Relevant bibliographies by topics / 16S rRNA gen

Contents

  1. Journal articles
  2. Dissertations / Theses
  3. Books
  4. Book chapters
  5. Conference papers

Academic literature on the topic '16S rRNA gen'

Author: Grafiati
Published: 4 June 2021
Last updated: 9 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic '16S rRNA gen.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "16S rRNA gen"

1

Akihary, Claudia Valleria, and Beivy Jonathan Kolondam. "PEMANFAATAN GEN 16S rRNA SEBAGAI PERANGKAT IDENTIFIKASI BAKTERI UNTUK PENELITIAN-PENELITIAN DI INDONESIA." PHARMACON 9, no. 1 (2020): 16. http://dx.doi.org/10.35799/pha.9.2020.27405.

Full text
Abstract:
ABSTRACTThe 16S rRNA gene has hyper variable region and different for one bacterial species to another. The gene is being used as research tool to help for accurate identification of bacteria in many fields in Indonesia. As a useful tool, the 16S rRNA gene sequence is important as to explore the potencies of a bacterial species. Sequencing of this gene is very useful for research in clinical study, fisheries, marine science, agricultural science, and animal husbandry in Indonesia. Keywords: 16S rRNA gene, research tool, bacteria, Indonesia ABSTRAKGen 16S rRNA memiliki region yang sangat bervar
APA, Harvard, Vancouver, ISO, and other styles
2

Rico Taareluan, Rico, Letha L. Wantania, Elvy L. Ginting, et al. "AMPLIFIKASI GEN 16S-rRNA BAKTERI EPIFIT PADA ALGA MERAH Kappaphycus alvarezii." JURNAL PESISIR DAN LAUT TROPIS 8, no. 1 (2020): 116. http://dx.doi.org/10.35800/jplt.8.1.2020.27696.

Full text
Abstract:
Bacteria are microscopic organism found living in marine algae. So far, species of bacteria in marine algae are not well known. In this study, epiphytic bacteria in algal species of Kappaphycus alvarezii (red algae) were isolated to amplify their 16S-rRNA gene. Sample K.alvarezii was collected from the island of Nain. The isolated epiphytic bacteria from the red algae K.alvarezii were grown in Nutrient Broth (NB) media. DNA extraction was carried out using InnuPREP DNA Mini Kit. 16SrRNA genes was performed using primer pair of 8F and 1492R. Two different character of epiphytic bacteria were su
APA, Harvard, Vancouver, ISO, and other styles
3

Dalenoh, Oktavianus, Stenly Wullur, Elvy L. Ginting, Veibe Warouw, Detty N. Rumampuk, and Henneke Pangkey. "FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER." JURNAL PESISIR DAN LAUT TROPIS 8, no. 2 (2020): 73. http://dx.doi.org/10.35800/jplt.8.2.2020.29909.

Full text
Abstract:
The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny o
APA, Harvard, Vancouver, ISO, and other styles
4

Carlier, Jean-Philippe, Guylène K'ouas, Isabelle Bonne, Alain Lozniewski, and Francine Mory. "Oribacterium sinus gen. nov., sp. nov., within the family ‘Lachnospiraceae’ (phylum Firmicutes)." International Journal of Systematic and Evolutionary Microbiology 54, no. 5 (2004): 1611–15. http://dx.doi.org/10.1099/ijs.0.63060-0.

Full text
Abstract:
A hitherto unknown anaerobic bacillus isolated from sinus pus in a young child (strain AIP 354.02T) was characterized by using phenotypic and genotypic methods. 16S rRNA gene sequence analysis indicated that this strain was phylogenetically affiliated with several sequences of cloned 16S rRNA gene inserts previously deposited in the public databases. According to their 16S rRNA gene sequence similarities, these uncultivated bacteria, together with strain AIP 354.02T, formed a separate subgroup belonging to the family ‘Lachnospiraceae’ within the phylum Firmicutes. Oribacterium gen. nov. is pro
APA, Harvard, Vancouver, ISO, and other styles
5

Puspitasari, Dhewanti, Hendro Pramono, and Oedjijono Oedjijono. "IDENTIFIKASI BAKTERI PENGOKSIDASI BESI DAN SULFUR BERDASARKAN GEN 16S rRNA DARI LAHAN TAMBANG TIMAH DI BELITUNG." Scripta Biologica 1, no. 1 (2014): 10. http://dx.doi.org/10.20884/1.sb.2014.1.1.12.

Full text
Abstract:
Heavy metals contamination disturb balance and diversity of microorganism in soil. Microorganisms which can able to survive in those conditions are bacteria capable of oxidizing heavy metals. Identification based on 16S rRNA was used to determine characteristics and phylogenetic relationship of bacteria which can oxidize iron and sulphur in tin mining areas. The aim of this research was able to determine the bacterias characteristics isolated from tin mining areas and determine the phylogenetic relation of iron-sulphur oxidizing bacteria on tin mining soil in Belitung based on 16S rRNA sequenc
APA, Harvard, Vancouver, ISO, and other styles
6

Trisno, Jumsu, and Yusniwati Yusniwati. "Identifikasi Rizobakteria Asal Tanaman Cabai Berdasarkan Sekuen Gen 16S rRNA." Jurnal Fitopatologi Indonesia 8, no. 3 (2016): 79–83. http://dx.doi.org/10.14692/jfi.8.3.79.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

UNER, Mahmut Celalettin, Gülşen HASÇELİK, and Hamit Kaan MÜŞTAK. "Antimicrobial Susceptibilities of Clinical Nocardia Isolates Identified by 16S rRNA Gene Sequence Analysis." Mikrobiyoloji Bulteni 50, no. 1 (2016): 11–20. http://dx.doi.org/10.5578/mb.10639.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Untu, Patricia, Inneke F. M. Rumengan, and Elvy L. Ginting. "Identifikasi Mikroba yang Koeksis Dengan Ascidia Lissoclinum patella Menggunakan Sekuens Gen 16S rRNA." JURNAL PESISIR DAN LAUT TROPIS 2, no. 1 (2014): 23. http://dx.doi.org/10.35800/jplt.2.1.2014.10109.

Full text
Abstract:
Penelitian ini dilakukan dengan tujuan untuk menentukan jenis mikroba koeksis denganascidia Lissoclinum patella menggunakan sekuens gen 16S rRNA. Sampel yang digunakandalam penelitian ini diambil dari jaringan tissue pada ascidia L. patella yang diambil dariperairan Malalayang, Sulawesi Utara. Sampel mikroba diinokulasi dalam media Hirata dandikultur selama ± 1 minggu. Sampel mikroba tersebut diisolasi DNA, amplifikasi melalui PCR(Polymerase Chain Reaction), elektroforesis gel agarose dan dianalisis data DNAnyamenggunakan BLAST pada NCBI (National Center for Biotechnology Information). Identif
APA, Harvard, Vancouver, ISO, and other styles
9

Untu, Patricia, Inneke F. M. Rumengan, and Elvy L. Ginting. "Identifikasi Mikroba yang Koeksis Dengan Ascidia Lissoclinum patella Menggunakan Sekuens Gen 16S rRNA." JURNAL PESISIR DAN LAUT TROPIS 3, no. 2 (2015): 23. http://dx.doi.org/10.35800/jplt.3.2.2015.10110.

Full text
Abstract:
Penelitian ini dilakukan dengan tujuan untuk menentukan jenis mikroba koeksis denganascidia Lissoclinum patella menggunakan sekuens gen 16S rRNA. Sampel yang digunakandalam penelitian ini diambil dari jaringan tissue pada ascidia L. patella yang diambil dariperairan Malalayang, Sulawesi Utara. Sampel mikroba diinokulasi dalam media Hirata dandikultur selama ± 1 minggu. Sampel mikroba tersebut diisolasi DNA, amplifikasi melalui PCR(Polymerase Chain Reaction), elektroforesis gel agarose dan dianalisis data DNAnyamenggunakan BLAST pada NCBI (National Center for Biotechnology Information). Identif
APA, Harvard, Vancouver, ISO, and other styles
10

Wantania, Letha L., Stenly Wullur, Elvi L. Ginting, et al. "Isolation and amplification of 16S rRNA gen of Associated Microbial isolates in Red Algae Kappaphycus alvarezii from Belang, Southeast Minahasa Regency, North Sulawesi." JURNAL ILMIAH PLATAX 7, no. 1 (2019): 220. http://dx.doi.org/10.35800/jip.7.1.2019.22808.

Full text
Abstract:
This study aims to obtain isolates and amplify the associative bacterial 16SrRNA gene in K. alvarezii algae. The K. alvarezii algae was collected from seaweed cultivation area in Belang, Southeast Minahasa, North Sulawesi. Associative bacteria were sampled from K. alvarezii algae, grown in Nutrient Agar and separated based on their morphological characteristics. Each isolates were extracted their DNA genome and.the16S rRNA gene of each isolate was amplified using PCR. Eight associative bacterial from K. alvarezii algae were successfully isolated based on morphological characteristics which wer
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "16S rRNA gen"

1

Büttner, Christian [Verfasser], and Matthias [Akademischer Betreuer] Noll. "Charakterisierung der anaeroben Gärung verschiedener Ausgangssubstrate mittels 16S rRNA Gen Amplikonsequenzierung und Metaproteomanalytik / Christian Büttner ; Betreuer: Matthias Noll." Bayreuth : Universität Bayreuth, 2021. http://d-nb.info/1236630467/34.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Romero, Condori Pedro Eduardo. "Diversidad y estructura genética de Bostryx scalariformis (Mollusca, Gastropoda) en base a polimorfismos del gen mitocondrial 16S rRNA." Bachelor's thesis, Universidad Nacional Mayor de San Marcos, 2008. https://hdl.handle.net/20.500.12672/882.

Full text
Abstract:
Bostryx scalariformis (Mollusca, Gastropoda) es un molusco terrestre endémico de las lomas costeras de la costa central del Perú que habita principalmente las zonas arenosas. Sólo se encuentran individuos vivos en las siguientes lomas del departamento de Lima: Ancón, Pasamayo, Lachay y Cerro de Agua. Además, posee morfotipos geográficamente aislados, uno en Ancón-Pasamayo y el otro en Lachay-Cerro de Agua. La fragmentación de su hábitat y la disminución en su tamaño poblacional pueden haber conllevado al decremento en su diversidad genética y una diferenciación genética entre sus poblaciones.
APA, Harvard, Vancouver, ISO, and other styles
3

Compte, Port Sergi. "Factors affecting the distribution, abundance and diversity of uncultured archaeal groups in freshwater sediments." Doctoral thesis, Universitat de Girona, 2018. http://hdl.handle.net/10803/663927.

Full text
Abstract:
Archaea are abundant in extreme environments but they are also a prevalent component of microbial communities in soils, marine or freshwater plankton and sediments. Many studies highlighted the prominent role of marine sedimentary Archaea in global nutrient cycles. Less information is available, however, on the diversity, abundance and ecological role of Archaea in freshwater sediments. A serious pitfall for the study of Archaea is their low cultivability under laboratory-controlled conditions thus constraining the progress towards the complete understanding of their metabolic capabilities and
APA, Harvard, Vancouver, ISO, and other styles
4

Casas, Reyes Andrea. "Caracterizacion metagenomica asociada a corrosion en un pozo petrolero." Tesis de Licenciatura, Universidad Autónoma del Estado de México, 2018. http://hdl.handle.net/20.500.11799/68483.

Full text
Abstract:
Según los resultados presentados para poder conocer el perfil taxonómico de las muestras de agua obtenidas de un pozo petrolero ubicado en Tabasco utilizando dos distintas plataformas de secuenciación masiva, fue posible conocer mediante dos perspectivas un análisis más completo de la comunidad que se encuentra en dicho pozo, ya que si hubieran sido utilizadas técnicas más básicas de biología molecular e incluso haber recurrido únicamente al uso de técnicas de cultivos bacterianos, no hubiera sido posible conocer más a fondo la comunidad analizada en este trabajo. Por otro lado, los OTUs en
APA, Harvard, Vancouver, ISO, and other styles
5

Varna, Klaidas. "Pienarūgščių bakterijų paieška ir jų identifikavimas migruojančių didžiųjų ančių (Anas platyrhynchos) žarnyne naudojant dalinių 16S rRNR geno sekų analizę ir kultivavimu paremtus metodus." Master's thesis, Lithuanian Academic Libraries Network (LABT), 2009. http://vddb.library.lt/obj/LT-eLABa-0001:E.02~2007~D_20090908_194033-88862.

Full text
Abstract:
Pienarūgščių bakterijų paieška ir jų identifikavimas migruojančių didžiųjų ančių (Anas platyrhynchos) žarnyne naudojant dalinių 16S rRNR geno sekų analizę ir kultivavimu paremtus metodus Klaidas VARNA Vilniaus Universiteto Ekologijos Institutas, Hidrobiontų Ekologijos ir Fiziologijos Laboratorija bei Populiacinės Genetikos Laboratorija, Akademijos-2, Vilnius-21, 08412, Lietuva. Šiame tyrime pavasarinių ir rudeninių didžiųjų ančių (Anas platyrhynchos) migrantų iš Nemuno deltos virškinamojo trakto pieno rūgšties bakterijų įvairovė buvo ištirta naudojant molekulinius metodus (polimerazės grandini
APA, Harvard, Vancouver, ISO, and other styles
6

Grešová, Katarína. "Klasifikace bakterií do taxonomických kategorií na základě vlastností 16s rRNA." Master's thesis, Vysoké učení technické v Brně. Fakulta informačních technologií, 2020. http://www.nusl.cz/ntk/nusl-417246.

Full text
Abstract:
The main goal of this thesis was to design and implement a tool that would be able to classify the sequences of the 16S rRNA gene into taxonomic categories using the properties of the 16S rRNA gene. The created tool analyzes all input sequences simultaneously, which differs from common classification approaches, which classify input sequences individually. This tool relies on the fact that bacteria contain several copies of the 16S rRNA gene, which may differ in sequence. The main contribution of this work is design, implementation and evaluation of the capabilities of this tool. Experiments h
APA, Harvard, Vancouver, ISO, and other styles
7

Silveira, Érico Leandro da [UNESP]. "Identificação de comunidades bacterianas de solo por seqüenciamento do gene 16S rRNA." Universidade Estadual Paulista (UNESP), 2004. http://hdl.handle.net/11449/94868.

Full text
Abstract:
Made available in DSpace on 2014-06-11T19:27:21Z (GMT). No. of bitstreams: 0 Previous issue date: 2004-04-07Bitstream added on 2014-06-13T19:14:40Z : No. of bitstreams: 1 silveira_el_me_jabo.pdf: 655008 bytes, checksum: ac46de019a2703894b3c1bc37633b43c (MD5)<br>Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)<br>Métodos tradicionais de isolamento e cultivo limitam análises da diversidade microbiana no meio ambiente, pois acredita - se que aproximadamente 10% desses microrganismos possam ser cultivados. A ecologia microbiana molecular teve recentes progressos através da con
APA, Harvard, Vancouver, ISO, and other styles
8

Silveira, Érico Leandro da. "Identificação de comunidades bacterianas de solo por seqüenciamento do gene 16S rRNA /." Jaboticabal : [s.n.], 2004. http://hdl.handle.net/11449/94868.

Full text
Abstract:
Resumo: Métodos tradicionais de isolamento e cultivo limitam análises da diversidade microbiana no meio ambiente, pois acredita - se que aproximadamente 10% desses microrganismos possam ser cultivados. A ecologia microbiana molecular teve recentes progressos através da construção de bibliotecas metagenômicas, o que constitui uma poderosa abordagem para explorar a diversidade microbiana de solo fornecendo inclusive dados sobre os microrganismos não cultiváveis desse habitat. Este trabalho teve por objetivo comparar e estimar a diversidade de comunidades bacterianas, em solos de duas áreas, send
APA, Harvard, Vancouver, ISO, and other styles
9

Kim, Min Seok. "AN INTEGRATED INVESTIGATION OF RUMINAL MICROBIAL COMMUNITIES USING 16S rRNA GENE-BASED TECHNIQUES." The Ohio State University, 2011. http://rave.ohiolink.edu/etdc/view?acc_num=osu1316383870.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Thorson, Mary Leah. "Characterization of the structure and function of a Bacteroides thetaiotaomicron 16S rRNA promoter." Thesis, Virginia Tech, 2003. http://hdl.handle.net/10919/42962.

Full text
Abstract:
The bacteroides group is a subdivision in the <I>Cytophaga-Flavobacterium-Bacteroides</I> phylum. This group is as phylogenetically distinct from other Gram-negative enterics, including <I>Escherichia coli</I>, as they are from Gram-positive organisms. Furthermore, there is no cross expression between genes of <I>E. coli</I> and <I>Bacteroides</I> species. It is thought that this difference in gene expression lies in part at the level of transcription initiation and is due to the sequences within the promoter region itself. A putative consensus sequence for <I>Bacteroides</I> promoters has
APA, Harvard, Vancouver, ISO, and other styles
More sources

Books on the topic "16S rRNA gen"

1

Kirchman, David L. Community structure of microbes in natural environments. Oxford University Press, 2018. http://dx.doi.org/10.1093/oso/9780198789406.003.0004.

Full text
Abstract:
Community structure refers to the taxonomic types of microbes and their relative abundance in an environment. This chapter focuses on bacteria with a few words about fungi; protists and viruses are discussed in Chapters 9 and 10. Traditional methods for identifying microbes rely on biochemical testing of phenotype observable in the laboratory. Even for cultivated microbes and larger organisms, the traditional, phenotype approach has been replaced by comparing sequences of specific genes, those for 16S rRNA (archaea and bacteria) or 18S rRNA (microbial eukaryotes). Cultivation-independent appro
APA, Harvard, Vancouver, ISO, and other styles
2

Kirchman, David L. Predation and protists. Oxford University Press, 2018. http://dx.doi.org/10.1093/oso/9780198789406.003.0009.

Full text
Abstract:
Protists are involved in many ecological roles in natural environments, including primary production, herbivory and carnivory, and parasitism. Microbial ecologists have been interested in these single-cell eukaryotes since Antonie van Leeuwenhoek saw them in his stool and scum from his teeth. This chapter focuses on the role of protozoa (purely heterotrophic protists) and other protists in grazing on other microbes. Heterotrophic nanoflagellates, 3–5 microns long, are the most important grazers of bacteria and small phytoplankton in aquatic environments. In soils, flagellates are also importan
APA, Harvard, Vancouver, ISO, and other styles
3

Kirchman, David L. Processes in anoxic environments. Oxford University Press, 2018. http://dx.doi.org/10.1093/oso/9780198789406.003.0011.

Full text
Abstract:
During organic material degradation in oxic environments, electrons from organic material, the electron donor, are transferred to oxygen, the electron acceptor, during aerobic respiration. Other compounds, such as nitrate, iron, sulfate, and carbon dioxide, take the place of oxygen during anaerobic respiration in anoxic environments. The order in which these compounds are used by bacteria and archaea (only a few eukaryotes are capable of anaerobic respiration) is set by thermodynamics. However, concentrations and chemical state also determine the relative importance of electron acceptors in or
APA, Harvard, Vancouver, ISO, and other styles

Book chapters on the topic "16S rRNA gen"

1

Hall, Michael, and Robert G. Beiko. "16S rRNA Gene Analysis with QIIME2." In Methods in Molecular Biology. Springer New York, 2018. http://dx.doi.org/10.1007/978-1-4939-8728-3_8.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Einarsson, Gisli G., and Sébastien Boutin. "Techniques: culture, identification and 16S rRNA gene sequencing." In The Lung Microbiome. European Respiratory Society, 2019. http://dx.doi.org/10.1183/2312508x.10000819.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Bally, René, Jacqueline Haurat, and Philippe Normand. "Azospirillum Phylogeny Based on rrs (16S rRNA Gene) Sequences." In Azospirillum VI and Related Microorganisms. Springer Berlin Heidelberg, 1995. http://dx.doi.org/10.1007/978-3-642-79906-8_12.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Fantini, Elio, Giulio Gianese, Giovanni Giuliano, and Alessia Fiore. "Bacterial Metabarcoding by 16S rRNA Gene Ion Torrent Amplicon Sequencing." In Methods in Molecular Biology. Springer New York, 2015. http://dx.doi.org/10.1007/978-1-4939-1720-4_5.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Huang, Yu-An, Zhi-An Huang, Zhu-Hong You, et al. "Precise Prediction of Pathogenic Microorganisms Using 16S rRNA Gene Sequences." In Intelligent Computing Theories and Application. Springer International Publishing, 2019. http://dx.doi.org/10.1007/978-3-030-26969-2_13.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Singleton, David R., Steven L. Rathbun, Glen E. Dyszynski, and William B. Whitman. "Section 7 update: LIBSHUFF Comparisons of 16S rRNA Gene Clone Libraries." In Molecular Microbial Ecology Manual. Springer Netherlands, 2008. http://dx.doi.org/10.1007/978-1-4020-2177-0_703.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Duduk, Bojan, Samanta Paltrinieri, Ing-Ming Lee, and Assunta Bertaccini. "Nested PCR and RFLP Analysis Based on the 16S rRNA Gene." In Methods in Molecular Biology. Humana Press, 2012. http://dx.doi.org/10.1007/978-1-62703-089-2_14.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Lawley, Blair, and Gerald W. Tannock. "Analysis of 16S rRNA Gene Amplicon Sequences Using the QIIME Software Package." In Methods in Molecular Biology. Springer New York, 2016. http://dx.doi.org/10.1007/978-1-4939-6685-1_9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Bertaccini, Assunta, Samanta Paltrinieri, and Nicoletta Contaldo. "Standard Detection Protocol: PCR and RFLP Analyses Based on 16S rRNA Gene." In Phytoplasmas. Springer New York, 2018. http://dx.doi.org/10.1007/978-1-4939-8837-2_7.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

James, Greg. "Universal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA Gene." In PCR for Clinical Microbiology. Springer Netherlands, 2010. http://dx.doi.org/10.1007/978-90-481-9039-3_28.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "16S rRNA gen"

1

Kazarina, Alisa, Ilva Pole, Viktorija Leonova, et al. "Insights into archaeological human sample microbiome using 16S rRNA gene sequencing." In 2017 IEEE International Conference on Bioinformatics and Biomedicine (BIBM). IEEE, 2017. http://dx.doi.org/10.1109/bibm.2017.8218018.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Silva, M. L. R. Bastos, M. C. C. Pereira Lyra, J. Paula Oliveira, H. Almeida Burity, and G. M. Campos-Takaki. "Microbial diversity in Chromobacterium violaceum determined by 16S rRNA gene analysis." In Proceedings of the II International Conference on Environmental, Industrial and Applied Microbiology (BioMicroWorld2007). WORLD SCIENTIFIC, 2009. http://dx.doi.org/10.1142/9789812837554_0063.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Ibrahim, N. J., B. M. Md-Zain, and S. Yaakop. "Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences." In THE 2013 UKM FST POSTGRADUATE COLLOQUIUM: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2013 Postgraduate Colloquium. AIP Publishing LLC, 2013. http://dx.doi.org/10.1063/1.4858679.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Chawla, Archit, and Anthony Byrne. "16S rRNA gene sequencing improves microbial diagnosis of culture-negative pleural effusions." In ERS International Congress 2019 abstracts. European Respiratory Society, 2019. http://dx.doi.org/10.1183/13993003.congress-2019.oa5140.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Vasileva, E. N., A. M. Afonin, G. A. Akhtemova, V. A. Zhukov, and I. A. Tikhonovich. "Endophytic bacteria isolated from garden pea (Pisum sativum L.)." In 2nd International Scientific Conference "Plants and Microbes: the Future of Biotechnology". PLAMIC2020 Organizing committee, 2020. http://dx.doi.org/10.28983/plamic2020.265.

Full text
Abstract:
Endophytic bacteria were isolated from surface-sterilized aerial parts of pea. Taxonomic status of isolated strains was determined by sequencing of 16S rRNA gene. Moreover, genomes of growth-promoting endophytes were sequenced.
APA, Harvard, Vancouver, ISO, and other styles
6

Brill, Simon, Phillip James, Leah Cuthbertson, et al. "Profiling the COPD airway microbiome using quantitative culture and 16S rRNA gene sequencing." In ERS International Congress 2016 abstracts. European Respiratory Society, 2016. http://dx.doi.org/10.1183/13993003.congress-2016.oa1787.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Deljou, A., K. Mousavi, A. Ghasemi, and H. Rahimian. "Identification of Mycobacterium sp. as Alfalfa endophytes using 16s rRNA gene sequence analysis." In Proceedings of the II International Conference on Environmental, Industrial and Applied Microbiology (BioMicroWorld2007). WORLD SCIENTIFIC, 2009. http://dx.doi.org/10.1142/9789812837554_0013.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Yamasaki, Kei, Kazuhiro Yatera, Toshinori Kawanami, et al. "The Bacteriological Incidence Of Community-Acquired Pneumonia Using Clone Analysis Of 16S RRNA Gene." In American Thoracic Society 2012 International Conference, May 18-23, 2012 • San Francisco, California. American Thoracic Society, 2012. http://dx.doi.org/10.1164/ajrccm-conference.2012.185.1_meetingabstracts.a5243.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Pertiwi, Melati Putri, Patricia Karin Himawan Praseptin, Ika Diana Werdani, Dwi Listyorini, and Sitoresmi Prabaningtyas. "Identification and phylogenetic study of bioluminescent bacteria from squid (Loligo duvaucelii) based on 16S rRNA gene." In INVENTING PROSPEROUS FUTURE THROUGH BIOLOGICAL RESEARCH AND TROPICAL BIODIVERSITY MANAGEMENT: Proceedings of the 5th International Conference on Biological Science. Author(s), 2018. http://dx.doi.org/10.1063/1.5050134.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Shelton, Jenna L., Elliott Barnhart, Leslie F. Ruppert, Aaron Jubb, Madalyn S. Blondes, and Christina DeVera. "REPETITIVE SAMPLING AND CONTROL THRESHOLD IMPROVE 16S RRNA GENE SEQUENCING RESULTS FROM NIOBRARA SHALE PRODUCED WATER." In GSA 2020 Connects Online. Geological Society of America, 2020. http://dx.doi.org/10.1130/abs/2020am-351340.

Full text
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic '16S rRNA gen' for particular source types:
Journal articles Dissertations / Theses
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography