Siga este link para ver outros tipos de publicações sobre o tema: Tobacco ring spot virus.
Artigos de revistas sobre o tema "Tobacco ring spot virus"
Crie uma referência precisa em APA, MLA, Chicago, Harvard, e outros estilos
Veja os 50 melhores artigos de revistas para estudos sobre o assunto "Tobacco ring spot virus".
Ao lado de cada fonte na lista de referências, há um botão "Adicionar à bibliografia". Clique e geraremos automaticamente a citação bibliográfica do trabalho escolhido no estilo de citação de que você precisa: APA, MLA, Harvard, Chicago, Vancouver, etc.
Você também pode baixar o texto completo da publicação científica em formato .pdf e ler o resumo do trabalho online se estiver presente nos metadados.
Veja os artigos de revistas das mais diversas áreas científicas e compile uma bibliografia correta.
1
Kawas, Houda Z. "Viral diseases on apple in southern Syria". Journal of Biotechnology Research Center 6, n.º 1 (1 de janeiro de 2012): 26–32. http://dx.doi.org/10.24126/jobrc.2012.6.1.194.
Texto completo da fonteResumo:
108 sample Collected from the fields of farmers in the areas of apple cultivation in the south of Syria during the years 1998-2007, and the most important symptoms associated with infection were recorded, results of the biometric tests (mechanical inoculation on indicator plant) and examination by electron microscope and serological tests (ELISA) using antisera of Apple mosaic virus, Apple chlorotic leaf spot virus, Tomato ring spot virus , Tomato spotted wilt virus, Tobacco ring spot virus , Tomato black ring virus and Arabis mosaic virus to the spread of a virus infection of Apple chlorotic leaf spot virus (ACLSV) by 24%, Apple mosaic virus (ApMV) by 26.9% and to register cases Tomato ring spot virus (TomRSV) by 13% and Tobacco ring spot virus (TRSV) by %14.8, Tomato black ring virus (TBRV) rate of % 12.03 and Arabis mosaic virus (ArMV) 2.43% for the first time on apples in Syria, and the likelihood of several viral and viroid diseases, that we need to reassess the health situation in view of the importance of maintaining the cultivation of apples and recommended program documentation for the production of propagation of disease-free, with proposal to use molecular methods to detect and identify viral diseases causes and strains prevalent in Syria.
2
Fisher, John R. "First Report of Tobacco rattle virus Associated with Ring Spot and Line Pattern Disease of Peony in Ohio". Plant Health Progress 13, n.º 1 (janeiro de 2012): 40. http://dx.doi.org/10.1094/php-2012-0711-01-br.
Texto completo da fonteResumo:
Tobacco rattle virus (TRV) is the type member of the Tobravirus genus which also includes pea early browning and pepper ringspot viruses. The ring spot disease of peony associated with TRV has been reported in Europe and Asia and recently in Alaska but the literature is sparse regarding reports of the disease in the US. These results represent the first confirmed report of TRV in peony in Ohio, and expand the known geographic distribution of the virus. Accepted for publication 26 June 2012. Published 11 July 2012.
3
Sharma, Anupama, Raja Ram e A. A. Zaidi. "Rubus ellipticus, a Perennial Weed Host of Prunus Necrotic Ring Spot Virus in India". Plant Disease 82, n.º 11 (novembro de 1998): 1283. http://dx.doi.org/10.1094/pdis.1998.82.11.1283b.
Texto completo da fonteResumo:
Rubus ellipticus is a perennial shrub occurring in natural vegetation of the temperate and subtropical Himalayas. For several years, plants of R. ellipticus in and around the Institute of Himalayan Bioresource Technology in Palampur were seen with mild mosaic and chlorotic symptoms on leaves followed by necrotic ring spots. Infected plants often recovered from the symptoms. The causal agent was mechanically transmissible to several herbaceous hosts including Cucumis sativus, Chenopodium album, C. quinoa, Cucurbita maxima, C. pepo, Melilotus alba, Trifolium repens, and Zinnia elegans. The virus incited chlorotic local lesions followed by systemic necrotic lesions or ring spots and severe stunting on C. sativus. Several aphid species (Myzus persicae, Aphis gossypii, A.fabae-solanella, Brevicoryne brassicae, and Macrosiphoniella sanbornii) were tried as viral vectors, but all failed to transmit the virus. Virus has been detected in pollen and fruit of infected plants. Ilarvirus-like particles, 27 nm in diameter, were observed in partially purified extracts of symptomatic plants of R. ellipticus and in experimentally infected C. sativus plants, but not in healthy plants. The isolate was distantly serologically related to apple mosaic virus and unrelated to tobacco streak virus. Presence of Prunus necrotic ring spot virus (PNRSV) in symptomatic plants was also confirmed by enzyme-linked immunosorbent assay with antiserum from American Type Culture Collection and Agdia, Inc. (Elkhart, IN). This is the first report of a viral disease in R. ellipticus. The presence of PNRSV in a new weed host may become an important constraint to production of susceptible agronomic crops around Palampur.
4
Mallikarjun, K. G. "Antiviral Activity of Substituted Chalcones and their Respective Cu(ii), Ni(ii) and Zn(ii) Complexes". E-Journal of Chemistry 2, n.º 1 (2005): 58–61. http://dx.doi.org/10.1155/2005/461302.
Texto completo da fonteResumo:
Complexes of Cu(II), Ni(II) and Zn(II) with of 3-(phenyl)-1-(2’-hydroxynaphthyl) – 2 – propen – 1 – one (PHPO) , 3 - (4-chlorophenyl) - 1- (2’-hydroxynaphthyl)–2–propen – 1 – one (CPHPO), 3 - (4 -methoxyphenyl) -1-(2’-hydroxynapthyl)-2-propen-1-one(MPHPO),3 - (3,4-dimethoxyphenyl) –1-(2’-hydroxynaphthyl) – 2 - propen– 1 – one (DMPHPO) have been prepared and the purity of the samples were checked by elemental analysis. The ligands and their Cu(II), Ni(II) and Zn(II) complexes were tested on the infectivity of tobacco ring spot virus(TRSV) using cowpea (Vigna Sinensis) as a local lesions assay host. All the compounds were tested at different concentrations (250 ppm to 1500 ppm)on the infectivity of the virus by applying them either with virus inoculum or 24 h before of after virus inoculation to the test plants. The compounds were found to have varied effects on virus infectivity depending on compounds concentration and method of application. The statistical significance of the data was determined by using analysis of variance.
5
Yellareddygari, S. K. R., Charles R. Brown, Jonathan L. Whitworth, Richard A. Quick, Launa L. Hamlin e Neil C. Gudmestad. "Assessing Potato Cultivar Sensitivity to Tuber Necrosis Caused by Tobacco rattle virus". Plant Disease 102, n.º 7 (julho de 2018): 1376–85. http://dx.doi.org/10.1094/pdis-12-17-1918-re.
Texto completo da fonteResumo:
Tobacco rattle virus (TRV) causes the economically important corky ring spot disease in potato. Chemical control is difficult due to the soilborne nature of the TRV-transmitting nematode vector, and identifying natural host resistance against TRV is considered to be the optimal control measure. The present study investigated the sensitivity of 63 cultivars representing all market types (evaluated at North Dakota and Washington over 2 years) for the incidence of TRV-induced tuber necrosis and severity. This article also investigates the cultivar–location interaction (using a mixed-effects model) for TRV-induced necrosis. TRV-induced tuber necrosis (P < 0.0001) and severity (P < 0.0001) were significantly different among cultivars evaluated separately in North Dakota and Washington trials. Mixed-effects model results of pooled data (North Dakota and Washington) demonstrated that the interaction of cultivar and location had a significant effect (P = 0.03) on TRV-induced necrosis. Based on the virus-induced tuber necrosis data from both years and locations, cultivars were categorized into sensitive, moderately sensitive, insensitive, and moderately insensitive groups. Based on data from North Dakota, 10 cultivars, including Bintje, Centennial Russet, Ciklamen, Gala, Lelah, Oneida Gold, POR06V12-3, Rio Colorado, Russian Banana, and Superior, were rated as insensitive to TRV-induced tuber necrosis. Similar trials assessing TRV sensitivity among cultivars conducted in Washington resulted in a number of differences in sensitivity rankings compared with North Dakota trials. A substantial shift in sensitivity of some potato cultivars to TRV-induced tuber necrosis was observed between the two locations. Four cultivars (Centennial Russet, Oneida Gold, Russian Banana, and Superior) ranked as insensitive for North Dakota trials were ranked as sensitive for Washington trials. These results can assist the potato industry in making cultivar choices to reduce the economic impact of TRV-induced tuber necrosis.
6
Hunt, David, Robert Foottit, Dana Gagnier e Tracey Baute. "First Canadian records of Aphis glycines (Hemiptera: Aphididae)". Canadian Entomologist 135, n.º 6 (dezembro de 2003): 879–81. http://dx.doi.org/10.4039/n03-027.
Texto completo da fonteResumo:
The soybean aphid, Aphis glycines Matsamura (Hemiptera: Aphididae), is a pest of soybeans in the People's Republic of China, Korea, Thailand, Japan, North Borneo, Malaya, and the Philippines (Blackman and Eastop 2000). It was first identified in North America in 2000 from soybean fields in 10 states in the north-central United States of America, although the route of entry and time of introduction are not known (North Central Regional Pest Alert 2001). Dai and Fan (1991) reported that yield losses caused by soybean aphids on soybeans in the People's Republic of China were greater when the crop was infested soon after planting, and the presence of large populations of the aphid throughout the growing season resulted in 20%–30% yield losses. The soybean aphid can also transmit several viruses that infect soybeans in North America, including alfalfa mosaic, soybean mosaic, bean yellow mosaic, peanut mottle, peanut stunt, and peanut stripe (Hartman et al. 2001). In North America, the soybean aphid is known to transmit soybean mosaic virus and alfalfa mosiac virus (Hill et al. 2001). A survey of Ontario soybean fields revealed the presence of tobacco ring spot virus, soybean mosiac virus, and bean pod mottle virus (Michelutti et al. 2001); all of which could potentially be spread by this newly introduced aphid.
7
Poudel, Nabin Sharma, e Kapil Khanal. "Viral Diseases of Crops in Nepal". International Journal of Applied Sciences and Biotechnology 6, n.º 2 (29 de junho de 2018): 75–80. http://dx.doi.org/10.3126/ijasbt.v6i2.19702.
Texto completo da fonteResumo:
Viral diseases are the important diseases next to the fungal and bacterial in Nepal. The increase in incidence and severity of viral diseases and emergence of new viral diseases causes the significant yield losses of different crops in Nepal. But the research and studies on plant viral diseases are limited. Most of the studies were focused in viral diseases of rice (Rice tungro virus and Rice dwarf virus), tomato (Yellow leaf curl virus) and potato (PVX and PVY). Maize leaf fleck virus and mosaic caused by Maize mosaic virus were recorded as minor disease of maize. Citrus Tristeza Virus is an important virus of citrus fruit in Nepal while Papaya ringspot potyvirus, Ageratum yellow vein virus (AYVV), Tomato leaf curlJava betasatellite and Sida yellow vein Chinaalphasatellite were recorded from the papaya fruit. The Cucumber mosaic virus (CMV) and Zucchini yellow mosaic potyvirus (ZYMV) are the viral diseases of cucurbitaceous crop reported in Nepal. Mungbean yellow mosaic India virus (MYMIV) found to infect the many crops Limabean, Kidney bean, blackgram and Mungbean. Bean common mosaic necrosis virus in sweet bean, Pea leaf distortion virus (PLDV), Cowpea aphid‐borne mosaic potyvirus (CABMV), Peanut bud necrosis virus (PBNV) in groundnut, Cucumber mosaic virus (CMV). Chili veinal mottle potyvirus (CVMV) and Tomatoyellow leaf curl gemini virus (TYLCV) were only reported and no any further works have been carried out. The 3 virus diseases Soyabean mosaic (SMV), Soybean yellow mosaic virus and Bud blight tobacco ring spot virus (TRSV) were found in soybean.Int. J. Appl. Sci. Biotechnol. Vol 6(2): 75-80
8
Pappu, H. R., K. R. W. Hammett e K. L. Druffel. "Dahlia mosaic virus and Tobacco streak virus in Dahlia (Dahlia variabilis) in New Zealand". Plant Disease 92, n.º 7 (julho de 2008): 1138. http://dx.doi.org/10.1094/pdis-92-7-1138b.
Texto completo da fonteResumo:
Dahlia (Dahlia variabilis Hort.) is a significant ornamental plant in New Zealand. Symptoms such as mosaic, ring spots, mottling, and veinal chlorosis, suggestive of a viral infection, are often seen in various dahlia collections. To better understand the incidence of viruses in dahlia in New Zealand, several popularly grown cultivars were evaluated for viruses that are known to infect dahlia. Viruses that were tested included Cucumber mosaic virus (CMV), Dahlia mosaic virus (DMV), Impatiens necrotic spot virus (INSV), Tobacco streak virus (TSV), and Tomato spotted wilt virus (TSWV). At least one symptomatic plant was tested from each of the following cultivars: Akito Dawn, Cincinnati Dancer, Hamari Accord, Hamari Rose, LeBatts Prime, LeVonne Splinter, Riverlea Tropicana, Spartacus, Tartan, Tui Connie, and Wandas Antartica. Except for DMV, initial testing was done by ELISA with commercially available kits for the above viruses. In the case of dahlia mosaic, samples were tested for DMV that was described previously (4) and two additional and distinct caulimoviruses (DMV-D10 and DMV-Holland) that were found to be associated with dahlia (1,2). Primer pairs, ORF6st: ATG GAA GAA ATT AAG GCG T and ORF6end: TTG TCT TCA TCC ATA AAG CAG; DenF1: CAG CAA GAA ACA GGA ATT GA and DenR: TTA CAG TCG AAG CTG CTA AA; and Kapht-F: ATG AGT AAT GCT TCA GCA A and Kapht-R: TGA CCA TGG CTT CTA ACT GT were used for the specific detection of DMV-D10, DMV-Holland, and DMV, respectively (1). None of the samples tested were ELISA positive for CMV, INSV, or TSWV. To verify the TSV infection, TSV-specific primers (5′-GTC CAG ACC ATC CAT CCA AC-3′ and 5′-TTG ATT CAC CAG GAA ATC TT-3′), designed based on sequences available in GenBank, were used in reverse transcription (RT)-PCR. For DMV, the diagnostic tests used were electron microscopy and PCR followed by amplicon cloning and sequencing. Electron microscopic observation of leaf-dip preparations showed near isometric virions, approximately 50 to 60 nm in all samples tested. PCR showed that all samples tested were positive for DMV-Holland and DMV-D10. While DMV-Holland is a typical caulimovirus, DMV-D10 was found to exist as an endogenous plant pararetroviral sequence in dahlia (3). One sample each from two cultivars, Spartacus and Tui Connie, were positive for TSV by ELISA, RT-PCR, followed by the sequence analysis of the cloned amplicon. The impact of TSV-infected dahlias as a potential source of inoculum remains to be seen. Our results suggested the prevalence of dahlia mosaic-associated caulimoviruses in several dahlia cultivars and the presence of TSV in New Zealand dahlias. Dahlia mosaic continues to be prevalent in several parts of the world (1), and with the current findings in New Zealand, testing for these viruses should be conducted to ensure virus-free status of the propagating material. References: (1) V. Pahalawatta et al. Plant Dis. 91:1194, 2007. (2) V. Pahalawatta et al. Arch. Virol.153:733, 2008. (3) V. Pahalawatta et al. Virology 376:253, 2008. (4) R. D. Richins and R. J. Shepherd. Virology 124:208, 1983.
9
Martin, Robert R., e Ioannis E. Tzanetakis. "High Risk Strawberry Viruses by Region in the United States and Canada: Implications for Certification, Nurseries, and Fruit Production". Plant Disease 97, n.º 10 (outubro de 2013): 1358–62. http://dx.doi.org/10.1094/pdis-09-12-0842-re.
Texto completo da fonteResumo:
There is limited information about the distribution of strawberry viruses in North America and around the world. Since the turn of the century, there has been a concerted effort to develop sensitive tests for many of the previously uncharacterized, graft-transmissible agents infecting strawberry. These tests were employed to determine the presence of strawberry viruses in major strawberry production and nursery areas of North America. The viruses evaluated in this study were Apple mosaic, Beet pseudo-yellows, Fragaria chiloensis latent, Strawberry chlorotic fleck, Strawberry crinkle, Strawberry latent ring spot, Strawberry mild yellow edge, Strawberry mottle, Strawberry necrotic shock, Strawberry pallidosis, Strawberry vein banding, and Tobacco streak. The aphid-borne viruses were predominant in the Pacific Northwest whereas the whitefly-borne viruses were prevalent in California, the Midwest, and the Southeast. In the Northeast, the aphid-transmitted Strawberry mottle and Strawberry mild yellow edge viruses along with the whitefly-transmitted viruses were most common. The incidence of pollen-borne viruses was low in most areas, with Strawberry necrotic shock being the most prevalent virus of this group. These results indicate that there are hotspots for individual virus groups that normally coincide with the presence of the vectors. The information presented highlights the high-risk viruses for nursery production, where efforts are made to control all viruses, and fruit production, where efforts are made to control virus diseases.
10
Krishnareddy, M., Devaraj, Lakshmi Raman, Salil Jalali e D. K. Samuel. "Outbreak of Tobacco streak virus Causing Necrosis of Cucumber (Cucumis sativus) and Gherkin (Cucumis anguria) in India". Plant Disease 87, n.º 10 (outubro de 2003): 1264. http://dx.doi.org/10.1094/pdis.2003.87.10.1264b.
Texto completo da fonteResumo:
Cucumber (Cucumis sativus L.) and Gherkin (Cucumis anguria L.) are important cucurbitaceous vegetables grown in India for slicing and pickling. During the 2000 to 2002 rainy season and summer, a new virus disease, causing yield losses of 31 to 75% in Bangalore, Bellary, Davanagiree, and Tumkur districts of Karnataka State, infected cucumber and gherkin. Symptoms were tip necrosis characterized by necrotic lesions on leaves, and a general leaf and stem necrosis extending to mid veins, petioles, flower buds and tip, eventually resulting in dieback of vines. Tissue extracts from symptomatic leaves of cucumber and gherkin were mechanically inoculated on several herbaceous indicator plants (cowpea, cucumber, pepper, Zinnia, watermelon, Chenopodium amaranticolor, sunflower, Nicotiana glutinosa, N. tabacum, and Gomphrena globosa). On most hosts, symptoms of chlorotic or necrotic lesions followed by mottle or systemic necrosis were observed. Back-inoculation from the symptomatic indicator plants onto cucumber and gherkin resulted in symptoms typical of those observed in the field. Electron microscopic examination of leaf-dip preparation and ultra thin sections of virus infected plant samples showed the presence of isometric particles 25 to 28 nm in diameter. Similar types of particles were observed when infected samples were trapped in immunosorbent electron microscopy with polyclonal antibodies specific to Tobacco Streak virus (TSV) but not to Watermelon silver mottle virus (WSMV). Enzymelinked immunosorbent assay tests using leaf extracts of field-collected samples and sap-inoculated plants showed positive reaction to antibodies of TSV (1) but not to antibodies of Cucumber mosaic virus, WSMV, Watermelon bud necrosis virus, Papaya ring spot virus W strain, and Zucchini yellow mosaic virus. Reverse transcription-polymerase chain reaction (RT-PCR) of RNA extracts of infected samples of field and inoculated symptomatic plants was done by using primers derived from TSV RNA3 specific for the coat protein (CP) region of TSV (2). A 800-bp specific DNA fragment was amplified from infected cucumber and gherkin but not from healthy control plants. Sequence analysis of cloned PCR fragments revealed nucleotide identities of 99% with TSV isolates from cotton, mungbean, sunnhemp, and sunflower (GenBank Accessions Nos. AF515824, AF515823, AF515825, and AY061929) and 88% with TSV-WC (GenBank Accession No. X00435). On the basis of host range, serological relationship, electron microscopy, and sequence analysis of the CP region, the virus was identified as a strain of TSV. To our knowledge, this is the first report of natural occurrence of TSV on cucumber and gherkin in India. References: (1). A. I. Bhat et al. Arch. Virol. 147:651, 2002. (2). B. J. C. Cornelissen et al. Nucleic Acids Res.12:2427, 1984.
11
Bellardi, M. G., C. Rubies-Autonell e A. Bianchi. "First Report of a Disease of Peony Caused by Alfalfa mosaic virus". Plant Disease 87, n.º 1 (janeiro de 2003): 99. http://dx.doi.org/10.1094/pdis.2003.87.1.99c.
Texto completo da fonteResumo:
During the summers of 2001 and 2002, Japanese peony (Paeonia albiflora Pall., synonym P. lactiflora, family Paeoniaceae) plants, cultivated in the Botanical Garden of the University of Parma (Emilia Romagna Region of northern Italy), were found affected by a disease with virus-like symptoms. The oldest leaves showed yellow, mosaic, oak-like arabesques and line-patterns; the remaining leaves and pink flowers were symptomless. A disease of peony, known as peony ring spot disease, has been reported worldwide (Europe, United States, Japan, and New Zeland) for several years and is associated with strains of Tobacco rattle virus (TRV) (1). Electron microscopic observations of peony leaf sap (leaf dip preparations stained with uranyl acetate and phospotungstic acid) did not show the presence of any rod-shaped virus particles, including TRV. Mechanical inoculations of sap from symptomatic leaves caused symptoms typical of Alfalfa mosaic virus (AMV) on Chenopodium amaranticolor Coste & Reyn. (local chlorotic and necrotic lesions and systemic periveinal line-patterns), Ocimum basilicum L. (yellow mosaic), Vigna unguiculata (L.) Walp. (red, local necrotic lesions), and Nicotiana tabacum cv. Samsun (white, necrotic lesions, systemic leaf malformation, and mosaic), and N. glutinosa L. (systemic leaf variegation). Symptomatic leaves of peony and infected herbaceous plants were analyzed for virus presence by protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA). The polyclonal antisera tested were those to AMV (PVAS 92, American Type Culture Collection, Manassas, VA), AMV-Vinca minor L. (DiSTA collection, Italy), and the nepoviruses Strawberry latent ringspot virus, Tomato ringspot virus, and Cherry leaf roll virus. PAS-ELISA revealed only the presence of AMV. Immunoelectron microscopy and gold-labeled decoration confirmed the identity of the virus. In 2001, five symptomless peony plants (provided by a commercial grower and previously analyzed for AMV and TRV presence) were grafted with shoots from peony showing yellow mosaic on the leaves and maintained in a greenhouse under aphid-proof cage. During the summer of 2002, one of the grafted plants showed a mild mosaic on the leaves; PAS-ELISA revealed this peony was infected by AMV. To our knowledge, this is the first report of AMV in peony. Reference: (1) Chang et al. Ann. Phytopathol. Soc. Jpn. 42:325, 1976.
12
Stanković, I., A. Bulajić, A. Vučurović, D. Ristić, K. Milojević, D. Nikolić e B. Krstić. "First Report of Tomato spotted wilt virus on Chrysanthemum in Serbia". Plant Disease 97, n.º 1 (janeiro de 2013): 150. http://dx.doi.org/10.1094/pdis-08-12-0778-pdn.
Texto completo da fonteResumo:
In July 2011, greenhouse-grown chrysanthemum hybrid plants (Chrysanthemum × morifolium) with symptoms resembling those associated with tospoviruses were observed in the Kupusina locality (West Bačka District, Serbia). Disease incidence was estimated at 40%. Symptomatic plants with chlorotic ring spots and line patterns were sampled and tested by double antibody sandwich (DAS)-ELISA using polyclonal antisera (Bioreba AG, Reinach, Switzerland) against the two of the most devastating tospoviruses in the greenhouse floriculture industry: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). Commercial positive and negative controls and extracts from healthy chrysanthemum tissue were included in each ELISA. TSWV was detected serologically in 16 of 20 chrysanthemum samples and all tested samples were negative for INSV. The virus was mechanically transmitted from ELISA-positive chrysanthemum samples to five plants each of both Petunia × hybrida and Nicotiana tabacum ‘Samsun’ using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite. Inoculated plants produced local necrotic spots and systemic chlorotic/necrotic concentric rings, consistent with symptoms caused by TSWV (1). The presence of TSWV in ELISA-positive chrysanthemum plants and N. tabacum‘Samsun’ was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using primers TSWVCP-f/TSWVCP-r specific to the nucleocapsid protein (N) gene (4). A Serbian isolate of TSWV from tobacco (GenBank Accession No. GQ373173) and RNA extracted from a healthy chrysanthemum plant were used as positive and negative controls, respectively. An amplicon of the correct predicted size (738-bp) was obtained from each of the plants assayed, and that derived from chrysanthemum isolate 529-11 was purified (QIAqick PCR Purification Kit, Qiagen) and sequenced (JQ692106). Sequence analysis of the partial N gene, conducted with MEGA5 software, revealed the highest nucleotide identity of 99.6% (99% amino acid identity) with 12 TSWV isolates deposited in GenBank originating from different hosts from Italy (HQ830186-87, DQ431237-38, DQ398945), Montenegro (GU355939-40, GU339506, GU339508), France (FR693055-56), and the Czech Republic (AJ296599). The consensus maximum parsimony tree obtained on a 705-bp partial N gene sequence of TSWV isolates available in GenBank revealed that Serbian TSWV isolate 529-11 from chrysanthemum was clustered in the European subpopulation 2, while the Serbian isolates from tomato (GU369723) and tobacco (GQ373172-73 and GQ355467) were clustered in the European subpopulation 1 denoted previously (3). The distribution of TSWV in commercial chrysanthemum crops is wide (2). To our knowledge, this is the first report of TSWV infecting chrysanthemum in Serbia. Since chrysanthemum popularity and returns have been rising rapidly, the presence of TSWV may significantly reduce quality of crops in Serbia. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) I. Stanković et al. Acta Virol. 55:337, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.
13
Piñeyro, M. J., K. A. Albrecht, A. M. Mondjana e C. R. Grau. "First Report of Alfalfa mosaic virus in Kura Clover (Trifolium amgibuum) in Wisconsin". Plant Disease 86, n.º 6 (junho de 2002): 695. http://dx.doi.org/10.1094/pdis.2002.86.6.695a.
Texto completo da fonteResumo:
Kura clover (Trifolium ambiguum M. Bieb.) has been reported to be resistant to several viruses, including Alfalfa mosaic virus (AMV), Bean yellow mosaic virus (BYMV), Clover yellow vein virus (CYVV), Peanut stunt virus, Red clover vein mosaic virus (RCVMV), and White clover mosaic virus (WCMV) (2). Furthermore, 54 of 61 kura clover plants were resistant to Clover yellow mosaic virus (CYMV). Field-grown kura clover plants had no visual symptoms of virus infection, but a small proportion of plant introductions tested positive for CYVV, WCMV, and RCVMV (1). These and similar studies have given kura clover the reputation of being highly resistant to most viruses that affect other forage legumes. Viral-like symptoms, characterized by mosaic, crinkling, and reduced size of leaflets were observed on 53 kura clover plants in an 88-plant collection (plant introductions and cultivars) growing in the field. A 20-plant subset was screened for AMV, Bean pod mottle virus, BYMV, Soybean mosaic virus, Tobacco ring spot virus, and Tobacco streak virus using enzyme-linked immunosorbent assay (ELISA). Only AMV was found, and it was detected in nine plants. To our knowledge, this is the first report of AMV in kura clover. The remaining 68 plants were tested for AMV. In total, 70 plants were positive, and 18 plants were negative. AMV was detected in leaves and rhizomes of kura clover. Simultaneously, plants were scored on two occasions for interveinal mosaic, yellowing, curling of leaves, and general chlorosis. There was no correlation between visual symptoms and ELISA results. Results from ELISA were confirmed with a local lesion assay on ‘Bountiful’ beans (Phaseolus vulgaris L.). Leaves from three AMV-positive plants were bulked and ground in phosphate buffer (pH 7.0). Leaves of challenge plants were dusted with Carborundum, and infected sap was rubbed on the youngest leaf of each plant. This procedure was repeated with leaves from three AMV-negative plants. All 12 bean plants inoculated with sap from AMV-positive kura clover developed local lesions or systemic reactions. None of the 12 negative controls developed local lesions. The transmission of AMV from one kura clover plant to another was attempted with the inoculation procedure described above, except that a phosphate-sulfite buffer was used and with soybean aphids (Aphis glycines Matsamura). Seven virus-free ‘Endura’ kura clover plants were inoculated with sap from AMV-positive kura clover plants, and five negative control plants were included. Ten other plants were inoculated with AMV using soybean aphids. Aphids were allowed to feed for 3 min on AMV-positive kura clover plants, then allowed to feed, 10 per plant, on AMV-negative plants. There were six negative controls for this treatment. Three weeks after inoculation, top-growth was clipped, and 9-week-old regrowth was tested for AMV. Two of the mechanically inoculated plants tested positive for AMV using ELISA, and infection was further confirmed by the local lesion assay described above. Therefore, it is demonstrated that AMV can be mechanically transmitted to kura clover. AMV was not transmitted by the colony of soybean aphids, which previously transmitted AMV to soybean (3). This suggests virus-strain aphid specificity and possibly host specificity for phid transmission of AMV to kura clover. References: (1) R. Alconero. Plant Dis. 67:1270, 1983. (2) O. W. Barnett and P. B. Gibson. Crop Sci. 15:32, 1975. (3) J. H. Hill et al. Plant Dis. 85:561, 2001.
14
Li, G. F., M. S. Wei, J. Ma e S. F. Zhu. "First Report of Broad bean wilt virus 2 in Echinacea purpurea in China". Plant Disease 96, n.º 8 (agosto de 2012): 1232. http://dx.doi.org/10.1094/pdis-04-12-0409-pdn.
Texto completo da fonteResumo:
Field-grown Echinacea purpurea plants showing necrosis, leaf roll, yellow mosaic, and mosaic symptoms in leaves were collected in June 2010 in Huairou, Beijing, China. ELISAs of extracts of four samples showed that one sample with mosaic symptoms had a positive reaction with Broad bean wilt virus 2 (BBWV-2) monoclonal antibody provided by Professor X. P. Zhou (1). The monoclonal antibody recognized the 44.7 kD coat protein subunit of BBWV-2. We used Chenopodium quinoa as an assay species to isolate the virus by sap transmissions and to maintain the virus strain. Sap from infected C. quinoa, when inoculated onto indicator plant species, induced the following symptoms: C. quinoa: local lesions in inoculated leaves, systemic chlorotic mottle in upper leaves, deformation, and apical necrosis; C. amaranticolor: chlorotic local lesions, systemic mosaic and leaf distortion; Nicotiana benthamiana: systemic mosaic; Gomphrena globosa: local purple spots in inoculated leaves and systemic infection in upper leaves; Tetragonia expansa: local lesions, but no symptoms of systemic infection; Physalis floridana: systemic mosaic. No symptoms were observed on Capsicum annuum, Datura stramonium, N. glutinosa, or N. tabacum cv. White Burley. To confirm BBWV-2 infection, total RNAs extracted from infected C. quinoa leaves were reverse transcripted to cDNA using oligo-dT primer (T17V). The primer pair Fab5′R1F (5′-AAATATTAAAACAAACAGCTTTCGTT-3′) and Fab5′R1R (5′-TTCAAAGCTCGTGCCATNTYATTKGC-3′) for specific detection of the Fabavirus genus (2) was used for PCR analysis. The amplified fragment is between the 5′-terminal non-translatable region (NTR) and the beginning of the coding region of RNA1. Amplicons of approximately the expected size (~391 bp) were produced from the virus-infected C. quinoa and a BBWV-2 positive control (ATCC PV131, PV0537). Amplicons of approximately the expected size (~350 bp) were produced from the BBWV-1 positive control (ATCC PV132). However, no such amplicons were observed from healthy C. quinoa plants and water control. The 391-bp amplicons of RNA1 obtained from the infected C. quinoa were cloned and sequenced. Comparison with sequences of other BBWV-2 isolates showed that the isolate we obtained (No. JX070674) had approximately 99% nt identity (98% amino acid identity) with Chinese BBWV-2 isolate BC (No. FJ485686.1) (3). As an ornamental and medicinal plant, E. purpurea is widely cultivated in northern China. Up until now, Tomato ring spot virus, Tobacco rattle virus, Cucumber mosaic virus, and Tomato spotted wilt virus have been detected or isolated from E. purpurea in the world (4). To our knowledge, this is the first report of BBWV-2 infecting E. purpurea in China. BBWV-2-infected E. purpurea may have less secondary metabolites, which could influence the quality and therapeutic efficacy of this herbal medicine. References: (1) L. Qing et al. Acta Microbiologica Sinica 40:166, 2000. (2) R. M. Ferrer et al. J. Virol. Methods 144:156, 2007. (3) C. Sui et al. Plant Dis. 93:844, 2009. (4) B. Dikova. Bulgarian J. Agric. Sci. 17:306, 2011.
15
Trkulja, V., J. Mihić Salapura, B. Ćurković, I. Stanković, A. Bulajić, A. Vučurović e B. Krstić. "First Report of Tomato spotted wilt virus on Gloxinia in Bosnia and Herzegovina". Plant Disease 97, n.º 3 (março de 2013): 429. http://dx.doi.org/10.1094/pdis-08-12-0777-pdn.
Texto completo da fonteResumo:
In June and July 2012, symptoms resembling those caused by a tospovirus infection were observed on the greenhouse-grown gloxinia (Sinningia speciosa Benth. and Hook.) in the Lijevče polje, in the vicinity of Banja Luka (Bosnia and Herzegovina). Infected plants exhibited chlorotic ring spots and chlorotic and necrotic patterns followed by necrosis and distortion of leaves. Disease symptom incidence was estimated at 30% out of 400 inspected plants. Symptomatic leaves were collected and tested by double-antibody sandwich (DAS)-ELISA test using commercial polyclonal antisera (Bioreba AG, Reinach, Switzerland) for two of the most important tospoviruses in the greenhouse production of ornamentals: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). TSWV was detected serologically in 27 out of 30 tested gloxinia samples, and all were negative for INSV. Symptomatic leaves of five selected ELISA-positive gloxinia plants were separately ground in chilled 0.01 M phosphate buffer (pH 7) containing 0.1% w/v sodium sulphite and were mechanically inoculated on five plants of Petunia × hybrida. All inoculated plants produced typical symptoms of TSWV (1), necrotic spots on inoculated leaves in 2 to 5 days post-inoculation. For further confirmation of TSWV infection, total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) from all 27 infected gloxinia plants and tested by reverse transcription (RT)-PCR assay. A 738-bp fragment of TSWV nucleocapsid (N) gene was amplified with One-Step RT-PCR Kit (Qiagen) using primer pairs TSWV CP-f and TSWV CP-r (4). Total RNAs from Serbian tobacco TSWV isolate (GenBank Accession No. GQ373173) and RNA extract from healthy gloxinia plants were used as positive and negative controls, respectively. Amplicons of the expected size were obtained from all 27 naturally infected gloxinia plants, while no amplification products were obtained from the healthy control. After the purification with QIAquick PCR Purification Kit (Qiagen), the RT-PCR product obtained from one selected isolate 160-12 was sequenced directly in both directions and submitted to GenBank (JX468079). Sequence analysis of the partial N gene, conducted by MEGA5 software (3), from isolate 160-12 showed the highest nucleotide identity of 99.7% (100% amino acid identity) with eight pepper isolates of TSWV from Spain (FR693229, FR693231, FR693152-153, FR693078, FR693081, FR693089, and FR693092). To our knowledge, this is the first report on the occurrence of TSWV in Bosnia and Herzegovina. The presence of this harmful pathogen into a new area could have a serious threat to intensive and increasing production of ornamentals and numerous other TSWV susceptible species in Bosnia and Herzegovina. The discovery of TSWV on gloxinia should prompt more surveys, thorough inspections, and subsequent testing of other TSWV susceptible plants cultivated in Bosnia and Herzegovina. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.
16
Han, J., M. A. Ellis e F. Qu. "First Report of Grapevine leaf roll-associated virus-2 and -3 in Ohio Vineyards". Plant Disease 98, n.º 2 (fevereiro de 2014): 284. http://dx.doi.org/10.1094/pdis-03-13-0276-pdn.
Texto completo da fonteResumo:
Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5′-ACCTGGTTGAACGAGATCGCTT and 1R: 5′-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5′-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5′-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5′-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5′-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5′-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5′-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5′-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5′-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5′-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.
17
LaMondia, J. A. "The Association of Tobacco mosaic virus with Green Spot of Cured Wrapper Tobacco Leaves". Plant Disease 92, n.º 1 (janeiro de 2008): 37–41. http://dx.doi.org/10.1094/pdis-92-1-0037.
Texto completo da fonteResumo:
Near-isogenic lines of cigar wrapper tobacco resistant or susceptible to Tobacco mosaic virus (TMV) were used to evaluate the association of TMV infection with green spot symptoms in cured leaves. TMV infection, as determined by double-antibody sandwich enzyme-linked immunosorbent assay (ELISA), was detected on susceptible but not resistant plants in field experiments. Green spot severity on cured leaves was greater for susceptible than resistant plants, even when symptoms of TMV were not evident in the field. Some green spots were present on resistant leaves despite the fact that the virus was not detected by ELISA. Resistant and susceptible plants had similar responses to virus infection and similar ELISA detection of TMV when plants were held at continuous temperatures over 28°C in growth chambers. Plant resistance was not compromised in the field in cloth-covered shade tents even when 33.5 of the 96 h immediately following inoculation were above 28°C. Green spot of cured leaves was strongly associated with TMV infection in susceptible plants, even when plants were infected after leaf expansion and mosaic symptoms were not present. Green spot also occurred to a lesser extent and for a limited time in inoculated resistant plants. The development of green spot symptoms on cured leaves may be the result of either systemic infection of TMV-susceptible plants or associated with the systemic resistance response to TMV inoculation of resistant plants.
18
Bogush, L. J., T. D. Verderevskaja e S. S. Bondarenko. "CHEMIOTHERAPY OF NECROTIC RING SPOT VIRUS (NRSV) IN CHERRY". Acta Horticulturae, n.º 193 (novembro de 1986): 133–38. http://dx.doi.org/10.17660/actahortic.1986.193.23.
Texto completo da fonte
19
Varveri, C. "STUDY ON PRUNUS NECROTIC RING SPOT VIRUS IN GREECE". Acta Horticulturae, n.º 309 (maio de 1992): 63–72. http://dx.doi.org/10.17660/actahortic.1992.309.6.
Texto completo da fonte
20
Suchá, J., e L. Svobodová. "Incidence of Prune dwarf virus and Prunus necrotic ring spot virus in orchards of sweet and sour cherry in the Czech Republic: Short communication". Horticultural Science 37, No. 3 (14 de julho de 2010): 118–20. http://dx.doi.org/10.17221/74/2009-hortsci.
Texto completo da fonteResumo:
During 2006–2008 field surveys were carried out in the important cherry growing areas of the Czech Republic to assess the incidence of Prune dwarf virus and Prunus necrotic ring spot virus in commercial orchards and nurseries. A total of 1,438 samples from 1,198 sweet cherry trees and from 240 sour cherry trees were tested by ELISA for the presence of Prune dwarf virus and Prunus necrotic ring spot virus. The overall average infection level was 17.7%. The most infected species were sour cherry trees (22.5%). The most frequently detected virus was Prune dwarf virus (10.9%). Prunus necrotic ring spot virus occurred in 6.3% of samples. Our study provided an indication of a sanitary status of sweet and sour cherry in commercial orchards and nurseries in the Czech Republic.
21
Ryu, Ki Hyun. "Occurrence of Cymbidium Mosaic Virus and Odontoglossum Ring-spot Virus in Korea." Plant Disease 79 (1995): 321. http://dx.doi.org/10.1094/pd-79-0321d.
Texto completo da fonte
22
Naidu, Rayapati A., Carl M. Deom e John L. Sherwood. "Expansion of the Host Range of Impatiens necrotic spot virus to Peppers". Plant Health Progress 6, n.º 1 (janeiro de 2005): 28. http://dx.doi.org/10.1094/php-2005-0727-01-hn.
Texto completo da fonteResumo:
This study reports the occurrence of Impatiens necrotic spot virus (INSV) on pepper under greenhouse conditions. In recent years, INSV has been detected in crops like peanut, tobacco, and potato as well as several weed species. Because INSV is vectored by western flower thrips and tobacco thrips, its expanding host range could make it an economically important problem in agricultural and horticultural crops in the U.S. Accepted for publication 11 July 2005. Published 27 July 2005.
23
Fan, Xudong, Zunping Zhang, Fang Ren, Guojun Hu, Chen Li, Baodong Zhang e Yafeng Dong. "Development of a Full-Length Infectious cDNA Clone of the Grapevine Berry Inner Necrosis Virus". Plants 9, n.º 10 (11 de outubro de 2020): 1340. http://dx.doi.org/10.3390/plants9101340.
Texto completo da fonteResumo:
Grapevine berry inner necrosis virus (GINV) belongs to the genus Trichovirus in the family Betaflexiviridae. The GINV isolate LN_BETA_RS was obtained from a “Beta” grapevine (Vitis riparia × Vitis labrusca) exhibiting chlorotic mottling and ring spot in Xingcheng, Liaoning Province, China. To verify the correlation between GINV and grapevine chlorotic mottling and ring spot disease, we constructed an infectious cDNA clone of GINV isolate LN_BETA_RS using the seamless assembly approach. Applied treatments of agroinfiltration infectious cDNA confirmed systemic GINV infection of the Nicotianaoccidentalis 37B by reverse transcription polymerase chain reaction (RT-PCR) and transmission electron microscopy, exhibiting chlorotic mottling symptoms on leaves. Infectious cDNA was also transmitted to new healthy N. occidentalis plants through rub-inoculation. Moreover, the cDNA clone was agroinfiltrated into “Beta” and “Thompson Seedless” grapevine plantlets, and the inoculated grapevines exhibited leaf chlorotic mottling and ringspot during the two years of observation. GINV-inoculated “Beta” grapevines had serious leaf chlorotic mottling and ringspot symptoms on the whole plant, while relatively few symptoms were observed on the leaves of agroinoculated “Thompson Seedless” grapevines in early spring and only weak ring spot gradually appeared later in the top young leaves. Our experiments fulfilled Koch’s postulates and revealed the causative role of GINV in grapevine chlorotic mottling and ring spot disease.
24
Qi, Fang, Dong Jiahong, Zheng Kuanyu e Zhang Zhongkai. "Cytopathological Characterization of Tobacco on Co-infection with Tomato zonate spot virus andPotato virus Y". Chinese Bulletin of Botany 49, n.º 6 (2014): 704. http://dx.doi.org/10.3724/sp.j.1259.2014.00704.
Texto completo da fonte
25
Cluever, Jeffrey D., e Hugh A. Smith. "Pest Identification Guide: Western Flower Thrips Frankliniella occidentalis (Pergande)". EDIS 2016, n.º 4 (3 de junho de 2016): 2. http://dx.doi.org/10.32473/edis-in1127-2016.
Texto completo da fonteResumo:
Western flower thrips transmit the carmovirus Pelargonium flower break virus (PFBV), the ilarvirus Tobacco streak virus (TSV), the tospoviruses Chrysanthemum stem necrosis virus (CSNV), Groundnut ringspot virus (GRSV), Impatiens necrotic spot virus (INSV), Tomato chlorotic spot virus (TCSV), and Tomato spotted wilt virus (TSWV). This species is primarily a flower feeder, so most damage would be expected on the flower or fruit. Learn to identify the western flower thrips with this two-page illustrated guide written by Jeffrey D. Cluever and Hugh A. Smith, and published by the Department of Entomology and Nematology, May 2016. ENY-2034/IN1127: Pest Identification Guide: Western Flower Thrips Frankliniella occidentalis (Pergande) (ufl.edu)
26
Cai, J. H., B. X. Qin, X. P. Wei, J. Huang, W. L. Zhou, B. S. Lin, M. Yao, Z. Z. Hu, Z. K. Feng e X. R. Tao. "Molecular Identification and Characterization of Tomato zonate spot virus in Tobacco in Guangxi, China". Plant Disease 95, n.º 11 (novembro de 2011): 1483. http://dx.doi.org/10.1094/pdis-06-11-0486.
Texto completo da fonteResumo:
In Guangxi Province of southwest China, diseases caused by Tospoviruses (family Bunyaviridae) pose a serious threat to tobacco (Nicotiana tobacum) production. During surveys conducted annually at Xinrong Village in Jingxi County from 2008 to 2010, more than 130 ha of fields were found to have 10 to 50% of plants exhibiting symptoms similar to spotted wilt caused by Tomato spotted wilt virus (TSWV). During this period, disease symptoms at similar prevalence and incidence were also found at Fushan, Debao County in most of the cultivars produced in these areas, including Yunyan 85, 87, 92, 97, and K326. Symptoms on tobacco varied but commonly included dwarfing, midrib browning, distorted apical buds, and concentric ringspots that coalesced to form large areas of dead leaf tissue. Mechanical inoculation from diseased tobacco leaves with concentric ringspots back to tobacco cv. Yunyan 85 or 87, resulted in 12 of 16 plants with symptoms similar to those observed in the field. No symptoms on plants developed following inoculation with buffer only. Symptoms found in the field resembled those caused by TSWV. However, testing using TSWV-specific antiserum was shown to be negative by double-antibody sandwich-ELISA (Agdia, Elkhart, IN). Total RNA was extracted from 27 diseased tobacco plants collected from different regions in Guangxi using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. RNA extracts were amplified by reverse transcription (RT)-PCR using the degenerate primers T2740 (ATGGGDATNTTTGATTTCATG) and T3920c (TCATGCTCATSAGRTAAATYTCTCT) designed to target the partial RNA-dependent RNA polymerase (RdRp) sequence of members in the genus Tospovirus (3). Amplification was performed at 42°C for 60 min, followed by 35 cycles of PCR (30 s denaturation at 94°C, 45 s annealing at 55°C, and 30 s extension at 72°C) and a 7-min final extension at 72°C. A PCR product of approximately 1.2 kb was amplified from 21 diseased plants. RT-PCR amplicons were cloned into the pUC19-T Simple Vector (TaKaRa, Dalian, China) and sequenced in both directions. Sequences were assembled and analyzed by DNAStar 5.01 (DNASTAR, Madison, WI). Sequences of representative isolates were deposited in GenBank (Accession Nos. JN020022 to JN020027). The 1.2-kb partial RdRp sequences of these isolates were shown to have 94.4 to 95.3% nucleotide identity and 96.5 to 97.5% amino acids identity to Tomato zonate spot virus (TZSV) (GenBank Accession No. NC_010491) (1). Among these TZSV isolates from Guangxi, the partial RdRp sequences have 98.0 to 99.4% nucleotide identity and 98.8 to 100% amino acids identity with each other. The presence of TZSV was further confirmed in diseased tobacco plants by indirect ELISA using antiserum of TZSV (provided by Prof. Zhongkai Zhang, Agricultural Academy of Yunnan, China). TZSV has been characterized as a novel tospovirus on various hosts including tobacco in Yunnan province (1,2). To our knowledge, this is the first report of TZSV-associated disease on tobacco in Guangxi Province, southwest China. Further work is necessary to study the epidemiology and management of the disease. References: (1) J. Dong et al. Arch. Virol. 153:855, 2008. (2) J. Dong et al. J. Insect Sci. 10:166, 2010. (3) Y. Lin. Master Thesis. National Chung Hsing University, Taichung, Taiwan, Republic of China, 2007.
27
Rojas, Eduardo A. Peña, Meizzer Cadena Ortega, Rafael Reyes Cuesta e Silvio Bastidas Pérez. "Descripción de síntomas de mancha anular en el híbrido interespecífico de palma aceitera OxG (Elaeis oleifera x Elaeis guineensis)". Corpoica Ciencia y Tecnología Agropecuaria 11, n.º 1 (30 de junho de 2010): 48. http://dx.doi.org/10.21930/rcta.vol11_num1_art:194.
Texto completo da fonteResumo:
<p>Se describen los síntomas que presentan las palmas del híbrido interespecífico OxG (Elaeis oleifera x Elaeis guineensis) al ser afectadas por la enfermedad viral de la mancha anular (MA) asociada al virus AOPRV (African Oil Palm Ring Spot Virus) y establecidas en las etapas de vivero y siembra comercial en campo en las condiciones agroecológicas de Tumaco, Departamento de Nariño, Colombia. La presencia del virus AOPRV, asociado con la enfermedad, se confirmó mediante pruebas moleculares RT-PCR.</p><p> </p><p><strong>Symptoms Description of Ringspot Disease in the Inter-specific Hybrid of the Oil Palm OxG (Elaeis oleifera x Elaeis guineensis)</strong></p>Symptoms of the viral annular spot disease associated with the African oil palm ring spot virus (AOPRV) on the interspecific hybrid palm OxG (Elaeis oleifera x Elaeis guineensis) in the early stages of commercial nursery and field planting agro-ecological conditions of Tumaco, Nariño State, Colombia, are described. The virus AOPRV associated with the disease was confirmed by RT-PCR molecular test.
28
Sajid, Quratul Ain, e Eminur Elçi. "Investigation of Virus Diseases and Molecular Detection of Little Cherry Virus 1 on Cherry Plants at Niğde Province". Turkish Journal of Agriculture - Food Science and Technology 7, n.º 7 (19 de julho de 2019): 1008. http://dx.doi.org/10.24925/turjaf.v7i7.1008-1013.2490.
Texto completo da fonteResumo:
To investigate the virus infections of sour and sweet cherries, various locations of Niğde province were examined during 2017. Ninety sweet and sour cherry leaf samples showing suspicious virus symptoms were collected and screened with virus-specific primers: Little cherry virus 1 (LChV1), Cherry necrotic rusty mottle virus (CNRMV), Prune dwarf virus (PDV), Prune necrotic ring spot virus (PNRSV), Apple mosaic virus (ApMV), Cherry green ring mottle virus (CGRMV), Cherry leaf roll virus (CLRV), Cherry mottle leaf virus (CMLV), Plum bark necrotic stem pitting associated virus (PBNSPaV), Cherry twisted leaf virus (CTLV), Apple stem grooving virus (ASGV), Little cherry virus 2 (LChV2), Cherry rusty leaf virus (CRLV), Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV). Based on RT-PCR analysis, no amplification was observed except LChV1 amplifications, dsRNA analysis resulted in one suspicious profile. To validate those results, more sensitive TaqMan Real-Time PCR analysis and sequence analysis were conducted and LChV1 was detected on 7 samples. It can be concluded that only a low quantity of LChV1 infections was observed on some of the screened cherry samples.
29
Lima, M. F., A. C. de Ávila, L. J. da G. Wanderley, T. Nagata e L. J. W. da Gama. "Coriander: A New Natural Host of Groundnut Ring Spot Virus in Brazil". Plant Disease 83, n.º 9 (setembro de 1999): 878. http://dx.doi.org/10.1094/pdis.1999.83.9.878c.
Texto completo da fonteResumo:
Coriander plants (Coriandrum sativum L. ‘Palmeira’), showing stunting, chlorotic ring spots, necrosis, and malformation of apical leaves were observed on 50-day-old-plants in July 1998 in one seed production field at Petrolina, State of Pernambuco, Brazil, but not in nearby fields. Leaf samples were collected and tested by double antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) with a panel of polyclonal antibodies made against the nucleocapsid protein (N) of tomato spotted wilt virus (TSWV), tomato chlorotic spot virus (TCSV), groundnut ring spot virus (GRSV), and impatiens necrotic spot virus (INSV) (1). All symptomatic samples reacted only with the GRSV antisera. Coriander leaf extracts from infected plants were mechanically inoculated onto potential indicator hosts. The virus induced systemic infection with vein clearing, chlorotic and necrotic spots, necrotic ring spots, mosaic, top distortion, and stunting within 21 days after inoculation on Capsicum annuum cv. Ikeda, C. chinense PI 159236, Physalis floridana, Nicandra physaloides, Nicotiana tabacum cv. TNN, N. benthamiana, Lycopersicon esculentum cv. Rutgers, Phaseolus vulgaris cv. BT2, and Gomphrena globosa. The symptomatic indicator plants tested positive for GRSV by DAS-ELISA. P. vulgaris, Chenopodium amaranthicolor, C. quinoa, and Cucurbita pepo (zucchini) cv. Caserta showed only small, necrotic, local lesions on inoculated leaves. Citrullus lanatus cv. Charleston Gray was asymptomatic. This is the first report of natural occurrence of GRSV on coriander in Brazil. Reference: (1) A. C. de Ávila et al. J. Gen. Virol. 71:2801, 1990.
30
Langenberg, W. G., S. A. Lommel e D. E. Purcifull. "Sorghum chlorotic spot virus binds to potyvirus cylindrical inclusions in tobacco leaf cells". Journal of Ultrastructure and Molecular Structure Research 102, n.º 1 (abril de 1989): 47–52. http://dx.doi.org/10.1016/0889-1605(89)90031-1.
Texto completo da fonte
31
Fisher, John R. "Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio". Plant Health Progress 14, n.º 1 (janeiro de 2013): 24. http://dx.doi.org/10.1094/php-2013-0330-01-rs.
Texto completo da fonteResumo:
Two Hosta sp. ‘So Sweet’ plants and one Hosta sieboldii (labeled as ‘Albo-marginata’) plant showing a suspected virus-like leaf mottle symptom tested negative for the Potyvirus group, Hosta virus X, Alfalfa mosaic virus, Arabis mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato ringspot virus, and Tomato spotted wilt virus by ELISA. DsRNA analysis produced a banding profile suggestive of a viral infection, and dsRNA was used as template to synthesize cDNAs for use with tobravirus group and Tobacco rattle virus (TRV) specific PCR primers. Amplicons were cloned and sequenced, and results showed two distinct populations of sequences: the two So Sweet isolates were ∼99% identical to each other but only ∼92% identical to the Albo-marginata isolate. These results represent the first confirmed report of TRV in Hosta in Ohio, and further demonstrate that there are at least two nucleotide sequence variants of the virus infecting Ohio Hosta. Accepted for publication 21 December 2012. Published 30 March 2013.
32
Mertelík, J., e K. Kloudová. "HYDRANGEA RING SPOT VIRUS IN HYDRANGEA SPP. PLANTS IN THE CZECH REPUBLIC". Acta Horticulturae, n.º 901 (julho de 2011): 237–38. http://dx.doi.org/10.17660/actahortic.2011.901.30.
Texto completo da fonte
33
Chandel, V., T. Rana, A. Handa, P. D. Thakur, V. Hallan e A. A. Zaidi. "Incidence of Prunus necrotic ring spot virus on Malus domestica in India". Journal of Phytopathology 156, n.º 6 (6 de fevereiro de 2008): 382–84. http://dx.doi.org/10.1111/j.1439-0434.2007.01361.x.
Texto completo da fonte
34
Esquivel, A. F., J. A. M. Rezende, E. F. B. Lima, E. W. Kitajima e F. O. Diniz. "First Report of Groundnut ring spot virus on Physalis peruviana in Brazil". Plant Disease 102, n.º 7 (julho de 2018): 1468. http://dx.doi.org/10.1094/pdis-10-17-1684-pdn.
Texto completo da fonte
35
Ciuffo, M., G. C. Mautino, L. Bosco, M. Turina e L. Tavella. "Identification of Dictyothrips betae as the vector of Polygonum ring spot virus". Annals of Applied Biology 157, n.º 2 (30 de julho de 2010): 299–307. http://dx.doi.org/10.1111/j.1744-7348.2010.00428.x.
Texto completo da fonte
36
Gebhardt, Ronald, Jean-Marie Teulon, Jean-Luc Pellequer, Manfred Burghammer, Jacques-Philippe Colletier e Christian Riekel. "Virus particle assembly into crystalline domains enabled by the coffee ring effect". Soft Matter 10, n.º 30 (2014): 5458–62. http://dx.doi.org/10.1039/c4sm00414k.
Texto completo da fonte
37
Riekel, C., M. Burghammer, I. Snigirev e M. Rosenthal. "Microstructural metrology of tobacco mosaic virus nanorods during radial compression and heating". Soft Matter 14, n.º 2 (2018): 194–204. http://dx.doi.org/10.1039/c7sm01332a.
Texto completo da fonte
38
Bezerra, I. C., R. de O. Resende, L. Pozzer, T. Nagata, R. Kormelink e A. C. De Ávila. "Increase of Tospoviral Diversity in Brazil with the Identification of Two New Tospovirus Species, One from Chrysanthemum and One from Zucchini". Phytopathology® 89, n.º 9 (setembro de 1999): 823–30. http://dx.doi.org/10.1094/phyto.1999.89.9.823.
Texto completo da fonteResumo:
During a survey conducted in several different regions of Brazil, two unique tospoviruses were isolated and characterized, one from chrysanthemum and the other from zucchini. The chrysanthemum virus displayed a broad host range, whereas the virus from zucchini was restricted mainly to the family Cucurbitaceae. Double-antibody sandwich-enzyme-linked immunosorbent assay and western immunoblot analyses demonstrated that both viruses were serologically distinct from all reported tospovirus species including the recently proposed peanut yellow spot virus and iris yellow spot virus (IYSV) species. The nucleotide sequences of the nucleocapsid (N) genes of both viruses contain 780 nucleotides encoding for deduced proteins of 260 amino acids. The N proteins of these two viruses displayed amino acid sequence similarities with the previously described tospovirus species ranging from 20 to 75%, but they were more closely related to each other (80%). Based on the biological and molecular features, these viruses are proposed as two new tospovirus species, designated chrysanthemum stem necrosis virus (CSNV) and zucchini lethal chlorosis virus (ZLCV). With the identification of CSNV and ZLCV, in addition to tomato spotted wilt virus, groundnut ring spot virus, tomato chlorotic spot virus, and IYSV, Brazil harbors the broadest spectrum of tospovirus species reported.
39
Martínez-Ochoa, N., A. S. Csinos, E. B. Whitty, A. W. Johnson e M. J. Parrish. "First Report on the Incidence of Mixed Infections of Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) in Tobacco Grown in Georgia, South Carolina, and Virginia". Plant Health Progress 4, n.º 1 (janeiro de 2003): 40. http://dx.doi.org/10.1094/php-2003-0417-01-hn.
Texto completo da fonteResumo:
Tomato spotted wilt caused by Tomato spotted wilt virus (TSWV) continues to be a serious disease problem on tobacco (Nicotiana tabacum L.), peanut (Arachis hypogaea L.), tomato (Lycopersicon esculentum Mill.), and pepper (Capsicum annum L.) in the southeastern United States. Impatiens necrotic spot virus (INSV, formerly known as TSWV-I) is an emerging virus found mostly in greenhouse production of ornamentals and is also vectored by thrips. A few years ago INSV was detected in peanut in Georgia and Texas and its occurrence appears to be increasing). Mixed infections of TSWV and INSV in tobacco have been observed within the last two years in North Carolina and Kentucky. Our objective was to sample several locations in Georgia, Florida, South Carolina and Virginia to confirm and report the presence of natural TSWV and INSV mixed infections in tobacco. Accepted for publication 14 March 2003. Published 17 April 2003.
40
Sanchez-Cuevas, M.-C., e S. G. P. Nameth. "Virus-associated Diseases of Double Petunia: Frequency and Distribution in Ohio Greenhouses". HortScience 37, n.º 3 (junho de 2002): 543–46. http://dx.doi.org/10.21273/hortsci.37.3.543.
Texto completo da fonteResumo:
Double petunia plants expressing virus-like symptoms were collected in greenhouses and garden centers throughout Ohio in Spring 1997 and 1998 in an effort to determine the frequency and distribution of petunia viruses present in the state. Direct antibody-sandwich and indirect enzyme-linked immunosorbent assay (ELISA) were conducted with commercial antisera made against 13 viruses, a potyvirus kit capable of detecting 80 different potyviruses, and our antiserum raised against a tobamo-like virus inducing severe mosaic in double petunia. Viral-associated double-stranded ribonucleic acid (dsRNA) analysis and light microscopy for detection of inclusion bodies were also carried out. ELISA, dsRNA analysis, and light microscopy revealed the presence of tobacco mosaic tobamovirus, an unknown tobamo-like petunia virus, tomato ringspot nepovirus, tobacco streak ilarvirus, and tobacco ringspot nepovirus. Tomato aspermy cucumovirus, tomato spotted wilt tospovirus, impatiens necrotic spot tospovirus, alfalfa mosaic virus, cucumber mosaic cucumovirus, potato virus X potexvirus, and chrysanthemum B carlavirus were not detected. No potyviruses were identified. A number of plants with virus-like symptoms tested negative for all viruses.
41
Zilkah, S., E. Faingersh, A. Rotbaum e A. Stein. "IN VITRO MICROPROPAGATION OF INDICATOR PLANTS FOR INDEXING PRUNUS NECROTIC RING SPOT VIRUS". Acta Horticulturae, n.º 336 (abril de 1993): 121–26. http://dx.doi.org/10.17660/actahortic.1993.336.15.
Texto completo da fonte
42
Jain, R. K., K. M. Nasiruddin, Jyoti Sharma, R. P. Pant e A. Varma. "First Report of Occurrence of Papaya ring spot virus Infecting Papaya in Bangladesh". Plant Disease 88, n.º 2 (fevereiro de 2004): 221. http://dx.doi.org/10.1094/pdis.2004.88.2.221c.
Texto completo da fonteResumo:
Papaya (Carica papaya L.) is an important fruit crop in Bangladesh. During surveys conducted in Dhaka and Mymensingh regions from April to June 2003, >50% of papaya plants were observed to have leaf mottling, mosaic and mild distortion, and water-soaked streaks on petioles and stem, which are typical symptoms of Papaya ring spot virus (PRSV) infection. Electron-microscopic examination of negatively stained leaf-dip preparations from 10 symptomatic samples revealed the association of flexuous virus particles that were decorated with polyclonal antibodies raised to an isolate from India (PRSV-D). The identity of PRSV associated with the papaya disease in Bangladesh was further confirmed by reverse transcription polymerase chain reaction and sequence analysis (2). By using PRSV specific primers (2), the 3′-terminal region comprising a part of the nuclear inclusion b gene, the coat protein (CP) gene, and the untranslated region were amplified and sequenced (GenBank Accession No. AY423557). The CP gene consisted of 286 amino acids and the conserved regions common to the genus Potyvirus, such as WCIEN and QMKAA, were present. Like all known PRSV sequences (1), a stretch of glutamic acid and lysine repeats (EK region) after the aphid transmission motif (DAG) also was present. Comparative CP amino acid sequence analyses revealed that the virus infecting papaya in Bangladesh, designated as PRSV-Bd, shared 89 to 92% identity with PRSV isolates from India and 88 to 93% identity with isolates from other parts of the world. To our knowledge, this is the first report of occurrence of PRSV infecting papaya in Bangladesh. References: (1) M. F. Bateson et al. J. Gen. Virol. 83:2575, 2002. (2) R. K. Jain et al. Ann Appl. Biol. 132:413, 1998.
43
Ombwara, F. K., G. O. Asudi, F. K. Rimberia, E. M. Ateka e L. S. Wamocho. "THE DISTRIBUTION AND PREVALENCE OF PAPAYA RING SPOT VIRUS (PRSV) IN KENYAN PAPAYA". Acta Horticulturae, n.º 1022 (março de 2014): 119–24. http://dx.doi.org/10.17660/actahortic.2014.1022.15.
Texto completo da fonte
44
Chavan, V. M., S. P. S. Tomar e M. G. Dhale. "MANAGEMENT OF PAPAYA RING SPOT VIRUS (PRSV-P) OF PAPAYA UNDER PUNE CONDITIONS". Acta Horticulturae, n.º 851 (janeiro de 2010): 447–52. http://dx.doi.org/10.17660/actahortic.2010.851.69.
Texto completo da fonte
45
Materazzi, A., e E. Triolo. "Spathiphyllum sp.: A New Natural Host of Impatiens necrotic spot virus". Plant Disease 85, n.º 4 (abril de 2001): 448. http://dx.doi.org/10.1094/pdis.2001.85.4.448b.
Texto completo da fonteResumo:
In September 1999, several Spathiphyllum plants grown in a greenhouse in Tuscany (Italy) showed leaf symptoms in the form of concentric chlorotic ringspots, line patterns, and irregular chlorotic blotches. These symptoms developed into localized necrosis. Crude sap of tissues showing symptoms was mechanically inoculated to young symptomless Spathiphyllum plants and to Nicotiana benthamiana and N. clevelandii. Samples drawn from symptomatic and symptomless tissues of naturally or artificially infected Spathiphyllum and Nicotiana plants were tested for the presence of Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Dasheen mosaic virus (DsMV), Impatiens necrotic spot virus (INSV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), and Tomato spotted wilt virus (TSWV) by double-antibody sandwich enzyme-linked immunosorbent assay carried out with commercial antisera. The symptomatic tissues obtained from Spathiphyllum and Nicotiana plants gave a positive reaction only for INSV. The symptomless samples obtained from various parts of the infected Spathiphyllum plants gave a negative reaction, even after 1 year from the appearance of localized necrosis, suggesting a non-systemic infection in this new host. This is the first report of infection of Spathiphyllum sp. by INSV.
46
Murphy, J. F., T. A. Zitter e A. Erb. "Tobacco mosaic virus in Jalapeno Pepper in New York". Plant Disease 87, n.º 2 (fevereiro de 2003): 202. http://dx.doi.org/10.1094/pdis.2003.87.2.202d.
Texto completo da fonteResumo:
Jalapeno pepper plants (Capsicum annuum cv. Jaladuro) grown in Erie County, New York expressed chlorotic oak-leaf patterns along the primary vein of fully expanded leaves. Fruit had patterns of irregular ripening with a bumpy surface. Symptom expression was most obvious in August 2002, when leaf and fruit abscission occurred. Symptomatic fruit samples were tested by western blot analysis for the presence of Cucumber mosaic virus (CMV), Potato virus Y (PVY), Pepper mottle virus (PepMoV), Tobacco etch virus (TEV), and Tobacco mosaic virus (TMV). A positive reaction for TMV, but none of the other viruses, was observed. Symptomatic leaf samples were tested by Agdia, Inc. (Elkhart, IN) for Alfalfa mosaic virus, CMV, Impatiens necrotic spot virus, Pepper mild mottle virus, PepMoV, PVY, TEV, TMV, Tobacco ringspot virus, Tomato ringspot virus, and TSWV and for potyviruses using a group-specific test. The Agdia test confirmed that the pepper plants were infected with TMV. The pepper field where the original samples were collected was surveyed for TMV-infected plants. Fifty symptomatic plants expressing foliar and fruit symptoms similar to those originally tested, and 50 asymptomatic plants were sampled by collection of three leaves per plant and tested using enzyme-linked immunosorbent assay for the presence of TMV. All symptomatic plants and 18% of asymptomatic plants tested positive for TMV. To our knowledge, this is the first occurrence of TMV causing losses in commercially grown pepper in New York.
47
Hassani-Mehraban, Afshin, Janneke Saaijer, Dick Peters, Rob Goldbach e Richard Kormelink. "A New Tomato-Infecting Tospovirus from Iran". Phytopathology® 95, n.º 8 (agosto de 2005): 852–58. http://dx.doi.org/10.1094/phyto-95-0852.
Texto completo da fonteResumo:
A new tospovirus species serologically distinct from all other established tospoviruses was found in tomato in Iran. Typical disease symptoms observed include necrotic lesions on the leaves and yellow ring spots on the fruits, hence the name Tomato yellow ring virus (TYRV) was proposed. The S RNA of this virus was cloned and its 3,061 nucleotide long sequence showed features characteristic for tospoviral S RNA segments. The nucleocapsid (N) protein with a predicted Mr of 30.0 kDa showed closest relationship to the N protein of Iris yellow spot virus (74% sequence identity).
48
Isogai, Masamichi, Youhei Suzuki, Takanori Matsudaira e Nobuyuki Yoshikawa. "Genomic RNA accumulation of gentian ovary ring-spot virus and raspberry bushy dwarf virus in pollen tubes". Journal of General Plant Pathology 84, n.º 5 (13 de junho de 2018): 376–80. http://dx.doi.org/10.1007/s10327-018-0795-2.
Texto completo da fonte
49
Kshirsagar, Hemlata, e Pankaj Deore. "Studies on Induced Resistance by Chemicals against Papaya Ring Spot Virus (PRSV) in Papaya". International Journal of Current Microbiology and Applied Sciences 9, n.º 11 (10 de novembro de 2020): 2074–83. http://dx.doi.org/10.20546/ijcmas.2020.911.247.
Texto completo da fonte
50
Chon-Seng, T., T. Poh Hwa, O. Ching Ang e H. Mat Daud. "CLONING AND EXPRESSION OF PAPAYA RING SPOT VIRUS (PRSV) COAT PROTEIN GENE IN BACTERIA". Acta Horticulturae, n.º 740 (março de 2007): 141–45. http://dx.doi.org/10.17660/actahortic.2007.740.15.
Texto completo da fonte