Log in

Relevant bibliographies by topics / 5-dimethoxyaniline)

Contents

Journal articles

Academic literature on the topic '5-dimethoxyaniline)'

Author: Grafiati

Published: 5 June 2025

Last updated: 1 August 2025

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic '5-dimethoxyaniline).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "5-dimethoxyaniline)"

1

Klink, Michael, Richard Akinyeye, Vernon Somerset, Mantoa Sekota, Priscilla Gloria Lorraine Baker, and Emmanuel Iheanyechukwu Iwuoha. "Electrochemical and Spectroscopic Dynamics of Nanostructured Polynuclear Sulphonic Acid-Doped Poly(2, 5-dimethoxyaniline)." Materials Science Forum 657 (July 2010): 231–48. http://dx.doi.org/10.4028/www.scientific.net/msf.657.231.

Full text

Abstract:

Conducting and electroactive nanostructured poly(2, 5-dimethoxyaniline), PDMA, doped with anthracene sulphonic acid, ASA, and phenanthrene sulphonic acid, PSA, respectively, were prepared by oxidative polymerisation of 2, 5-dimethoxyaniline, DMA, with ammonium persulphate as oxidant. Scanning electron microscope, SEM, images of the polymers showed well defined nanotubes and fibrils with diameters of between 50 to 100 nm and 200 to 300 nm for PDMA-ASA and PDMA-PSA, respectively. Evidence of the incorporation of ASA and PSA into the PDMA backbone was provided by UV-Vis and FTIR analyses. Electro

APA, Harvard, Vancouver, ISO, and other styles

2

M., Senthilkumar, and Manisankar P. "Synthesis of poly(2,5-dimethoxyaniline)-SnO2 nanocomposites and their structural, optical and electrochemical properties." Journal of Indian Chemical Society Vol. 96, Jan 2019 (2019): 81–84. https://doi.org/10.5281/zenodo.5652960.

Full text

Abstract:

Department of Chemistry, Alagappa Chettiar Government College of Engineering and Technology, Karaikudi-630 003. Tamailnadu, India Department of Industrial Chemistry, Alagappa University, Karaikudi-630 003. Tamailnadu, India <em>E-mail</em>: pms11@rediffmail.com <em>Manuscript received online 30 August 2018, accepted 09 October 2018</em> Nanocomposites have gained much importance in different fields, commercially and technologically, due to the possibilities in tuning the properties. In the present work, poly(2,5-dimethoxyaniline)/tin oxide (PDMA/SnO<sub>2</sub> ) nanocomposites were synthesize

APA, Harvard, Vancouver, ISO, and other styles

3

Huang, Li-Ming, Ten-Chin Wen, and A. Gopalan. "Synthesis and characterization of soluble conducting poly(aniline-co-2, 5-dimethoxyaniline)." Materials Letters 57, no. 12 (2003): 1765–74. http://dx.doi.org/10.1016/s0167-577x(02)01066-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Hidayah, Nurul, Bambang Purwono, and Harno Dwi Pranowo. "One Step Synthesis of Symmetrical Amino Azine Derivatives Using Hydrazine Hydrate as a Reagent." Key Engineering Materials 840 (April 2020): 257–64. http://dx.doi.org/10.4028/www.scientific.net/kem.840.257.

Full text

Abstract:

Symmetrical Amino Azine derivative compound of 6,6'-((1E,1'E)-hydrazine-1,2-diylidenebis (methanyl-ylidene)) bis (3,4-dimethoxyaniline) TM has been synthesized through an unusual reaction route employed benzylidine derivative with some electron withdrawing groups as intermediate compounds. The targeted TM compound was prepared by one pot reaction of the intermediate 2-(4,5-dimethoxy-2-nitrobenzylidene) malononitrile 3 or (E)-1,2-dimethoxy-4-nitro-5-(2-nitrovinyl)-benzene 4 or nitrohydrazone 5 with excess 80% hydrazine hydrate and 10% Pd/C catalyst. However, direct synthesis to produce TM using

APA, Harvard, Vancouver, ISO, and other styles

5

Bilibana, Mawethu Pascoe, Usisipho Feleni, Avril Rae Williams, and Emmanuel Iwuoha. "Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite." Processes 9, no. 1 (2021): 179. http://dx.doi.org/10.3390/pr9010179.

Full text

Abstract:

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nano

APA, Harvard, Vancouver, ISO, and other styles

6

Sun, Miao, Wei Wang, Ben Lin He, et al. "Preparation and Properties of Poly-2,5-dihydroxyaniline/Activated Carbon Composite Electrode." Applied Mechanics and Materials 190-191 (July 2012): 528–33. http://dx.doi.org/10.4028/www.scientific.net/amm.190-191.528.

Full text

Abstract:

Poly-2, 5-dimethoxyaniline (PDMA) coating was successfully prepared by electrochemical method on the surface of active carbon (AC) electrodes in oxalic acid aqueous solution. The resulted coating was hydrolyzed to produce poly-2,5-dihydroxyaniline (PDHA) to enhance the capacitance of the composite electrode. Scanning electron microscope (SEM), cyclic voltammetry (CV), galvanostatic charge/discharge test, and electrochemical impedance spectroscopy (EIS) were used to investigate the properties of these electrodes. A comparative analysis on the electrochemical properties of bare-carbon electrode

APA, Harvard, Vancouver, ISO, and other styles

7

Balakit, Asim A., Ahmed Ahmed, Gamal A. El-Hiti, Keith Smith, and Emad Yousif. "Synthesis of New Thiophene Derivatives and Their Use as Photostabilizers for Rigid Poly(vinyl chloride)." International Journal of Polymer Science 2015 (2015): 1–10. http://dx.doi.org/10.1155/2015/510390.

Full text

Abstract:

Five new thiophenes, namely,N-[(3-bromo-2-methylthiophen-5-yl)methylene]-4-methoxyaniline (4a),N-[(3-bromo-2-methylthiophen-5-yl)methylene]-3,4-dimethoxyaniline (4b),N-[(3-bromo-2-methylthiophen-5-yl)methylene]-3,4-dimethylaniline (4c), 3-[(3-bromo-2-methylthiophen-5-yl)methyleneamino]-2-methylquinazolin-4(3H)-one (4d), and 3-[(3-bromo-2-methylthiophen-5-yl)methyleneamino]-2-isopropylquinazolin-4(3H)-one (4e), have been synthesized. All of these materials brought about a reduction in the level of photodegradation of poly(vinyl chloride) (PVC) films containing the synthesized thiophenes (0.5%;

APA, Harvard, Vancouver, ISO, and other styles

8

Pistoia, G., and R. Rosati. "Electrochemical synthesis of poly(2,5-dimethoxyaniline): Evaluation of the Equivalent circuit associated with the film and of its stability in solution." Electrochimica Acta 39, no. 3 (1994): 333–38. http://dx.doi.org/10.1016/0013-4686(94)80071-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Masikini, Milua, Stephen N. Mailu, Abebaw Tsegaye, et al. "In - situ Electrochemical Synthesis, Microscopic and Spectroscopic Characterisations of Electroactive poly(2,5- dimethoxyaniline) - Multi-Walled Carbon Nanotubes Composite Films in Neutral Media." International Journal of Electrochemical Science 9, no. 12 (2014): 7003–20. http://dx.doi.org/10.1016/s1452-3981(23)10948-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

"Camphor Sulfonic acid Protonated Poly (2, 5-dimethoxyaniline) - Cadmium sulfide blend thin film for Ammonia gas Sensing Application." VOLUME-8 ISSUE-10, AUGUST 2019, REGULAR ISSUE 8, no. 10 (2019): 3237–42. http://dx.doi.org/10.35940/ijitee.j1176.0881019.

Full text

Abstract:

Poly (2, 5-dimethoxyaniline) and Cadmium sulfide nanocomposite blend have been prepared by low cost, feasible oxidative polymerization method. Poly (2, 5-dimethoxyaniline) has been protonated with Camphor sulfonic acid. nanocomposite blend thin films were obtained by blending with CdS into Poly (2, 5-dimethoxyaniline) for different weight percentage by dip coating. The structural, morphological, optical characterizations of pristine Poly (2, 5-dimethoxyaniline) and nanocomposite blend thin films were analyzed. The XRD pattern shows that the crystallinity of the blend film increases with increa

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!