of an unusual Streptococcus agalactiae growing on MacConkey Agar and its confirmation by biochemical tests, qPCR and nanopore sequencing." Journal of Veterinary and animal sciences 55, no. 4 (2024): 675–79. https://doi.org/10.51966/jvas.2024.55.4.675-679.

Pełny tekst źródła

Streszczenie:

Streptococcus agalactiae belongs to Group B Streptococcus (GBS), an important Gram-positive pathogen attributed to mastitis and elevated somatic cell counts (SCC) in dairy cows, which invariably exhibits complete β-haemolysis on blood agar (BA) / Polymixin Nalidixic acid Blood Agar (PNBA) and fails to grow on MacConkey agar (MCA). The present study conducted in the Advanced Agricultural Laboratories under the Almarai company, Riyadh, KSA, reports the isolation, identification and characterization of β-haemolytic Strepotococcus agalactiae which exhibited lactose fermenting colonies on MCA. Thou

Style APA, Harvard, Vancouver, ISO itp.

3

Nafiqoh, Nunak, Hessy Novita, Desy Sugiani, et al. "Aeromonas hydrophila AHL 0905-2 and Streptococcus agalactiae N14G as Combined Vaccine Candidates for Nile Tilapia." HAYATI Journal of Biosciences 29, no. 2 (2022): 137–45. http://dx.doi.org/10.4308/hjb.29.2.137-145.

Pełny tekst źródła

Streszczenie:

In Indonesia, the Nile tilapia (Oreochromis niloticus) is the most widely farmed and available fish for consumption. Production loss due to bacterial infection by Aeromonas hydrophila and Streptococcus agalactiae is the main problem in tilapia cultivation. This study aimed to determine the occurrence of concurrent infection of Aeromonas hydrophila AHL 0905-2 and Streptococcus agalactiae N14G in Nile tilapia based on biochemical and molecular characteristics. From the results of biochemical assay and sequence analysis of the 16S rRNA fragment, Aeromonas hydrophila and Streptococcus agalactiae w

Style APA, Harvard, Vancouver, ISO itp.

4

Lusiastuti, Angela Mariana, Lila Gardenia, Tatik Mufidah, and Yani Aryati. "Streptococcus agalactiae INFECTION ON TILAPIA (Oreochromis niloticus) IN CIRATA RESERVOIR, WEST JAVA." Indonesian Aquaculture Journal 4, no. 1 (2009): 47. http://dx.doi.org/10.15578/iaj.4.1.2009.47-51.

Pełny tekst źródła

Streszczenie:

Streptococcosis is one of bacterial diseases in the culture of Tilapia, Oreochromis niloticus and has caused significant economic losses. Streptococcus iniae, is known as pathogen to marine and freshwater fishes whereas Streptococcus agalactiae is known as pathogen to Tilapia. The isolation and characterization of four isolates of S. agalactiae, were described from an infected Tilapia from Cirata Reservoir, West Java, in July 2008. Conventional and rapid identification systems were used to determine isolates of S. agalactiae from brain and kidney tissues. In this paper, we have characterized S

Style APA, Harvard, Vancouver, ISO itp.

5

Gan, ZiXuen, Pei Qin Tan, Murni Halim, et al. "Characterization of Streptococcus agalactiae Strain TP540K and Its Potential as a Target for DNA Aptamer Development in the Preliminary Stage of Whole-Cell Based SELEX." Journal of Environmental Microbiology and Toxicology 12, no. 2 (2024): 31–37. https://doi.org/10.54987/jemat.v12i2.1010.

Pełny tekst źródła

Streszczenie:

Streptococcus outbreak caused mainly by Streptococcus agalactiae leads to massive mortalities of freshwater aquatic organisms, especially cultured tilapias. This has caused a huge concern in the Malaysian aquaculture industry due to a lower aquaculture production affected by the outbreak. Thus, there is a need for a rapid and simple method to detect and monitor S. agalactiae in cultured fishponds. This study aims to investigate the characteristics of a local S. agalactiae strain TP540K and its potential as a target bacterium to develop DNA aptamer through the whole-cell based ‘systematic evolu

Style APA, Harvard, Vancouver, ISO itp.

6

Rarassari, Madyasta, and Marsela Aprilia. "Case report; Identification of Bacteria in Catfish (Pangasius sp.) at the Palembang Fish Quarantine Station." Journal of Aquaculture Science 9, no. 1 (2024): 23–29. http://dx.doi.org/10.20473/joas.v9i1.53385.

Pełny tekst źródła

Streszczenie:

One of the causes of disease attacks can be caused by bacteria, two of which are Edwardsiella ictaluri and Streptococcus agalactiae which often attack catfish. One of the causes of disease attacks can be caused by bacteria, two of which are Edwardsiella ictaluri and Streptococcus agalactiae which often attack catfish. Disease attacks can be prevented as early as possible by periodically identifying certain bacteria so that it can facilitate appropriate treatment to prevent them. This activity aimed to study bacterial identification techniques in catfish (Pangasius sp.) at the Fish Quarantine S

Style APA, Harvard, Vancouver, ISO itp.

7

Haneen Kadhum Abdul-Hamza and Ghaidaa Jihadi Mohammed. "Identification of Streptococcus agalactiae isolated from pregnant women by 16srRNA gene." International Journal of Research in Pharmaceutical Sciences 10, no. 2 (2019): 1523–26. http://dx.doi.org/10.26452/ijrps.v10i2.783.

Pełny tekst źródła

Streszczenie:

The main goal of the current study is to isolate and diagnose of Streptococcus agalactiae by using the diagnostic 16 SrRNA gene. S.agalactiae was isolated from 850 samples including (425) vaginal swabs, (425) rectal swabs and identified by studying the morphological characteristics of colonies on culture, microscopic characteristics of bacterial cells, biochemical methods, Vitek 2 system, API-20 Strep, and then confirmed the identification by detection of 16SrRNA gene by Polymerase Chain reaction (PCR) followed by DNA Sequence analysis for this gene. A total of 16 isolates of S.agalactiae were

Style APA, Harvard, Vancouver, ISO itp.

8

Ganesh, Phaniraj K. L., Rajasekhar P., and Prabha R. "Biochemical Characteristics of Bacterial Isolates Obtained from Bovine Mastitic Milk Samples." Journal of Advances in Microbiology 24, no. 9 (2024): 37–47. http://dx.doi.org/10.9734/jamb/2024/v24i9850.

Pełny tekst źródła

Streszczenie:

Aim: Bovine mastitis affects the milk production in milking cattle and the milk producer. The major causative organism of mastitis includes the bacteria. The present study is focused on the identification of bacterial isolates obtained from milk samples of bovine mastitis based on their biochemical activities. Study Design: The bacterial isolates obtained from California mastitis test positive milk samples of in and around Bengaluru district, Karnataka were collected from Department of Veterinary Microbiology, Veterinary College, KVAFSU, Bengaluru, Karnataka and subjected to staining for morph

Style APA, Harvard, Vancouver, ISO itp.

9

Salvador, Rogério, Ernst Eckehardt Muller, Julio César de Freitas, Julio Hermann Leonhadt, Lucienne Garcia Pretto-Giordano, and Juliana Alves Dias. "Isolation and characterization of Streptococcus spp. group B in Nile tilapias (Oreochromis niloticus) reared in hapas nets and earth nurseries in the northern region of Parana State, Brazil." Ciência Rural 35, no. 6 (2005): 1374–78. http://dx.doi.org/10.1590/s0103-84782005000600023.

Pełny tekst źródła

Streszczenie:

The objective of this study was to isolate and characterize Streptococcus spp. in Nile tilapias (Oreochromis niloticus) reared in net-pens and earth nurseries. Eight intensive tilapia-rearing farms were investigated in north Paraná, Brazil from April 1st 2001 to April 30th 2002. The fish were reared in a system of hapas nets on four farms and in earth nurseries on other four farms. A total of 370 samples were analyzed of material collected from 120 fish (brain, liver, kidney, skin scrapes, ascites liquid and eye) that were sown on BHI agar (Brain Heart Infusion) supplemented with 1% yeast extr

Style APA, Harvard, Vancouver, ISO itp.

10

Richards, Vincent P., Irina M. Velsko, Md Tauqeer Alam, et al. "Population Gene Introgression and High Genome Plasticity for the Zoonotic Pathogen Streptococcus agalactiae." Molecular Biology and Evolution 36, no. 11 (2019): 2572–90. http://dx.doi.org/10.1093/molbev/msz169.

Pełny tekst źródła

Streszczenie:

Abstract The influence that bacterial adaptation (or niche partitioning) within species has on gene spillover and transmission among bacterial populations occupying different niches is not well understood. Streptococcus agalactiae is an important bacterial pathogen that has a taxonomically diverse host range making it an excellent model system to study these processes. Here, we analyze a global set of 901 genome sequences from nine diverse host species to advance our understanding of these processes. Bayesian clustering analysis delineated 12 major populations that closely aligned with niches.

Style APA, Harvard, Vancouver, ISO itp.

11

Mpatswenumugabo, J. P., L. C. Bebora, G. C. Gitao, et al. "Prevalence of Subclinical Mastitis and Distribution of Pathogens in Dairy Farms of Rubavu and Nyabihu Districts, Rwanda." Journal of Veterinary Medicine 2017 (July 17, 2017): 1–8. http://dx.doi.org/10.1155/2017/8456713.

Pełny tekst źródła

Streszczenie:

A cross-sectional study was conducted from May 2016 to January 2017 in Rubavu and Nyabihu districts, Western Rwanda, aiming at estimating the prevalence of subclinical mastitis (SCM) and identifying its causative bacteria. Management practices and milking procedures were recorded through a questionnaire. 123 crossbreed milking cows from 13 dairy farms were randomly selected and screened for SCM using California Mastitis Test (CMT). Composite CMT positive milk samples were processed for bacterial isolation and identification. The overall SCM prevalence at cow level was 50.4%. 68 bacterial isola

Style APA, Harvard, Vancouver, ISO itp.

12

Daoud, Ziad, and Claude Afif. "Escherichia coli Isolated from Urinary Tract Infections of Lebanese Patients between 2000 and 2009: Epidemiology and Profiles of Resistance." Chemotherapy Research and Practice 2011 (October 12, 2011): 1–6. http://dx.doi.org/10.1155/2011/218431.

Pełny tekst źródła

Streszczenie:

The purpose of this study was to investigate the bacterial etiology of urinary tract infections in one of the busiest hospitals of Lebanon and to examine the epidemiologic and microbiologic properties of Escherichia coli isolated from urinary tract infections of Lebanese patients over a 10-year period. Methods. This retrospective study analyzed the data generated between 2000 and 2009 (10,013 Gram-positive and Gram-negative bacteria). Bacterial identification was based on standard culture and biochemical characteristics of isolates. Antimicrobial susceptibility was tested by the disk diffusion

Style APA, Harvard, Vancouver, ISO itp.

13

Kareem Raheem, Zahraa, and Layla Abdulhamid Said. "Incidence of symptomatic aerobic vaginitis among some Iraqi women in Baghdad city." Bionatura 7, no. 4 (2022): 1–8. http://dx.doi.org/10.21931/rb/2022.07.04.59.

Pełny tekst źródła

Streszczenie:

Aerobic vaginitis (AV) is a newly adopted type of vaginal infection caused by aerobic bacteria; it was defined by Donders in 2002 and diagnosed according to Donder's criteria. AV is associated with increased vaginal pH, decreased vaginal microbiota and overgrowth of facultative anaerobic or aerobic bacteria, including Gram-positive cocci and Gram-negative bacilli. Because knowledge of the aerobic bacterial types causing AV is very important and only limited studies are available in Iraq about this type of vaginal infection, this study aimed to report the prevalence of AV in symptomatic women i

Style APA, Harvard, Vancouver, ISO itp.

14

Mohamed Ismail Mohamed Fangama, Myson Ali Babiker, and Siham Elias Suliman Mohamed Abdelsalam Abdalla. "Bovine Mastitis in Eldamazine Locality – Blue Nile State." International Journal of Current Microbiology and Applied Sciences 10, no. 9 (2021): 1–7. http://dx.doi.org/10.20546/ijcmas.2021.1009.001.

Pełny tekst źródła

Streszczenie:

This study conducted to examine the clinical bovine mastitis to isolate and identify the bacteria causing the disease and to determine the sensitivity pattern of isolates to commonly using antibiotic in Eldamazine locality, Blue Nile State. A total of 45 dairy cows clinically infected by different types of mastitis. Mastitis milk samples were collected from the animals and transported to microbiology laboratory for bacteriological examination. The samples were cultured in blood agar, MacConkey agar and purified in nutrient agar. Gram stain was used for morphological characteristics. Biochemica

Style APA, Harvard, Vancouver, ISO itp.

15

Trivedi, Mahendra Kumar, Alice Branton, Dahryn Trivedi, et al. "Effect of Biofield Energy Treatment on Streptococcus group B: A Postpartum Pathogen." Journal of Microbial & Biochemical Technology 7, no. 5 (2015): 269–73. https://doi.org/10.4172/1948-5948.1000223.

Pełny tekst źródła

Streszczenie:

Streptococcus agalactiae group B (S. agalactiae gr. B) is widespread in nature mainly causes bacterial septicemia and neonatal meningitis. The current study was attempted to investigate the effect of biofield treatment on S. agalactiae gr. B with respect of antimicrobial sensitivity, biochemical reactions and bio typing. S. agalactiae gr. B strain was used in this experiment bearing the American Type Culture Collection (ATCC 12386) number and stored according to the recommended storage protocol. The revived and lyophilized state of ATCC strains of S. agalactiae gr. B were selected for the stud

Style APA, Harvard, Vancouver, ISO itp.

16

Trivedi, Mahendra Kumar, Alice Branton, Dahryn Trivedi, et al. "Effect of Biofield Energy Treatment on Streptococcus group B: A Postpartum Pathogen." Journal of Microbial & Biochemical Technology 7, no. 5 (2015): 269–73. https://doi.org/10.5281/zenodo.167155.

Pełny tekst źródła

Streszczenie:

Streptococcus agalactiae group B (S. agalactiae gr. B) is widespread in nature mainly causes bacterial septicemia and neonatal meningitis. The current study was attempted to investigate the effect of biofield treatment on S. agalactiae gr. B with respect of antimicrobial sensitivity, biochemical reactions and bio typing. S. agalactiae gr. B strain was used in this experiment bearing the American Type Culture Collection (ATCC 12386) number and stored according to the recommended storage protocol. The revived and lyophilized state of ATCC strains of S. agalactiae gr. B were selected for the stud

Style APA, Harvard, Vancouver, ISO itp.

17

ZDRAGAS (Α. ΖΔΡΑΓΚΑΣ), A., P. TSAKOS (Π. ΤΣΑΚΟΣ), C. KOTZAMANIDIS (Χ. ΚΟΤΖΑΜΑΝΙΔΗΣ), K. ANATOLIOTIS (Κ. ΑΝΑΤΟΛΙΩΤΗΣ), and I. TSAKNAKIS (Η. ΤΣΑΚΝΑΚΗΣ). "Outbreak of mastitis in ewes caused by Streptococcus agalactiae." Journal of the Hellenic Veterinary Medical Society 56, no. 2 (2017): 114. http://dx.doi.org/10.12681/jhvms.15075.

Pełny tekst źródła

Streszczenie:

Many cases of acute clinical mastitis, in seven neighboring sheep flocks of Larissa Prefecture, were investigated. The causative agent was identified by biochemical and serological tests as Streptococcus agalactiae. Further investigation of the isolates by pulsed-field gel electrophoresis (PFGE) revealed identical profiles. The results indicate that S. agalactiae should be considered as a significant pathogen that induces mastitis in ewes; the disease is characterized by high morbidity, easy transmission between ewes and rapid reduction in milk production. The antibiotic therapy proved to be i

Style APA, Harvard, Vancouver, ISO itp.

18

Lusiastuti, Angela Mariana, Uni Purwaningsih, and Tuti Sumiati. "ISOLASI BAKTERIOFAGA ANTI Streptococcus agalactiae DARI IKAN NILA (Oreochromis niloticus)." Jurnal Riset Akuakultur 5, no. 2 (2016): 237. http://dx.doi.org/10.15578/jra.5.2.2010.237-243.

Pełny tekst źródła

Streszczenie:

Infeksi Streptococcus merupakan salah satu penyakit serius pada ikan yang disebabkan oleh bakteri gram positif. Infeksi oleh streptococcus beta-hemolitik paling sering dilaporkan menginfeksi ikan. Di antara streptococci beta-hemolitik, Streptococcus iniae penyebab septicemia, meningoencefalitis, dan kematian pada ikan budidaya. Selain itu, Streptococcus agalactiae juga menyebabkan streptococcosis parah pada ikan nila. Alternatif yang bisa digunakan untuk terapi infeksi streptococcosis adalah dengan penggunaan bakteriofaga yang merupakan virus yang hidup pada bakteri. Tujuan penelitian ini adal

Style APA, Harvard, Vancouver, ISO itp.

19

Lusiastuti, Angela Mariana, Taukhid Taukhid, Eni Kusrini, and Wartono Hadie. "SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus)." Indonesian Aquaculture Journal 4, no. 2 (2009): 87. http://dx.doi.org/10.15578/iaj.4.2.2009.87-92.

Pełny tekst źródła

Streszczenie:

Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG a

Style APA, Harvard, Vancouver, ISO itp.

20

Suhermanto, Achmad, Suhermin Suhermin, Ridwan Ridwan, Indri Astuti, and Iis Nurmawanti. "POLA INFEKSI Streptococcus agalactiae STRAIN NP105O DAN N14G PADA IKAN NILA (Oreochromis niloticus)." Jurnal Riset Akuakultur 15, no. 1 (2020): 51. http://dx.doi.org/10.15578/jra.15.1.2020.51-58.

Pełny tekst źródła

Streszczenie:

Infeksi Streptococcosis yang disebabkan oleh bakteri patogen Streptococcus agalactiae dengan karakteristik strain berbeda menjadi permasalahan utama pada budidaya ikan nila. Penelitian ini bertujuan untuk menelaah pola infeksi bakteri S. agalactiae strain NP105O dan N14G, melalui performa organ target, gejala klinis, serta hematologi ikan nila Oreochromis niloticus. Karakterisasi S. agalactiae berdasarkan pada SNI dan API 20 STREP, uji pertumbuhan bakteri dilakukan dengan metode total plate count (TPC). Pengujian eksistensi bakteri dengan cara menginjeksikan S. agalactiae secara intraperitonea

Style APA, Harvard, Vancouver, ISO itp.

21

Hogan, Joseph S., K. Larry Smith, Deborah A. Todhunter, and Pam S. Schoenberger. "Sensitivity and specificity of latex agglutination tests used to identify Streptococcus agalactiae and Staphylococcus aureus isolated from bulk tank milk." American Journal of Veterinary Research 49, no. 9 (1988): 1537–39. https://doi.org/10.2460/ajvr.1988.49.09.1537.

Pełny tekst źródła

Streszczenie:

SUMMARY Comparisons were made among rapid latex agglutination tests and conventional biochemical tests used to identify Streptococcus agalactiae and Staphylococcus aureus. Ninety-eight streptococci and 149 staphylococci isolated from bulk tank milk were tested. Sensitivity and specificity for the latex agglutination test used for identification of Str agalactiae were 97.6 and 98.2%, respectively. Sensitivity and specificity for the latex agglutination test used for identification of S aureus were 90.2 and 67.5%, respectively. Of 25 staphylococci considered false-positive by the latex agglutina

Style APA, Harvard, Vancouver, ISO itp.

22

Kannambath, Rachana, Shruthi Vasanthaiah, Imola Jamir, Haritha Sagili, and Jharna Mandal. "The trends of isolation and antimicrobial susceptibility of group B Streptococcus in urine culture: a 7-years cross sectional study." International Journal of Reproduction, Contraception, Obstetrics and Gynecology 12, no. 6 (2023): 1784–88. http://dx.doi.org/10.18203/2320-1770.ijrcog20231555.

Pełny tekst źródła

Streszczenie:

Background: Group B Streptococcus (GBS)/Streptococcus agalactiae (S. agalactiae) is a common rectovaginal colonizer, thereby a potential agent of neonatal and maternal infection. This study estimates the trends of isolation of GBS, its antimicrobial profile in urine culture and the demographic characteristics of these patients over a 7-year period. Methods: A record-based study was conducted, which included all the urine culture reports of GBS/S. agalactiae from January 2014 to December 2020. The trend of occurrence of GBS bacteriuria, demographic characteristics and antimicrobial susceptibili

Style APA, Harvard, Vancouver, ISO itp.

23

Bigus, Daniel, Wioleta Lewandowska, Ewelina Bięga, et al. "Ultra-Fast Impedimetric Immunoassay for Detection of Streptococcus agalactiae Using Carbon Electrode with Nanodiamonds Film." Micromachines 14, no. 5 (2023): 1076. http://dx.doi.org/10.3390/mi14051076.

Pełny tekst źródła

Streszczenie:

This publication presents the results of work on the development of a quick and cheap electrochemical immunosensor for the diagnosis of infections with the pathogen Streptococcus agalactiae. The research was carried out on the basis of the modification of the well-known glassy carbon (GC) electrodes. The surface of the GC (glassy carbon) electrode was covered with a film made of nanodiamonds, which increased the number of sites for the attachment of anti-Streptococcus agalactiae antibodies. The GC surface was activated with EDC/NHS (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide/N-Hydroxysuccin

Style APA, Harvard, Vancouver, ISO itp.

24

Megat Mazhar Khair, Megat Hamzah, An Nie Tee, Nurul Fazlin Wahab, et al. "Comprehensive Characterization of a Streptococcus agalactiae Phage Isolated from a Tilapia Farm in Selangor, Malaysia, and Its Potential for Phage Therapy." Pharmaceuticals 16, no. 5 (2023): 698. http://dx.doi.org/10.3390/ph16050698.

Pełny tekst źródła

Streszczenie:

The Streptococcus agalactiae outbreak in tilapia has caused huge losses in the aquaculture industry worldwide. In Malaysia, several studies have reported the isolation of S. agalactiae, but no study has reported the isolation of S. agalactiae phages from tilapia or from the culture pond. Here, the isolation of the S. agalactiae phage from infected tilapia is reported and it is named as vB_Sags-UPM1. Transmission electron micrograph (TEM) revealed that this phage showed characteristics of a Siphoviridae and it was able to kill two local S. agalactiae isolates, which were S. agalactiae smyh01 an

Style APA, Harvard, Vancouver, ISO itp.

25

van der Mee-Marquet, Nathalie, Cindy Jouannet, Anne-Sophie Domelier, Laurence Arnault, Marie-Frédérique Lartigue, and Roland Quentin. "Genetic diversity of Streptococcus agalactiae strains and density of vaginal carriage." Journal of Medical Microbiology 58, no. 2 (2009): 169–73. http://dx.doi.org/10.1099/jmm.0.005827-0.

Pełny tekst źródła

Streszczenie:

We screened 500 pregnant women who had no risk factors for Streptococcus agalactiae vaginal carriage, and isolated 39 S. agalactiae strains (8 %). The density of carriage was low in 16 cases (41 %), intermediate in 16 cases (41 %) and heavy in seven cases (18 %). Strains were mostly of serotype III (41 %), Ia (26 %) and V (18 %). Thirty-five strains had at least one of five genetic markers that have been associated with virulent phylogenetic subgroups of strains. Using PCR, nine strains (23 %) were identified as belonging to CC17. The 39 vaginal strains that were studied exhibited a substantia

Style APA, Harvard, Vancouver, ISO itp.

26

Patrick, Edafe Ejiro, Imarenezor Edobor Peter Kenneth, Anyiam Vivian Ifeoma, and Salvage Akpomedaye. "Prevalence of Group B Streptococcus among Individuals in Yenagoa, Bayelsa State, South South, Nigeria." African Journal of Medicine, Surgery and Public Health Research 1, no. 1 (2024): 54–65. https://doi.org/10.58578/ajmsphr.v1i1.4036.

Pełny tekst źródła

Streszczenie:

Streptococcus agalactiae also known as Group B Streptococcus (GBS) is a Gram-positive bacterium that primarily colonizes the gastrointestinal and genitourinary tracts of humans. While it is a commensal organism in many healthy individuals, GBS can become pathogenic, causing a variety of infections. This study investigated the prevalence of Group B Streptococcus (GBS) colonization among adults in Yenagoa, Bayelsa State, Nigeria, to assess the distribution of GBS across various age groups and between sexes. A total of 185 individuals were included in the study which comprises of both male and fe

Style APA, Harvard, Vancouver, ISO itp.

27

Suhermanto, Achmad, Sukenda Sukenda, Muhammad Zairin Jr., Angela Mariana Lusiastuti та Sri Nuryati. "TOKSISITAS SEL UTUH DAN EXTRACELLULAR PRODUCT (ECP) Streptococcus agalactiae β-HEMOLITIK DAN NON-HEMOLITIK PADA IKAN NILA (Oreochromis niloticus)". Jurnal Riset Akuakultur 13, № 4 (2019): 317. http://dx.doi.org/10.15578/jra.13.4.2018.317-328.

Pełny tekst źródła

Streszczenie:

Bakteri Streptococcus agalactiae tipe β-hemolitik dan non-hemolitik menjadi agen penyebab infeksi streptococcosis yang mengakibatkan kematian dan kerugian besar pada budidaya ikan nila. Penelitian ini bertujuan untuk membandingkan toksisitas sel utuh dan extracellular product (ECP) bakteri b-hemolitik dan non-hemolitik yang diinjeksikan pada ikan nila. Karakterisasi S. agalactiae berdasarkan SNI dan API 20 STREP, serta pemisahan protein dengan metode SDS-PAGE. Pengujian toksisitas dilakukan dengan cara menginjeksikan sel utuh dan ECP S. agalactiae secara intraperitoneal (IP) dengan dosis 0,1 m

Style APA, Harvard, Vancouver, ISO itp.

28

Du, Jinliang, Liping Cao, Jiancao Gao, et al. "Protective Effects of Glycyrrhiza Total Flavones on Liver Injury Induced by Streptococcus agalactiae in Tilapia (Oreochromis niloticus)." Antibiotics 11, no. 11 (2022): 1648. http://dx.doi.org/10.3390/antibiotics11111648.

Pełny tekst źródła

Streszczenie:

Clinical studies have confirmed that Glycyrrhiza total flavones (GTFs) have good anti-hepatic injury, but whether they have a good protective effect on anti-hepatic injury activity induced by Streptococcus agalactiae in tilapia (Oreochromis niloticus) is unknown. The aims of this study were to investigate the protective effects of Glycyrrhiza total flavones on liver injury induced by S. agalactiae (SA) and its underlying mechanism in fish. A total of 150 tilapia were randomly divided into five groups, each with three replicates containing 10 fish: normal control group, S. agalactiae infection

Style APA, Harvard, Vancouver, ISO itp.

29

Cheng, Zhaomin, Pinghua Qu, Peifeng Ke, et al. "Antibiotic Resistance and Molecular Epidemiological Characteristics of Streptococcus agalactiae Isolated from Pregnant Women in Guangzhou, South China." Canadian Journal of Infectious Diseases and Medical Microbiology 2020 (April 30, 2020): 1–11. http://dx.doi.org/10.1155/2020/1368942.

Pełny tekst źródła

Streszczenie:

Streptococcus agalactiae colonization in pregnant women can cause postpartum intrauterine infections and life-threatening neonatal infections. To formulate strategies for the prevention and treatment of S. agalactiae infections, we performed a comprehensive analysis of antibiotic resistance and a molecular-based epidemiological investigation of S. agalactiae in this study. Seventy-two S. agalactiae strains, collected from pregnant women, were subjected to antibiotic susceptibility tests; then, the screened erythromycin and clindamycin nonsusceptible isolates were used for macrolides and clinda

Style APA, Harvard, Vancouver, ISO itp.

30

Bryan, Joshua D., and Daniel W. Shelver. "Streptococcus agalactiae CspA Is a Serine Protease That Inactivates Chemokines." Journal of Bacteriology 191, no. 6 (2008): 1847–54. http://dx.doi.org/10.1128/jb.01124-08.

Pełny tekst źródła

Streszczenie:

ABSTRACT Streptococcus agalactiae (group B Streptococcus [GBS]) remains a leading cause of invasive infections in neonates and has emerged as a pathogen of the immunocompromised and elderly populations. The virulence mechanisms of GBS are relatively understudied and are still poorly understood. Previous evidence indicated that the GBS cspA gene is necessary for full virulence and the cleavage of fibrinogen. The predicted cspA product displays homology to members of the extracellular cell envelope protease family. CXC chemokines, many of which can recruit neutrophils to sites of infection, are

Style APA, Harvard, Vancouver, ISO itp.

31

Shen, Lijuan, Manqian Huang, and Nanli Xie. "Experimental Study on Streptococcus agalactiae Genotype and Erythromycin Resistance in Neonatal Sepsis." Cellular and Molecular Biology 67, no. 6 (2022): 100–106. http://dx.doi.org/10.14715/cmb/2021.67.6.14.

Pełny tekst źródła

Streszczenie:

This study aimed to evaluate Streptococcus agalactiae genotype and erythromycin resistance in neonatal sepsis. After obtaining the mothers’ informed consent, trained nurses sampled 430 neonatal specimens of sepsis from the ear canal, oral cavity and umbilical cord immediately after childbirth and implemented a cross-sectional study. By Gram staining, morphology, hemolysis mode, catalase and CAMP tests, the isolate was identified as S. agalactiae. All 455 isolates were tested for antimicrobial susceptibility by the disc diffusion method. Multilocus sequence typing was used to serotype S. agalac

Style APA, Harvard, Vancouver, ISO itp.

32

Hsu, Jen-Fu, Jang-Jih Lu, Shih-Ming Chu, et al. "The Clinical and Genetic Characteristics of Streptococcus agalactiae Meningitis in Neonates." International Journal of Molecular Sciences 24, no. 20 (2023): 15387. http://dx.doi.org/10.3390/ijms242015387.

Pełny tekst źródła

Streszczenie:

Streptococcus agalactiae (Group B Streptococcus, GBS) is an important pathogen of bacterial meningitis in neonates. We aimed to investigate the clinical and genetic characteristics of neonatal GBS meningitis. All neonates with GBS meningitis at a tertiary level medical center in Taiwan between 2003 and 2020 were analyzed. Capsule serotyping, multilocus sequence typing, antimicrobial resistance, and whole-genome sequencing (WGS) were performed on the GBS isolates. We identified 48 neonates with GBS meningitis and 140 neonates with GBS sepsis. Neonates with GBS meningitis had significantly more

Style APA, Harvard, Vancouver, ISO itp.

33

Wilson, David J., Helena H. Das, Ruben N. Gonzalez, and Philip M. Sears. "Association between management practices, dairy herd characteristics, and somatic cell count of bulk tank milk." Journal of the American Veterinary Medical Association 210, no. 10 (1997): 1499–502. http://dx.doi.org/10.2460/javma.1997.210.10.1499.

Pełny tekst źródła

Streszczenie:

Objective— To determine whether particular dairy management practices and herd characteristics were associated with somatic cell count (See) of bulk tank milk. Design— Analysis of records. Sample Population— Milk samples collected from 59,435 cows housed in 843 dairy herds between March 1992 and June 1994. Procedure— Results of bacterial culture of milk samples and data on farm housing, sanitation, milking system, and management were collected. Multiple regression analysis was used to determine sources of variation in bulk tank milk see among herds. Results— Prevalence of Streptococcus agalact

Style APA, Harvard, Vancouver, ISO itp.

34

Dung, Tu Thanh, Quach Van Cao Thi, and Nguyen Bao Trung. "Streptococcus agalactiae Associated with "Dark Body" Disease on Snakeskin Gourami Farmed in the Mekong Delta, Vietnam." HAYATI Journal of Biosciences 31, no. 3 (2024): 486–97. http://dx.doi.org/10.4308/hjb.31.3.486-497.

Pełny tekst źródła

Streszczenie:

Streptococcosis, due to Streptococcus agalactiae, has become a serious challenge for aquaculture around the world. Therefore, the main purpose of this work was to confirm the etiological agent that caused "dark body" disease in snakeskin gourami (Trichogaster pectoralis) cultured in the Mekong Delta, Vietnam. Infected fish displayed clinical signs, including anorexia, lethargic swimming on the water surface, corneal opacity, and hemorrhage in the base of the fin. Remarkably, abnormal black coloration on the body and serious hemorrhage at the base of the pectoral fin, and on the body were found

Style APA, Harvard, Vancouver, ISO itp.

35

Taukhid, Taukhid, Edy Farid Wajdy, Desy Sugiani, and Nunak Nafiqoh. "Streptococcosis on Nile tilapia (Oreochromis niloticus) in Indonesian freshwater aquaculture." Omni-Akuatika 19, no. 1 (2023): 1. http://dx.doi.org/10.20884/1.oa.2023.19.1.1005.

Pełny tekst źródła

Streszczenie:

This review aimed to provide the current status of streptococcosis in freshwater aquaculture in Indonesia. So far, this disease has been mostly reported in tilapia aquaculture, and there have been no serious reports of this disease in other species of freshwater aquaculture. The disease is mostly encountered during the dry season or the transition period from the dry season to the rainy season or vice versa. Initially, the disease was mostly reported in tilapia larger than 250 grams, but in its development, it was also reported in smaller fish. The Ministry of Marine Affairs and Fisheries (MMA

Style APA, Harvard, Vancouver, ISO itp.

36

Alieva, G. K., M. Zh Aisin, M. Zh Aubakirov, and S. K. Dyusembekov. "The main biological features and resistance to antibacterial drugs of Streptococcus agalactiae isolated from the cow’s milk." HERALD OF SCIENCE OF S SEIFULLIN KAZAKH AGRO TECHNICAL RESEARCH UNIVERSITY: Veterinary sciences, no. 2(006) (June 28, 2024): 28–35. http://dx.doi.org/10.51452/kazatuvc.2024.2(006).1685.

Pełny tekst źródła

Streszczenie:

Background and Aim. The main goal of our research, as stated in the article, was to study the phenotypic characteristics of strains of S. agalactiae isolated from milk, identify and evaluate the effectiveness of the main groups of antibiotics recommended for use in veterinary medicine, including those provided by EUCAST. Materials and Methods. The study of the phenotypic characteristics of S. agalactiae and the research on antibiotic resistance were carried out at the base of the Microbiology Laboratory of the Biotechnology Research Institute of Kostanay State University named after A. Baiturs

Style APA, Harvard, Vancouver, ISO itp.

37

SATO, Makoto, Tomie YAMASAKI, Takashi TSURUMIZU, Hiroshi OKONOGI, Takashi HASHIMOTO, and Tatsumi SHIBUSAWA. "Biochemical and serological characteristics of Streptococcus salivarius." JOURNAL OF DENTAL HEALTH 40, no. 3 (1990): 325–30. http://dx.doi.org/10.5834/jdh.40.325.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

38

Khanzadeh, Majid, Babak Beikzadeh, and Seyed Hossein Hoseinifar. "The Effects of Laurencia caspica Algae Extract on Hemato-Immunological Parameters, Antioxidant Defense, and Resistance against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus)." Aquaculture Nutrition 2023 (July 4, 2023): 1–13. http://dx.doi.org/10.1155/2023/8882736.

Pełny tekst źródła

Streszczenie:

Natural immune stimulants are among the most effective chemicals for boosting immunity and fish welfare. This study aims to investigate the effects of red macroalgae extract (Laurencia caspica) on hematological, immunological, antioxidant, biochemical, and disease resistance against S. agalactiae in Nile tilapia for 50 days. For this purpose, fishes were assigned to four dietary treatments group in which the base meal was supplemented with 0.5%, 1%, and 2% of L. caspica extract. On days 25 and 50 of the experiment, samples were taken to investigate the hematological, immunological, biochemical

Style APA, Harvard, Vancouver, ISO itp.

39

Hoque, Md Nazmul, Monira Rahman, Taniya Sultana, et al. "Molecular Characterization of Streptococcus spp. Isolated from Milk, Feces and Farm Environment of Mastitic Dairy Cows." Journal of Science and Technology Research 6, no. 1 (2024): 1–12. https://doi.org/10.3329/jscitr.v6i1.77358.

Pełny tekst źródła

Streszczenie:

Streptococci are the primary cause of mastitis, significantly impacting the dairy industry economically. This study aimed to explore the molecular epidemiology, antimicrobial resistance, and virulence characteristics of Streptococcus spp. isolated from the milk, feces, and environment of dairy cows with mastitis. Sixty (60) samples (milk = 20, feces = 20 and soil = 20) from cows with clinical mastitis (CM) were purposively collected and examined. Samples were enriched in Luria Bertani broth (LB) and Streptococcus spp. was isolated on Modified Edwards Medium and confirmed by ribosomal (16S rRNA

Style APA, Harvard, Vancouver, ISO itp.

40

Zhang, Defeng, Zhigang Liu, Yan Ren, et al. "Epidemiological characteristics of Streptococcus agalactiae in tilapia in China from 2006 to 2020." Aquaculture 549 (February 2022): 737724. http://dx.doi.org/10.1016/j.aquaculture.2021.737724.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

41

Mweu, Marshal M., Søren S. Nielsen, Tariq Halasa, and Nils Toft. "Annual incidence, prevalence and transmission characteristics of Streptococcus agalactiae in Danish dairy herds." Preventive Veterinary Medicine 106, no. 3-4 (2012): 244–50. http://dx.doi.org/10.1016/j.prevetmed.2012.04.002.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

42

Gabrielsen, Christina, Johan A. Mæland, Randi Valsø Lyng, Andreas Radtke, and Jan Egil Afset. "Molecular characteristics of Streptococcus agalactiae strains deficient in alpha-like protein encoding genes." Journal of Medical Microbiology 66, no. 1 (2017): 26–33. http://dx.doi.org/10.1099/jmm.0.000412.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

43

Lacy-Hulbert, S. Jane, and J. Eric Hillerton. "Physical characteristics of the bovine teat canal and their influence on susceptibility to streptococcal infection." Journal of Dairy Research 62, no. 3 (1995): 395–404. http://dx.doi.org/10.1017/s0022029900031101.

Pełny tekst źródła

Streszczenie:

SummaryPhysical characteristics of the bovine teat canal were examined for their influence on susceptibility to intramammary infection. All quarters of 18 cows were inoculated with 2 × 105 cfu Streptococcus agalactiae (Trial 1) and 20 cows with 105 cfu Str. Uberis (Trial 2) 3–4 mm into the teat canal every 3 d for 12 d. Incidence of quarter infection was similar for both pathogens, 30/72 (42%) in Trial 1 and 32/80 (40%) in Trial 2. Logistic regression analysis showed that probability of infection by Str. Agalactiae increased significantly with an increase in quarter peak flow rate (P < 0·05

Style APA, Harvard, Vancouver, ISO itp.

44

Zhang, Ze, Jiangfeng Lan, Yuhui Li, et al. "The pathogenic and antimicrobial characteristics of an emerging Streptococcus agalactiae serotype IX in Tilapia." Microbial Pathogenesis 122 (September 2018): 39–45. http://dx.doi.org/10.1016/j.micpath.2018.05.053.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

45

Oliveira, Thais Cristina de Assis, Maria Aparecida Vasconcelos Paiva Brito, Marcia Giambiagi-de Marval, Nívea Maria Vicentini, and Carla Christine Lange. "Identification of bovine mastitis pathogens using MALDI-TOF mass spectrometry in Brazil." Journal of Dairy Research 88, no. 3 (2021): 302–6. http://dx.doi.org/10.1017/s0022029921000595.

Pełny tekst źródła

Streszczenie:

AbstractIn this Research Communication we evaluate the use of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify 380 bacteria isolated from cases of bovine mastitis in Brazil. MALDI-TOF MS identifications were compared to previous identifications by biochemical tests and 16S rRNA sequencing. MALDI-TOF MS achieved a typeability of 95.5%. The accuracy of MALDI-TOF MS for the identification of Staphylococcus isolates was 93.2%. The agreement between MALDI-TOF MS and biochemical identification of Streptococcus agalactiae was 96%, however, the ag

Style APA, Harvard, Vancouver, ISO itp.

46

Yamagata, M., W. J. Goodger, L. Weaver, and C. Franti. "The economic benefit of treating subclinical Streptococcus agalactiae mastitis in lactating cows." Journal of the American Veterinary Medical Association 191, no. 12 (1987): 1556–61. https://doi.org/10.2460/javma.1987.191.12.1556.

Pełny tekst źródła

Streszczenie:

Summary The economic benefits of treating lactating cows for Streptococcus agalactiae mastitis were studied at a large (689 milking cows) central California dairy. Postcure milk production of case cows (infected, treated, and cured) was compared with production of paired control cows (uninfected) and was matched for yield, days in milk, days in gestation, and parity. A simulation was used to plot expected lactation curves for mastitic cows (infected, not treated) with characteristics similar to those of each control cow, and these curves were compared with actual case-cow lactation curves. The

Style APA, Harvard, Vancouver, ISO itp.

47

Colino, Jesus, Leah Duke, and Clifford Snapper. "Non-covalent association of protein and capsular polysaccharide on bacteria-sized latex beads as a model for polysaccharide-specific humoral immunity to intact Gram-positive extracellular bacteria (P3083)." Journal of Immunology 190, no. 1_Supplement (2013): 125.17. http://dx.doi.org/10.4049/jimmunol.190.supp.125.17.

Pełny tekst źródła

Streszczenie:

Abstract Intact Streptococcus pneumoniae, expressing type 14 capsular polysaccharide (PPS14) and type 3 Streptococcus agalactiae containing a PPS14 core capsule identical to PPS14, exhibit non-covalent associations of PPS14 and bacterial proteins, in contrast to covalent conjugates. Secondary immunization with conjugate and S. agalactiae, although not S. pneumoniae, results in a boosted response. However, in contrast to conjugate, PPS14-specific IgG responses to bacteria lack affinity maturation and use the 44.1-idiotype. To better understand the mechanism underlying this dichotomy we develope

Style APA, Harvard, Vancouver, ISO itp.

48

Abdelsalam, Mohamed, Mamdouh Y. Elgendy, Mohamed Shaalan, Mohamed Moustafa, and Masayuki Fujino. "Rapid identification of pathogenic streptococci isolated from moribund red tilapia (Oreochromis spp.)." Acta Veterinaria Hungarica 65, no. 1 (2017): 50–59. http://dx.doi.org/10.1556/004.2017.005.

Pełny tekst źródła

Streszczenie:

Accurate and rapid identification of bacterial pathogens of fish is essential for the effective treatment and speedy control of infections. Massive mortalities in market-sized red tilapia (Oreochromis spp.) were noticed in mariculture concrete ponds in northern Egypt. Histopathological examination revealed marked congestion in the central vein of the liver with the presence of bacterial aggregates inside the lumen and in the vicinity of the central vein. A total of 12 isolates of streptococci were obtained from the moribund fish. This study documented the ability of the MicroSeq 500 16S bacter

Style APA, Harvard, Vancouver, ISO itp.

49

Domelier, Anne-Sophie, Nathalie van der Mee-Marquet, Pierre-Yves Sizaret, et al. "Molecular Characterization and Lytic Activities of Streptococcus agalactiae Bacteriophages and Determination of Lysogenic-Strain Features." Journal of Bacteriology 191, no. 15 (2009): 4776–85. http://dx.doi.org/10.1128/jb.00426-09.

Pełny tekst źródła

Streszczenie:

ABSTRACT The application of mitomycin C induction to 114 genetically diverse Streptococcus agalactiae strains generated 36 phage suspensions. On electron microscopy of the phage suspensions, it was possible to assign the phages to the Siphoviridae family, with three different morphotypes (A, B, and C). Phage genetic diversity was evaluated by a PCR-based multilocus typing method targeting key modules located in the packaging, structural, host lysis, lysogeny, replication, and transcriptional regulation clusters and in the integrase genes and by DNA digestion with EcoRI, HindIII, and ClaI. Thir

Style APA, Harvard, Vancouver, ISO itp.

50

Mahmmod, Y. S., I. C. Klaas, J. Katholm, M. Lutton, and R. N. Zadoks. "Molecular epidemiology and strain-specific characteristics of Streptococcus agalactiae at the herd and cow level." Journal of Dairy Science 98, no. 10 (2015): 6913–24. http://dx.doi.org/10.3168/jds.2015-9397.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

Oferujemy zniżki na wszystkie plany premium dla autorów, których prace zostały uwzględnione w tematycznych zestawieniach literatury. Skontaktuj się z nami, aby uzyskać unikalny kod promocyjny!