Journal articles on the topic '632.950 42'

A novel method of assessing muscle function in the common marmoset was developed as part of a multidisciplinary long-term study. The method involved home cage presentation of a weight-pulling task. Over a 4–5 month period, 38 of 42 animals were successfully trained to displace weights of up to 920 g (mean 612±20 g). Performance, following initial training, was stable and independent of gender or body weight.

Field trials were conducted to compare on-site visual evaluations with color-infrared photography (CIR), and near-infrared (NIR) videography (video) and hand-held radiometry (HHR) for detecting and mapping dicamba injury in cotton. CIR, video, and HHR detected 48%, 42% and 36%, respectively, of the injured crop area as defined by visual evaluation (injury ratings >0 on a scale of 0 to 9). The remote techniques were unable to differentiate crop injury that did not involve the entire plant canopy. Reflectance measurements in the visible red (R) (630–690 nm) and NIR (760–900 nm) wavelengths were taken and used in herbicide dosage prediction equations. Predicted herbicide dosages were significantly, positively correlated (P≤0.01) with physical measures of herbicide present. These studies suggest that remote detection and mapping of moderate and severe herbicide injury is possible. Further, NIR videography, with near-real-time capability and low cost may be the system of choice for this type of application.

The new sardine Sardinella ventura n. sp. (Teleostei: Clupeiformes: Clupeidae) is described on the basis of 10 specimens collected from Mauritius. The new species is most similar to Sardinella dayi Regan 1917 in having non-deciduous scales with pores and discontinuous striae, a dark spot on the dorsal-fin origin, the pelvic fin with 8 rays, and similar number of gill rakers, in addition to very similar numbers of keeled scutes. However, the new species is distinguished from S. dayi by having a shorter caudal peduncle [6.2–7.6% SL (mean 7.0%) vs. 8.2–12.0% (9.2%) in S. dayi], larger eye [8.4–9.9% (9.0%) vs. 6.8–8.0% (7.4%)] and orbit [9.6–12.3% (10.7%) vs. 8.5–10.2% (9.3%)], longer pectoral [21.0–22.7% (21.5%) vs. 17.0–21.0% (19.8%)] and pelvic fins [12.5–13.5% (12.8%) vs. 10.4–12.2% (11.2%)], and a greater numbers of pseudobranchial filaments [17–19 (modally 17) vs. 18–22 (19)], lateral scale rows in longitudinal series [41–43 (41) vs. 38–42 (40)] and transverse scales [11 or 12 (12) vs. 11]. There were significant differences in seven meristic and 14 morphometric characters between the two species.

Abstract Context.—False-positive cultures for Mycobacterium tuberculosis have been found in nearly all DNA fingerprinting studies, but the effectiveness of interventions to reduce cross-contamination has not been evaluated. Objective.—To evaluate whether changes in laboratory policies and procedures reduced the rate of false-positive cultures. Design.—Retrospective study of isolates with matching DNA fingerprints. Setting.—A mycobacteriology laboratory serving an urban tuberculosis control program and public hospital system. Patients.—All M tuberculosis isolates processed from July 1994 to December 1999. Methods.—Isolates were fingerprinted using IS6110; pTBN12 was used to fingerprint isolates having fewer than 6 copies of IS6110. We further evaluated all patients having only one positive culture whose DNA fingerprint matched that of another isolate processed in the laboratory within 42 days. Interventions.—We changed laboratory policy to reduce the number of smear-positive specimens processed and changed laboratory procedures to minimize the risk of cross-contamination during batch processing. Main Outcome Measure.—The rate of false-positive cultures. Results.—Of 13 940 specimens processed during the study period, 630 (4.5%) from 184 patients and 48 laboratory proficiency specimens grew M tuberculosis. There were no cases (0/184) of probable or definite cross-contamination, compared with the 4% rate (8/199) identified in our previous study (P = .008). We also fingerprinted a convenience sample of isolates from other laboratories in Denver; 13.6% (3/22) of these were false-positive, a rate similar to the 11.9% rate (5/42) identified for other laboratories in our previous study (P = .84). Conclusions.—Laboratory cross-contamination decreased significantly after relatively simple, inexpensive changes in laboratory policies and practices. Cross-contamination continued to occur in other laboratories in Denver.

AbstractThe 590±2 Ma Ben Vuirich Granite was intruded into late Proterozoic Dalradian rocks prior to the Grampian orogeny, during which it was affected by upper amphibolite facies regional metamorphism. Spotted cordierite and andalusite (chiastolite) hornfelses at the granite margin were altered to kyanite-and garnet-bearing assemblages during regional metamorphism. From the inferred mineralogy of the hornfels, together with the normative Qz–Ab–Or values of the granite and the application of a simple cooling model, we conclude that the country rocks immediately adjacent to the granite were hornfelsed at T = ∼600°C and P ≤ 2 kbar.The hornfelsed rocks were subsequently metamorphosed during the regional D2 event to form an equilibrium mineral assemblage of muscovite + biotite + garnet + plagioclase + quartz + kyanite (after chiastolite). Garnet which grew during this event shows unusual reversed chemical zoning, with Ca increasing systematically from core to rim as Fe, Mg and Mn decrease. A study of element partitioning between coexisting phases in equilibrium (including zoned garnets), and use of an internally consistent thermodynamic dataset, suggest that isothermal (T = 577±42°C) compression (from P = 6.2±1.6 kbar to 9.0±1.9 kbar) occurred during crustal thickening. K-feldspar-plagioclase-quartz veinlets found in the hornfels close the granite contact are demonstrated to be of igneous origin.

The purpose of this research is : (1) to know the literature obsolescence cited on the 2008 theses Forest Management Department, Faculty of Forestry UGM (2) to know the growth of literature based on the type and language of collection which were mostly cited by students of the Forest Management Department, Faculty of Forestry UGM in writing theses during 2008, (3) to know the availability of a collection cited by students of the Forest Management Department, Faculty of Forestry Gadjah Mada University in writing theses in 2008, this study is a descriptive research, with research subjects is the theses of Forest Management, Faculty of Forestry Gadjah Mada University in 2008 which amounted to 67 theses and research objects is all the literature included in the cited bibliography on Forest Management theses, Faculty of Forestry Gadjah Mada University in 2008 which amounted to 1498. Method of data collection uses documentation. Data analysis uses citation analysis. The results show that: (1) the literature obsolescence of the theses aged 8 years or ;ess is up to date and aged more than 8 years is out of date (2) the growth of literature on this research shows 8 years, this means that the growth of Forest Management literature is quickly enough when compared with other sciences, while the growth of the literature based on literature and language of the literature indicates that the book is a kind of literature the most widely cited with citation 950 (63, 42%), the language of literature the most widely cited is the Indonesian-language literature with the 1328 citation (88.65%), (3) overall citation data in this study found 865 citation or 57.74% cited in the literature on theses writing is available at the library and as many as 633 or 42.26% citation is cited literature is not available in the library.

Background There is a high risk of Plasmodium vivax parasitaemia following treatment of falciparum malaria. Our study aimed to quantify this risk and the associated determinants using an individual patient data meta-analysis in order to identify populations in which a policy of universal radical cure, combining artemisinin-based combination therapy (ACT) with a hypnozoitocidal antimalarial drug, would be beneficial. Methods and findings A systematic review of Medline, Embase, Web of Science, and the Cochrane Database of Systematic Reviews identified efficacy studies of uncomplicated falciparum malaria treated with ACT that were undertaken in regions coendemic for P. vivax between 1 January 1960 and 5 January 2018. Data from eligible studies were pooled using standardised methodology. The risk of P. vivax parasitaemia at days 42 and 63 and associated risk factors were investigated by multivariable Cox regression analyses. Study quality was assessed using a tool developed by the Joanna Briggs Institute. The study was registered in the International Prospective Register of Systematic Reviews (PROSPERO: CRD42018097400). In total, 42 studies enrolling 15,341 patients were included in the analysis, including 30 randomised controlled trials and 12 cohort studies. Overall, 14,146 (92.2%) patients had P. falciparum monoinfection and 1,195 (7.8%) mixed infection with P. falciparum and P. vivax. The median age was 17.0 years (interquartile range [IQR] = 9.0–29.0 years; range = 0–80 years), with 1,584 (10.3%) patients younger than 5 years. 2,711 (17.7%) patients were treated with artemether-lumefantrine (AL, 13 studies), 651 (4.2%) with artesunate-amodiaquine (AA, 6 studies), 7,340 (47.8%) with artesunate-mefloquine (AM, 25 studies), and 4,639 (30.2%) with dihydroartemisinin-piperaquine (DP, 16 studies). 14,537 patients (94.8%) were enrolled from the Asia-Pacific region, 684 (4.5%) from the Americas, and 120 (0.8%) from Africa. At day 42, the cumulative risk of vivax parasitaemia following treatment of P. falciparum was 31.1% (95% CI 28.9–33.4) after AL, 14.1% (95% CI 10.8–18.3) after AA, 7.4% (95% CI 6.7–8.1) after AM, and 4.5% (95% CI 3.9–5.3) after DP. By day 63, the risks had risen to 39.9% (95% CI 36.6–43.3), 42.4% (95% CI 34.7–51.2), 22.8% (95% CI 21.2–24.4), and 12.8% (95% CI 11.4–14.5), respectively. In multivariable analyses, the highest rate of P. vivax parasitaemia over 42 days of follow-up was in patients residing in areas of short relapse periodicity (adjusted hazard ratio [AHR] = 6.2, 95% CI 2.0–19.5; p = 0.002); patients treated with AL (AHR = 6.2, 95% CI 4.6–8.5; p < 0.001), AA (AHR = 2.3, 95% CI 1.4–3.7; p = 0.001), or AM (AHR = 1.4, 95% CI 1.0–1.9; p = 0.028) compared with DP; and patients who did not clear their initial parasitaemia within 2 days (AHR = 1.8, 95% CI 1.4–2.3; p < 0.001). The analysis was limited by heterogeneity between study populations and lack of data from very low transmission settings. Study quality was high. Conclusions In this meta-analysis, we found a high risk of P. vivax parasitaemia after treatment of P. falciparum malaria that varied significantly between studies. These P. vivax infections are likely attributable to relapses that could be prevented with radical cure including a hypnozoitocidal agent; however, the benefits of such a novel strategy will vary considerably between geographical areas.

This paper presents pulsed-field ionization, zero electron kinetic energy (ZEKE) photoelectron and threshold photoionization spectra of M-X(CH3)3 (M = Ga, In; X = P, As). The ZEKE spectra exhibit well-resolved vibrational structures. A comparison with B3LYP calculations shows that the spectrum of In-P(CH3)3 arises from the 1A1 ← 2E transition and the spectra of Ga-P(CH3)3 and Ga-As(CH3)3 arise from transitions of a Jahn–Teller distorted doublet state to the 1A1 state. The intensities of the 1A1–2E transition in the indium species are described with the Franck–Condon approximation, while the transitions in the gallium complexes are more complicated due to the dynamic Jahn–Teller effect. The adiabatic ionization potentials of Ga-P(CH3)3, In-P(CH3)3, and Ga-As(CH3)3 are 39 635, 38 930, and 40 322 cm–1, respectively, and the ionization threshold of In-As(CH3)3 is ~39 550 cm–1. The metal–ligand stretching frequencies are 143, 116, and 125 cm–1 for Ga+-P, In+-P, and Ga+-As, respectively, and 96 cm–1 for In-P. The intermolecular bending frequencies are 71, 65, and 42 cm–1 for Ga+-P-C, In+-P-C, and Ga+-As-C, respectively, and 47 cm–1 for In-P-C. In addition, ligand-based vibrational frequencies are determined for the CH3 wag, PC3 and AsC3 umbrella, and P-C stretching vibrations. Key words: ZEKE photoelectron, photoionization, DFT, gallium–phosphine, gallium–arsine, indium–phosphine, indium–arsine.

BackgroundFalls can lead to severe health loss including death. Past research has shown that falls are an important cause of death and disability worldwide. The Global Burden of Disease Study 2017 (GBD 2017) provides a comprehensive assessment of morbidity and mortality from falls.MethodsEstimates for mortality, years of life lost (YLLs), incidence, prevalence, years lived with disability (YLDs) and disability-adjusted life years (DALYs) were produced for 195 countries and territories from 1990 to 2017 for all ages using the GBD 2017 framework. Distributions of the bodily injury (eg, hip fracture) were estimated using hospital records.ResultsGlobally, the age-standardised incidence of falls was 2238 (1990–2532) per 100 000 in 2017, representing a decline of 3.7% (7.4 to 0.3) from 1990 to 2017. Age-standardised prevalence was 5186 (4622–5849) per 100 000 in 2017, representing a decline of 6.5% (7.6 to 5.4) from 1990 to 2017. Age-standardised mortality rate was 9.2 (8.5–9.8) per 100 000 which equated to 695 771 (644 927–741 720) deaths in 2017. Globally, falls resulted in 16 688 088 (15 101 897–17 636 830) YLLs, 19 252 699 (13 725 429–26 140 433) YLDs and 35 940 787 (30 185 695–42 903 289) DALYs across all ages. The most common injury sustained by fall victims is fracture of patella, tibia or fibula, or ankle. Globally, age-specific YLD rates increased with age.ConclusionsThis study shows that the burden of falls is substantial. Investing in further research, fall prevention strategies and access to care is critical.

Background:Chronic non-bacterial osteomyelitis (CNO) is an immune-mediated disease associated with cytokine dysbalance.Objectives:The aim of our study was to evaluate the cytokines levels in CNO and compare to juvenile idiopathic arthritis (JIA) – disease with immune-mediated mechanism.Methods:The diagnosis of CNO made with criteria, proposed by Jansson (2007, 2009), after the exclusion of other causes of bone disease [1]. We included 42 patients with NBO, 28 patients with non-systemic juvenile idiopathic arthritis (JIA). We evaluated plasma levels of 14-3-3 protein, S100A8/S100A9-protein, interleukine-6 (IL-6), interleukine-18 (IL-18), interleukine-4 (IL-4), interleukine-17 (IL-17), interleukine-1β (IL-1 β) and tumor necrosis factor-α (TNFα) in 2 groups by the ELISA. Statistical analysis was carried out with Statistica 10.0 software. We utilized descriptive statistics (Me; IQR), Mann-Whitney tests.Results:We have found differences in the proinflammatory biomarkers between CNO, JIA. Patients with NBO had lower levels of studied cytokines, exclude14-3-3-protein, S100A8/S100A9 and interleukin-6 compare to JIA patients (table 1).Table 1.Comparison the cytokine levels between CNO, JIA NParameterNBO (n=42)JIA (n=28)pHemoglobin, g/l112 (104; 124)120 (114.5; 126.0)0.02WBC x 109/l7.9 (7.0; 10.5)8.0 (6.7; 10.0)0.86PLT x 109/l347 (259; 408)336.5 (274.0; 390.5)0.98ESR. mm/h25.0 (9.0; 46.0)8.5 (2.5; 13.0)0.013CRP, mg/l6.1 (0.6; 2.4)1.8 (0.4; 11.9)0.02714-3-3, ng/ml21.4 (18.5; 27.1)19.9 (18.0; 27.8)0.77S100A8/S100A9, ng/ml5.9 (5.2; 6.5)5.9 (5.0; 6.2)0.76IL-6, ng/ml126,2 (112.8; 137.5)132.4 (117.4; 142.9)0.16IL-18, ng/ml270.1 (200.1; 316.1)388.3 (373.9; 405.1)0.0000001IL-4, ng/ml15.3 (11.5; 18.2)18.7 (16.2; 20.2)0.003IL-17, ng/ml83.1 (71.1; 97.3)99.2 (87.3; 115.8)0.003IL-1b, ng/ml47.4 (42.0; 51.3)70.8 (65.3; 73.6)0.0000001TNFa, ng/ml19.4 (17.8; 21.3)23.1 (20.2; 25.9)0.0006Conclusion:Patients with CNO had less proinflammatory activity then JIA patients, besides IL-6 and S100A8/S100A9. Further investigations required for finding new more precise biomarkers and finding possible molecular targets for treatment.This work supported by the Russian Foundation for Basic Research (grant № 18-515-57001)References:[1]Jansson AF, et al. Clinical score for nonbacterial osteitis in children and adults. Arthritis Rheum. 2009;60(4):1152-9.Disclosure of Interests:None declared

High productivity breed cows are delivered to the Republic recently for intensive development of livestock. Subsidies are allocated to farmers, modern type livestock complexes are constructed by state. But, although all conducted works, there are several diseases which prevent the development of livestock. The leading one of such diseases are diseases occurred after delivery among breed cows. Along with various factors, special attention involves the age of animals and number of lactation in occurrence of such diseases. Metritis was observed in 361cows from 4826 cows between 3-8 ages and older, as well as passing lactation for 6 and more times (7.5%), mastitis in 278 of 4826 cows (5.8%), latency delay in 106 of 4826 cows (2.2%), and birth paresis in 42 of 4826 cows (0.9%) in Guba – Khachmaz natural – economic geographic region. In the Guba-Khachmaz region, among the three-year-old cows during the first lactation, infections with metritis amounted to 4.7%, mastitis – 3.1%, detention of the sequence – 0.7%, birth paresis - 0.3%; Among four-year-old cows during the second lactation, infections by metritis amounted to 5.1%, mastitis – 3.5%, detaining the sequence – 1.6%, generic paresis - 0.4%; among five-year-old cows during the third period of lactation: 6.3% metritis, 5.8% mastitis, 2.3% post-mortem, generic paresis – 0.5%; among six-year-old cows during the fourth lactation: 8.2% metritis, 6.2% mastitis, 2.6% post-sedentation, 0.7% birth paresis; Among the seven-year-old cows during the fifth lactation: metritis 9.0%, mastitis 7.2%, post-traumatic delay 2.7%, birth paresis 1.5%; among cows at the age of 8 years and older who have undergone 6 or more lactations: metritis 10.7%, mastitis 8.9%, postural detention 3.4%, generic paresis 1.7%. The results of the study show that with increasing age of cows and the number of lactations, their sensitivity to postpartum diseases increases.

ObjectiveTo determine whether cortical hyperexcitability was more prominent in cognitively impaired patients with amyotrophic lateral sclerosis (ALS).MethodsThreshold tracking transcranial magnetic stimulation (TMS) was used to assess cortical excitability and cognitive function was determined by the Edinburgh Cognitive and Behavioural ALS Screen (ECAS). Cognitive impairment was defined by ECAS < 105. Patients with ALS, defined by the Awaji criteria, were prospectively recruited. Patients unable to undergo TMS, or in whom TMS indices were compromised by coexistent medical conditions, were excluded. Cortical hyperexcitability was defined by reduced short interval intracortical inhibition (SICI) and increased short interval intracortical facilitation (SICF), index of excitability (IE), and motor evoked potential (MEP) amplitude. Student t test determined differences between groups and multivariable regression modeling was used to assess association among cognitive, clinical, and TMS measures. TMS results were compared with those of 42 controls.ResultsCognitive impairment was evident in 36% of the 40 patients with ALS (23 male, mean age 62.1 years). Cortical hyperexcitability was more prominent in cognitively impaired patients as indicated by an increase in SICF (ECAS≥105 –15.3 ± 1.7%, ECAS<105 –20.6 ± 1.2%; p < 0.01), IE (ECAS ≥105 80.9 ± 7.8, ECAS <105 95.0 ± 4.5; p < 0.01), and MEP amplitude (ECAS≥105 28.7 ± 3.3%, ECAS<105 43.1 ± 5.9%; p < 0.05). SICF was independently associated with the ECAS score (β = 2.410; p < 0.05). Reduced SICI was evident in ALS, being more prominent in patients with reduced executive score (ECASexecutive score>33 6.2 ± 1.3%, ECASexecutive score<33 1.5 ± 2.1%; p < 0.01).ConclusionCortical hyperexcitability was more prominent in cognitively impaired patients with ALS than in controls. Given that ECAS is a valid predictor of TDP-43 pathology, the increase in cortical hyperexcitability may be associated with TDP-43 accumulation.

Abstract Despite the substantial improvements made in the outcomes of paediatric ALL, with ‘cure' rates now in excess of 90%, survival in teenage and young adult (TYA) patients has remained inferior. The reasons for this are likely multifactorial, including tumour biology, toxicity, compliance, access to clinical trials and protocol (adult or paediatric) used. We report the toxicity profiles observed in children, teenagers and young adults treated on the UK intensive, minimal residual disease (MRD) directed ALL protocol, UKALL2003. Of a total of 3126 patients treated, 1520 patients were under 5 years old, 767 were aged 5-9 years, 610 aged 10-15 years and 229 aged 16-24 years, with a median overall follow-up of 4 year and 10 months. The risk of serious adverse events (SAEs) was higher in patients older than 10 years (56% in 10-15 year olds, 53% in 16-24 year olds) compared to those aged 9 or younger (30% in under 5 years and 31% in 5-9 years)(p<0.0001), with no difference in the those aged 16-24 compared to younger teenagers (p=0.5). The incidence (per number of patients in each group) and distribution of toxicities according to age group is summarised in the table.Table 1Age in years<55-910-1516-24AllTotal number of patients1520767610229 NB: 56 pts≥20 years3126Infection n (%)328 (21.6%)130 (17.0%)145 (23.8%)72 (31.4%)675 (21.6%)Asaparaginase n (%)57 (3.8%)57 (7.4%)64 (10.5%)31 (13.5%)209 (6.7%)Methotrexate n (%)100 (6.6%)74 (9.6%)123 (20.2%)33 (14.4%)330 (10.6%)Steroid n (%)54 (3.6%)37 (4.8%)141 (23.1%)52 (22.7%)284 (9.0%)Vincristine n (%)34 (2.2%)11 (1.4%)22 (3.6%)7 (3.0%)74 (2.4%)Other SAEs94 (6.2%)42 (5.5%)90 (14.8%)25 (10.9%)251 (8.0%) The incidence of certain toxicities including viral infection (5.3%), asparaginase hypersensitivity (1.9%) and vincristine neurotoxicity (2.1%) appeared equivalent across all age groups. Avacular necrosis was seen predominantly in adolescents (83% of 147 events in 10-19 year olds) and was rare in those younger than 10 years (n=18) or older than 20 years (n=7). Asparaginase thrombotic events increased in frequency with increasing age (1.5% in under 5 years, 3.3% in 5-9 years, 4.4% in 10-15 years and 8.3% in 16-24 year olds)(p<0.0001). All other toxicities were more frequently observed in over 10 year olds compared to patients aged 9 or younger, with no difference between 16-24 year olds and 10-15 year olds. The impact of age on SAEs associated with intensive ALL chemotherapy varies according to specific toxicities. In general, toxicity is higher in those over 10 years compared to younger patients, with no excess toxicity in those aged 16-24 compared to 10-15 years. However, specific toxicities may increase with increasing age (thrombosis), be restricted to adolescence (AVN) or be unrelated to age (vincristine neurotoxicity, asparaginase hypersensitivity). Disclosures: No relevant conflicts of interest to declare.

Invasive fungal infections (IFIs) remain a major clinical burden due to their morbidity and mortality, particularly in patients with acute leukemias and allogeneic HSCT which represent the main risk factors for proven/probable IFI in hematology. We conducted a study in France which enrolled 677 patients with acute myeloid leukemia (AML) receiving intensive chemotherapy from 34 ALFA centers. This study confirmed the significant lower rate of proven/probable IFI in patients who received antifungal prophylaxis (AFP), and that IFI was associated with an increased early mortality rate. The trial recommended laminar air flow rooms and posaconazole AFP according to the 2009 recommendations of the European Conference on Infections in Leukaemia (ECIL). IFI were graded as proven/probable or possible by local investigators. Two central review processes were performed. All study data were centrally reviewed by hematological expert according to the EORTC classification. In parallel, available CT-scans were reviewed by two independent experts (hematologist and pneumologist). We showed three supplementary important observations: (1) Despite the ECIL recommendations, 30% of patients (203/677) did not receive any AFP, and 91 patients (13%) received another antifungal agent than the one recommended. (2) with regards to the IFI grading (Figure 1), 71 IFI were diagnosed and graded by the investigators. After review by the experts, the grade was maintained for 49/71 IFI [69%, 20 possible and 28 proven/probable IA and 1 proven/probable invasive candidiasis (IC)], while 9 possible IFI (13%) (8 IA and 1 IC) were upgraded as proven/probable, and 13 proven/probable IFI (18%) (13 IA) were downgraded as possible. Twenty-five IFI were not graded by the investigators including 3 cases of IA graded by the experts (2 proven/probable and 1 possible) for whom antifungal prophylaxis was pursued, and 22 cases of other IFI graded only by the experts: 15 IC and 7 invasive mucormycosis (IM) all proven/probable, for whom AFP was modified for a curative therapy. In addition, chest imaging data of 37 patients were centrally reviewed, and 21 (57%) were reclassified. The review of imaging data was 100% consistent with the EORTC-based expert review. The experts graded more proven/probable IFI than the investigators with 9.0% (61/677) versus 6.2% (42/677). (3) Among patients without IFI, the rate of complete hematological remission was higher (513/581, 88.3%) versus those with IFI (77/96, 80.2%) (p=0.04). Among patients with IFI, the rate of posaconazole-based AFP was 45.5% (35/77) for those who achieved CR, vs. 63.2% (12/19) for those who did not achieve CR. In conclusion, we showed in this very high-risk population, ECIL recommendations were followed only in 57% of patients. The frequent "misgrading" of the IFI (33% of IA up or downgraded and 92% of other IFI) has an impact on their appropriate management. Another important message is that haematological failure is associated with more IFI despite the AFP. Disclosures De Botton: Pierre Fabre: Consultancy; AbbVie: Consultancy; Forma: Consultancy, Research Funding; Daiichi: Consultancy; Janssen: Consultancy; Novartis: Consultancy; Agios: Consultancy, Research Funding; Servier: Consultancy; Bayer: Consultancy; Pfizer: Consultancy; Celgene Corporation: Consultancy, Speakers Bureau; Syros: Consultancy; Astellas: Consultancy. Bertoli:Astellas: Consultancy, Honoraria; Jazz Pharmaceuticals: Honoraria; Sanofi: Honoraria; Daiichi Sankyo: Consultancy. Castaigne:Pfizer: Consultancy. Vey:Janssen: Honoraria; Novartis: Consultancy, Honoraria. Dombret:CELGENE: Consultancy, Honoraria; AGIOS: Honoraria; Institut de Recherches Internationales Servier (IRIS): Research Funding. Thomas:DAICHI: Honoraria; ABBVIE: Honoraria; PFIZER: Honoraria; INCYTE: Honoraria.

55 Background: We have previously reported the safety of robotic gastrectomy (RG) for clinical Stage IA or IB gastric cancer in single arm phase II studies. To date, a number of retrospective case control studies comparing RG and laparoscopic gastrectomy (LG) have been performed. However, since randomized controlled trials have never been conducted, no definitive conclusion demonstrating benefits of RG over LG has been demonstrated. In this study, we aimed to evaluate the safety of RG compared to LG using propensity score matching (PSM) methods. Methods: We retrospectively reviewed 766 consecutive patients who underwent either RG (n = 231) or LG (n = 535) for gastric cancer between January 2012 and December 2017. A 1:1 PSM was performed with the matched variables of age, sex, body mass index, performance status, clinical Stage, type of gastrectomy, and extent of lymphadenectomy. We compared short-term outcomes between the patients who underwent RG (RG group) and LG (LG group). Results: After PSM analysis, 231 patients were included in the RG group and 230 in the LG group. Intraoperative blood loss was similar between the groups. Operation time was significantly longer in the RG group (326 min vs. 281 min, P < 0.001). Significantly more lymph nodes were retrieved in the RG group (42 vs. 38.5, P = 0.031). Serum CRP level were significantly lower in the RG group in postoperative day 3 (9.0 mg/dL vs. 9.8 mg/dL, P = 0.049) and 6 (3.1 mg/dL vs. 3.7 mg/dL, P = 0.034), and drain amylase level in postoperative day 3 was also significantly lower in the RG group (612 U/L vs. 856 U/L, P < 0.001). Overall postoperative complication (Clavien–Dindo classification grade IIIA or greater) was similar between the groups (RG: 3.9% vs. LG: 5.6%, P = 0.656). However, pancreatic fistula tended to be less frequent in the RG group than in the LG group (0.4% vs. 2.2%, P = 0.122), although it did not reach statistically significant difference. Conclusions: Although RG takes longer operation time, it appears to be less invasive than LG with the possibility of decreased postoperative complications. To validate the results, randomized controlled trial should be performed.

158 Background: In the United States, prostate cancer (PCa) incidence and death rate differ among racial groups. Non-Hispanic Blacks (NHB) have a higher incidence and death rate than non-Hispanic Whites (NHW), whereas incidence and death rate are slightly lower in Hispanics (H) than in NHW. We sought to compare the socioeconomic, demographic and baseline prognostic factors at PCa diagnosis among different races at a large, urban academic center serving a diverse population. Methods: Following institutional review board approval, the Montefiore Medical Center Cancer Registry was used to generate a comprehensive list of patients diagnosed with PCa 2004 to 2013. Clinical Looking Glass (a searchable database of patient information) and individual patient chart review were used to obtain data including age at diagnosis, socioeconomic score (SES), Gleason score, stage at diagnosis and PSA at diagnosis. Patients were classified by self-identified race as H, NHB or NHW. For categorical variables the chi-square test was used, whereas the ANOVA or the Kruskal-Wallis tests were employed for continuous variables. Results: During the specified period 2352 patients were diagnosed with PCa among which 778 were self-classified as H, 1046 as NHB, 486 as NHW and 42 as other (O). The mean age at diagnosis differed between these groups (H 63.2, NHB 63.4, NHW 67, O 63.0, p < 0.0001). The proportion of men below the mean SES also differed between races (H 92.8%, NHB 91.3%, NHW 56.6%, O 75%, p < 0.0001). Median PSA (ng/ml) at diagnosis was similar (H 8.0, NHB 8.4 NHW 7.2, O 6.4, p = 0.0768) whereas Gleason score differed between racial groups (Gleason ≤ 6: H 42.8%, NHB 39.1%, NHW 52.2%, O 50%; Gleason 8-10: H 15.8%, NHB 17.6%, NHW 14.3%, O 16.7%, p = 0.0005). The proportion of men with metastatic disease at diagnosis also differed significantly in these groups (H 7.5%, NHB 9.0%, NHW 4.3%, O 9.5%, p = 0.0139). Conclusions: At our center, in patients with newly diagnosed PCa, there are significant differences among racial groups. These include age at diagnosis, SES, Gleason score and proportion with metastatic disease. Such differences at diagnosis suggest that minority patients are at risk for inferior PCa outcomes.

Thirty six candidate cotton varieties developed by different breeders of Pakistan were tested consecutively for two years (2017 and 2018) and at seven locations of Sindh and Balochista Provinces in national coordinated varietal trials (NCVT). The trials were conducted to explore seed cotton yield potential and fiber properties against two check varieties (CIM-602 and FH-142/IUB-13). As per claim of the breeders, the samples of all varieties for both the years were sent to four designated biotechnological laboratories for conducting biochemical tests also. The results revealed highly significant differences among the varieties for both the years. During the year 2017, on an average of six location, top ten high yielding varieties recorded were GH-Haadi, Weal-AG-6, VH-189, GH-Mubarak, Weal-AG-5, MNH-1026, Badar-1(DG), FH-444, CIM-343 and TJ-Max(DG) which yielded 3434, 3407, 3342, 3255, 3251, 3248, 3185, 3154, 3134 and 3131 kg/ha seed cotton yield respectively. When the results of 2018 trial were looked at, averagely top ten high yielding varieties were GH-Haadi, ICI-2121, CRIS-613, VH-383, VH-189, NIAB-898, FH-490, Cyto-225, Tahafuz-10(DG) and GS-Ali-7 with 3526, 3356, 3306, 3139, 3101, 3091, 3084, 3074, 3060 and 3026 kg/ha of seed cotton yield respectively. However, on an average of both the years (2017 and 2018), top ten high yielding varieties were GH-Haadi, VH-189, CRIS-613, Weal-AG-6, GH-Mubarak, Badar-1(DG), ICI-2121, Weal-AG-5, FH-940 and MNH-1026 producing 3480, 3221, 3186, 3155, 3113, 3083, 3057, 3054, 3042 and 3042 kg/ha of seed cotton respectively. As regards fiber properties, (04 candidate varieties) could qualified all fiber standards set by government. The biochemical test results received from all four laboratories revealed that on an average of four laboratories and two years, the trait purity range recorded was from 42 to 96 percent, whereas, quantification of Bt toxin ranged from 0.74 to 2.62. From the present study, it was concluded that almost 15-20 candidate varieties have the potential to be included among already approved varieties for commercial cultivation in the province of the Punjab.

Background:The management of a broad spectrum of autoimmune/inflammatory diseases has been transformed with the development of biological treatments. However, little is known about their use in solid organ transplant recipients, a group of patients with high risk of serious infections and malignancies.Objectives:To evaluate complications occurring with biologic treatments in solid-organ transplant recipients.Methods:A systematic review of the literature was performed on the PubMed including Medline, Embase and Cochrane databases, up to 01/10/2020, to identify published case reports/series regarding the use of biologic treatments in solid organ transplant recipients in the context of chronic inflammatory diseases. Collected data were patient’s characteristics (age, sex, reason for transplantation, antirejection regimen, type of biological treatment used, autoimmune/inflammatory disease treated, time between transplantation and biotherapy initiation, treatment duration) and their reported complications (deaths, infections, malignancies, graft dysfunction).Results:55 papers were included, representing 177 patients (131 liver, 42 kidney, 3 heart, and 1 liver-kidney transplant recipients). Inflammatory bowel diseases represented largely the most common indication of biologic treatment initiation (80.2%), followed by rheumatic diseases (7.3%), hereditary periodic fever syndromes (6.2%) and psoriasis (5.1%). Anti-TNFα were mainly used (81.4%) before anti- α4β7 integrin Vedolizumab (23.7%) and anti-IL1R Anakinra (7.3%). 25/177 patients had several lines of different treatments. Median treatment duration was 13.5 months. Infections occurred in 48 patients (27.1%) through 76 recorded flares (mostly bacterial 68.4% and viral 19.7%). No therapeutic or epidemiological factor was associated with the occurrence of an infection. 16 patients (9.0%) developed malignancies, especially colorectal (4 cases, 2.3%) and skin cancers (4 cases, 2.3%) or Post-transplantation lymphoproliferative disorders (3 cases, 1.7%). Acute graft rejections occurred in 5 patients (2.8%), mostly in kidney transplants (4/5). Among a total of 177 patients, 6 deaths were identified (3.4%).Conclusion:This review gathers, to our knowledge, the largest number of published case series/reports about the use of biological treatments in solid organ transplant recipients, providing data about their safety. Caution must be taken about eventual publication bias and the necessity of further head-to-head analysis comparing complications occurring in solid organ transplant recipients cohorts with and without biologic treatments.Disclosure of Interests:None declared

e16008 Background: Camrelizumab, a fully humanized monoclonal antibody against PD-1, has been approved in the treatment of advanced esophageal squamous carcinoma in China. The purpose of this study was to observe the efficacy and safety of Camrelizumab in the treatment of esophageal cancer in the real world. Methods: This is an open-label, prospective, multicenter, observational study. Eligible patients (pts) who received Camrelizumab had esophageal cancer; age≥18, ECOG PS of 0-2; and measurable disease. Results: As of November 30, 2020, a total of 229 patients were enrolled, of which 192 were male (83.8%). The ECOG PS score was 0 in 48 cases (21.0%), 1 in 149 cases (65.0%), and 2 in 32 cases (14.0%). Among the 134 patients of stage IV patients (58.5%), 174 patients had metastases (76.0%), and 99% of patients did not undergo PD-L1 testing. A history of radiotherapy accounted for 57.6%, and a history of surgery on the primary lesion accounted for 42%. Camrelizumab accounted for 26.2% of the first-line treatment, 33.6% of the second-line treatment, and 35.4% of the third-line and above. Camrelizumab combined with chemotherapy accounted for 40%, combined with anti-angiogenesis therapy accounted for 38.0%, combined with anti-angiogenesis + chemotherapy accounted for 9.0%, and combined radiotherapy accounted for 6.2%. Among 145 patients with evaluable efficacy, 5 cases of CR, 14 cases of PR, 97 cases of SD, and 29 cases of PD. The ORR reached 13.1% and the DCR reached 80.0%. The overall adverse event rate was 42.8%, the major adverse event RCCEP rate was 11.7%, pneumonia was 8.3%, and fatigue was 4.1%. Adverse events greater than or equal to grade 3 included 1 case of RCCEP, 3 cases of bleeding, 1 case of diarrhea, and 1 case of fever. Conclusions: In this real-world study of esophageal cancer, most of the patients enrolled were patients with poor PS score and late stage, but the efficacy and safety of Camrelizumab in patients with advanced esophageal cancer were still confirmed. The dominant population and combination therapy are still under study. Clinical trial information: ChiCTR1900027275.

Background:Guidelines on polymyalgia rheumatica (PMR) recommend early introduction of methotrexate (MTX), especially in patients with worse prognosis such as flare or glucocorticoid (GC)-related adverse events (AE).1GC-AE are reported in up to 65% of PMR patients,2and 50% of secondary care patients are unable to discontinue GCs, emphasizing the need for GC-sparing agents.3However, evidence regarding MTX efficacy in PMR remains limited.2Objectives:To assess the efficacy of add-on MTX in preventing subsequent flares and GC- sparing in PMR patients.Methods:In a retrospective cohort of newly diagnosed PMR patients visiting our hospital from April 2008 - January 2018, patients starting methotrexate (index event) were compared to first-time flaring PMR patients in whom MTX was not started (control group). Concomitant inflammatory rheumatic diseases were excluded. Data on patient, disease and treatment characteristics were compared. Main outcomes were difference in number of subsequent flares per year between groups (multivariable Poisson regression) and mean GC-use (total GC-dose/total follow-up; multivariable linear regression). In the MTX group only, also incidence rate ratio of flare before vs. after starting MTX was assessed.Results:Of 454 PMR patients, 262 were selected; 42 receiving MTX and 220 in the control group. Reasons for prescribing MTX were GC ineffectiveness and/or GC-related AE and MTX starting dose was 10, 15 and 25 mg/week in 11 %, 82% and 2% respectively. Adjusted for covariates, mean GC-use was 1.21 higher in the MTX group compared to the control group (p = 0.155). The yearly incidence rate of flares in the MTX group did not differ from the control group: incidence rate ratio (IRR) 0.93, (95% CI 0.53-1.63). The yearly flare rate was 1.19 before and 0.42 after MTX initiation, resulting in an IRR of 0.36 (95% CI 0.24-0.53).Conclusion:MTX is infrequently prescribed in daily clinical practice, despite guideline recommendations. No difference in GC use or flare incidence was seen between MTX treated patients and controls, although within MTX treated patients, flare rates were lower after MTX start. Confounding by indication may explain the lack of difference in the outcomes between groups. The optimal timing and dosage of MTX in PMR remains unclear, justifying a clinical trial.References:[1]Dejaco C.e.al.2015. Recommendations. management.of.polymyalgia.rheumatica:a.European.League.Against Rheumatism/American.College.of.Rheumatology.collaborative.initiative.ARD.2015;74:1799-1807.[2]L.Couvaras.etal.Prevalence.of.long-term.steroid.therapy:French data.AB1141 (2017)[3]González-Gay MA et al. Polymyalgia. rheumatica. Lancet. 2017 Oct 7;390(10103):1700-1712Table 1.Patients characteristics methotrexate versus controlsMTXN = 42ControlsN = 220P-valueDifference (95% CI) Time of PMR diagnosisFemale(%)22(52)127(58)0.611-5.3 (-11.0; 21.7)Age,years*(SD)62(7)67(10)0.002-5.0 (-8.2;- 1.8)Previous history PMR*(%)7(17)13(6)0.02510.8 (2.0; 19.5)PMR symptoms,weeks(IQR)9(6-16)5(5-16)0.639Bilateral shoulderpain(%)42(100)209(95)0.2215.0 (-1.6; 11.6)Morning stiffness>45 minutes(%;n=33 versus 159)32(76)177(80)0.533-4.3 (-17.5; 9.0)Elevated ESR/CRP*, (%;n=41 versus 218)40(96)185(84)0.02312.7 (1.4; 24.0) At index eventPMR duration, weeks*,**(IQR)87(41-116)53(33-80)0.001GC-dose index event39(93)Oral10(5-15)210(95) Mg(IQR)*3(7)5(0-8)0.000Intramuscular(%)120(100-10(5) Mg(IQR)120)100(80-120)0.355Mean GC-dose until index event, mg, (IQR; n=33 versus 170)*7.1 (5.9-9.0)5.7 (3.8-7.4)0.000During follow-upFlares, n(%)21 (50)100 (45)0.6164.5 (-21.0; 11.9)Weeks to first flare (IQR)36 (24-51)39 (22-66)0.517Mean GC-dose, mg (IQR)6.2 (4.6-9.7)4.7 (2.9-6.9)0.004Daily GC-dose year1,mg (IQR; n=32 versus 153)*5 (2.5-7.9)2.5 (0-5)0.03* Significant alpha level < 0.05**Before diagnosis until index eventDisclosure of Interests:None declared

Objectives: Fifty-three percent of children play individual sports and 42% participate in team sports. As youth sports continue to gain popularity, sports specialization is becoming popular among young athletes. The reasons for sport specialization vary, but the most common reason offered is to gain a competitive advantage at a younger age to allow for higher level play in college and potentially at the professional level. However, there is concern that early sports specialization increases the risk of overuse injuries in youth athletes. The purpose of this investigation was to determine the prevalence of sport specialization in youth athletes, and prospectively examine whether specialization correlates with an increased incidence of athletic injury. Methods: We prospectively enrolled 602 high school students with the intent of following them through their four years of high school. Sports specialization was defined as participating in one sport for more than 6 months of the year, while excluding other sports. Freshman and sophomore athletes completed a sports specialization and injury survey at the beginning of each sport season. Athletes’ demographic information, sport commitment, injury history and future athletic plans were collected. The same athletes were queried again at the conclusion of each season to collect injury information including but not limited to fractures, ligamentous injuries, dislocations and concussions. Athletic training records were reviewed and corroborated with covering team physician records to ensure capture of all injuries reported to health care personnel during the years of the investigation. Categorical data was analyzed via chi-squared tests. Results: At the two year time point, of the 602 athletes, 255 (42.4%) reported sport specialization. Soccer (26.9%), baseball (20.6%), softball (18.3%) and swimming (15.6%) had the highest rates of specialization among participants. Ninety-five (37.3%) specialized athletes reported spending more than 10 hours a week participating in sports related activities, compared to 105 (30.3%) non-specialized athletes, p= 0.072. Of the specialized athletes, 56.5% had been injured playing their primary sport in the past, compared to 43.5% of non-specialized athletes, p= 0.046. Seventy-eight percent of the specialized athletes sustained an injury before the study period that prevented them from participating in sports for part or the whole season, whereas only 40% of the non-specialized athletes sustained these types of injuries, p= 0.055. Finally, during the study period, 9.0% of specialized athletes sustained injuries compared to 5.2% of non-specialized athletes, p= 0.065. The most common injuries were concussions (43.9% of injuries) and lateral ankle sprains (12.2% of injuries). Conclusion: A considerable number of high school athletes specialize in one sport during their underclass years (42.4%). Specialized student athletes spend more time participating in sports related activities than non-specialized athletes, which may account for the increased frequency of injuries, compared to non-specialized athletes. Although not statistically significant at the 2 year time point, this relationship warrants further investigation into the potential health effects of early sports specialization.

Abstract Background: The relative benefit-to-risk ratio of various LMWH in the setting of colorectal cancer surgery has never been directly compared. Objective: We performed a multicenter, randomized, double-blind study to compare the efficacy and safety of enoxaparin 40 mg (4000 anti-Xa IU) and nadroparin 0.3 mL (2850 anti-Xa IU) in the prevention of venous thromboembolism (VTE) after colorectal cancer surgery. Methods: Patients undergoing elective colorectal adenocarcinoma resection under general anesthesia were recruited. They were randomized to receive once daily either nadroparin 0.3 mL or enoxaparin 40 mg subcutaneously for 9±2 days, starting 2 to 4 hours preoperatively. The primary efficacy outcome was the composite of deep-vein thrombosis (DVT) detected by bilateral venography or documented symptomatic DVT or pulmonary embolism (PE) up to Day 12. The main safety outcomes were major bleeding and all-cause death. A blinded independent committee adjudicated all outcomes. Results: A total of 1288 patients (median age: 69, range: 26–97 years; men: 61.4%) were randomized either to nadroparin (n=653) or to enoxaparin (n=635). Efficacy was evaluable in 950 (73.8%) patients who underwent contrast venography or had a symptomatic thromboembolic event. The rate of VTE at Day 12 was 15.9% for nadroparin and 12.6% for enoxaparin (relative risk reduction 21.3% [95% CI: −7.75; 42.5]). This difference was not statistically significant (p=0.13, Chi-squared test). In contrast, there were more symptomatic VTE, including symptomatic PE, in the enoxaparin group than in the nadroparin group (Table). Furthermore, the rate of major bleeding was significantly lower in nadroparin-treated patients than in enoxaparin-treated patients (Table). By Day 12, there were three (0.5%) deaths related to VTE or major bleeding in enoxaparin patients compared with none in nadroparin patients. By Day 60, 23 (3.5%) patients receiving nadroparin and 23 (3.5%) patients receiving enoxaparin had died. Conclusion: Enoxaparin 40 mg was not more effective than nadroparin 0.3 mL in the prevention of total VTE in patients undergoing colorectal cancer surgery. The non-significant difference between the two groups was mainly due to a lower rate of asymptomatic distal DVT in the enoxaparin group than in the nadroparin group. However, nadroparin was more effective than enoxaparin for reducing symptomatic VTE, including PE, and was associated with significantly less major bleeding. Efficacy and safety results at Day 12 Nadroparin 0.3 mL, n/N (%) Enoxaparin 40 mg, n/N (%) p *Chi-squared test Total VTE 74/464 (15.9) 61/486 (12.7) 0.13* Asymptomatic proximal DVT 15/503 (3.0) 14/515 (2.7) 0.81 Asymptomatic distal DVT 58/503 (11.5) 42/515 (8.2) 0.07 Symptomatic VTE 1/643 (0.2) 9/628 (1.4) 0.01 Symptomatic proximal DVT 1/643 (0.2) 4/628 (0.6) 0.22 Symptomatic PE 0/643 (0.0) 5/628 (0.8) 0.03 Major bleeding 47/643 (7.3) 72/628 (11.5) 0.01 All-cause death 2/643 (0.3) 8/628 (1.3) 0.06

Background:Nailfold videocapillaroscopy (NVC) is a feasible method that allows the observation and follow-up of the microvascular changes that mark the course of Systemic Sclerosis (SSc). In previous studies, we demonstrated that the NEMO score, namely the cumulative Number of microhaEMOrrhages and microthromboses, is a good indicator of the steady state level and over time changes of disease activity (DA) in SSc (1-3).Objectives:To verify whether a high NEMO score, and then a high level of active microvascular derangement in the fingers may be predictive of the subsequent development of ischemic digital ulcers (IDUs).Methods:The NEMO score was assessed at baseline (T0) in 98 patients affected by SSc, according to the ACR-EULAR criteria. Out of them, 90 were females, 48 had the limited form and 50 the diffuse cutaneous variant of SSc. ACA and anti-Scl-70 antibodies were positive in 42 and 50 patients, respectively. The NVC pattern was early, active and late in 16, 42 and 40 patients, respectively.Afterwards, patients were closely followed up for 3 years, and the appearance of new IDUs was recorded in any time of the follow up.The T0-NEMO score values of patients who developed IDUs were compared to those of patients who did not. A receiver operating curve (ROC) was constructed, and the area under the curve (AUC) calculated, by plotting the sensitivity and 1-specificity of the different NEMO score values in predicting the development of IDUs.Results:During the follow up, 38 out of 98 patients developed one or more DUs. The NEMO score at T0 was significantly higher in those who developed IDUs with respect to those who did not [median 14.5 (CI 11.0-21.5), and 4.5 (CI 4.0-6.0), respectively, p<.0001]. The AUC was 0.79 (CI 0.69-0.86, p<0.0001). A NEMO score of 12 or more had a sensitivity of 83.3 (CI 71.5-91.7), and a specificity of 63.2 (CI 46.0-78.2), with positive (P) and negative (N) predictive values (PV) of 59.1 (CI 44.9-72.3), and 85.6 (CI 71.7-94.3), respectively. A NEMO score of 16 or more had a sensitivity of 95.0 (CI 86.1-99.0), and a NPV of 93.3 (CI 77.4-99.2).Conclusion:NEMO score is not only a valid tool to assess the level of DA in the course of SSc, but this NVC parameter could also be used as a good predictor of the future development of IDUs in patients with this disease.References:[1]Sambataro et al. Arthritis Res Ther 2014;16:462-69[2]Andracco et al. Arthritis Res Ther 2017;19:133-41[3]Pignataro et al. Arthritis Res Ther. 2019;21(1):258Disclosure of Interests:Nicoletta Del Papa: None declared, Francesca Pignataro: None declared, Wanda Maglione: None declared, Antonina Minniti: None declared, Domenico Sambataro: None declared, Gianluca Sambataro: None declared, Gabriele Valentini Grant/research support from: BMS, MSD, NOVARTIS, LILLY, PFIZER, ABBVIE, CELGENE, Claudio Vitali: None declared, Roberto Caporali Consultant of: AbbVie; Gilead Sciences, Inc.; Lilly; Merck Sharp & Dohme; Celgene; Bristol-Myers Squibb; Pfizer; UCB, Speakers bureau: Abbvie; Bristol-Myers Squibb; Celgene; Lilly; Gilead Sciences, Inc; MSD; Pfizer; Roche; UCB

5 Background: To evaluate long-term quality of life (QOL) in 630 patients with high-risk prostate cancer (HRPC) treated in a prospective randomized phase III trial (PCS IV clinical trials, Gov. # NCT 00223171). Methods: Patients were randomized to radiotherapy (RT) plus 36 or 18 months of androgen deprivation therapy (ADT). QOL was assessed by two validated tools: EORTC30 (30 items) and PR25 (25 items). The 55 items were regrouped into 21 scales: 15 for EORTC30 and six for PR25. All items and scales scores were linearly transformed to a 0 to 100 points scale. A p value less than 0.01 was considered statistically significant and a difference between groups in mean scores of greater than or equal to 10 points as clinically relevant. Patient-reported outcomes were filled out before treatments, every six months during ADT, four months after and then once a year for five years. All items and scales scores were analysed with general linear model with repeated measures to evaluate changes between groups and over time periods. Results: Three hundred ten patients were randomized to 36 months and 320 to 18 months of ADT, with a median follow-up of 79 months, there was no difference in survival outcomes. The global adherence to QOL questionnaires was 72.4% (10,052 out of 13,880). When comparing the two groups, 6 out of 21 scales (physical, emotional, and social functioning, fatigue, hormonal treatment-related symptoms, and sexual active) and 14 out of 55 items (trouble with long walks, stay in bed during the day, weakness, tenseness, worry, irritable, depressed, close to a toilet, blood in stools, hot flushes, enlarged breasts, interested in sex, sexually active, enjoyable sex) were statistically significant (p< 0.01) in favor of the 18 months ADT group. None of the 21 scales reached clinical relevance (mean scores greater than or equal to 10 points) sexual active being the highest score with 9.0 points of difference. For the 14 statistically significant items, interest in sex with 9.9 points and sexually active with 8.1 points were close to clinical relevance and hot flushes with 24 points and enjoyable sex with 18 points had important clinical relevance at 42 months. Conclusions: In HRPC treated with RT and ADT, reducing the duration of ADT from 36 to 18 months improves QOL, without a negative impact on survival. Source of Funding: AstraZeneca Pharmaceuticals grant. Clinical trial information: PCS IV clinical trials, Gov. # NCT 00223171.

Background:Many treatments have been tried in therapy systemic sclerosis (SSc) patients but use of hyperbaric oxygen therapy (HBOT) is very limited.Objectives:To assess the effects of HBOT to quality of life and state of microcirculation in SSc patients.Methods:18 female patients aged 29-68 years (mean 57 years) with limited SSc and digital or leg ulcers were included in this work. The HBOT protocol comprised 20 sessions 5 day/weekly, 60 min, 100% oxygen at 2.2 ATA. The treated patients were evaluated at baseline and after 20 HBOT sessions. Evaluation consisted of physical examination, capillaroscopy, pulmonary function tests, biochemical analyses, socio-demographic and clinimetric questionnaires: Systemic Sclerosis Questionnaire (SySQ) and Health Assessment Disaability index Questionnaire (HAQ-DI).Results:Mean value [before: after, mean (range)] for SySQ [15.5 (4-48) vs 9.0 (3-31)], HAQ-DI [0.60 (0-2.88) vs 0.35 (0 -1.75)], erythrocyte sedimentation rate [21 (4-42) vs 12 (3-27)], forced vital capacity (96.61±14.44% vs 115.94±16.69%), diffusing lung capacity of carbon monoxide (73.61±6.63% vs 87.33±9.30%) significantly improved after HBOT sessions (p<0.001). There was no significant changes in the total number of capillaries (325 vs 338, p=0.235), mean number of enlarged capillaries (21 vs 27, p=0.182), giant capillaries (14 vs 14, p=0.235) and ramified/bushy capillaries (14 vs 13, p=0.178) before and after HOBT. All patients had digital ulcers, and 5 patients had bilateral lesions (digital and leg ulcers). Mean size of ulceration before HBOT was 12x11mm, and after therapy was 4x4mm (p<0.001). Three patients had digital gangrene. Amputation was not require for any.Conclusion:Our data confirm the efficacy of HBOT in treating SSc patients. Further studies are required to evaluate the protocol and to understand the durattion of the clinical effect.References:[1]Mirasoglu B, Bagli BS, Aktas S. Hyperbaric oxygen therapy for chronic ulcers in systemic sclerosis - case series. Int J Dermatol. 2017;56(6):636-640.[2]Gerodimos C, Stefanidou S, Kotsiou M, et al. Hyperbaric oxygen treatment of intractable ulcers in a systemic sclerosis patient.Aristotle Un Med J. 2013;(40)3:19-22.[3]Wallace DJ, Silverman S, Goldstein J, Hughes D. Use of hyperbaric oxygen in rheumatic diseases: case report and critical analysis. Lupus. 1995;4(3):172-5.Disclosure of Interests:Slavica Pavlov-Dolijanovic: None declared, Vesna Koletic: None declared, Nada Vujasinovic Stupar: None declared, Nemanja Damjanov Grant/research support from: from AbbVie, Pfizer, and Roche, Consultant of: AbbVie, Gedeon Richter, Merck, Novartis, Pfizer, and Roche, Speakers bureau: AbbVie, Gedeon Richter, Merck, Novartis, Pfizer, and Roche

Abstract Abstract 589 Background: The initial results of this intergroup trial with median follow-up of 3.5 years (yrs) were previously reported (J Clin Oncol 24:3121, 2006). We present updated results with median follow-up of 9.4 yrs from induction therapy randomization, and 9.0 yrs from maintenance randomization. Methods: 632 patients (pts), age >60 yrs, with DLBCL were randomized to CHOP+rituximab 375 mg/m2 IV, administered Day -7, -3, and two days before cycles 3/5/7 (if given) (R-CHOP), versus CHOP, for two cycles beyond best response for 6–8 cycles total. Pts were stratified by the International Prognostic Index (IPI) (<3 vs >3). 415 pts responding to R-CHOP or CHOP were then randomized to maintenance rituximab 375 mg/m2 weekly times 4, every 6 months for 2 yrs starting 4 weeks after the last chemotherapy (MR, n=207), or observation (OBS, n=208). Results are presented for the 546 (267 R-CHOP; 279 CHOP) pts for induction, and 352 (174 MR; 178 observation) evaluable, centrally reviewed, maintenance pts. Failure-free survival (FFS) was the primary endpoint. The stratified weighted Cox regression was used to remove the effect of MR in comparing induction treatment, and stratified log-rank test used to assess maintenance effect. Results: Baseline characteristics and response to induction were balanced. 9-yr FFS and OS) are 35% and 44% for R-CHOP, and 25% and 37% for CHOP. Compared with CHOP, R-CHOP significantly prolonged FFS (p=.008), but not OS (p=.11). Pts were categorized into low-risk (LR) and high-risk (HR) groups according to their IPI (<3 or 33) (LR, n=217; HR, n=327). A significant difference in the effect of induction therapy was observed for high-risk patients only for FFS (p=0.02, HR=0.61, 95% CI, 0.51 to 0.93) but not for OS. MR significantly prolonged FFS (log-rank p=0.018, HR=0.71, 95%CI, 0.54 to 0.94), but not OS (p=0.44, HR=0.89, 95%CI, 0.65 to 1.20). A significant interaction between maintenance and induction therapies was observed in that MR significantly prolonged FFS after CHOP (p=0.003, HR=0.56, 95%CI, 0.38 to 0.82), but not after R-CHOP (p=0.89, HR=0.97, 95% CI, 0.64 to 1.47). There was no OS difference with MR after CHOP (p=0.19, HR=0.76, 95% CI. 0.50 to 1.15) or R-CHOP (p=0.77, HR=1.07, 95% CI, 0.68 to 1.68). Median time to failure after maintenance randomization following CHOP+MR was 9.5 yrs vs 2.0 yrs for CHOP+OBS (p=0.003) and following R-CHOP+MR was 8.5 yrs vs 7.5 yrs for R-CHOP+OBS (p=NS). Proportionately more treatment failures occurred within 2 yrs after CHOP+OBS (73%) compared to CHOP+MR (47%), p=0.01. In contrast, the proportion of failures within 2 yrs was similar for R-CHOP+OBS (38%) and R-CHOP+MR (36%), p=NS. Conclusions: Initial R-CHOP therapy, as compared with CHOP, resulted in improved DFS and FFS for older DLBCL pts. MR after CHOP, but not after R-CHOP, significantly prolonged time to failure but did not prolong OS. However, FFS was 42% at 9 yrs among R-CHOP responders, with or without MR. Future treatment strategies should build upon these findings in this older patient population, often with significant co-morbidities. Disclosures: Morrison: merck: Consultancy, Membership on an entity's Board of Directors or advisory committees; celgene: Consultancy, Speakers Bureau; amgen: Consultancy, Speakers Bureau; genentech: Speakers Bureau; pfizer: Speakers Bureau. Fisher:roche: Consultancy. Horning:Genentech: Employment.

Aims/Objectives/BackgroundGlobally, injuries cause more than 5 million deaths annually. Children and young people are a particularly vulnerable group and injuries are the leading cause of death in people aged 5–24 years globally and a leading cause of disability.In most low and middle-income countries where the majority of global child injury burden occurs, systems for routinely collecting injury data are limited. There is a continuing need for better data on childhood injuries and for injury surveillance.The aim of our study was to introduce a hospital-based injury surveillance tool – the first of its kind in Nepal and explore its feasibility. We undertook prospective collection of data on all injuries/trauma presenting to 2 hospital emergency departments to describe the epidemiology of paediatric hospital injury presentations and associated risk factors.Methods/DesignA new injury surveillance system for use in emergency departments in Nepal was designed and used to collect data on patients presenting with injuries. Data were collected prospectively in two hospitals 24 h a day over 12 months (April 2019 - March 2020) by trained data collectors using tablet computers.Abstract 432 Table 1Socio-demographic profile and characteristics of injury among children attending emergency of hospitals in Makwanpur district, Nepal, April 2019 – March 2020 (N=2696)CharacteristicsFrequencyGender Male 1778 Female 918 Age groups 0–4 years 653 5–9 years 866 10–14 years 680 15–17 years 497 Median year (IRQ) 8 (5 – 13) Ethnicity/caste Janajati 1384 Brahmin/Chhetri 892 Dalit 148 Madhesi 146 Muslim 74 Others 50 Unknown 2 Place where injury occurred Home/Compound 1576 Highway/road/street 636 School 233 Recreational area 138 Workplace 76 Other 37 Activities at the time injury occurred Leisure/Play 1889 Travelling (other than to/from school/work) 296 Work 202 Travelling (to/from school/work) 184 Education 42 Organised sports 11 Other 52 Unknown 20 Intent of injury Unintentional 2560 Intentional (self-harm) 61 Intentional (assault) 75 Unintentional (n=2560) Fall 912 Animal or insect related 728 Road traffic injury 356 Injured by a blunt force 201 Stabbed, cut or pierced 176 Fire, burn or scald 65 Poisoning 52 Suffocation/choking 36 Electrocution 12 Drowning and submersion 7 Other 13 Unknown 2 Self-harm (n=61) Poisoning 38 Hanging, strangulation, suffocation 12 Stabbed, cut or pierced 6 Injured by blunt object 4 Other 1 Assault (n=75) Bodily force (physical violence) 43 Injured by blunt object 18 Stabbed, cut or pierced 8 Pushing from a high place 2 Poisoning 2 Sexual assault 1 Other 1 Nature of injury (one most severe) Cuts, bites or open wound 1378 Bruise or superficial injury 383 Fracture 299 Sprain, strain or dislocation 243 Internal injury 124 Head Injury/Concussion 83 Burns 67 Other 115 Unknown 2 Not recorded 2 Severity of injury No apparent injury 125 Minor 1645 Moderate 813 Severe 111 Not recorded 2 Disposition Discharged 2317 Admitted to hospital 164 Transferred to another hospital 179 Died 21 Leave Against Medical Advice (LAMA) 11 Unknown 2 Not recorded 2 Note:Not recorded = missing cases95% CI calculated using one proportion test and normal approximation method in Minitab.Abstract 432 Table 2Distribution of injuries by age-group, sex and mechanism of injury among children attending emergency of hospitals in Makwanpur district, Nepal, April 2019 – March 2020Age groups & Sex0 - 4 years5 - 9 years10–14 years15–17 yearsMaleFemaleTotalIntent & mechanismsn (%)n (%)n (%)n (%)n (%)n (%)n (%)Unintentional Fall 239 (26.2) 328 (36.0) 249 (27.3) 96 (10.5) 636 (69.7) 276 (30.3) 912 (100) Animal or insect related 175 (24.0) 260 (35.7) 190 (26.1) 103 (14.1) 470 (64.6) 258 (35.4) 728 (100) Road traffic injury 49 (13.8) 108 (30.3) 86 (24.2) 113 (31.7) 223 (62.6) 133 (37.4) 356 (100) Injured by a blunt force 54 (26.9) 74 (36.8) 49 (24.4) 24 (11.9) 150 (74.6) 51 (25.4) 201 (100) Stabbed, cut or pierced 20 (11.4) 56 (31.8) 49 (27.8) 51 (29.0) 127 (72.2) 49 (27.8) 176 (100) Fire, burn or scald 42 (64.6) 10 (15.4) 9 (13.8) 4 (6.2) 27 (41.5) 38 (58.5) 65 (100) Poisoning 33 (63.5) 6 (11.5) 5 (9.6) 8 (15.4) 26 (50.0) 26 (50.0) 52 (100) Suffocation/choking 24 (66.7) 5 (13.9) 2 (5.6) 5 (13.9) 20 (55.6) 16 (44.4) 36 (100) Electrocution 2 (15.7) 0 (0.0) 3 (25.0) 7 (58.3) 10 (83.3) 2 (16.7) 12 (100) Drowning and submersion 1 (14.3) 1 (14.3) 3 (42.9) 2 (28.6) 3 (42.9) 4 (57.1) 7 (100) Other 6 (46.2) 4 (30.8) 3 (23.1) 0 (0.0) 10 (76.9) 3 (23.1) 13 (100) Unknown 2 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 2 (100) 2 (100) Total 647 (25.3) 852 (33.3) 648 (25.3) 413 (16.1) 1702 (66.5) 858 (33.5) 2560 (100) Self-harm Poisoning 0 (0.0) 0 (0.0) 6 (15.8) 32 (84.2) 7 (18.4) 31 (81.6) 38 (100) Hanging 0 (0.0) 0 (0.0) 3 (25.0) 9 (75.0) 4 (33.3) 8 (66.7) 12 (100) Stabbed, cut or pierced 0 (0.0) 0 (0.0) 2 (33.3) 4 (66.7) 1 (16.7) 5 (83.3) 6 (100) Injured by blunt object 0 (0.0) 2 (50.0) 2 (50.0) 0 (0.0) 4 (100) 0 (0.0) 4 (100) Other 0 (0.0) 0 (0.0) 0 (0.0) 1 (100) 1 (100) 0 (0.0) 1 (100) Total 0 (0.0) 2 (3.3) 13 (21.3) 46 (75.4) 17 (27.9) 44 (72.1) 61 (100) Assault Bodily force (physical violence) 3 (7.0) 1 (2.3) 11 (25.6) 28 (65.1) 37 (86.0) 6 (14.0) 43 (100) Injured by blunt object 2 (11.1) 8 (44.4) 4 (22.2) 4 (22.2) 13 (72.2) 5 (27.8) 18 (100) Stabbed, cut or pierced 1 (12.5) 0 (0.0) 2 (25.0) 5 (62.5) 7 (87.5) 1 (12.5) 8 (100) Pushing from a high place 0 (0.0) 1 (50.0) 1 (50.0) 0 (0.0) 1 (50.0) 1 (50.0) 2 (100) Poisoning 0 (0.0) 1 (50.0) 0 (0.0) 1 (50.0) 1 (50.0) 1 (50.0) 2 (100) Sexual assault 0 (0.0) 0 (0.0) 1 (100) 0 (0.0) 0 (0.0) 1 (100) 1 (100) Other 0 (0.0) 1 (100) 0 (0.0) 0 (0.0) 0 (0.0) 1 (100) 1 (100) Total 6 (8.0) 12 (16.0) 19 (25.3) 38 (50.7) 59 (78.7) 16 (21.3) 75 (100) Abstract 432 Table 3Association of injury location, nature and severity with age among children attending emergency of hospitals in Makwanpur district, Nepal, April 2019 – March 2020Age groups0 – 4 years5 – 9 years10–14 years15–17 yearsTotalChi-SquareInjury characteristicsn (%)n (%)n (%)n (%)n (%)P valueLocation of injury sustained Home/Compound 537 (34.1) 504 (32.0) 319 (20.2) 216 (13.7) 1576 (100) <0.001 Highway/road/street 85 (13.4) 196 (30.8) 190 (29.9) 165 (25.9) 636 (100) School 15 (6.4) 107 (45.9) 85 (36.5) 26 (11.2) 233 (100) Recreational area 9 (6.5) 44 (31.9) 55 (39.9) 30 (21.7) 138 (100) Workplace 1 (1.3) 4 (5.3) 19 (25.0) 52 (68.4) 76 (100) Other 6 (16.2) 11 (29.7) 12 (32.4) 8 (21.6) 37 (100) Total 653 (24.2) 866 (32.1) 680 (25.2) 497 (18.4) 2696 (100) Nature of injury Cuts, bites or open wound 328 (23.8) 506 (36.7) 314 (22.8) 230 (16.7) 1378 (100) <0.001 Bruise or superficial injury 81 (21.1) 99 (25.8) 118 (30.8) 85 (22.2) 383 (100) Fracture 48 (16.1) 101 (33.8) 112 (37.5) 38 (12.7) 299 (100) Sprain, strain or dislocation 48 (19.8) 78 (32.1) 72 (29.6) 45 (18.5) 243 (100) Internal injury 44 (35.5) 8 (6.5) 18 (14.5) 54 (43.5) 124 (100) Head Injury/Concussion 18 (21.7) 26 (31.3) 18 (21.7) 21 (25.3) 83 (100) Burns 42 (62.7) 9 (13.4) 10 (14.9) 6 (9.0) 67 (100) Other 41 (35.7) 38 (33.0) 18 (15.7) 18 (15.7) 115 (100) Unknown 2 (100) 0 (0.0) 0 (0.0) 0 (0.0) 2 (100) Total 652 (24.2) 865 (32.1) 680 (25.2) 497 (18.4) 2694 (100) Severity of injury No apparent injury 39 (31.2) 45 (36.0) 26 (20.8) 15 (12.0) 125 (100) <0.001 Minor 419 (25.5) 535 (32.5) 406 (24.7) 285 (17.3) 1645 (100) Moderate 171 (21.0) 262 (32.2) 225 (27.7) 155 (19.1) 813 (100) Severe 23 (20.7) 23 (20.7) 23 (20.7) 42 (37.8) 111 (100) Total 652 (24.2) 865 (32.1) 680 (25.2) 497 (18.4) 2694 (100) Abstract 432 Table 4Association of injury location, nature and severity with sex among children attending emergency of hospitals in Makwanpur district, Nepal, April 2019 – March 2020SexMaleFemaleTotalChi-SquareInjury characteristicsn (%)n (%)n (%)P valueLocation of injury sustained Home/Compound 979 (62.1) 597 (37.9) 1576 (100) <0.001 Highway/road/street 421 (66.2) 215 (33.8) 636 (100) School 176 (75.5) 57 (24.5) 233 (100) Recreational area 111 (80.4) 27 (19.6) 138 (100) Workplace 62 (81.6) 14 (18.4) 76 (100) Other 29 (78.4) 8 (21.6) 37 (100) Total 1778 (65.9) 918 (34.1) 2696 (100) Nature of injury Cuts, bites or open wound 959 (69.6) 419 (30.4) 1378 (100) <0.001 Bruise or superficial injury 246 (64.2) 137 (35.8) 383 (100) Fracture 200 (66.9) 99 (33.1) 299 (100) Sprain, strain or dislocation 154 (63.4) 89 (36.6) 243 (100) Internal injury 50 (40.3) 74 (59.7) 124 (100) Head Injury/Concussion 59 (71.1) 24 (28.9) 83 (100) Burns 27 (40.3) 40 (59.7) 67 (100) Other 79 (68.7) 36 (31.3) 115 (100) Unknown 2 (100) 0 (0.0) 2 (100) Total 1776 (65.9) 918 (34.1) 2694 (100) Severity of injury No apparent injury 81 (64.8) 44 (35.2) 125 (100) 0.048 Minor 1102 (67.0) 543 (33.0) 1645 (100) Moderate 533 (65.6) 280 (34.4) 813 (100) Severe 60 (54.1) 51 (45.9) 111 (100) Total 1776 (65.9) 918 (34.1) 2694 (100) Abstract 432 Table 5Distribution of injuries by outcome and mechanism of injury among children attending emergency of hospitals in Makwanpur district, Nepal, April 2019 – March 2020Outcome of injuryDischargedAdmittedTransferredDiedLAMAUnknownTotalIntent & mechanismsn (%)n (%)n (%)n (%)n (%)n (%)n (%)Unintentional Fall 787 (86.5) 65 (7.1) 53 (5.8) 0 (0.0) 4 (0.4) 1 (0.1) 910 (100) Animal/insect bite/sting 704 (96.7) 3 (0.4) 19 (2.6) 0 (0.0) 1 (0.1) 1 (0.1) 728 (100) Road traffic injury 260 (73.0) 47 (13.2) 44 (12.4) 5 (1.4) 0 (0.0) 0 (0.0) 356 (100) Injured by a blunt force 190 (94.5) 4 (2.0) 6 (3.0) 0 (0.0) 1 (0.5) 0 (0.0) 201 (100) Stabbed, cut or pierced 165 (93.8) 8 (4.5) 3 (1.7) 0 (0.0) 0 (0.0) 0 (0.0) 176 (100) Fire, burn or scald 52 (80.0) 12 (18.5) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 65 (100) Poisoning 30 (57.7) 4 (7.7) 16 (30.8) 1 (1.9) 1 (1.9) 0 (0.0) 52 (100) Suffocation/choking/asphyxia 24 (66.7) 4 (11.1) 6 (16.7) 1 (2.8) 1 (2.8) 0 (0.0) 36 (100) Electrocution 7 (58.3) 2 (16.7) 2 (16.7) 1 (8.3) 0 (0.0) 0 (0.0) 12 (100) Drowning and submersion 4 (57.1) 0 (0.0) 0 (0.0) 3 (42.9) 0 (0.0) 0 (0.0) 7 (100) Other 12 (92.3) 1 (7.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 13 (100) Unknown 2 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 2 (100) Total 2237 (87.5) 150 (5.9) 150 (5.9) 11 (0.4) 8 (0.3) 2 (0.1) 2558 (100) Self-harm Poisoning 5 (13.2) 8 (21.1) 23 (60.5) 0 (0.0) 2 (5.3) 0 (0.0) 38 (100) Hanging 1 (8.3) 0 (0.0) 1 (8.3) 10 (83.3) 0 (0.0) 0 (0.0) 12 (100) Stabbed, cut or pierced 6 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 6 (100) Injured by blunt object 4 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 4 (100) Other 1 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1 (100) Total 17 (27.9) 8 (13.1) 24 (39.3) 10 (16.4) 2 (3.3) 0 (0.0) 61 (100) Assault Bodily force (physical violence) 34 (79.1) 5 (11.6) 3 (7.0) 0 (0.0) 1 (2.3) 0 (0.0) 43 (100) Injured by blunt object 18 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 18 (100) Stabbed, cut or pierced 6 (75.0) 1 (12.5) 1 (12.5) 0 (0.0) 0 (0.0) 0 (0.0) 8 (100) Pushing from a high place 2 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 2 (100) Poisoning 1 (50) 0 (0.0) 1 (50.0) 0 (0.0) 0 (0.0) 0 (0.0) 2 (100) Sexual assault 1 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1 (100) Other 1 (100) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1 (100) Total 63 (84.0) 6 (8.0) 5 (6.7) 0 (0.0) 1 (1.3) 0 (0.0) 75 (100) Abstract 432 Figure 1Seasonal variation of injuries identified by the injury surveillance system over a year among children attending emergency of hospitals in Makwanpur district, Nepal, April 2019 – March 2020Results/ConclusionsThe total number of ED patients with injury in the study was 10,154.2,696 were patients aged <18 years. Most injuries in children were unintentional and over half of children presenting with injuries were <10 years of age. Falls, animal bites/stings and road traffic injuries accounted for nearly 75% of all injuries with some (drowning, poisonings and burns) under-represented. Over half of injuries were cuts, bites and open wounds. The next most common injury types were superficial injuries (14.2%); fractures (11.1%); sprains/dislocations (9.0%). Child mortality was 1%.This is the biggest prospective injury surveillance study in a low or middle country in recent years and supports the use of injury surveillance in Nepal for reducing child morbidity and mortality through improved data.CHILD PAPER: RESULTS SECTIONTotal number of ED patients: 33046Total number of ED patient with injury: 10154 (adult=7458 & children=2696)8.2% (n=2696) patients with injury were children aged <18 yearsHetauda hospital: 2274 (84.3%)Chure hill hospital: 422 (15.7%)

Abstract Iron deficiency affects billions worldwide, and anemia develops when iron stores become insufficient to maintain normal erythropoiesis. However, iron depleted erythropoiesis is incompletely understood. In this study, an ex vivo model of iron depleted erythropoiesis was developed using dosed titrations of the iron chelator deferoxamine (DFO) in CD34+ cell cultures. All experiments were performed in triplicate with cells from three separate donors. Hemoglobinization and expression patterns of erythroid markers (GPA/CD71) demonstrated minimal changes in DFO supplemented medium. DFO caused dose-related suppression of cell counts after 14 days (20uM DFO: 42% reduction, 30uM DFO: 86% reduction, 40uM DFO: 96% reduction of cell counts compared to 0uM DFO controls). Cultures supplemented with 30uM DFO were used for subsequent studies, and the DFO-mediated effects were completely reversed by addition of 30uM ferric chloride. To investigate whether apoptosis caused the reduction in cell counts, surface Annexin V was measured by flow cytometry. No significant increases in levels of apoptosis among the proliferating erythroblasts were detected (Annexin V positive cells; 0uM DFO 6.2 ± 0.95%, 30uM DFO 9.0 ± 1.55%, p = 0.058). Analyses of p53 protein quantitation and p53 DNA-binding activity further suggested that the suppression of cell counts by iron chelation was not due to p53 related apoptosis. In the absence of apoptosis or maturation arrest, we hypothesized that the growth suppressing effects of DFO were not due to ineffective erythropoiesis. To test this hypothesis, a recently-discovered marker of ineffective erythropoiesis named GDF15 (Tanno et al. Nat. Med. 2007) was measured in the culture supernatants, and no increase was detected (GDF15 concentration per 1×104 cells: 0uM DFO; 79.7 ± 4.4 pg, 30uM; 43.9 ± 4.3 pg). In the clinic, serum GDF15 levels from 17 blood donors with significantly reduced ferritin and iron saturation (279 ± 98 pg/ml) were not increased when compared to serum GDF15 levels in 17 healthy volunteers with normal iron parameters (410 ± 119 pg/ml). To determine if cell cycling, instead of apoptosis, caused the reduction in cell counts, carboxyfluorescein diacetate succinimidyl diester (CFSE) staining studies were performed during the first and second weeks of culture. CFSE is an intracellular fluorescent stain, the intensity of which halves with each cell division. Three or four fewer erythroblast cell divisions were detected in 30uM DFO during the 14-day culture period when compared to controls. Based upon the reduction in cell divisions, it was estimated that the average cell cycle time was prolonged by 40–70% in DFO. Propidium iodide analyses additionally demonstrated changes in the cell cycle kinetics including a significant reduction in the percentage of S-phase erythroblasts at the peak phase of proliferation (30uM DFO: 37.0 ± 1.8% vs. control: 48.7 ± 3.4%, p = 0.0063). These results suggest that iron depletion inhibits the overall growth of erythroblasts by prolonging the cell cycle rather than causing apoptosis or maturation arrest. Due to the large amount of iron required for hemoglobin production, slower cell cycles may facilitate effective erythropoiesis by allowing extra time for uptake when extracellular iron is scarce.

Abstract M. Cazenave, V. Audard and J.P. Bertocchio, and P Bartolucci and M. Courbebaisse equally contributed to this work Introduction: Metabolic acidosis is encountered in 42% of patients with sickle cell disease (SCD) (Maurel S, Clin J Am Soc Nephrol, 2014) but the pathophysiological processes remain largely unknown. Patients and methods: We conducted a monocentric observational study including SCD patients, at steady state (>1 month of a vaso occlusive crisis and >3 months of a transfusion), with and without overt metabolic acidosis [HCO3-]<22 mmol/l and glomerular filtration rate estimated by CKD-EPI (eGFR)>60 ml/min/1.73 m2 The urinary acidification test was achieved by oral administration of furosemide and fludrocortisone, increasing distal tubular Na+ delivery, Na+ reabsorption via principal cells and H+ secretion via α-intercalated cells (Walsh SB, Kidney Int, 2007). An abnormal test was identified by a failure to lower urinary pH <5.3 and/or to increase urinary NH4+ excretion rate ≥33 µEq/min at least once within 6 hours. Results: We evaluated 13 SCD patients with metabolic acidosis (4 males, 40.0 years [33.0-44.0], eGFR=114.0 ml/min/1,73m2 [95.0-126.0]) and 12 SCD patients without overt metabolic acidosis (4 males, 29.5 years [24,0.0-37.3], eGFR=128.5 ml/min/1,73m2 [124.8-140.0]). During the test, among overt metabolic acidosis patients, urinary pH remained ≥5.3 in 7 patients and urinary NH4+ excretion remained <33 µEq/min in 9 patients. Only one patient had a normal test. In the control group, all of patients except one had a normal test. Maximum urinary NH4+ excretion was positively associated with fasting urine osmolality (r2 = 0.34, p=0.002). Regarding hemolysis parameters, patients with overt metabolic acidosis had lower hemoglobin (7.7 [6.8-8.7] vs 9.2 [8.9-9.4] g/dl, p=0.02), higher lactate dehydrogenase (492 [455-636] vs 327 [256-458] IU/l, p=0.01) and a higher average red blood cell density (1.097 [1.096-1.097] vs 1.092 [1.091-1.094], p<0.01). Discussion: Our study shows that SCD patients with overt metabolic acidosis have a defect in renal acidification process. The positive association between NH4+ excretion and fasting urine osmolality suggests that this metabolic acidosis is likely due to an impaired NH4+availability, probably secondary to the medullary ischemia seen in some SCD patients. This is supported by the fact that SCD patients with metabolic acidosis have a haematological phenotype of hyperhemolysis. Contrary to previous reports (Goossens JP, Clin Chim Act, 1972; Oster JR, Arch Intern Med, 1976), our results highlight that SCD patients with plasma bicarbonate within the normal range are not likely to exert incomplete tubular metabolic acidosis. Conclusion: In SCD patients, metabolic acidosis is related to a renal acidification defect, itself linked to the severity of hemolysis. Disclosures Bartolucci: Addmedica: Research Funding; Novartis US: Membership on an entity's Board of Directors or advisory committees; GBT: Membership on an entity's Board of Directors or advisory committees; Fondation Fabre: Research Funding.

Abstract Central venous access devices (CVADs), such as tunneled central venous catheters (tCVADs) and peripherally inserted central catheters (PICCs), help provide essential care for some patients with sickle cell disease (SCD). CVADs facilitate administration of multiple intravenous (IV) medications and blood products, as well as blood draws for laboratory analysis. Understanding CVAD use and complications is particularly relevant for SCD patients because of their high risk of having insufficient peripheral IV access. Prior studies describing CVAD use and complications in SCD patients were limited by small sample sizes, typically including 15-20 SCD patients in a single treatment center. The resulting estimates for CVAD use and complications in SCD patients vary widely, are insufficient for development of evidence-based guidelines, and may not be representative of the treatment burden in the broader SCD population. The purpose of this study was to describe the frequency of CVAD use and CVAD-associated complications among SCD patients in a large US population sample. We used data from two large U.S. insurance claims databases from Truven Health MarketScan® Research to examine both Medicaid-insured and commercially-insured SCD patients. From January 2009 through December 2013, these databases encompassed over 14 million Medicaid-insured and over 116 million commercially-insured patients. SCD patients were defined as patients with at least two International Classification of Disease-9 (ICD-9) diagnosis codes for SCD (282.41-42, 282.6x) on separate dates in excess of sickle cell trait codes, or one ICD-9 code for an inpatient (emergency department or hospitalization) visit with sickle cell crisis. CVAD insertions were identified using relevant procedure codes for tCVADs or PICCs. We conducted two sets of analyses for each database: (1) per patient among those with at least one CVAD insertion, and (2) per CVAD insertion. We conducted descriptive analyses on the frequency of CVAD-related procedures (e.g., repair, replacement, removal of obstructive material, repositioning), complications, and infections, thromboses, or phlebitis. A total 17,119 Medicaid-insured SCD patients and 21,342 commercially-insured SCD patients were observed for an average of 3-4 years, during which 1,945 (11.4%) and 1,316 (6.2%) patients, respectively, had at least one CVAD insertion. Most SCD patients (80%) were aged >18 y at time of first CVAD insertion; 18% of adult Medicaid SCD patients had at least one CVAD inserted. The mean number of CVAD insertions per patient was 3.1 (Medicaid) and 2.4 (commercially-insured). In the per CVAD analysis, complication claims were frequent, including infection (31-37%), thrombosis (4-5%), and phlebitis/thrombophlebitis (12-15%). The mean time to removal of CVADs (duration) was 31-34 days (PICC lines) and 102 days (tCVADs). In the per patient analysis, 54.3% had infection claims, 24.3% had thrombosis claims, and 10.2% had phlebitis/thrombophlebitis claims in Medicaid (see Table and Figure; additional results to be provided, also stratified by age). Both tCVADs and PICCs were commonly used in SCD patients, particularly adults, with high occurrence of infection, thrombosis and phlebitis/thrombophlebitis, as well as repeated CVAD insertions. Determinants of CVAD use and complications warrant further investigation to inform practice standards. These findings from a large observational study indicate that device-related risks of administering IV treatments are limitations of IV treatment options and may add to SCD treatment burden. Table 1. Medicaid-Insured Commercially-Insured Any CVAD (Overall) PICC Only tCVAD Only Both PICC and tCVAD Any CVAD (Overall) PICC Only tCVAD Only Both PICC and tCVAD N (%) 1,945 681 (35.0%) 893 (45.9%) 371 (19.1%) 1,316 450 (34.2%) 664 (50.5%) 202 (15.3%) Age, mean (sd) y 30.0 (16.3) 34.2 (14.9) 26.9 (17.5) 30.1 (13.6) 32.6 (17.1) 34.1 (15.8) 31.3 (18.3) 33.2 (15.9) CVAD insertions per patient, mean (sd) 3.1 (3.9) 3.1 (3.9) 1.8 (1.3) 6.2 (5.8) 2.4 (2.3) 2.5 (2.6) 1.6 (1.0) 4.5 (2.9) CVAD insertions total 6,107 3,651 2,456 n/a 3,082 1,636 1,446 n/a Duration per CVAD, median days 44 31 102 n/a 53 34 102 n/a CVAD complications, % patients with CVAD Complication, general 28.8% 13.2% 31.8% 50.1% 22.3% 9.1% 25.9% 39.6% Removal of obstructive material 11.2% 3.8% 15.3% 14.6% 9.0% 2.4% 11.4% 15.3% Replacement 8.3% 3.7% 10.2% 12.4% 6.5% 3.8% 6.5% 12.9% Figure 1. Figure 1. Disclosures Maserejian: Biogen: Employment, Equity Ownership. Hayflinger:Biogen: Consultancy, Employment. Eaton:Biogen: Employment, Equity Ownership. Madigan:Biogen: Employment, Equity Ownership. Hobbs:Biogen: Employment, Equity Ownership.

Abstract Cytokines release HSC from marrow and thus facilitate their collection from blood. We performed studies in parabiotic mice to determine if microenvironmental niches are vacated when HSC are mobilized. In our initial experiments, ROSA26 (CD45.2+) and Pep3b (CD45.1+) (both C57BL6) mice were joined in parabiosis for 3, 6, 8 or 12 wks. Although their circulations were shared (approximately 50% of granulocytes in the blood of each parabiont had partner phenotype in all studies), few HSC engrafted in partner marrow. Specifically, 1.0–2.5 % of marrow HSC had a partner phenotype, as determined by the transplantation of marrow cells into irradiated secondary recipients (Blood 102,1249,2003). Also, few marrow granulocytes and CFU-GM had a partner phenotype, implying that marrow functions as an intact compartment in which resident HSC give rise to progenitors then mature cells. In contrast, in the spleen, 1.5–3.6% of HSC, yet 38–55% of granulocytes and CFU-GM had a partner phenotype. We then treated each parabiont with one cycle of hG-CSF (25 ug/kg) and hSCF (200 ug/kg) sq qd x 4d on days 17–20 of parabiosis and examined the marrow at 6 weeks (day 42). 10.1±6.2(SD)% of HSC had partner phenotype (p=0.02). When 3 cycles of cytokines were administered beginning days 17, 24 and 31, 13.9±9.0% of marrow HSC had partner phenotype at 6 wks of parabiosis (p=0.01). Experiments were then repeated with AMD3100 (a SDF-1/CXCR4 axis antagonist, gift of AnorMed, Langley, BC, CA; 5mg/kg/mouse sq on day 20; n=3 pairs (6 parabionts)) to demonstrate that HSC mobilization, and not replication, was responsible for these results. At 6 wks of parabiosis, 5.9±2.9% of marrow HSC, 5.7±2.3% of marrow CFU-GM and 5.6±2.8% of marrow granulocytes had partner phenotype (p=0.02), while 7.2±2.7%, 44.0±3.2% and 40.0±6.1% of splenic HSC, CFU-GM and granulocytes had partner phenotype, respectively. These data imply that HSC exited marrow, transited blood, engrafted in open niches in partner marrow, and contributed (normally) to hematopoiesis. Similar percentages of HSC also engrafted in spleen. However, splenic hematopoiesis, as at baseline, derived from CFU-GM, not HSC, engraftment. We next tested a corollary of these findings. If niches are vacated after AMD3100 administration, transplanted HSC might preferentially engraft. Pep3b mice were treated with AMD3100 (5 mg/g sq) and 40 x 106 donor marrow cells (from ROSA26 mice) were transplanted (via tail vein infusion) 6 h later, 2 h later, or both 2 and 6 h later (n=3 mice per condition). Control animals received donor cells but no AMD3100. Donor cell engraftment was assayed at 3m (6 h later group) and 2m (other groups, 3 m data are pending) and was significantly higher in the experimental animals than control. Engraftment was 3.0±1.6, 6.5±4.9, 6.5±3.6 (SD)%, respectively, in the AMD3100-treated mice, and 0.6±0.9, 0.6±0.8 and 2.0±1.9% in the concurrent control studies (all p values = 0.02). Confirmatory experiments in BalbC mice (where higher engraftment rates are anticipated in control studies (Blood 98:1246,2001)) are underway. Our data argue that the number of available niches determine the number of HSC that engraft. As importantly, mobilization with AMD3100 could provide a non-toxic preparative approach to HSC transplantation for genetic (and other nonmalignant) disorders.

Abstract There are 3 kinds of PMN apoptosis: spontaneous, Fas or TNFα mediated system and ROS induced. The purpose of this work is to investigate the mechanisms of modulation of the CD16 decrease and the phospholipids “flip-flop” which are classically described as simultaneous events in apoptosis in relationship with the intracellular production of H2O2. Incubations during different times of PMN suspensions from healthy controls were performed in presence of Phorbol Myristate Acetate (PMA) at priming (10−9 M) and stimulating (2 10−6 M) concentrations, of fMLP 5 10−6M, of TNFα at 200ng/ml and finally of agonistic anti-Fas antibodies at 1 μg/ml. Inhibitors of PKC (staurosporin 10−5 M) and of the oxidase (DPI 400 μM) were tested with stimulating PMA. Standard two-colour flow-cytometry was performed for detection on one side of FITC-Annexin-V fixation and membrane impermeability to Propidium Iodide and on the other side of DCFH-DA for the intracellular H2O2 detection and CD16-PECy5. Results after 3 hours incubation are given in Table 1. Table 1. MEAN +/− SD CD16 % ANNEXIN V % DCFH-DA % n Wilcoxon test*: between spontaneous and the stimulant;°: between PMA and the inhibitor SPONTANEOUS 85 +/−7.1 7 +/− 4.7 1 +/−0.9 33 PMA 10-9 M 75 +/−9.0 9 +/− 5.2 1 +/− 0.9 10 PMA 2 10-6 M 21 +/−27.1 *** 51 +/− 21.4 *** 83 +/− 11.8 *** 33 PMA & STAURO 51 +/−23.3 °°° 23 +/− 16.0 °° 1 +/− 2.0 15 PMA & DPI 20 +/− 33.4 20 +/− 17.1 °° 3 +/− 6.2 20 fMLP 5 10-6M 41 +/− 19.3 *** 11 +/− 6.9 8 +/− 9.7 * 23 α TNF 200 ng/ml 42 +/− 19.2 * 5 +/− 3.5 * 8 +/− 9.5 * 7 Anti-Fas μg/ml 1 40 +/− 25.2 * 17 +/− 8.2 ** 1 +/− 0.9 7 Stimulating PMA induced both intracellular H2O2 production and apoptosis with increase of Annexin V fixation and CD16 down-regulation. Partial prevention of both features was observed when the ROS production was completely inhibited in presence of staurosporin. DPI had an effect on Annexin V fixation but no effect on CD16 decrease dissociating the 2 apoptotic features. Neutrophils activated with fMLP generated mainly extra-cellular H2O2 and did not undergo apoptosis measured thanks to Annexin V fixation, but CD16 down-regulation was observed. In presence of TNFα, a very slight stimulation of intracellular H2O2 production was observed with an inhibition of the Annexin V fixation and a CD16 down-regulation. The Fas mediated signalling system induced moderately both Annexin fixation and CD16 down-regulation without ROS production. Discussion: CD16 down-regulation seems to be present with fMLP and TNFα without other apoptotic features. Moreover, TNFα at 200ng/ml offers a protection for the phospholipids “flip-flop”. Dissociation of the classical PMN apoptotic features CD16 down-regulation and Annexin-V fixation with TNFα and fMLP demonstrates the complexity of the transduction signals used by these stimulants, and for the first time the independence of CD16 down-regulation from the phospholipids “flip-flop” which appears to be strongly dependent of intracellular ROS or more moderately of Fas stimulation and is never present without CD16 decrease. Only the presence of both events demonstrates apoptosis with certitude. On the opposite, it appears that the CD16 decrease alone cannot reflect the presence of the cell apoptosis. This decrease in absence of phospholipids “flip-flop”could be induced by extra-cellular ROS.

Background:Dactylitis is a hallmark feature of Psoriatic arthritis (PsA) and Spondyloarthritis (SpA) defined as a uniform swelling of a digit (“sausage digit”). Dactylitis is associated with radiographic damage in chronic PsA. However, there are a paucity of data on the significance of dactylitis and its potential impact in disease burden in early PsA.Objectives:To characterize a very early DMARD naïve PsA cohort based on clinical presence or absence of dactylitis at disease onset.Methods:PsA subjects fulfilling the CASPAR classification criteria, were recruited into a prospective observational cohort, the Leeds Spondyloarthropathy Register for Research and Observation (SpARRO) after providing informed written consent. Clinical data including tender (TJC) and swollen joint counts (SJC) were independently assessed. Dactylitis was recorded per digit (finger or toe) as tender (hot) or non-tender (cold). Differences in baseline characteristics were evaluated using percentages to describe categorical variables and means and standard deviations for continuous variables, p value of the mean/proportion difference was calculated. Ultrasound (US) examination was conducted by trained ultra-sonographers blinded to clinical details. Bone erosions were defined on US if intra-articular discontinuity was present in two perpendicular planes at any of 46 joints: wrists, MCP1-5, PIP2-5, DIP2-5, MTP1-5, knees, ankles, subtalar, talonavicular.Results:A total of 177 PsA patients were recruited. Dactylitis was seen in nearly half the cohort [n=83 (47%)]. Patients with dactylitis had significantly more early morning stiffness, higher TJC and SJC, compared with non-dactylitis (Table 1). A total of 211 digits with dactylitis were recorded in 83 patients. Dactylitis of multiple digits was seen in 47/83 (57%) patients whilst a single dactylitic digit occurred in 36/83 (43%). Foot involvement was more prevalent (141/211, 67%) than hands (70/211, 33%). “Hot” or tender dactylitis was more frequently detected (153/211, 72.5%) than “cold” or non-tender dactylitis (58/211, 27.5%). The most prevalent sites for hot dactylitis were toes 2-4thand fingers 2-3rd.Table 1.VariableNo Dactylitis (n=94)Dactylitis (n=83)P valueAge, mean (SD) years44.4 (12.8)43.7 (13.2)>0.05Male38 (40.4%)42 (50.6%)>0.05Disease duration, median (IQR) weeks4.7 (0.0-11.4)5.2 (1-22.4)>0.05Early Morning stiffness, mean (SD) mins82.8 (145.4)170.5 (230.2)0.0025*TJC (78), mean (SD)8.3 (10.9)13.7 (14.0)0.004*SJC (76), mean (SD)2.2 (3.2)8.4 (8.0)<0.001*Psoriasis94/94 (100.0%)76/83 (91.6%)0.004*PASI, mean (SD)3.6 (4.0)3.0 (4.1)>0.05Nail Dystrophy51/94 (54.3%)41/83 (49.4%)>0.05mNAPSI, mean (SD)4.9 (7.1)7.5 (14.0)>0.05MASES, mean (SD)1.6 (2.9)1.5 (2.4)>0.05BMI, mean (SD)29.1 (6.4)28.6 (5.6)>0.05Smoker19.0 (20.2%)9.0 (10.8%)>0.05Elevated CRP (>10 mg/L)24 (25.5%)36 (43.4%)>0.05PsAQoL, mean (SD)6.2 (6.6)6.2 (6.1)>0.05HAQ, mean (SD)0.79 (0.71)0.84 (0.65)>0.05US Erosions (n=154)12/83 (14.4%)21/71 (29.5%)0.023*US defined erosions were significantly more prevalent in the dactylitis group: 34 erosions in 21/71 patients (29.5%) versus 16 erosions in 12/83 (14.4%) patients in non-dactylitis. Sites prone to erosive damage in both groups were the wrists, MCP1,2 and MTP4,5. The right MCP2 (n=6) and MTP5 (n=6) were most commonly eroded in the dactylitis group, but erosions corresponding at the dactylitic digit level were overall low.Conclusion:This study identifies a more severe phenotype in very early DMARD naïve PsA presenting with dactylitis with higher prevalence of ultrasound erosions. Longitudinal follow up will determine whether dactylitis represents a poor prognostic factor in very early PsA, which may be a useful discriminator for risk stratification in future PsA management recommendations.Disclosure of Interests:Sayam Dubash: None declared, Oras Alabas: None declared, Xabier Michelena: None declared, Gabriele De Marco: None declared, Leticia Garcia-Montoya: None declared, Richard Wakefield Speakers bureau: Novartis, Janssen, GE, Ai Lyn Tan: None declared, Philip Helliwell: None declared, Paul Emery Grant/research support from: AbbVie, Bristol-Myers Squibb, Merck Sharp & Dohme, Pfizer, Roche (all paid to employer), Consultant of: AbbVie (consultant, clinical trials, advisor), Bristol-Myers Squibb (consultant, clinical trials, advisor), Lilly (clinical trials, advisor), Merck Sharp & Dohme (consultant, clinical trials, advisor), Novartis (consultant, clinical trials, advisor), Pfizer (consultant, clinical trials, advisor), Roche (consultant, clinical trials, advisor), Samsung (clinical trials, advisor), Sandoz (clinical trials, advisor), UCB (consultant, clinical trials, advisor), Dennis McGonagle Grant/research support from: Janssen Research & Development, LLC, Helena Marzo-Ortega Grant/research support from: Janssen, Novartis, Consultant of: Abbvie, Celgene, Eli Lilly, Janssen, Novartis, Pfizer, UCB, Speakers bureau: Abbvie, Celgene, Eli Lilly, Janssen, Novartis, Pfizer, Takeda, UCB

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

Интерес к изучению систем, содержащих сульфиды формулой АIВIIIСVI2, обусловлен, прежде всего, открывающимися возможностями их практического использования в изготовлении нелинейных оптических приборов, детекторов, солнечных батарей, фотодиодов, люминофоров и др. Поэтому в связи с поиском новых перспективных материаловна основе тиогаллата серебра и железа целью этой работы является исследование квазибинарного разреза FeGa2S4–AgGaS2 четырехкомпонентной системы Fe–Ag–Ga–S.Синтез сплавов системы AgGaS2–FeGa2S4 проводили из лигатур с использованием высокой чистоты: железа – 99.995 %, галлия – 99.999 %, серебра – 99.99 % и серы – 99.99 %. Исследование сплавов проводили методами дифференциально-термического, рентгенофазового, микроструктурного анализов, а также измерением микротвердости и определениемплотности.Методами физико-химического анализа впервые изучена и построена Т-x фазовая диаграмма разреза AgGaS2–FeGa2S4, который является внутренним сечением квазитройной системы FeS–Ga2S3–Ag2S. Установлено, что система относится к простому эвтектическому типу. Состав эвтектической точки: 56 мол. % FeGa2S4 и Т = 1100 К. На основе исходных компонентов были определены области твердых растворов. Растворимость на основе FeGa2S4 и AgGaS2 при эвтектической температуре достигает до 10 и 16 мол. % соответственно. С уменьшением температуры твердые растворы сужаются и при комнатной температуре составляют на основе тиогаллата железа (FeGa2S4) 4 мол. % AgGaS2,а на основе тиогаллата серебра (AgGaS2) 11 мол. % FeGa2S4. ЛИТЕРАТУРА 1. Zhаo B., Zhu S., Li Z., Yu F., Zhu X., Gao D. Growth of AgGaS2 single crystal by descending cruciblewith rotation method and observation of properties. Chinese Sci. Bull. 2001; 46(23): 2009–2013. DOI:https://doi.org/10.1007/BF029019182. Горюнова Н. А. Сложные алмазоподобные полупроводники. М.: Сов. радио; 1968. 215 с.3. Абрикосов Н. Х., Шелимова Л. Е. Полупроводниковые материалы на основе соединений АIVBVI..М.:Наука; 1975. 195 с.4. Kushwaha A. K., Khenata R., Bouhemadou A., Bin-Omran S., Haddadi K. Lattice dynamical propertiesand elastic constants of the ternary chalcopyrite compounds CuAlS2, CuGaS2, CuInS2, and AgGaS2. Journalof Electronic Materials. 2017;46(7): 4109–4118. DOI: https://doi.org/10.1007/s11664-017-5290-65. Uematsu T., Doi T., Torimoto T., Kuwabata S. Preparation of luminescent AgInS2-AgGaS2 solid solutionnanoparticles and their optical properties. The Journal of Physical Chemistry Letters. 2010;1(22):3283–3287. DOI: https://doi.org/10.1021/jz101295w6. Karaagac H., Parlak M. The investigation of structural, electrical, and optical properties of thermalevaporated AgGaS2 thin films. J. Thin Solid Films. 2011;519(7): 2055–2061. DOI: https://doi.org/10.1016/j.tsf.2010.10.0277. Karunagaran N., Ramasamy P. Synthesis, growth and physical properties of silver gallium sulfi de singlecrystals. Materials Science in Semiconductor Processing. 2016;41: 54–58. DOI: https://doi.org/10.1016/j.mssp.2015.08.0128. Zhou H., Xiong L., Chen L., Wu L. Dislocations that decrease size mismatch within the lattice leadingto ultrawide band gap, large second-order susceptibility, and high nonlinear optical performance of AgGaS2.Angewandte Chemie International Edition. 2019;58(29): 9979–9983. DOI: https://doi.org/10.1002/anie.2019039769. Li G., Chu Y., Zhou Z. From AgGaS2 to Li2ZnSiS4: Realizing impressive high laser damage thresholdtogether with large second-harmonic generation response. Journal Chemistry of Materials. 2018;30(3):602–606. DOI: https://doi.org/10.1021/acs.chemmater.7b0535010. Yang J., Fan Q., Yu Y., Zhang W. Pressure effect of the vibrational and thermodynamic properties ofchalcopyrite-type compound AgGaS2: A fi rst-principles investigation. Journal Materials. 2018;11(12): 2370.DOI: https://doi.org/10.3390/ma1112237011. Paderick S., Kessler M., Hurlburt T. J., Hughes S. M. Synthesis and characterization of AgGaS2nanoparticles: a study of growth and fl uorescence. Journal Chemical Communications. 2018;54(1): 62–65.DOI: https://doi.org/10.1039/C7CC08070K12. Kato K., Okamoto T., Grechin S., Umemura N. New sellmeier and thermo-optic dispersion formulasfor AgGaS2. Journal Crystals. 2019;9(3): 129–135. DOI: https://doi.org/10.3390/cryst903012913. Li W., Li Y., Xu Y., Lu J., Wang P., Du J., Leng Y. Measurements of nonlinear refraction in the mid-infraredmaterials ZnGeP2 and AgGaS2. Journal Applied Physics B. 2017;123(3). DOI: https://doi.org/10.1007/s00340-017-6643-914. Jahangirova S. K., Mammadov Sh. H., Ajdarova D. S., Aliyev O. M., Gurbanov G. R. Investigation ofthe AgGaS2–PbS and some properties of phases of variable composition. Russian Journal of InorganicChemistry. 2019;64(9): 1169–1171. DOI: https://doi.org/10.1134/S003602361909009215. Asadov S. M., Mustafaeva S. N., Guseinov D. T. X-ray dosimetric characteristics of AgGaS2 singlecrystals grown by chemical vapor transport. Inorganic Materials. 2017;53(5): 457–461. DOI: https://doi.org/10.1134/S002016851705002816. Mys O., Adamenko D., Skab I., Vlokh R. Anisotropy of acousto-optic fi gure of merit for the collineardiffraction of circularly polarized optical waves at the wavelength of isotropic point in AgGaS2 crystals.Ukrainian Journal of Physical Optics. 2019;20(2): 73–80.DOI: https://doi.org/10.3116/16091833/20/2/73/20117. Karunagaran N., Ramasamy P. Investigation on synthesis, growth, structure and physical propertiesof AgGa0.5In0.5S2 single crystals for Mid-IR application. Journal of Crystal Growth. 2018;483: 169–174.DOI: https://doi.org/10.1016/j.jcrysgro.2017.11.03018. Ranmohotti K. G. S., Djieutedjeu H., Lopez J., Page A., Haldolaarachchige N., Chi H., Sahoo P., Uher C.,Young D., Poudeu P. F. P. Coexistence of high-Tc ferromagnetism and n-type electrical conductivity inFeBi2Se4. J. of the American Chemical Society. 2015;137(2): 691–698. DOI: https://doi.org/10.1021/ja508425519. Karthikeyan N., Aravindsamy G., Balamurugan P., Sivakumar K. Thermoelectric properties of layeredtype FeIn2Se4 chalcogenide compound. Materials Research Innovations. 2018;22(5): 278–281. DOI:https://doi.org/10.1080/14328917.2017.131488220. Nakafsuji S., Tonomura H., Onuma K., Nambu Y., Sakai O., Maeno Y., Macaluso R. T., Chan J. Y.Spin disorder and order in quasi-2D triangular Heisenberg antiferromagnets: comparative study ofFeGa2S4, Fe2Ga2S5 and NiGa2S4. Phys. Rev. Letters. 2007;99(1–4): 157–203. DOI: https://doi.org/10.1103/PhysRevLett.99.15720321. Rushchanskii K. Z., Haeuseler H., Bercha D. M. Band structure calculations on the layered compoundsFeGa2S4 and NiGa2S4. J. Phys. Chem. Solids. 2002;63(11): 2019–2028. DOI: https://doi.org/10.1016/S0022-3697(02)00188-922. Dalmas de Reotier P., Yaouanc A., MacLaughlin D. E., Songrui Zhao. Evidence for an exotic magnetictransition in the triangular spin system FeGa2S4. J. Phys. Rev. B. 2012;85(14): 140407.1–140407.5. DOI: https://doi.org/10.1103/physrevb.85.14040723. Myoung B. R., Lim J. T., Kim C. S. Investigation of magnetic properties on spin-ordering effects ofFeGa2S4 and FeIn2S4. Journal of Magnetism and Magnetic Materials. 2017;438: 121–125. DOI: https://doi.org/10.1016/j.jmmm.2017.04.05624. Asadov M. M., Mustafaeva S. N., Hasanova U. A., Mamedov F. M., Aliev O. M., Yanushkevich K. I., NikitovS. A., Kuli-Zade E. S. Thermodynamics of FeS–PbS–In2S3 and properties of intermediate phases. JournalDefect and Diffusion Forum.2018;385: 175–181. DOI: https://doi.org/10.4028/www.scientific.net/DDF.385.17525. Li K., Yuan D., Shen S., Guo J. Crystal structures and property characterization of two magneticfrustration compounds. Journal Powder Diffraction. 2018;33(3): 190–194. DOI: https://doi.org/10.1017/S088571561800050726. Chen B., Zhu S., Zhao B., Lei Y., Wu X., Yuan Z., He Z. Differential thermal analysis and crystal growthof AgGaS2. Journal of Crystal Growth. 2008;310(3): 635–638. DOI: https://doi.org/10.1016/j.jcrysgro.2007.10.06727. Sinyakova E. F., Kosyakov V. I., Kokh K. A. Oriented crystallization of AgGaS2 from the melt systemAg–Ga–S. J. Inorganic Materials. 2009;45(11): 1217–1221. DOI: https://doi.org/10.1134/S002016850911004128. Chykhrij S. I., Parasyuk O. V., Halka V. O. Crystal structure of the new quaternary phase AgCd2GaS4and phase diagram of the quasibinary system AgGaS2–CdS. Journal of Alloys and Compounds.2000;312(1–2):189–195. DOI: https://doi.org/10.1016/S0925-8388(00)01145-229. Olekseyuk I. D., Parasyuk O. V., Halka V. O., Piskach L. V. F., Pankevych V. Z. Romanyuk Ya. E. Phaseequilibria in the quasi-ternary system Ag2S–CdS–Ga2S3. J. Alloys and compounds. 2001;325(10): 167–179. DOI:https://doi.org/10.1016/S0925-8388(01)01361-530. Brand G., Kramer V. Phase equilibrium in the quasi-binary system Ag2S–Ga2S3. Mater. Res. Bull.1976;11(11): 1381–1388. DOI: https://doi.org/10.1016/0025-5408(76)90049-031. Лазарев В. Б., Киш З. З., Переш Е. Ю., Семрад Е. Е. Сложные халькогениды в системе Аэ–Вэээ–СVI. М.: Металлургия; 1993. 229 с.32. Угай Я. А. Введение в химию полупроводников.М.: Высшая школа; 1975. 302 с.33. Pardo M. E, Dogguy-Smiri L., Flahaut J., Nguyen H. D. System Ga2S3–FeS Diagramme dephase — etude cristallographique. Mater. Res. Bull. 1981;16(11): 1375–1384. DOI: https://doi.org/10.1016/0025-5408(81)90056-834. Wintenberger M. About the unit cells and crystal structures of ~MGa2X4 (M = Mn, Fe, Co; X = S,Se) and ZnAI2S4 Type. In: Proc. VII Int. Conf. on Solid Compounds of Transition Elements, CNRS. Grenoble,France: IA 14/1-3, 1983.35. Rustamov P. G., Babaeva P. K., Azhdarova D. S., Askerova N. A., Ailazov M. R. Nature of interaction inMn(Fe,Co,Ni)–Ga(In)–S(Se) ternary systems. Azerb. Khim. Zh. 1984;15: 101–103.36. Raghavan V. Fe-Ga-S (Iron-Gallium-Sulfur). J. Phase Equil. 1998;19: 267–268. DOI: https://doi.org/10.1361/10549719877034231937. Ueno T., Scott S. D. Phase relations in the Ga-Fe-S system at 900 and 800 C. The Canadian Mineralogist.2002;40(2): 568–570. DOI: https://doi.org/10.2113/gscanmin.40.2.56338. Allazov M. R. The system of FeS–GaS–S. Bulletin of Baku State University. 2009;(2): 42-47. Режимдоступа: http://static.bsu.az/w8/Xeberler%20Jurnali/Tebiet%202009%203/42-47.pdf39. Dogguy-Smiri L., Dung Nguyen Huy, Pardo M. P. Structure crystalline du polytype FeGa2S4 a 1T. Mater.Res. Bull. 1980;15(7): 861–866. DOI: https://doi.org/10.1016/0025-5408(80)90208-140. Hahn H., Klingler W. Unter such ungen uber ternare chalkogenide. I. Uber die, kristall structureiniger ternaerer sulfi de, die sichvom In2S3 ableiten. Zeitschrift fur Anorganische und Allgemeine Chemie.1950; 263(4): 177–190. DOI: https://doi.org/10.1002/zaac.1950263040641. Dogguy-Smiri L., Pardo M. P. Etude cristallographique du systeme FeS–Ga2S3. Compt. Rend. Acad.Sci. 1978;287: 415–418.42. Аллазов М. Р., Мусаева С. С., Аббасова Р. Ф., Гусейнова А. Г. Области кристаллизации фаз поизотермическим сечениям систем Fe-Ga-S. Известия Бакинского государственного университета.2013;(3): 11–14. Режим доступа: http://static.bsu.az/w8/Xeberler%20Jurnali/Tebiet%20%202013%20%203/11-15.pdf43. Рзагулуев В. А., Керимли О. Ш., Аждарова Д. С., Мамедов Ш. Г., Алиев О. М. Фазовые рав-новесия в системах Ag8SnS6–Cu2SnS3 и Ag2SnS3–Cu2Sn4S9. Конденсированные среды и межфазныеграницы. 2019;21(4): 544–551. DOI: https://doi.org/10.17308/kcmf.2019.21/2365

Abstract Background: The treatment goal for patients with immune thrombocytopenia (ITP) is to raise platelet counts to levels that minimize or stop bleeding. Thrombopoietin receptor agonists (TPO-RAs) have been successfully and extensively employed as second-line therapy for ITP. TPO-RAs, however, have a small but significant increase in the risk of thrombosis. Aim: The aim of this study was to elucidate the mechanisms involved in the procoagulant effect of TPO-RAs. Methods: This is a prospective, observational and transversal study. Eighty-two patients with chronic primary ITP, 40 without treatment for at least six months (UT-ITP) and 42 responders to TPO-RA therapy (64.3% with eltrombopag and 35.7 % with romiplostim) were recruited. One hundred and twelve healthy participants were also included. ROTEM® (naTEM test: only recalcification) was performed on platelet rich plasma adjusted to a platelet count of 25 x 109/L. Clotting time (CT, time from start of measurement until 2 mm of amplitude [in seconds], alpha angle, which reflects the rate of fibrin polymerisation (tangent to the curve at 2 mm amplitude [in degrees]), maximum clot firmness, which reflects the maximum tensile strength of the thrombus (MCF, [in mm]) and LI60, which describes the percentage of maximum clot strength present at 60 min (in %), were recorded. Surface exposure of phosphatidylserine (PS), active caspase-3, -8 or -9 and prothrombinase complex binding to platelets were assessed by flow cytometry. Plasma and platelet levels of PAI-1 were determined by ELISA (eBioscience Ltd., Hatfield, United Kingdom). The effect of TPO and romiplostim on PAI-1 content of MEG-01 cells was evaluated by Western blot. Three MEG-01 cell cultures were initiated simultaneously: control without drugs and treated with either TPO (100 ng/mL) or romiplostim (53 μg/mL). Samples were collected at the start and after 24, 48 and 72 hours to determine the PAI-1 content. The statistical analysis was performed using SPSS 9.0 software (SPSS Inc., Chicago, Illinois, USA). Results: The ROTEM® studies showed significant differences in the dynamics of clot formation when comparing the control with ITP samples. There was a delay in clot formation in the UT-ITP group, as observed by a prolonged CT [expressed as median (p25-p75): control: 516 (490- 633) s; UT-ITP: 938 (914-1348) s, p<0.001], and a diminished alpha angle (mean±SD; control: 61.7±5.6 degrees; UT-ITP: 49.2±7.3 degrees, p<0.05). Nevertheless, samples from patients with UT-ITP reached the same MCF as those from healthy controls (control: 45.3±2.4 mm; UT-ITP: 46.9±3.7 mm). On the other hand, patients with ITP undergoing TPO-RA therapy presented an initial clot formation similar to that of the control group [expressed as median (p25-p75): CT, 672 (598-928) s; alpha angle, 55.8±5.8 degrees] but achieved a higher MCF (53.1±4.5 mm, p<0.05) and a reduced clot lysis after 60 min (control: 91.8±4.0%; UT-ITP: 93.7±4.0%, TPO-RA ITP: 97.6±1.7, p<0.05). Higher values of MCF observed with platelets from ITP patients treated with TPO-RAs might be a consequence of their augmented apoptosis signs: platelets from this group exposed more PS than controls and this situation was accompanied by an increased activity of caspases-3,7, -8 and -9 (Figure 1 A and B). Moreover, platelets from ITP patients on treatment with TPO-RAs bound more prothrombinase complex than platelets from UT-ITP patients and healthy controls (Figure 1 C). Reduced clot lysis observed in ITP patients treated with TPO-RA was due, at least in part, to increased plasma and platelet levels of PAI-1 (Table 1). Increase in platelet content of PAI-1 might be the result of the effect of TPO-RAs during megakaryopoiesis since treatments of MEG-01 cells with TPO or romiplostim induced a 3-fold increase in their endogenous PAI-1 content after an incubation period of 48 hs. Conclusion: The patients with ITP undergoing TPO-RAs therapy presented a procoagulant profile due to the formation of a more fibrinolysis-resistant clot because of increased platelet and plasma PAI-1 levels. Moreover, platelets from this group of patients showed more signs of apoptosis that causes a higher exposure of PS and, consequently, a larger surface for the binding of the prothrombinase complex. Work supported by grant from FIS-FEDER PI15/01457. NB holds a Miguel Servet II (FIS-FEDER CP14/00024). Disclosures Álvarez-Roman: SOBI: Consultancy; NovoNordisk: Consultancy; Shire: Consultancy. Jimenez-Yuste:Grifols: Consultancy, Research Funding; Octapharma: Consultancy, Research Funding; CSL Behring: Consultancy; Bayer: Consultancy, Research Funding; Roche: Consultancy, Research Funding; Shire: Consultancy, Research Funding; Sobi: Consultancy, Research Funding; Pfizer: Consultancy, Research Funding; NovoNordisk: Consultancy, Research Funding. Butta:FIS-Fondos FEDER: Research Funding.

Abstract Despite the significant improvement in outcomes for myeloma patients (pts) in the more recent years (yrs), the disease remains incurable. Because of high morbidity and mortality the role of allo-SCT in treatment of myeloma remains controversial. Registry data from the European Society of Blood and Marrow Transplantation (EBMT) suggest an increasing use of allo-SCT as salvage therapy after failure to auto-SCT. In present single center study we provide data on the use of allo-SCT focusing on pts with first relapse/progressive disease after autografting. A total of 89 pts (males, 62%) with median age of 53y (24-73) relapsed after an autograft (single, 64%; tandem, 36%) and received an allo-SCT during 2000 - 2015 yrs at University of Hamburg were included. The majority of the pts experienced advanced disease (stage III, 80%) and short remission duration after auto-SCT (≤24 mo, 81%) with median of 15 mo (2-91). A total of 76% of pts received a reinduction therapy prior to allo-SCT, whereas 24% did not. Twelve pts (14%) had high risk cytogenetics (defined as detection of del17p and/or t(4;14) by FISH). Twelve pts experienced extramedullary relapses. At time of transplantation pts were in CR (10%), vgPR (22%), PR (27%), SD (16%) or PD (25%). Allo-SCTs were performed mostly with peripheral stem cell (92%) and from unrelated (matched, 40%; mismatched, 32%) donors. Myeloablative conditioning was used in 70% of pts (busulfan-based, 61%; treosulfan-based, 9%). A total of 28 pts (31%) received a maintenance therapy (lenalidomide, 79%) starting at median 6 mo (4-8) post-transplant. Furthermore, 19 pts (24%) received DLIs (positive immunofixation, n=15; prophylaxis, n=4) within a median of 10 mo (4-27). The cumulative incidence (CI) of acute GvHD (grade II-IV) at d100 was 43% (32-55%). The CI of chronic GvHD at 5y post-transplant was 51% (39-63%; mild, n=19, moderate, n=12, severe, n=5). Of the 19 pts receiving DLIs, 5 (26%) developed GvHD (grade II-IV). Six (40%) of 15 pts responded (CR). The CI of TRM at d100 and at 5y were 8% (4-16%) and 19% (12-28%), respectively. We observed improved TRM in pts who didn't receive radiation before allo-SCT (p=0,03). The CI of relapses at 5y was 61% (49-72%). We observed a trend to lower relapse rate of 29% in pts with longer remission duration (>24 mo, p=0,07). The 5y probability of EFS was 28% (19-39%). The median EFS was 29 mo (22-36). In univariate analysis, we observed decreased survival probability for pts with high risk cytogenetics (p=0,026), remission duration ≤24 mo (p=0,008) and non-responders to salvage therapy (p=0,037). In multivariate analysis the negative impact of remission duration ≤24 mo (HR 6,9; 1,8-25,6; p=0,004) and failure to salvage therapy (HR 3,3; 1,2-9,0; p=0,021) were confirmed. In landmark analysis at d100 we observed improved survival for responding pts (p<0,001), pts in CR (p=0,028), those in "stringent" CR compared to CR (p=0,014) and those with negative MRD (minimal residual disease, FACS, p=0,037). Intriguingly, the median EFS for pts in "stringent" CR was not reached. In landmark analysis at 6 mo we observed improved survival for pts receiving preemptive/prophylactic DLIs (p=0,045). After a median follow up of 48 mo (6-170), the 5y probability of OS was 57% (46-78%). The median OS was 76 mo (42-110). In univariate analysis, we observed decreased survival probability for pts with extramedullary relapse (p=0,039), high risk cytogenetics (p=0,001), remission duration ≤6 mo (p=0,044) and those who received reduced intensity conditioning (p=0,022). In multivariate analysis the negative impacts of extramedullary relapses (HR 7,3; 2,7-20; p<0,001), reduced intensity conditioning (HR 3,5; 1,4-8,5; p=0,006) and short remission duration (HR 2,6; 1,1 - 6,2; p=0,038) were confirmed. In landmark analysis at d100 we observed improved survival for responding pts (p<0,001), pts in CR (p=0,028) and those in "stringent" CR compared to CR (p=0,014). In landmark analysis at 6 mo we observed improved survival for pts receiving DLIs (p<0,001) and maintenance therapy (p=0,002). Allo-SCT being performed as salvage therapy after autograft failure resulted in around 30% 5y EFS. The response on d100 post-transplant, augmented by the MRD detection, seems to be prognostic important and might be used for planning further therapeutic strategies post-transplant. The use of DLIs and maintenance therapy post-transplant represent a possible approach to further improve survival. Disclosures Kröger: Sanofi: Honoraria, Research Funding; Neovii: Honoraria, Research Funding; Riemser: Honoraria, Research Funding; Novartis: Honoraria, Research Funding.

Enzyme preparations witchused in animal breeding are unstable. Instability is due to a partial or complete inactivation of the enzymes in the gastrointestinal tract under the influence of a strongly acidic environment, inhibitors and proteases. Increasing the effectiveness of the use of exogenous enzyme preparations is possible by the creation of stabilized forms of biopreparations. To do this, use the principles and methods of engineering enzymology. The aim of the research is to determine the optimal conditions for the immobilization of the enzyme preparation of protosubtilin G3X (proteolytic spectrum of the action) by the adsorption method. Conduct a comparative evaluation of the properties of native and immobilized biocatalysts on the conditions in vitro and in vivo. Proteolytic activity was determined by Anson's method. The amount of protein on the carrier was evaluated by reducing its concentration in the reaction mixture, measured with Lowry O.H. et al .. The activity of the immobilized enzyme was expressed as a percentage of the activity of the native enzyme. The pH solutions were measured on the potentiometer pH- 340. For immobilization weused enzyme preparation of protosubtilin G3X with an activity of 70 units / g, as a carrier we used zeolite. The immobilization procedure consisted of mixing the buffer solution of the enzyme with the carrier. During research and study of the influence of the ionic strength of the solution and pH on the adsorption process it was established that the catalytic activity of the obtained preparation falls in the buffers: phosphate, citrate, borate, acetate. Moreover, with an increase in the ionic strength of the solution, regardless of its composition, the enzyme activity of preparation was reduced. Optimal for immobilization was a 0.1 M phosphate buffer solution with pH in the range of 7.0–7.4. Protosubtilin G3X lost 80 % of the initial activity during immobilization in water. When determining the capacity of a carrier, it is found that 1 g of zeolite adsorbs 29.8 mg of protein. The maximum specific activity of the enzyme (0.16 U / mg protein) is appeared at the optimum load of the carrier 22.5 mg protein per 1 g zeolite and corresponded to 85.7 % of the activity of the native protosubtilin G3X. Consequently, the optimal conditions for the immobilization of protosubtilin G3X on zeolite are: 0.1 M phosphate buffer solution with pH 7.0–7.4, temperature 20–25 ºС, carrier capacity 22.5 mg / g, duration of the process 2 years. In experiments in vitro studied the dependence of the catalytic activity of the pH value in the range of 1.5 to 8.0. After 1 hour of incubation in the buffer solutions, it was found that the optimal value of pH for both forms of preparations coincides (pH 7.2). With pH-inactivation of native and immobilized forms of protosubtilin G3X, the loss of catalytic activity of the modified preparation was significantly less than the native. Moreover, a significant expansion of the pH profile in the acidic zone was observed for the immobilized enzyme. If the native enzyme retained 20 % of the original activity at pH 5.0 and irreversibly inactivated at pH 4.5–4.8; the immobilized enzyme retained 42 % of the activity at pH 4.0. We studied the proteolytic activity of digestive enzymes in different parts of the gastrointestinal tract of broilers: goitre (pH 4.5–5.8), glandular stomach (pH 3.6–4.7), duodenum (pH 5.7–6.2). The proteolytic activity of the contents of goiter in the groups of chickens witch received native and immobilized protosubtilin G3X, was the same or higher, than in the control groups (p <0.01). The value of the proteolytic activity of the contents of the glandular stomach in the group of broiler chickens witch received the native enzyme sharply decreased almost to the level of the value in the control group. same value in the group witch received the immobilized enzyme was higher by 30 % (p <0.05). There was also an increase of the proteolytic activity in the chyme of the duodenum in the experimental groups of chicks (p <0.05); however, the catalytic activity in the group witch received the immobilized enzyme, was higher by 12.8 %. It should be noted that in conditions in vivo, in contrast to similar conditions in vitro, was observed partial reactivation of the catalytic properties of the native protosubtilin G3X after exposure to the strongly acid medium of the glandular stomach, which is obviously related to the biological environment of the protein molecule. To show the intensity of metabolic processes witch provide growth and development of broiler, we use the integral indicator as productivity. Feeding of immobilized protosubtilin G3X to chickens positively influenced the weight gain and helped to reduce feed costs. At the end of the experiment, the weight of the chicks receiving the native enzyme was higher by 9.0 % (p> 0.1) and immobilized by 16.0 % (p <0.05) compared to the control group. The feed costs for 1 kg of gain in both experimental groups were the same (2.40 kg) and less than in the control group by 5.8 %. Key words: enzyme, immobilization, native enzyme, zeolite, adsorption, proteolytic activity, pH, buffer solution.

Abstract Abstract 2007 Introduction: Identification of genetic and molecular markers of high risk disease for chronic lymphocytic leukemia (CLL) have improved risk-stratification of these patients and allow for adapted treatment. Allogeneic hematopoietic cell transplantation (HCT) offers a chance for prolonged disease free survival and there is increasing use of this strategy for CLL. The risk which these factors incur on HCT outcomes remains uncertain. Methods and Patients: We performed a retrospective analysis of all CLL patients who underwent aHCT at the Moffitt Cancer Center between 2003 and 2011. Our IRB approved study was designed to examine the effect of 13 variables upon overall survival (OS) via univariate and multivariate analysis. Secondary outcomes included progression free survival (PFS), non-relapse mortality (NRM), and relapse rate. Variables were: age (years) at HCT of <50 vs. 50–59 vs. >=60; HLA matched related donor (MRD)/matched unrelated donor (MUD) vs. mismatched unrelated donor (MMUD); Chemoresponsive to last therapy (CR/PR) vs. stable disease (SD) vs. progressive disease (PD); fludarabine vs. pentostatin-based conditioning regimen; Karnofsky performance status (KPS) <90%; presence of any acute GVHD; presence of deletion 17p; presence of deletion 11q; >=3 treatment regimens prior to HCT; >=3 enlarged lymph nodes (LN) areas at HCT; presence of >=5 cm LN (bulky disease) at HCT; >=30% CLL bone marrow involvement; HCT specific comorbidity index (HCT-CI) score >= 1. 43 patients, 37% female, were identified. At diagnosis of CLL 19% had B symptoms; 58% had a Rai stage of II-IV; and 35% had bulky disease. Genetic abnormalities present at any time before HCT were: 35% del 17p and 35% del 11p. Two patients had Richter's transformation. Prior to HCT conditioning, 88% had received fludarabine and 63% had received >= 3 regimens. Median age at HCT was 55 (34–65) years, 19% had bulky disease, and 63% had a Karnofsky performance status (KPS) of at least 90%. Disease status at HCT: CR (23%), PR (33%), SD (21%), PD (23%) and the number of LN areas at HCT >=3 in 65% patients. The HCT-CI was >= 1 in 56%; donors were 42% MRD, 35% MUD, and 23% MMUD (including 3 umbilical cord blood); conditioning regimens were 33% fludarabine+busulfan, 37% pentostatin+busulfan, 19% fludarabine+TBI and 11% other. Results: At a median follow-up of 2.6 (range:) years for survivors, median OS and PFS were 46.5 mo and 31.4 mo by Kaplan Meier estimate. By univariate analysis, 5 factors were found predictive of worse OS: age at HCT >=60 (HR=6.1,95%CI:1.5–24.9) vs reference < 50; MMUD (HR=3.3;95%CI:1.3–8.1); PD(HR=4.9,95%CI:1.9–12.4) vs reference CR/PR; presence of del 17p (HR=2.7,95%CI:1.1–6.2); and presence of del 11q (HR=5.2,95%CI:2.1–13.0). The same five factors were predictive for PFS compared to reference group: age at HCT >=60 (HR=5.5,95%CI:1.3–22.4) vs reference <50; MMUD (HR=3.6;95%CI:1.5–9.0); PD(HR=5.7,95%CI:2.2–14.4) vs reference CR/PR; presence of del 17p (HR=2.3,95%CI:1.0–5.3); and presence of del 11q (HR=4.2,95%CI:1.7–10.4). The presence of del 11q (n=15) and del 17p (n=15) did not correlate (p=1.0). Median OS was significantly worse for del 17p patients (7 mo vs 46 mo, p=0.0193) or those with del 11q (7 mo vs. 55 mo, p=0.0001). The cumulative incidence of relapse was not different among del 11q (HR=0.82; 95%CI: 0.22 – 3.11) or del 17p patients (HR=0.86; 95%CI: 0.22 – 3.43) while NRM was worse for del 11q patients(HR=5.14; 95%CI: 1.82–14.6). Published data is inconclusive on the influence of genetic risk factors upon outcomes after HCT for CLL. Therefore, we conducted a multivariable analysis recognizing the number of variables in the final model would be relatively large considering the limited number of events. In our model the following three variables were associated with worse OS: MMUD (HR=3.7; 95% CI:1.1–12.6; p=0.035); del 17p (HR=5.1; 95%CI:1.6–16.6; p=0.006); and del 11q (HR=10.9; 95%CI:3.1–38.4; p<0.001). These same 3 variables correlated with worse PFS: MMUD (HR=14.4; 95% CI:3.1–66.7; p=0.001); del 17p (HR=4.4; 95%CI:1.4–14.5; p=0.014); and del 11q (HR=16.0; 95%CI:3.8–68.5; p<0.001). Conclusion: For patients undergoing HCT for CLL, the presence of del 17p OR del 11q predicted for worse OS and PFS; however, the risk of relapse did not appear different. Additional prospective studies should examine the independent effects of these variables in larger cohorts of CLL patients undergoing HCT. Disclosures: No relevant conflicts of interest to declare.

Background:Differences in efficacy outcomes favouring males vs females with rheumatoid arthritis (RA) have been reported with conventional synthetic (cs) disease-modifying antirheumatic drugs (DMARDs) and tumour necrosis factor inhibitors; results with Janus kinase inhibitors are less clear.Objectives:To assess the impact of sex on efficacy, safety and persistence in tofacitinib RA clinical trials.Methods:Efficacy and safety analyses included data pooled from Phase (P)3 randomised controlled trials (RCTs) of patients (pts) with RA and an inadequate response (IR) to methotrexate (NCT00847613; NCT00853385) or ≥1 DMARD (NCT00856544) who received tofacitinib 5 or 10 mg twice daily (BID), adalimumab (ADA) 40 mg Q2W or placebo (PBO), with background csDMARDs. Persistence analyses of pts receiving tofacitinib 5 or 10 mg BID ± csDMARDs used data pooled from two long-term extension trials (NCT00661661; NCT00413699). Efficacy outcomes to Month (M)12 included: ACR20/50/70 responses, changes from baseline (Δ; BL) in DAS28-4(ESR), CDAI, HAQ-DI and FACIT-F, and DAS28-4(ESR) remission (<2.6). Safety was evaluated to M24 for tofacitinib and ADA. Kaplan-Meier persistence analysis estimated time to discontinuation.Results:2265 pts were included from P3 RCTs. Demographics and BL characteristics were comparable across sexes and treatments. Tofacitinib or ADA vs PBO generally led to significantly higher ACR20/50/70 responses in both sexes through M6. To M12, ACR20/50/70 responses were broadly comparable across active treatments and between sexes, with significant differences favouring males at some time points, including M3 (Figure 1). Statistically significant differences favouring males vs females were observed in DAS28-4(ESR) remission rates at most time points, including M3 (Figure 1); a similar trend was observed for ΔDAS28-4(ESR). ΔCDAI, ΔHAQ-DI and ΔFACIT-F significantly favoured males vs females receiving tofacitinib 5 mg BID at most time points, while ΔHAQ-DI and ΔFACIT-F tended to favour females receiving tofacitinib 10 mg BID. Rates of adverse events (AEs), serious AEs (SAEs), severe AEs and discontinuations due to AEs were slightly higher in females vs males with tofacitinib 5 mg BID; this was generally reversed with tofacitinib 10 mg BID and ADA (Table 1). AEs of special interest (AESI) were comparable between sexes with tofacitinib and ADA, although low event numbers limit interpretation (Table 1). Time to all-cause discontinuation and discontinuation due to AEs/lack of efficacy with tofacitinib 5 mg BID was similar between sexes. Numerical differences favouring females vs males were observed for time to all-cause discontinuation and discontinuation due to AEs with tofacitinib 10 mg BID.Table 1.Safety summary to M24 in pooled DMARD-IR P3 RCTsTofacitinib5 mg BIDTofacitinib10 mg BIDADAPts with events,n (%)Females(N=707)Males(N=133)Females(N=698)Males(N=137)Females(N=162)Males(N=42)AEs562 (79.5)85 (63.9)529 (75.8)107 (78.1)119 (73.5)30 (71.4)SAEs107 (15.1)17 (12.8)71 (10.2)24 (17.5)13 (8.0)6 (14.3)Severe AEs86 (12.2)12 (9.0)55 (7.9)22 (16.1)14 (8.6)5 (11.9)Discontinuations due to AEs87 (12.3)10 (7.5)88 (12.6)10 (7.3)17 (10.5)5 (11.9)Death6 (0.8)4 (3.0)03 (2.2)1 (0.6)2 (4.8)AESISerious infections28 (4.0)6 (4.5)27 (3.9)6 (4.4)2 (1.2)1 (2.4)All HZ (non-serious/serious)35 (5.0)7 (5.3)43 (6.2)5 (3.6)2 (1.2)3 (7.1)MACE5 (0.7)02 (0.3)3 (2.2)03 (7.1)Malignancies (excl. NMSC)7 (1.0)1 (0.8)9 (1.3)1 (0.7)01(2.4)NMSC2 (0.3)5 (3.8)4 (0.6)2 (1.5)1 (0.6)1 (2.4)Venous thromboembolism3 (0.4)03 (0.4)1 (0.7)00HZ, herpes zoster; MACE, major adverse cardiovascular events; NMSC, non-melanoma skin cancerConclusion:Efficacy outcomes with tofacitinib and ADA were generally higher in males and comparable in females vs previously reported mixed population response rates for advanced therapies. Safety findings did not reveal a consistent pattern between sexes. Tofacitinib persistence was similar between sexes.Acknowledgements:Study sponsored by Pfizer Inc. Medical writing support was provided by Christina Viegelmann, CMC Connect, and funded by Pfizer Inc.Disclosure of Interests:H Niall Jones Consultant of: Pfizer Inc, Vibeke Strand Consultant of: AbbVie, Amgen, Arena, AstraZeneca, Bayer, Boehringer Ingelheim, Bristol-Myers Squibb, Celltrion, Corrona, Eli Lilly, Galapagos, Genentech/Roche, Gilead, GlaxoSmithKline, Ichnos, Inmedix, Janssen, Kiniksa, Merck, Myriad Genetics, Novartis, Pfizer Inc, Regeneron, Samsung, Sandoz, Sanofi, Scipher, SetPoint Medical, UCB, Hendrik Schulze-Koops Consultant of: AbbVie, Amgen, Biogen, Bristol-Myers Squibb, Celgene, Eli Lilly, Gilead Sciences, Hexal Sandoz, Hospira, Janssen-Cilag, MSD, Novartis, Pfizer Inc, Roche, UCB, Grant/research support from: Novartis, Pfizer Inc, Eduardo Mysler Speakers bureau: AbbVie, Bristol-Myers Squibb, Eli Lilly, Janssen, Pfizer Inc, Roche, Sanofi, Grant/research support from: Eli Lilly, Pfizer Inc, Roche, Cassandra Kinch Shareholder of: Pfizer Canada ULC, Employee of: Pfizer Canada ULC, David C Gruben Shareholder of: Pfizer Inc, Employee of: Pfizer Inc, Rebecca Germino Shareholder of: Pfizer Inc, Employee of: Pfizer Inc, Carol A. Connell Shareholder of: Pfizer Inc, Employee of: Pfizer Inc, Lihi Eder Speakers bureau: AbbVie, UCB, Consultant of: AbbVie, Celgene, Eli Lilly, Novartis, Pfizer Inc, UCB, Grant/research support from: AbbVie, Eli Lilly, Pfizer Inc, UCB

Background:C-reactive protein (CRP), an objective marker of inflammation, can be used to monitor treatment response to biologics in patients with axial spondyloarthritis (axSpA) in addition to evaluating signs & symptoms. CRP is not elevated in all patients with active axSpA questioning its validity as a universal biomarker of response. Ixekizumab (IXE) demonstrated efficacy in axSpA treatment irrespective of baseline (BL) CRP levels. However, response to IXE categorized on CRP change from BL is unknown.Objectives:To evaluate response to IXE treatment from BL through week (wk) 16 in patients with axSpA categorized according to change in high sensitivity (hs) CRP.Methods:COAST-V (NCT 02696785),-W (NCT02696798), & -X (NCT02757352), were phase 3, multicentre, randomized, controlled trials, investigating the efficacy of IXE 80 mg every 4 & 2 wks in patients with: r-axSpA naïve to biologic disease-modifying antirheumatic drugs (bDMARDs; COAST-V); or who were inadequate responders/intolerant to tumour necrosis factor inhibitors (TNFi; COAST-W); or who fulfilled Assessment of SpondyloArthritis International Society (ASAS) criteria for non-radiographic (nr)axSpA (COAST-X).This post hoc analysis focuses on approved dosing regimens. Depending on BL and wk 16 hsCRP values, patients were categorised as stable low (hsCRP ≤5 mg/L at BL & ≤5 mg/L at wk 16), normalized (hsCRP >5 mg/L at BL & ≤5 mg/L at wk 16) or elevated (hsCRP >5 mg/L at wk 16, irrespective of BL hsCRP). An absolute cutoff of 5 mg/L was used as the stratification factor in all COAST studies. Data were analyzed by treatment arm. Each trial was analyzed separately.For hsCRP subgroups, patient demographics & other characteristics at BL, as well as trajectory over time for the endpoints ASAS40 & Bath Ankylosing Spondylitis Disease Activity Index (BASDAI) 50 are described. Non-responder imputation was used for missing values.Results:In all studies at BL, disease activity & MRI SPARCC score were higher in normalized & elevated subgroups compared to the stable low subgroup - a.In COAST-V, ASAS40 & BASDAI50 response was observed in IXE-treated patients regardless of hsCRP change status by wk 16 vs placebo. The highest ASAS40 & BASDAI50 response rate was reported in patients with normalized hsCRP - b. Similar findings were observed in COAST-W & -X.Table 1.Baseline Patient demographics & other characteristics - ITT population, per CRP subgroupCOAST-V(r-axSpA, bDMARD naive)COAST-W(r-axSpA, inadequate responders /intolerant to TNFi)COAST-X(non-radiographic axSpA, bDMARD naïve)Stable low (n=79)Norma-lized (n=80)Elevated (n=98)Stable low(n=58)Norma-lized (n=34)Elevated (n=126)Stable low (n=78)Norma-lized(n=40)Elevated (n=81)ParameterAge (years)43.7 (12.1)38.9 (10.9)42.7 (12.0)50.4 (13.3)46.1 (13.8)45.7 (12.5)44.0 (12.8)37.2 (14.6)38.7 (12.8)Male gender, n (%)63 (79.7)71.0 (88.8)78 (79.6)39.0 (67.2)30 (88.2)109 (86.5)35 (44.9)23 (57.5)34 (42)Duration of symptoms since axSpA onset (years)17.5 (11.2)14.4 (9.3)16.1 (9.9)21.7 (12.9)16.8 (11.6)18.9 (10.9)12.1 (9.9)10.3 (9.7)9.5 (9.0)HLA-B27 positive, n (%)69 (87.3)75.0 (93.8)89 (90.8)31.0 (91.2)101 (80.2)101 (80.2)48 (61.5)31 (77.5)67 (82.7)BASDAI Total Score6.5 (1.4)6.7 (1.5)7.0 (1.1)7.4 (1.5)7.3 (1.3)7.4 (1.3)6.9 (1.5)7.1 (1.6)7.2 (1.5)ASDAS Total Score3.1 (0.5)3.9 (0.6)4.2 (0.7)3.5 (0.6)4.3 (0.6)4.4 (0.8)3.2 (0.6)4.2 (0.8)4.2 (0.9)Spinal Pain due to AS7.0 (1.5)7.0 (1.5)7.5 (1.3)7.8 (1.5)7.7 (1.5)7.9 (1.4)7.2 (1.7)7.5 (1.7)7.5 (1.6)Patients with peripheral articular manifestations (>=1 TJC or >=1 SJC)47 (59.5)40 (50)62 (63.3)43 (74.1)24 (70.6)86 (68.3)56 (71.8)33 (82.5)66 (81.5)MRI Spine SPARCC ScoreMRI SIJ SPARCC ScoreMRI SPARCC Score6.7 (11.2)21.8 (27.3)20.7 (25.7)1.2 (2.3)7.0 (7.6)10.4 (17.0)5.2 (6.6)6.1 (8.2)6.2 (10.5)Conclusion:IXE reduced clinical disease activity in patients with axSpA irrespective of hsCRP change from BL to wk 16. Improvement in hsCRP level was associated with overall response rates.Acknowledgements:The authors would like to acknowledge Philana Fernandes, an employee of Eli Lilly and Company, for her for writing and editorial support.Disclosure of Interests:Helena Marzo-Ortega Consultant of: Celgene, Janssen, Eli Lilly, Novartis, Pfizer, UCB, Grant/research support from: Janssen, Novartis, Xavier Juanola: None declared, Tadashi Okano Speakers bureau: Asahi Kasei, Astellas, Abbvie, Ayumi, Chugai, Daiichi-Sankyo, Eisai, Eli Lilly, Janssen, Mitsubishi Tanabe, Novartis, Ono, Pfizer, Sanofi and Takeda, Grant/research support from: Asahi Kasei, Abbvie, Chugai, Eisai, Yves Schymura Employee of: Eli Lilly, Andrew Bradley Shareholder of: Eli Lilly, Employee of: Eli Lilly, Jens Gerwien Shareholder of: Eli Lilly, Employee of: Eli Lilly, Brigitte Monsberger Shareholder of: Eli Lilly, Employee of: Eli Lilly, Soyi Liu Leage Employee of: Eli Lilly, Daniel Aletaha Speakers bureau: Abbvie, Amgen, Celgene, Lilly, Medac, Merck, Novartis, Pfizer, Roche, Sandoz, Sanofi/Genzyme, Grant/research support from: Abbvie, Lilly, Novartis, Roche, Mikkel Østergaard Speakers bureau: Abbvie, Celgene, Eli-Lilly, Janssen, Novartis, Pfizer, Roche, Sanofi and UCB, Consultant of: Abbvie, BMS, Boehringer-Ingelheim, Celgene, Eli-Lilly, Hospira, Janssen, Merck, Novartis, Novo, Orion, Pfizer, Regeneron, Roche, Sandoz, Sanofi and UCB, Grant/research support from: Abbvie, BMS, Merck, Celgene, Novartis

Background:Targeted DMARDs may dampen the inflammatory response in COVID-19, perhaps leading to a less severe clinical course. However, some DMARD targets may impair viral immune defenses. Due to sample size limitations, previous studies of DMARD use and COVID-19 outcomes have combined several heterogeneous rheumatic diseases and medications, investigating a single outcome (e.g., hospitalization).Objectives:To investigate the associations of baseline use of biologic or targeted synthetic (b/ts) DMARDs with a range of poor COVID-19 outcomes in rheumatoid arthritis (RA).Methods:We analyzed voluntarily reported cases of COVID-19 in patients with rheumatic diseases in the COVID-19 Global Rheumatology Alliance physician registry (March 12, 2020 - January 6, 2021). We investigated RA treated with b/tsDMARD at the clinical onset of COVID-19 (baseline): abatacept (ABA), rituximab (RTX), Janus kinase inhibitors (JAK), interleukin-6 inhibitors (IL6i), or tumor necrosis factor inhibitors (TNFi). The outcome was an ordinal scale (1-4) for COVID-19 severity: 1) no hospitalization, 2) hospitalization without oxygen need, 3) hospitalization with any oxygen need or ventilation, or 4) death. Baseline covariates including age, sex, smoking, obesity, comorbidities (e.g., cardiovascular disease, cancer, interstitial lung disease [ILD]), concomitant non-biologic DMARD use, glucocorticoid use/dose, RA disease activity, country, and calendar time were used to estimate propensity scores (PS) for b/tsDMARD. The primary analysis used PS matching to compare each drug class to TNFi. Ordinal logistic regression estimated ORs for the COVID-19 severity outcome. In a sensitivity analysis, we used traditional multivariable ordinal logistic regression adjusting for covariates without matching.Results:Of the 1,673 patients with RA on b/tsDMARDs at the onset of COVID-19, (mean age 56.7 years, 79.6% female) there were n=154 on ABA, n=224 on RTX, n=306 on JAK, n=180 on IL6i, and n=809 on TNFi. Overall, 498 (34.3%) were hospitalized and 112 (6.7%) died. Among all patients, 353 (25.3%) were ever smokers, 197 (11.8%) were obese, 462 (27.6%) were on glucocorticoids, 1,002 (59.8%) were on concomitant DMARDs, and 299 (21.7%) had moderate/high RA disease activity. RTX users were more likely than TNFi users to have ILD (11.6% vs. 1.7%) and history of cancer (7.1% vs. 2.0%); JAK users were more likely than TNFi users to be obese (17.3% vs. 9.0%). After propensity score matching, RTX was strongly associated with greater odds of having a worse outcome compared to TNFi (OR 3.80, 95% CI 2.47, 5.85; Figure). Among RTX users, 42 (18.8%) died compared to 27 (3.3%) of TNFi users (Table). JAK use was also associated with greater odds of having a worse COVID-19 severity (OR 1.52, 95%CI 1.02, 2.28). ABA or IL6i use were not associated with COVID-19 severity compared to TNFi. Results were similar in the sensitivity analysis and after excluding cancer or ILD.Table 1.Frequencies for the ordinal COVID-19 severity outcome for patients with RA on biologic or targeted synthetic DMARDs (n=1673).COVID-19 outcomes by severity scale (n,%)ABAn=154RTXn=224JAKn=306IL6in=180TNFi n=8091)Not hospitalized113 (73.3%)121 (54.0%)220 (71.9%)150 (83.3%)666 (82.3%)2)Hospitalization without oxygenation10 (6.5%)14 (6.2%)11 (3.6%)9 (5.0%)53 (6.5%)3)Hospitalization with any oxygenation or ventilation16 (10.4%)47 (21.0%)52 (17.0%)16 (8.9%)63 (7.8%)4)Death15 (9.7%)42 (18.8%)23 (7.5%)5 (2.8%)27 (3.3%)Conclusion:In this large global registry of patients with RA and COVID-19, baseline use of RTX or JAK was associated with worse severity of COVID-19 compared to TNFi use. The very elevated odds for poor COVID-19 outcomes in RTX users highlights the urgent need for risk-mitigation strategies, such as the optimal timing of vaccination. The novel association of JAK with poor COVID-19 outcomes requires replication.Acknowledgements:The views expressed here are those of the authors and participating members of the COVID-19 Global Rheumatology Alliance and do not necessarily represent the views of the ACR, EULAR, the UK National Health Service, the National Institute for Health Research, the UK Department of Health, or any other organization.Disclosure of Interests:Jeffrey Sparks Consultant of: Bristol-Myers Squibb, Gilead, Inova, Janssen, and Optum, unrelated to this work, Grant/research support from: Amgen and Bristol-Myers Squibb, unrelated to this work, Zachary Wallace Consultant of: Viela Bio and MedPace, outside the submitted work., Grant/research support from: Bristol-Myers Squibb and Principia/Sanofi, Andrea Seet: None declared, Milena Gianfrancesco: None declared, Zara Izadi: None declared, Kimme Hyrich Speakers bureau: Abbvie unrelated to this study, Grant/research support from: BMS, UCB, and Pfizer, all unrelated to this study, Anja Strangfeld Paid instructor for: AbbVie, MSD, Roche, BMS, Pfizer, outside the submitted work, Grant/research support from: grants from a consortium of 13 companies (among them AbbVie, BMS, Celltrion, Fresenius Kabi, Lilly, Mylan, Hexal, MSD, Pfizer, Roche, Samsung, Sanofi-Aventis, and UCB) supporting the German RABBIT register, outside the submitted work, Laure Gossec Consultant of: Abbvie, Biogen, Celgene, Janssen, Lilly, Novartis, Pfizer, Sanofi-Aventis, UCB, unrelated to this study, Grant/research support from: Lilly, Mylan, Pfizer, all unrelated to this study, Loreto Carmona: None declared, Elsa Mateus Grant/research support from: grants from Abbvie, Novartis, Janssen-Cilag, Lilly Portugal, Sanofi, Grünenthal S.A., MSD, Celgene, Medac, Pharmakern, GAfPA; grants and non-financial support from Pfizer, outside the submitted work, Saskia Lawson-Tovey: None declared, Laura Trupin: None declared, Stephanie Rush: None declared, Gabriela Schmajuk: None declared, Patti Katz: None declared, Lindsay Jacobsohn: None declared, Samar Al Emadi: None declared, Leanna Wise: None declared, Emily Gilbert: None declared, Ali Duarte-Garcia: None declared, Maria Valenzuela-Almada: None declared, Tiffany Hsu: None declared, Kristin D’Silva: None declared, Naomi Serling-Boyd: None declared, Philippe Dieudé Consultant of: Boerhinger Ingelheim, Bristol-Myers Squibb, Lilly, Sanofi, Pfizer, Chugai, Roche, Janssen unrelated to this work, Grant/research support from: Bristol-Myers Squibb, Chugaii, Pfizer, unrelated to this work, Elena Nikiphorou: None declared, Vanessa Kronzer: None declared, Namrata Singh: None declared, Manuel F. Ugarte-Gil Grant/research support from: Janssen and Pfizer, Beth Wallace: None declared, Akpabio Akpabio: None declared, Ranjeny Thomas: None declared, Suleman Bhana Consultant of: AbbVie, Horizon, Novartis, and Pfizer (all <$10,000) unrelated to this work, Wendy Costello: None declared, Rebecca Grainger Speakers bureau: Abbvie, Janssen, Novartis, Pfizer, Cornerstones, Jonathan Hausmann Consultant of: Novartis, Sobi, Biogen, all unrelated to this work (<$10,000), Jean Liew Grant/research support from: Yes, I have received research funding from Pfizer outside the submitted work., Emily Sirotich Grant/research support from: Board Member of the Canadian Arthritis Patient Alliance, a patient run, volunteer based organization whose activities are largely supported by independent grants from pharmaceutical companies, Paul Sufka: None declared, Philip Robinson Speakers bureau: Abbvie, Eli Lilly, Janssen, Novartis, Pfizer and UCB (all < $10,000), Consultant of: Abbvie, Eli Lilly, Janssen, Novartis, Pfizer and UCB (all < $10,000), Pedro Machado Speakers bureau: Yes, I have received consulting/speaker’s fees from Abbvie, BMS, Celgene, Eli Lilly, Janssen, MSD, Novartis, Pfizer, Roche and UCB, all unrelated to this study (all < $10,000)., Consultant of: Yes, I have received consulting/speaker’s fees from Abbvie, BMS, Celgene, Eli Lilly, Janssen, MSD, Novartis, Pfizer, Roche and UCB, all unrelated to this study (all < $10,000)., Jinoos Yazdany Consultant of: Eli Lilly and AstraZeneca unrelated to this project

Background: Peripheral T-cell lymphoma (PTCL) is an aggressive form of non-Hodgkin lymphoma (NHL) that is typically associated with a poor prognosis. Romidepsin is a histone deacetylase inhibitor approved by the US Food and Drug Administration for patients with PTCL who have received at least 1 prior therapy (J Clin Oncol. 2012;30:631). Presented here is the final analysis of a phase III randomized study comparing romidepsin + cyclophosphamide, doxorubicin, vincristine, and prednisone (Ro-CHOP) with CHOP in patients with previously untreated PTCL. Methods: Ro-CHOP (NCT01796002) is a randomized multicenter phase III study in adult patients with previously untreated PTCL (i.e. nodal or extranodal entities including primary cutaneous non epidermotropic TCL, with the exclusion of ALK-positive anaplastic large cell lymphomas and EBV-positive extranodal NK/T-cell lymphomas). Diagnostic biopsies were centrally reviewed (94%), and patients were randomized based on International Prognostic Index (IPI) score at baseline (&lt; 2 vs ≥ 2), age (≤ 60 vs &gt; 60 y), and histology type (nodal vs extranodal) to receive either Ro-CHOP or CHOP. Two-sided P-value from log-rank test stratified by all 3 stratification factors was used. All patients received CHOP in 3-week cycles for 6 cycles. Romidepsin, 12 mg/m2, was administered intravenously on days 1 and 8 of each 3-week cycle for 6 cycles (Lancet Haematol. 2015;2:e160), with dose reductions to 10 and 8 mg/m2 based on toxicity. The primary end point was progression-free survival (PFS) per Response Adjudication Committee assessment according to International Working Group 1999 criteria. Secondary end points included overall survival (OS), objective response rate (ORR), complete response (CR) + CR unconfirmed (CRu), and safety. Results: As of the December 13, 2019 cutoff date, 421 patients were included in the intention-to-treat population (Ro-CHOP, n = 211; and CHOP, n =210). Median age was 65 y (range, 25-81); 76 patients (18%) had ECOG PS of 2-3; 267 (63%) had Ann Arbor stage IV disease; and 342 (81%) had IPI score ≥ 2. At a median follow-up of 27.5 mo, the study did not meet its primary end point because Ro-CHOP did not show a statistically significant PFS improvement vs CHOP alone. Median PFS for Ro-CHOP vs CHOP was 12.0 mo (95% CI, 9.0-25.8) vs 10.2 mo (95% CI, 7.4-13.2), with a hazard ratio of 0.81 (95% CI, 0.63-1.04; P = 0.096). Median OS for Ro-CHOP vs CHOP was 51.8 mo (95% CI, 35.7-72.6) vs 42.9 mo (95% CI, 29.9-not evaluable). ORR of Ro-CHOP vs CHOP was 63% vs 60% with CR + CRu rates of 41% vs 37%. In the safety population (Ro-CHOP, n = 210; CHOP, n = 208), any-grade treatment emergent adverse events (TEAEs) that occurred ≥ 40% in the Ro-CHOP or CHOP arms, respectively, included anemia (67% vs 38%), nausea (55% vs 31%), thrombocytopenia (52% vs 17%), neutropenia (51% vs 37%), and vomiting (40% vs 10%). Grade 3/4 TEAEs that occurred in ≥ 30% of patients in the Ro-CHOP or CHOP arm, respectively, included thrombocytopenia (50% vs 10%), neutropenia (49% vs 33%), anemia (47% vs 17%), and leukopenia (32% vs 20%). One grade 5 TEAE occurred in the Ro-CHOP arm (E. coli sepsis), and 2 occurred in the CHOP arm (colitis and acute cholecystitis). In the Ro-CHOP vs CHOP arms, TEAEs led to CHOP dose interruption in 75 (36%) vs 42 (20%) patients, reduction in 54 (26%) vs 31 (15%) patients, and discontinuation in 7 (3%) and 6 (3%) patients, respectively. In the Ro-CHOP arm, TEAEs led to romidepsin interruption, reduction, and discontinuation in 132 (63%), 77 (37%), and 17 (8%) patients, respectively. Conclusions: The addition of romidepsin to CHOP did not improve PFS, the primary endpoint of the study, and response rates and OS appeared similar with the combination. The toxicity profile of Ro-CHOP was consistent with its phase Ib/II data, with no unexpected findings. The high rates of TEAEs with the addition of romidepsin hampered the ability to adequately administer 6 cycles of CHOP. Additional exploratory analyses to compare Ro-CHOP outcomes in specific patient subgroups are ongoing. The combination of CHOP plus romidepsin does not represent an advance in the standard of care for patients with previously untreated PTCL. Figure Disclosures Bachy: Beigene: Membership on an entity's Board of Directors or advisory committees; Roche, Gilead: Consultancy; Amgen: Research Funding; Roche, Celgene, Amgen, Janssen, Gilead, Novartis, Sanofi: Honoraria. Camus:PFIZER: Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); ROCHE: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); JANSSEN: Honoraria; AMGEN: Honoraria. Thieblemont:Celgene: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Bristol-Myers Squibb: Consultancy, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Cellectis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company), Speakers Bureau; Hospira: Research Funding; Incyte: Honoraria; Roche: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company), Research Funding; AbbVie: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Kite, a Gilead Company: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Amgen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Novartis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: travel support; Bayer: Honoraria. Casasnovas:Amgen: Consultancy, Honoraria; MSD: Consultancy, Honoraria; Roche: Consultancy, Honoraria, Other: travel, accomodations, expenses, Research Funding; Gilead: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company), Research Funding; Takeda: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company), Research Funding; Abbvie: Consultancy, Honoraria. Ysebaert:Roche: Consultancy; AbbVie: Consultancy; Janssen: Consultancy. Guidez:BMS: Honoraria; CELGENE: Honoraria; TAKEDA: Honoraria; JANSEN: Honoraria; AMGEN: Honoraria; Service Hématologie et Thérapie cellulaire CHU POITIERS: Current Employment. Kim:JJ: Research Funding; Celltrion: Research Funding; Kyowa Kirn: Research Funding; Donga: Research Funding; Mundipharma: Research Funding; Pfizer: Research Funding; F. Hoffmann-La Roche: Research Funding. Lim:National Cancer Centre Singapore: Current Employment. André:Amgen: Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company), Research Funding; Johnson & Johnson: Research Funding; CHU UCL Namur, site Godinne, Yvoir, Belgium: Current Employment; Novartis: Consultancy, Research Funding; Gilead: Consultancy, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Karyopharm: Consultancy; Bristol-Myers-Squibb: Consultancy, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Takeda: Consultancy; Celgene: Other, Research Funding; Roche: Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company), Research Funding; Abbvie: Consultancy; Seattle Genetics: Consultancy. Martin Garcia-Sancho:Celgene, Eusa Pharma, Gilead, iQuone, Kyowa Kirin, Roche, Morphosys: Consultancy; Roche, Celgene, Janssen, Servier, Gilead: Honoraria. Penarrubia Ponce:Novartis: Consultancy; Takeda: Consultancy, Honoraria; Janssen: Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Roche: Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Servier: Honoraria; HOSPITAL CLINICO UNIVERSITARIO DE VALLADOLID: Current Employment; Abbvie: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Amgen: Consultancy; Celgene: Consultancy, Honoraria; Incyte: Consultancy. Staber:msd: Consultancy, Honoraria; Takeda: Consultancy, Honoraria; Astra Zeneca: Consultancy, Honoraria; Janssen: Consultancy, Honoraria; Gilead: Consultancy, Honoraria; AbbVie: Consultancy, Honoraria; Roche: Consultancy, Honoraria, Research Funding; Celgene/ BMS: Consultancy, Honoraria. Trotman:BeiGene: Research Funding; Takeda: Research Funding; F. Hoffmann-La Roche: Research Funding; Celgene: Research Funding; PCYC: Research Funding. Hüttmann:Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Roche: Other: Travel expenses; University Hospital Essen, University of Duisburg-Essen, Essen, Germany: Current Employment; Seattle Genetics: Research Funding; Lead Discovery Center GmbH: Consultancy; Celgene: Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); Gilead: Honoraria. Gaulard:Roche: Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); INNATE PHARMA: Research Funding; TAKEDA: Consultancy, Honoraria, Research Funding; CHU Henri Mondor, Assistance Publique-Hôpitaux de Paris: Current Employment. Delfau-Larue:MUNDIPHARMA: Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company); ROCHE: Honoraria; GILEAD: Honoraria; AMGEN: Honoraria. De Leval:Lausanne University Hospital & Lausanne University Institute of Pathology: Current Employment; Lunaphore Technologies SA: Consultancy, Honoraria; Abbvie: Honoraria; Roche Diagnostics: Honoraria. Meignan:ROCHE: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company). Li:BMS: Current Employment, Current equity holder in publicly-traded company. Morschhauser:F. Hoffmann-La Roche: Consultancy, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Gilead: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Janssen: Honoraria; Abbvie: Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees; Epizyme: Membership on an entity's Board of Directors or advisory committees; Genentech, Inc.: Consultancy; Servier: Consultancy. Delarue:Celgene International, a BMS company: Current Employment; BMS: Current equity holder in private company. OffLabel Disclosure: Romidepsin is not approved for patients with previously untreated PTCL.

In the last few decades, the studies in second language acquisition have not answered the question what mechanisms a human’s brain uses to make acquisition of language(s) possible. A neurocognitive model which tries to address SLA from such a perspective was suggested by Ullman (2005; 2015), according to which, “both first and second languages are acquired and processed by well-studied brain systems that are known to subserve particular nonlanguage functions” (Ullman, 2005: 141). The brain systems in question have analogous roles in their language and nonlanguage functions. This article is meant to critically analyse the suggested DP model within the context of neurocognitive studies of L2; and evaluate its contribution to the field of SLA studies. References Aboitiz, F. (1995). Working memory networks and the origin of language areas in the human brain. Medical Hypothesis, 25, 504-506. Aboitiz, F. & Garcia, R. (1977). The anatomy of language revisited. Biological Research, 30, 171-183. Aboitiz, F., Garcia, R., Brunetti, E. & Bosman, C. (2006). The origin of Broca’s area and its connections from an ancestral working memory network. In: Broca’s Region, (pp. 3-16). Y.Grodzinsky and K. Amunts, (Eds.). Oxford: Oxford University Press. Alexander, M. P. (1997). Aphasia: clinical and anatomic aspects. In: Behavioral Neurology and Neuropsychology, (pp. 133–150). T. E. Feinberg, & M. J. Farah, (Eds.). New York: McGraw-Hill. Alexander, G.E., DeLong, M.R. & Strick, P.L. (1986). Parallel organisation of functionally segregated circuits linking basal ganglia and cortex. Annual Review of Neuroscience, 9, 357-381. Anderson, J. R., Bothell, D., Byrne, M. D., Douglass, S., Lebiere, C., Qin, Y. (2004). An integrated theory of the mind. Psychological Review, 111, 1036–1060. Birdsong, D., ed. (1999). Second Language Acquisition and the Critical Period Hypothesis. Mahwah, NJ: Lawrence Erlbaum Associates. Buckner, R. L., & Wheeler, M. E. (2001). The cognitive neuroscience of remembering. Nature Review Neuroscience, 2(9), pp. 624–634. Calabresi, P., Centonze, D., Gubellini, P., Pisani, A. & Bernardi, G. (2000). Acetyl-chlorine-ediated modulation of striatal function. Trends in Neurosciences, 23(3), 120-126. Cepeda, N.J., Vul. E., Rohrer, D., Wixted, J. T., Pashler, H. (2008) Spacing effects in learning: A temporal ridgeline of optimal retention. Psychological Science, 19, 1095-1102. Chun, M.M. (2000). Contextual cueing of visual attention. Trends in Cognitive Science, 4(5), 170-178.Crosson, B., Benefield, H., Cato, M. A., Sadek, R. J., Moore, A. B., Auerbach, E. J., Gokcay, D., Leonard, C.M. & Briggs, R.W. (2003). Left and right basal ganglia activity during language generation: contributions to lexical, semantic and phonological processes. Journal of the International Neuropsychological Society, 9, 1061-1077. Devescovi, A., Caselli, M. C., Marchione, D., Pasqualetti, P., Reilly, J., & Bates, E. (2005). A crosslinguistic study of relationship between grammar and lexical development. Journal of Child Language, 32, 759–786. Di Giulio, D.V., Seidenberg, M., O’Leary, D. S. & Raz, N. (1994). Procedural and declarative memory: a developmental study. Brain and Cognition, 25(1), 79-91. Dionne, G., Dale, P., Boivin, M., & Plomin, R. (2003). Genetic evidence for bidirectional effects of early lexical and grammatical development. Child Development, 74, 394–412. Eichenbaum, H. & Cohen, N.J. (2001). From Conditioning to Conscious Recollection: Memory Systems of the Brain. Oxford: Oxford University Press. Ellis, N.C. (1994). Implicit and Explicit Learning of Languages. New York: Academic Press. Ellis, N.C. (2002). Reflections on frequency effects in language processing. Studies in Second language acquisition, 24, 297-339. Ellis, R., Loewen, S., Elder, C., Erlam, R., Philp, J., Reinders, H. (2009). Implicit and Explicit Knowledge in Second Language Learning, Testing and Teaching. Bristol: Multilingual Matters. Embick, D., Marantz, A., Miyashita, Y., O’Neil, W., & Sakai, K. L. (2000). A syntactic specialization for Broca’s area. Proceedings of the National Academy of Sciences USA, 97, (6150–6154). Fabbro, F., Clarici, A., Bava, A. (1996). Effects of left basal ganglia lesions on language production. Perceptual and Motor Skills, 82(3), 1291–1298. Ferman, S., Olshtain, E., Schechtman, E. & Karni, A. (2009). The acquisition of a linguistic skill by adults: procedural and declarative memory interact in the learning of an artificial morphological rule. Journal of Neurolinguistics, 22, 384-412. Retrieved from: http://www.elsevier.com/locate/jneuroling. Fredriksson, A. (2000). Maze learning and motor activity deficits in adult mice induced by iron exposure during a critical postnatal period. Developmental Brain Research, 119(1), 65-74. Friederici, A. (2002). Towards a neural basis of auditory sentence processing. Trends in Cognitive Sciences, 6(2), 78–84. Friederici, A., von Cramon, D., Kotz, S. (1999). Language related brain potentials in patients with cortical and subcortical left hemisphere lesions. Brain, 122, 1033-1047. Goodale, M. A. (2000). Perception and action in the human visual system. In: The New Cognitive Neurosciences, (pp. 365-378). M. S. Gazzaniga, (ed.). Cambridge, MA: MIT Press, Hahne, A., Friederichi, D. (2003). Processing a second language: late learners’ comprehension strategies as revealed by event-related brain potentials. Bilingualism: Language and Cognition, 4, 1-42. Henke, K (2010) A model for memory systems based on processing modes rather than consciousness. Nature Reviews Neuroscience, 11, 523–532. Hikosaka, O., Sakai, K., Nakahara, H., Lu, X., Miyachi, S., Nakamura, K., Rand, M. K. (2000). Neural mechanisms for learning of sequential procedures. In: The New Cognitive Neurosciences, (pp. 553-572). M. S. Gazzaniga, (ed.). Cambridge, MA: MIT Press. Joanisse, M.F., Seidenberg, M.S. (1999). Impairments in verb morphology after brain injury: a connectionist model. Proceedings of the National Academy of Science USA. 96, (7592 –7597). Middleton, F.A., Strick, P.L. (2000). Basal ganglia and cerebral loops: motor and cognitive circuits. Brain research reviews, 31, 236-250. Moro, A., Tettamanti, M., Perani, D., Donati, C., Cappa, S. F., & Fazio, F. (2003). Syntax and the brain: disentangling grammar by selective anomalies. Neuroimage, 13(1), 110–118. Neurolinguistic and Psycholinguistic Perspectives on SLA. (2010). Arabski, J. & Wojtaszek, A. (Eds.), Bristol: Multilingual Matters. Newport, E. (1993). Maturational constraints on language learning. Cognitive Science, 14(1), 11-28. Opitz, B. & Friederichi, A.D. (2003). Interactions of the hippocampal system and the prefrontal cortex in learning language-like rules. Neuroimage, 19(4), 1730-1737. Packard, M.& Knowlton, B. (2002). Learning and memory functions of the basal ganglia. Annual Review of Neuroscience, 25, 563–593. Park, D., Lautenschlager, G., Hedden, T., Davidson, N., Smith, A. & Smith, P. (2002). Models of visuospatial and verbal memory across the adult life span. Psychology and Aging, 16, 299-320. Peelle, J.E., McMillan, C., Moore, P., Grossman, M. & Wingfield, A. (2004). Dissociable patterns of brain activity during comprehension of rapid and syntactically complex speech: evidence from fMRI. Brain and Language, 91, 315-325. Pinker, S. (1994). The Language Instinct. New York: William Morrow. Poldrack, R., Packard, M. G. (2003). Competition among multiple memory systems: converging evidence from animal and human brain studies. Neuropsychologia, 41(3), 245–251. Roediger, H.L., Butler, A.C. (2011). The critical role of retrieval practice in long-term retention. Trends in Cognitive Science, 15, 20-27. Schlaug, G. (2001). The brain of musicians: a model for functional and structural adaptation. Annals of the New York Academy of Sciences, 930(1), 281-299. Squire, L.R., Knowlton, B.J. (2000). The medial temporal lobe, the hippocampus, and the memory systems of the brain. In: The New Cognitive Neurosciences. (pp. 765-780). M. S. Gazzaniga, Ed. Cambridge, MA: MIT Press, Squire, L. R., Zola, S. M. (1996). Structure and function of declarative and nondeclarative memory systems. Proceedings of the National Academy of Sciences USA, 93. (13515–13522). Sun, R., Zhang, X. (2004). Top-down versus bottom-up learning in cognitive skill acquisition. Cognitive Systems Research, 5, 63–89. Ullman, M.T. (2004). Contributions of memory circuits to language: the declarative/procedural model. Cognition, 92(1-2), 231-70. Ullman, M.T. (2005). A cognitive neuroscience perspective on second language acquisition: the declarative/procedural model. In: Adult Second Language Acquisition, (pp. 141-178). C. Sanz, (ed.). Washington, DC: Georgetown University Press. Ullman, M.T. & Pieport, E.I. (2005). Specific language impairment is not specific to language: the procedural deficit hypothesis. Cortex, 41, 399-433. Ullman, M. (2006). Is Broca’s area part of a basal ganglia thalamocortical circuit? In: The Cortex: Integrative Models of Broca’s Area and the Ventral Premotor Cortex. (pp. 480-485). R. Schubotz & C. Fiebach, (Eds.). Milan: Masson. Ullman, M. (2015) The declarative / procedural model: A neurobiologically motivated theory of first and second language. In: Theories in Second Language Acquisition: An Introduction, (pp. 135-158.) VanPatten, B. and J. Williams, (Eds.). 2nd ed. New York: Routledge. Ullman, M. and Lovelett, J. (2016). Implications of the declarative / procedural model for improving second language learning: The role of memory enhancement techniques. Second Language Research, Special issue, 1-27. Zurowski, B., Gostomzyk, J., Gron, G., Weller, R., Schirrmeister, H., Neumeier, B., Spitzer, M., Reske, S.N. & Walter, H. (2002). Dissociating a common working memory network from different neural substrates of phonological and spatial stimulus processing. Neuroimage, 15, 45-57.

1 Modo de enfoque do problemaTodo e qualquer estudo de direito há de partir não de análises pré-jurídicas ou sociológicas, mas é imperioso que seja ele perquirido à luz do Direito positivo. Despiciendo, daí, todo envolvimento com posições e estudos realizados em outros países, salvo para aprimoramento cultural. Evidente que a análise do Direito comparado passa a interessar se o direito alienígena possuir norma igual ou assemelhada à existente no Direito brasileiro. A menção retrospectiva do direito comparado resultaria inútil, da perspectiva de utilidade prática deste trabalho. Mesmo porque, como assinala Marcelo Caetano “há países onde o expropriado pode requerer a reversão ou retrocessão dos bens, restituindo a indenização recebida, ou o expropriante tem o dever de oferecer os bens ao expropriado mediante a devolução do valor pago" (Princípios fundamentais do Direito Administrativo, 1977, p. 468) enquanto que "noutros países entende-se que, em qualquer caso, a conversão dos bens desapropriados no montante da indenização paga é definitiva. Portanto, nunca haverá lugar a reversão ou retrocessão dos bens” (idem, ibidem). Afigura-se-nos dispensável e sem qualquer utilidade prática a apresentação de uma resenha da doutrina estrangeira a propósito do tema. Apenas será feita menção a alguns autores, na medida em que suas afirmações interessarem à análise. Observe-se, tão-somente que o direito de retrocessão em espécie é reconhecido em diversas legislações. Na Itália há previsão legal (art. 60 da Lei 2.359, de 25.6.1865) o mesmo ocorrendo na França (art. 54 do Dec. 58.997, de 23. 10. 58, que fixa o prazo de 10 anos a contar do decreto de desapropriação para que se requeira a retrocessão). Em Portugal há dispositivo semelhante (art. 8 º da Lei 2 .030, de 22.6.48); o que acontece também na Espanha (art. 54 da Lei de 15. 12. 54) e na Alemanha (Lei de 23. 2.57, em seu § 102) Demais de tal inicial observação, perigoso é o estudo de qualquer instituto jurídico atrelado à lei. Impõe-se a análise de determinado instituto a partir da Constituição. Daí inicia-se o estudo da retrocessão. 2 Desapropriação. Desvio de poderDispõe o § 22 do art. 153 da Lei Maior "que é assegurado o direito de propriedade, salvo o caso de desapropriação por necessidade ou utilidade pública ou por interesse social, mediante previa e justa indenização em dinheiro...”. Assegura-se o direito de propriedade que cede apenas, ante o interesse coletivo, representado pelo Estado. Ao mesmo tempo em que garante a propriedade, a Constituição assegura ao Estado o poder de retirá-la mediante desapropriação. Esta pode ser entendida como "o procedimento administrativo através do qual o Poder Público compulsoriamente despoja alguém de uma propriedade e a adquire para si, mediante indenização, fundada em um interesse público" (Elementos de Direito Administrativo, Celso Antônio Bandeira de Mello, 1980, p. 188). Caracteriza-se a desapropriação pela retirada compulsória do bem do domínio particular, com sua transferência ao domínio público, sob fundamento de interesse público mediante indenização. O fulcro da permissão legal para a transferência do domínio é o interesse público, ou seja, finalidade prevista no próprio ordenamento jurídico a ser perseguido pelo Estado. Sob a rubrica interesse público albergam-se todos os conteúdos possíveis de utilidade coletiva desde que alcançados pelo sistema de normas (sob o rótulo interesse público acolhe-se a necessidade ou utilidade pública e o interesse social). O poder de desapropriação deflui do domínio eminente que possui o Poder Público sobre todas as coisas materiais e imateriais sujeitas ao âmbito espacial de validade do sistema jurídico. O poder de desapropriação pode ser decomposto em três aspectos: a) transferência compulsória de alguma coisa; b) mediante indenização e c) sob o fundamento de interesse público. A desapropriação, como forma originária de aquisição de domínio, implica na compulsoriedade da transferência do bem do domínio particular para o público. Sempre haverá indenização, devidamente apurada através do processo próprio ou mediante acordo de vontades. E, o que mais nos interessa, há que vir fundamentada em interesse público, sob pena de invalidade. A competência, no Direito, não é dada a qualquer título. Sempre é outorgada a determinado agente para que persiga interesses coletivos ou mais propriamente denominados públicos, sendo estes apurados pela análise de todo o sistema de normas. A visão completa da competência apenas pode ser entrevista, pois, em contraste com a finalidade descrita na norma legal. Desviando-se o agente administrativo dos fins que lhe foram traçados pelo sistema de normas, incide no desvio de poder (ou de finalidade, como dizem alguns). 3 Conceito de retrocessãoA retrocessão implica no direito do expropriado de retomar a propriedade do imóvel que lhe fora retirada compulsoriamente pelo Poder Público. Os léxicos consignam que "retrocessão é o ato pelo qual o adquirente de um bem transfere de volta a propriedade desse bem àquele de quem o adquiriu" (Novo Dicionário Aurélio, lª ed., p. 1.231). Assinala Oliveira Cruz que "a retrocessão é um instituto de Direito Público, destinado a fazer voltar ao domínio do desapropriado os bens que saíram do seu patrimônio, por efeito de uma desapropriação por utilidade pública" (Da desapropriação, p. 119). E, acrescenta que "a retrocessão tem, indiscutivelmente, uma feição real porque significa um direito que só se desliga do imóvel quando preenchidos os fins determinantes da desapropriação" (ob. cit., p. 121). Assim entendida a retrocessão, como defluente do próprio preceito constitucional que assegura a propriedade e resguarda sua retirada apenas e exclusivamente pela desapropriação por necessidade, utilidade pública ou interesse social, não há como confundi-la com a preempção ou prelação, ou assimilá-la a qualquer tipo de direito pessoal. A fixação de tal premissa é fundamental para todo o desenvolvimento do trabalho e para alicerçar as conclusões que serão apontadas ao final. Daí porque não se pode concordar com a assertiva feita por alguns autores de que se cuida de simples obrigação imposta ao Poder Público de oferecer ao ex-proprietário o bem que lhe desapropriou, se este não tiver o destino para o qual fora expropriado (Múcio de Campos Maia, "Ensaio sobre a retrocessão", in RDA, 34/1-11). Pela própria dúvida no conteúdo do conceito, já os autores manifestaram-se surpresos e a jurisprudência claudicou sobre a análise do tema. Muitos julgados, inclusive, chegaram a admitir a inexistência da retrocessão no Direito brasileiro. Mas, pela análise que será feita e pelas conclusões a que se chegará, ver-se-á não só da existência do instituto no Direito brasileiro, sendo despicienda a indagação do Direito Civil a respeito, defluindo o instituto da só análise do texto constitucional brasileiro. A retrocessão é mero corolário do direito de propriedade, constitucionalmente consagrado e decorre do direito emergente da não utilização do bem desapropriado para o fim de interesse público. Sob tal conteúdo é que o conceito será analisado. 4 Desenvolvimento histórico, no BrasilEm estudo sobre o aspecto histórico do desenvolvimento da retrocessão no Direito brasileiro Ebert Chamoun escreveu que o inc. XXII do art. 179 da Constituição do Império, de 25. 3. 1824 dispôs sobre a possibilidade da desapropriação. E a Lei provincial 57, de 18.3.1836 pela vez primeira cuidou da retrocessão, assegurando que, na hipótese de desapropriação caberia "recurso à Assembleia Legislativa provincial para a restituição da propriedade ... " A admissibilidade da retrocessão foi aceita pelo STF que assim deixou decidido: “que abrindo a mesma Constituição à plenitude o direito de propriedade no art. 72, § 17, a exceção singular da desapropriação por utilidade pública presumida, desde a certeza de não existir tal necessidade, o ato de desapropriação se equipara a violência (V) e deve se rescindir mediante ação do espoliado" (O Direito, vol. 67, 1895, p. 47). A referência é à Constituição republicana de 24.2.1891. Em sua Nova Consolidação das Leis Civis vigentes em 11 de agosto de 1899, Carlos de Carvalho escrevia o art. 855 "se verificada a desapropriação, cessar a causa que a determinou ou a propriedade não for aplicada ao fim para o qual foi desapropriada, considera-se resolvida a desapropriação, e o proprietário desapropriado poderá reivindicá-la". Diversas leis cuidaram do assunto, culminando com a edição do art. 1.150 do CC (LGL\2002\400) que dispôs: ''A União, o Estado, ou o Município, oferecerá ao ex-proprietário o imóvel desapropriado, pelo preço por que o foi, caso não tenha o destino para que se desapropriou". Criou-se, assim, o direito de preempção ou preferência, como cláusula especial à compra e venda. As Constituições que se seguiram igualmente asseguraram o direito de propriedade (a de 1934, no art. 113, 17; a de 1937, no art. 122, 14; a de 1946, no § 16 do art. 141). A Constituição de 1967 igualmente protegeu, juridicamente, a propriedade, permanecendo a garantia com a EC 1/69. 5 Hipóteses de retrocessãoO instituto da retrocessão foi bem analisado por Landi e Potenza quando escrevem que "fatta l'espropriazione, se l'opera non siasi eseguita, e siano trascorsi i termini a tal uopo concessi o prorogati, gli espropriati potranno domandare che sia dall'autorità giudiziaria competente pronunciata la decadenza dell'ottenuta dichiarazione di pubblica utilità, e siano loro restituiti i beni espropriati. In altri termini, la mancata esecuzione dall'opera dimostra l'insussistenza dell’interesse pubblico, che aveva determinato l'affievolimento del diritto di proprietà" (Manuale di Diritto Amministrativo, 1960, p. 501). Mas não é só a falta de destinação do bem a interesse público ou a não construção da obra para que teria sido o imóvel desapropriado que implica na possibilidade de retrocessão, afirmam os autores citados. Também no caso em que ''l'opera pubblica sia stata eseguita: ma qualche fondo, a tal fine espropriato, non abbia ricevuto in tutto o in parte la prevista destinazione" (ob. cit., p. 501). A retrocessão, pois, deflui, do que se lê da lição dos autores transcritos, na faculdade de o expropriado reaver o próprio bem declarado de utilidade pública, - quando lhe tenha sido dado destinação diversa da declarada no ato expropriatório ou não lhe tenha sido dada destinação alguma. De outro lado, esclarece André de Laubadere que "si l'immeuble exproprié ne reçoit pas la destination prévue dans la déclaration d'utilité publique, il est juste que le propriétaire exproprié puisse le récupérer. C'est l'institution de la rétrocession" (Traité deDroit Administratif, 6." ed., 2. 0 vol., p. 250). No direito brasileiro, os conceitos são praticamente uniformes. Eurico Sodré entende que "retrocessão é o direito do ex-proprietário de reaver o imóvel desapropriado, quando este não tenha tido utilização a que era destinado" (A desapropriação por necessidade ou utilidade pública, 1928, pp. 85-86). Firmino Whitaker afirma que "é direito que tem o ex-proprietário de readquirir o imóvel desapropriado mediante a restituição do valor recebido, quando não tenha sido o mesmo imóvel aplicado em serviço de ordem pública" (Desapropriação, 3ª ed., p. 23, 1946). Cretella Junior leciona que "é o direito do proprietário do imóvel desapropriado de reavê-lo ou de receber perdas e danos, pelos prejuízos sofridos, sempre que ocorrer inaproveitamento, cogitação de venda ou desvio de poder do bem expropriado" (Comentários às leis de desapropriação, 2.ª ed., 2.ª tiragem, 1976, p. 409). Fazendo a distinção prevista por Landi e Potenza, escreve Marienhoff que "la retrocesión, en cambio, sólo puede tener lugar en las dos siguientes hipótesis: a) cuando, después de la cesión amistosa o avenimiento, o después de terminado el juicio de expropiación, el expropiante afecta el bien o cosa a un destino diferente del tenido en cuenta por el legislador ai disponer la expropiación y hacer la respectiva calificación de utilidad publica; b) cuando efectuada la cesión amistosa o avenimiento, o terminado el juicio de expropiación, y transcurrido cierto plazo el expropiante no le dá al bien o cosa destino alguno" (Tratado de Derecho Administrativo, T. IV, 2ª ed., p. 369). Embora os autores costumem distinguir as hipóteses de cabimento da retrocessão, parece-nos que no caso de o Poder Público alterar a finalidade para que houvera decretado a desapropriação não existe o direito à retrocessão. Isto porque a Constituição Federal como já se viu, alberga no conceito "interesse público" a mais polimorfa gama de interesses. Assim, se desapropriado imóvel para a construção de uma escola, mas constrói-se um hospital, não nos parece ter havido "desvio de poder" ou de "finalidade". Simplesmente houve desvio do fim imediato, mas perdura o fim remoto. O interesse público maior, presente no ordenamento jurídico ficou atendido. Simplesmente, por interesses imediatos do Poder Público, mas sempre dentro da competência outorgada pela legislação, o agente entendeu de dar outra destinação à coisa expropriada. Em tal hipótese, não parece ter havido desvio de poder, hábil a legitimar a retrocessão. De tal sentir é Celso Antônio Bandeira de Mello quando afirma "convém ressaltar enfaticamente, contudo, que a jurisprudência brasileira pacificou-se no entendimento de que se o bem desapropriado para uma específica finalidade for utilizado em outra finalidade pública, não há vício algum que enseje ao particular ação de retrocessão (tal como é concebida hoje), considerando que, no caso, inexistiu violação do direito de preferência" (ob. cit., p. 210). Cita o autor a jurisprudência mencionada (RDP, 2/213, 3/242 e em RDA, 88/158 e 102/188). A doutrina é remançosa em afirmar a possibilidade de ser o bem empregado em outra finalidade diversa da alegada no decreto expropriatório ou na lei, desde que também de utilidade pública (Adroaldo Mesquita da Costa, in RDA, 93 /377; Alcino Falcão, Constituição Anotada, vol. II, pp. 149/SO; Carlos Maximiliano, Comentários à Constituição Brasileira, 1954, vol. III, p. 115; Diogo Figueiredo Moreira Neto, Curso de Direito Administrativo, vol. 2, p. 116; Ebert Chamoun, Da retrocessão nas desapropriações, pp. 74 e ss.; Hely Lopes Meirelles, Direito Administrativo Brasileiro, 2.ª ed., p. 505; Pontes de Miranda, Comentários à Constituição de 1967, com a Emenda Constituição n.º 1, de 1969, T. V, pp. 445/6; Cretella Junior, Tratado de Direito Administrativo, vol. IX, pp. 165/6). A jurisprudência a respeito é farta (RTJ, 39/495, 42/195 e 57 /46). Mais recentemente decidiu-se que "não cabe retrocessão quando o imóvel expropriado tem destino diverso, vias de utilidade pública" (RDA, 127 /440). Poucos autores manifestam-se em sentido contrário, ou seja, pela inadmissibilidade de aplicação do destino do bem em outra finalidade que não a invocada no decreto ou lei que estipula a desapropriação (Hélio Moraes de Siqueira, A retrocessão nas desapropriações, p. 61 e Miguel Seabra Fagundes, Da desapropriação no Direito brasileiro, 1949, p. 400). Tais indicações foram colhidas na excelente Desapropriação – Indicações de Doutrina e Jurisprudência de Sérgio Ferraz, pp. 122/124. Já diversa é a consequência quando o imóvel não é utilizado para qualquer fim, ficando ele sem destinação específica, implicando, praticamente, no abandono do imóvel. Daí surge, realmente, o problema da retrocessão. Mas, emergem questões prévias a serem resolvidas. Como se conta o prazo, se é que há, para que se legitime o expropriado, ativamente? Em consequência da solução a ser dada à questão anterior, cuida-se a retrocessão de direito real ou pessoal, isto é, a não utilização do bem expropriado enseja reivindicação ou indenização por perdas e danos? Estas questões são cruciais e têm atormentado os juristas. Passemos a tentar equacioná-las. 6 Momento do surgimento do direito de retrocessãoEntende Cretella Júnior que há dois momentos para que se considere o nascimento do direito de ingressar com a ação de retrocessão. Mediante ato expresso ou por ato tácito. "Mediante ato expresso, que mencione a desistência do uso da coisa expropriada e notifique o ex-proprietário de que pode, por ação própria, exercer o direito de retrocessão" (Comentários às leis de desapropriação, p. 415) ou através de ato tácito, ou seja, pela conduta da Administração que permita prever a desistência de utilização do bem expropriado, possibilitando ao antigo proprietário o exercício do direito de preferência...” (ob. cit., p. 416). De igual teor a lição de Eurico Sodré, A desapropriação por necessidade ou utilidade pública, 2.ª ed., p. 289. A jurisprudência já se manifestou em tal sentido (RTJ, 57 /46). Ebert Chamoun (ob. cit., pp. 80 e ss.) entende que apenas por ato inequívoco da administração tem cabimento a ação de retrocessão. Jamais se poderia julgar pela procedência da ação que visasse a retrocessão, desde que o Poder Público alegue que ainda vá utilizar o bem. Afirma o citado autor que "é assim, necessário frisar que o emprego, pelo expropriante do bem desapropriado para fim de interesse público não precisa ser imediato. Desde que ele consiga demonstrar que o interesse público ainda é presente e que a destinação para esse escopo foi simplesmente adiada, porque não é oportuna, exequível ou aconselhável, deve ser julgado improcedente o pedido de indenização do expropriado, com fundamento no art. 1.150 do CC (LGL\2002\400)" (ob. cit., p. 84). De igual teor a lição de Pontes de Miranda (Comentários. T. V, p. 445). Celso Antonio Bandeira de Mello tem posição intermediária. Afirma que "a obrigação do expropriante de oferecer o bem em preferência nasce no momento em que este desiste de aplicá-lo à finalidade pública. A determinação exata deste momento há que ser verificada em cada caso. Servirá como demonstração da desistência, a venda, cessão ou qualquer ato dispositivo do bem praticado pelo expropriante em favor de terceiro. Poderá indicá-la, também, a anulação do plano de obras em que se calcou o Poder Público para realizar a desapropriação ou outros fatos congêneres" (ob. cit., p. 209). A propósito, já se manifestou o STF que "o fato da não utilização da coisa expropriada não caracteriza, só por si, independentemente das circunstâncias. desvio do fim da desapropriação" (RTJ. 57/46). Do mesmo teor o acórdão constante da RDA, 128/395. 7 Prazo a respeito. AnalogiaOutros autores entendem que há um prazo de cinco anos para que o Poder Público destine o imóvel à finalidade Pública para que efetuou a desapropriação. Assim se manifestam Noé Azevedo (parecer in RT 193/34) e Seabra Fagundes (ob. cit., pp. 397 /8). O prazo de cinco anos é já previsto na doutrina francesa. Afirma Laubadere que "si les immeubles expropriés n'ont pas reçu dans le délai de cinq ans la destination prévue ou ont cessé de recevoir cette destination, les anciens propriétaires ou leurs ayants droit à titre universel peuvent en demander la rétrocession dans un délai de trente ans à compter également de l'ordonance d'expropriation, à moins que l'expropriant ne requère une nouvelle déclaration d'utilité publique" (ob. cit., p. 251). Tal orientação encontra por base o art. 10 do Dec.-lei 3.365/41 (LGL\1941\6) que estabelece: "a desapropriação deverá efetivar-se mediante acordo ou intentar-se judicialmente dentro de cinco anos, contados da data da expedição do respectivo decreto e findos os quais este caducará". Claro está que não tendo a lei previsto o direito à retrocessão, o intérprete há de buscar a solução para o problema (interpretação prudencial) dentro do próprio sistema normativo, para suprir ou colmatar a lacuna (a propósito deste tema, especificamente, veja se nosso "Lacuna e sistema normativo", in RJTJSP, 53/13-30). Esta surge no momento da decisão. Como todo problema jurídico gira em torno da decidibilidade, admite-se a interpretação analógica ao se entender que o prazo para que o Poder Público dê ao imóvel destinação específica ou outra permitida pelo direito (finalidade prevista no ordenamento) igualmente será o prazo de cinco anos. Neste, caduca o interesse público. Daí legitimar-se o expropriado a ingressar com a ação de retrocessão. Caso se entenda da inadmissibilidade de fixação de prazo, deixar-se-á à sorte o nascimento do direito ou, então, como pretende Cretella Junior, à manifestação volitiva do Poder Público decidir sobre a oferta do imóvel a alguém, com o que caracterizaria expressamente a vontade de alienar ou dispor do imóvel. Nunca haveria um prazo determinado, com o que padeceria a relação jurídica de segurança e estabilidade. Permaneceria o expropriado eternamente à disposição do Poder Público e perduraria, constantemente, e em suspense, até que a Administração decida como e quando destinará ou desafetará o imóvel. A solução que se nos afigura mais compatível com a realidade brasileira é a de se fixar o prazo de cinco anos, por aplicação analógica com o art. 10, retro citado. Está evidente que a só inércia não caracteriza a presunção do desvio. Se a Administração desapropria sem finalidade pública, o ato pode ser anulado, mesmo sem o decurso do prazo de cinco anos. Mas, aqui, o fundamento da anulação do ato seria outro e não se cuidaria do problema específico da retrocessão. 8 Natureza do direito à retrocessãoDiscute-se, largamente, sobre a natureza do direito à retrocessão. Para uns seria direito pessoal e eventual direito resolver-se-ia em indenização por perdas e danos. Para outros, cuida-se de direito real e, pois, há possibilidade de reivindicação. Magnífica resenha de opiniões é feita por Sérgio Ferraz em seu trabalho Desapropriação, pp. 117/121. Dentre alguns nomes que se manifestam pelo reconhecimento de que se cuida de direito pessoal e, pois, enseja indenização por perdas e danos encontram-se Ebert Chamoun (ob. cit., p. 31), Cretella Junior (Tratado . . ., vol. IX, pp. 159, 333/4), Múcio de Campos Maia ("ensaio sobre a retrocessão ", in RT 258/49). A jurisprudência já se tem manifestado neste sentido (RDA, 98/ 178 e 106/157). A propósito da pesquisa jurisprudencial, veja-se, também, o repertório de Sergio Ferraz. A solução apontada pelos autores encontra fundamento no art. 35 do Dec.-lei 3.365/41 (LGL\1941\6) ao estabelecer que "os bens expropriados, uma vez incorporados à Fazenda Pública, não podem ser objeto de reivindicação, ainda que fundada em nulidade do processo de desapropriação. Qualquer ação julgada procedente, resolver-se-á em perdas e danos". Com base em tal artigo afirma Ebert Chamoun que "o direito do expropriado não é, evidentemente, um direito real, porque o direito real não se contrapõe, jamais, um mero dever de oferecer. E, por outro lado, se o expropriante não perde a propriedade, nem o expropriado a adquire, com o simples fato da inadequada destinação, é óbvio que a reivindicação que protege o direito de domínio, e que incumbe apenas ao proprietário, o expropriado não pode ter" (ob. cit., pp. 38/39). Mais adiante afirma que "o direito do ex-proprietário perante o poder desapropriante que não deu à coisa desapropriada o destino de utilidade pública, permanece, portanto, no direito positivo brasileiro, como direito nítido e irretorquivelmente pessoal, direito que não se manifesta em face de terceiros , eventuais adquirentes da coisa, nem ela adere, senão exclusivamente à pessoa do expropriante. Destarte, o poder desapropriante, apesar de desrespeitar as finalidades da desapropriação, desprezando os motivos constantes do decreto desapropriatório, não perde a propriedade da coisa expropriada, que ele conserva em sua Fazenda com as mesmas características que possuía quando da sua. aquisição" (ob. cit., pp. 44/45). Em abono de sua orientação invoca o dispositivo mencionado e afirma "quaisquer dúvidas que ainda houvesse acerca da natureza do direito do expropriado seriam espancadas por esse preceito, límpido e exato, consectário perfeito dos princípios gerais do nosso direito positivo, dispositivo que se ajusta, como luva, ao sistema jurídico brasileiro relativo à aquisição de propriedade, à preempção e à desapropriação" (ob. cit., p. 47). De outro lado, autores há que entendem cuidar-se de direito real. Dentre eles Hely Lopes Meirelles (Direito Administrativo Brasileiro, 2.ª ed., p. 505), Seabra Fagundes (ob. cit., p. 397), Noé Azevedo (parecer citado, in RT, 193/34), Pontes de Miranda (Comentários . . . ", T. V, pp. 443/6 e Vicente Ráo (O direito e a vida dos direitos, 2.ª ed., p. 390, nota 113). Apontam-se, também, diversos julgados (RDA, 48/231 e 130/229). 9 Crítica às posiçõesRealmente não se confundem as disposições do art. 1.149 com o art. 1.150 do CC (LGL\2002\400). O primeiro refere-se a pacto de compra e venda e tem por pressuposto a venda ou a dação em pagamento. Implica manifestação volitiva, através de contrato específico, em que se tem por base a vontade livre dos negócios jurídicos, assim exigida para validade do contrato. Já o art. 1.150 constitui norma de Direito Público, pouco importando sua inserção no Código Civil (LGL\2002\400) (Pontes de Miranda, Tratado de Direito Privado, T. XIV, 2.ª ed., § 1.612, p. 172). Em sendo assim, a norma do art. 1.150 do CC (LGL\2002\400) que determina o oferecimento do imóvel desapropriado ao ex-proprietário para o exercício do direito de preferência não está revogada. Mas, daí não se conclui que há apenas o direito de prelação. Diverso é nosso entendimento. Pelo artigo referido, obriga-se a Administração a oferecer o imóvel (é obrigação imposta à Administração), mas daí não pode advir a consequência de que caso não oferecido o imóvel, não há direito de exigi-lo. A norma não é unilateral em prol do Poder Público. De outro lado, surge a possibilidade de exigência por parte do expropriado. E a tal exigência dá-se o nome de retrocessão. Superiormente ensina Hélio Moraes de Siqueira que "entretanto, não é na lei civil que se encontra o fundamento da retrocessão. Aliás, poder-se-ia, quando muito, vislumbrar os lineamentos do instituto. É na Constituição Federal que a retrocessão deita raízes e recebe a essência jurídica que a sustém. Mesmo se ausente o preceito no Código Civil (LGL\2002\400), a figura da retrocessão teria existência no direito brasileiro, pois é consequência jurídica do mandamento constitucional garantidor da inviolabilidade da propriedade, ressalvada a desapropriação por utilidade e necessidade pública e de interesse social, mediante prévia e justa indenização em dinheiro" (ob. cit., pp. 76/77). Idêntico entendimento deve ser perfilhado. Realmente, despiciendo é que o art. 35 do Dec.-lei 3.365/41 (LGL\1941\6) tenha estabelecido que "os bens expropriados, uma vez incorporados à Fazenda Pública, não podem ser objeto de reivindicação, ainda que fundada em nulidade do processo de desapropriação. Qualquer ação, julgada procedente, resolver-se-á em perdas e danos". A lei não pode mudar a norma constitucional que prevê a possibilidade da desapropriação sob fundamento de interesse público. O interesse público previsto na Constituição Federal é concretizado através das manifestações da Administração, em atos administrativos, possuindo, como condição de sua validade e de sua higidez o elemento finalidade ("finalidade-elemento teleológico contido no sistema. Conjunto de atribuições assumidas pelo Estado e encampadas pelo ordenamento jurídico", cf. nosso Ato Administrativo, ed. 1978, p. 48). Destina-se a finalidade a atender aos interesses públicos previstos no sistema normativo. Há por parte do agente administrativo emanador do ato, a aferição valorativa do interesse manifestado no decreto. É pressuposto lógico da emanação de qualquer ato administrativo que a competência do agente seja exercitada em direção a alcançar os objetivos ou os valores traçados no sistema de normas. Tal aferição valorativa é realizada no momento da expedição do ato. No decurso de certo tempo, pode desaparecer o interesse então manifestado. Mas, tal reconhecimento do desinteresse não pertence apenas à Administração Pública, mas também ao expropriado que pode provocá-lo, mediante ação direta. A Administração Pública, pela circunstância de ter adquirido o domínio da coisa expropriada, não fica isenta de demonstrar a utilidade da coisa ou a continuidade elo interesse público em mantê-la. Desaparecendo o interesse público, o que pode acontecer por vontade expressa da Administração, ou tacitamente, pelo decurso do prazo de cinco anos, contados dos cinco anos seguintes à transferência de domínio, que se opera pelo registro do título aquisitivo, que é a carta de adjudicação mediante prévio pagamento do preço fixado, nasce ao expropriado o direito de reaver a própria coisa. Trata-se de direito real, porque a perquirição da natureza do direito não deflui do momento atual do reconhecimento da desnecessidade da coisa, mas remonta ao momento do ato decretatório da utilidade pública. Já disse alhures (Ato Administrativo, pp. 122 e ss.) que a nulidade ou o ato inválido não prescreve. No caso a prescrição alcança o expropriado no prazo de cinco anos, contados do término dos cinco anos anteriores ao termo final do prazo de presunção da desnecessidade do imóvel. Explicando melhor: o Poder Público tem cinco anos, contados da data da aquisição da propriedade, que opera pelo registro da carta de adjudicação no Cartório do Registro de Imóveis competente, ou mediante registro da escritura pública lavrada por acordo das partes, no mesmo Cartório, para dar destinação específica, tal como declarada no decreto expropriatório ou outra destinação, havida como de interesse público. Passado tal prazo, abre-se ao expropriado o direito de haver a própria coisa, também pelo prazo de Cinco anos, nos termos do Dec. 20.910/32 (LGL\1932\1). A propósito já se decidiu que "a prescrição da ação de retrocessão, visando às perdas e danos, começa a correr desde o momento em que o expropriante abandona, inequivocamente, o propósito de dar, ao imóvel, a destinação expressa na declaração de utilidade pública" (PDA, 69/ 200). Ausente a utilidade pública, seja no momento da declaração, seja posteriormente. o ato deixa de ter base legal. Como afirma José Canasi, "la retrocesión tiene raiz constitucional implicita y surge del concepto mismo de utilidade publica. No se concibe una utilidad publica que puede desaparecer o deformarse a posteriori de la expropriación. Seria un engano o una falsidad" (La retrocesión en la Expropiación Publica, p. 47). Rejeita-se o raciocínio de que o expropriado, não sendo mais proprietário, falece-lhe o direito de pleitear reivindicação. Tal argumento serviria, também, para &e rejeitar a existência de direito pessoal. Isto porque, se o ex-proprietário já recebeu, de acordo com a própria Constituição Federal a justa indenização pela tomada compulsória de seu imóvel, nenhum direito teria mais. Não teria sentido dar-se nova indenização ao ex-proprietário, de vez que o Poder Público já lhe pagara toda quantia justa e constitucionalmente exigida para a composição do patrimônio desfalcado pela perda do imóvel. Aí cessaria toda relação criada imperativamente, pelo Poder Público. Inobstante, a pretensão remonta à edição do ato. O fundamento do desfazimento do decreto expropriatório reside exatamente na inexistência do elemento finalidade que deve sempre estar presente nas manifestações volitivas da Administração Pública. Demais, cessado o interesse público subsistente no ato expropriatório, a própria Constituição Federal determina a persistência da propriedade. A nosso ver, a discussão sobre tratar-se de direito real ou pessoal é falsa. Emana a ação da própria Constituição, independentemente da qualificação do direito. Ausente o interesse público, deixa de existir o fundamento jurídico da desapropriação. Logo, não podem subsistir efeitos jurídicos de ato desqualificado pelo ordenamento normativo. Trata-se de direito real, no sentido adotado por Marienhoff quando afirma que "desde luego, trátase de una acción real de "derecho público", pues pertenece al complejo jurídico de la expropiación, institución exclusivamente de derecho público, segun quedó dicho en un parágrafo precedente (n. 1.293). No se trata, pues, de una acción de derecho comun, ni regulada por este. El derecho privado nada tiene que hacer al respecto. Finalmente, la acción de retrocesión, no obstante su carácter real, no trasunta técnicamente el ejercicio de una acción reivindicatoria, sino la impugnación a una expropiación donde la afectación del bien o cosa no se hizo al destino correspondiente, por lo que dicha expropiación resulta en contravención con la garantia de inviolabilidad de propiedad asegurada en la Constitución. La acción es "real" por la finalidad que persigue: reintegro de un bien o cosa" (Tratado de Derecho Administrativo, vol. IV, p. 382, n. 1.430). De igual sentido a orientação traçada no Novíssimo Digesto Italiano, onde se afirma que "per tale disciplina deve escludersi che il diritto alla retrocessione passa considerarsi un diritto alla risoluzione del precedente trasferimento coattivo, esso e stato definito un diritto legale di ricompera, ad rem (non in rem) (ob. cit., voce - espropriazione per pubblica utilità", vol. VI, p. 950). Recentemente o Supremo Tribunal Federal decidiu que "o expropriado pode pedir retrocessão, ou readquirir o domínio do bem expropriado, no caso de não lhe ter sido dado o destino que motivou a desapropriação" (RDA 130/229). No mesmo sentido o acórdão constante da "Rev. Trim. de Jur.", vol. 104/468-496, rel. Min. Soares Muñoz. 10 Transmissibilidade do direito. Não se cuida de direito personalíssimoAdmitida a existência da retrocessão no Direito brasileiro in specie, ou seja, havendo a possibilidade de reaquisição do imóvel, e rejeitando-se frontalmente, a solução dada pela jurisprudência de se admitir a indenização por perdas e danos, de vez que, a nosso ver, há errada interpretação do art. 35 do Dec.-lei 3.365/41 (LGL\1941\6), surge a questão também discutida se o direito à retrocessão é personalíssimo, ou é transmissível, causa mortis. Pela negativa manifestam-se Ebert Chamoun (ob. cit., p. 68), Eurico Sodré (ob. cit., p. 76), Hely Lopes Meirelles (ob. cit., p. 505) e Pontes de Miranda (ob. cit., p. 446). Em sentido oposto Hélio Moraes de Siqueira (ob. cit., p. 64) e Celso Antônio Bandeira de Mello (oh. cit., p. 210). A jurisprudência tem se manifestado favoravelmente à transmissão do direito de retrocessão (RTJ 23/169, 57 / 46 e 73/155). Inaplicável no Direito Público o art. 1.157 do CC (LGL\2002\400). Disciplina ele relações de particulares, devidamente ajustado ao art. 1.149 que, como se viu anteriormente, cuida, também, de manifestações volitivas. Já, a desapropriação implica na tomada compulsória do domínio dos particulares, em decorrência de ato imperativo (tal como por nós conceituado a fls. 29 do Ato Administrativo). A imperatividade implica em manifestação de poder, ou seja, na possibilidade que goza o Poder Público de interferir na esfera jurídica alheia, por força jurídica própria. Já nas relações particulares, estão estes no mesmo nível; quando intervém o Estado o relacionamento é vertical e não horizontal. Daí porque o referido dispositivo legal não tem aplicação ao tema em estudo. O TJSP já deixou decidido que "os sucessores do proprietário têm direito de ser indenizados, no caso de o expropriante do imóvel expropriado não se utilizar deste, e procurar aliená-lo a terceiros, sem mesmo oferecê-lo àqueles (RT 322/193). Rejeitando, apenas o direito de preferência, de vez que entendendo a retrocessão como espécie de direito real, aceita-se a argumentação da transmissibilidade da ação. No mesmo sentido a orientação do Supremo Tribunal Federal (RTJ 59/631). As ações personalíssimas são de interpretação estrita. Apenas quando a lei dispuser que não se transmite o direito causa mortis é que haverá impossibilidade jurídica da ação dos herdeiros ou sucessores a qualquer título. No caso ora analisado, verificando-se da inaplicabilidade do art. 1.157 do CC (LGL\2002\400), percebe-se que defluindo o direito à retrocessão da própria Constituição Federal, inarredável a conclusão que se cuida de direito transmissível. 11 Montante a ser pago pelo expropriado, pela reaquisição do imóvelResta indagar qual o critério para fixação do montante a ser pago pelo ex-proprietário quando do acolhimento da ação de retrocessão. Inicialmente, pode-se dizer que o expropriado deve devolver o montante apurado quando do recebimento do preço fixado pelo juiz ou havido mediante acordo lavrado em escritura pública. Inobstante, se o bem recebeu melhoras que tenham aumentado seu valor, parece-nos que devam elas ser levadas em conta, para efeito de apuração do montante do preço a ser devolvido ao expropriante. O valor a ser pago, pois, será o recebido à época, por parte do expropriado acrescido de melhoramentos eventualmente introduzidos no imóvel, caso deste se cuide. 12 Correção monetáriaHá autores que afirmam que a correção monetária não fará parte do valor a ser devolvido, "in principio", pois, embora haja previsão legal de seu pagamento quando da desapropriação, há razoável fundamento de que se o Poder Público não destinou o imóvel ou deu margem a que ele não fosse utilizado, por culpa sua, de seu próprio comportamento, deve suportar as consequências de sua atitude. A Corte Suprema de Justiça da Nação Argentina prontificou-se pelo descabimento da atualização monetária, deixando julgado que ''en efecto, obvio parece decir que el fundamento jurídico del instituto de la retrocesión es distinto ai de la expropiación, como que se origina por el hecho de no destinarse el bien expropiado al fin de utilidad publica previsto por la ley. Si esta finalidad no se cumple, el expropiante no puede pretender benefíciarse con el mayor valor adquirido por el inmueble y su derecho, como principio, se limita a recibir lo que pagó por él" (Fallos, t. 271, pp. 42 e ss.). Outro argumento parece-nos ponderável. É que, a se admitir a devolução com correção monetária poderia facilitar a intervenção do Estado no domínio econômico, de vez que poderia pretender investir na aquisição de imóveis, para restituí-los, posteriormente, com acréscimo de correção monetária, com o que desvirtuar-se-ia de suas finalidades precípuas. Parece-nos, entretanto, razoável que se apure o valor real do imóvel devidamente atualizado e se corrija, monetariamente, o valor da indenização paga, para que se mantenha a equivalência econômica e patrimonial das partes. Há decisão admitindo a correção monetária da quantia a ser paga pelo expropriado (RDP 11/274) proferida pelo Min. Jarbas Nobre, do TFR. O valor do imóvel serviria de teto para o índice da correção. 13 Rito processualO tipo de procedimento a ser adotado nas hipóteses de ação de retrocessão previsto na legislação processual. É o procedimento ordinário ou sumaríssimo, dependendo do valor da causa. Não há qualquer especialidade de rito, de vez que independe de depósito prévio. Não se aplica, aqui, o procedimento desapropriação, às avessas. Isto porque, no procedimento de desapropriação há um rito especial e pode o Poder Público imitir-se previamente na posse da coisa, desde que alegue urgência na tomada e efetue o depósito do valor arbitrado. Tal característica do processo de desapropriação não está presente no rito processual da ação de retrocessão. Demais disso, a ação depende de prévio acolhimento, com produção de prova do abandono do imóvel, ou sua não destinação ao fim anunciado no decreto. 14 Retrocessão de bens móveisA desapropriação alcança qualquer tipo de coisa. Não apenas os imóveis podem ser desapropriados. Isto porque o art. 2.0 do Dec.-lei 3.365/41 (LGL\1941\6) dispõe "mediante declaração de utilidade pública, todos os bens poderão ser desapropriados pela União, pelos Estados, Municípios, Distrito Federal e Territórios”. Como assinala Celso Antônio Bandeira de Mello "pode ser objeto de desapropriação, tudo aquilo que seja objeto de propriedade. Isto é, todo bem, imóvel ou móvel, corpóreo ou incorpóreo, pode ser desapropriado. Portanto, também se desapropriam direitos em geral. Contudo, não são desapropriáveis direitos personalíssimos, tais os de liberdade, o direito à honra, etc. Efetivamente, estes não se definem por um conteúdo patrimonial, antes se apresentam como verdadeiras projeções da personalidade do indivíduo ou consistem em expressões de um seu status jurídico, como o pátrio poder e a cidadania, por exemplo (ob. cit., p. 194). De igual teor a lição de Ebert Chamoun (ob. cit., 94). A lição do autor merece integral subscrição, por ser da mais absoluta juridicidade. A Constituição Federal assegura o direito de propriedade. A única limitação é a possibilidade de desapropriação, por parte do Poder Público. Mas, como a Constituição não limita a incidência da expropriação apenas sobre imóveis e a lei específica fala em "bens", entende-se que todo e qualquer direito pode ser desapropriado. Por consequência, qualquer bem pode ser passível de retrocessão (verbi gratia, os direitos autorais). 15 Retrocessão parcialCaso tenha havido desapropriação de um imóvel e parte dele não tenha aproveitada para a finalidade precípua declarada no decreto, surge a questão de se saber se o remanescente não utilizado pode ser objeto da retrocessão. Pelas mesmas razões expostas pelas quais se admitiu a existência da retrocessão no Direito brasileiro e cuidar-se de direito real, pelo qual o expropriado pode reaver posse e propriedade do próprio imóvel, admite-se a retrocessão parcial. 16 RenúnciaCaso o expropriado renuncie ao direito de retrocessão, nada terá a reclamar. Tratando-se, como se cuida, de direito patrimonial, é ele renunciável. Nada obriga a manter seu direito. Como salienta Ebert Chamoun, "a renúncia é plenamente eficaz. Uma vez que consta do instrumento de acordo dispositivo que exprima o desinteresse do ex-proprietário pelo destino que venha ulteriormente a ser dado ao bem e no qual se revele, claro e indiscutível, o seu propósito de renunciar ao direito de preferência à aquisição e ao direito de cobrar perdas e danos em face da infração do dever de oferecimento, o não atendimento das finalidades previstas no decreto desapropriatório, não terá quaisquer consequências patrimoniais, tornando-se absolutamente irrelevante sob o ponto de vista do direito privado" (ob. cit., p. 93). Embora não se adote a consequência apontada pelo autor. aceita-se o fundamento da possibilidade da renúncia. 17 Retrocessão na desapropriação por zonaNeste passo, acompanha-se o magistério de Celso Antônio Bandeira de Mello, segundo quem "é impossível cogitar de ação de retrocessão relativa a bens revendidos pelo Poder Público no caso de desapropriação por zona, quanto à área expropriada exatamente para esse fim, uma vez que, em tal caso não há transgressão alguma à finalidade pública em vista da qual foi realizada (ob. cit., p. 210). De igual teor a orientação de Ebert Chamoun (ob. cit., p. 96). E a posição é de fácil compreensão. O "interesse público", na hipótese, foi ditada exatamente para que se reserve a área para ulterior desenvolvimento da obra ou para revenda. Destina-se a absorver a extraordinária valorização que alcançará o local. De qualquer forma, estará o interesse público satisfeito. lnadmite-se, em consequência, a ação de retrocessão, quando a desapropriação se fundar em melhoria de determinada zona (art. 4.0 do Dec.-lei 3.365/41 (LGL\1941\6)). A propósito os pareceres de Vicente Ráo (RDP 7 /79), Castro Nunes (RDP 7 /94) e Brandão Cavalcanti (RDP 7 /102). 18 Referência jurisprudencialAlém da jurisprudência já referida no curso da expos1çao da matéria, convém transcrever alguns acórdãos do STF que cuidam do assunto. Negativa de vigência ao art. 1.150 do CC (LGL\2002\400). "Não vejo na decisão recorrida negativa de vigência do art. 1.150 do CC (LGL\2002\400). De conformidade com a melhor interpretação desse dispositivo, o expropriante não está obrigado a oferecer o imóvel ao expropriado, quando resolve devolvê-lo ao domínio privado, mediante venda ou abandono" (RTJ 83/97. Também o mesmo repertório 56/785 e 66/250. Possibilidade do exercício da ação. "Se se verifica a impossibilidade da utilização do bem, ou da execução da obra, então passa a ser possível o exercício do direito de retrocessão. Não é preciso esperar que o desapropriante aliene o bem desapropriado" (RTJ 80/150). Destinação diversa do bem. "Incabível a retrocessão ou ressarcimento se o bem expropriado tem destino diverso, mas de utilidade pública" (RTJ 74/95; No mesmo sentido o mesmo repertório 48/749 e RDA 127 /440). Pressupostos da retrocessão. "Retrocessão. Seus pressupostos; devolução do imóvel ao domínio privado, · quer pela alienação, quer pelo abandono por longo tempo, sem destinação de utilidade pública. Ausência desses pressupostos. Ação julgada improcedente" (RTJ 83/96). Fundamento do direito à retrocessão. "Constituição, art. 153, § 22CC (LGL\2002\400), art. 1 .150. Desapropriamento por utilidade pública. Reversão do bem desapropriado. O direito à requisição da coisa desapropriada tem o seu fundamento na referida norma constitucional e na citada regra civil, pois uma e outra exprimem um só princípio que se sobrepõe ao do art. 35 do Dec.-Lei 3.365/41 (LGL\1941\6), visto que o direito previsto neste último (reivindicação) não faz desaparecer aqueloutro" (RTJ 80/139). Estes alguns excertos jurisprudenciais de maior repercussão, já que enfrentaram matéria realmente controvertida dando-lhe solução fundamentada. Há inúmeros julgados sobre o tema que, no entanto, dispensam transcrição ou menção expressa, pois outra coisa não fazem que repetir os argumentos já manifestados. Como se cuida de matéria controvertida e a nível de repertório enciclopédico, o importante é a notícia sobre o tema, sem prejuízo de termos feito algumas colocações pessoais a respeito. Nem tivemos o intuito de esgotar o assunto, de vez que incabível num trabalho deste gênero.

Abstract Funding Acknowledgements no funding sources exists OnBehalf RIGHT Heart International NETwork (RIGHT-NET) Purpose Exercise stress echocardiography (ESE) is a well-validated tool in ischemic and valvular heart diseases. The aim of this study is to assess the ESE feasibility for the evaluation of the right heart pulmonary circulation unit (RH-PCU) in a large cohort of subjects, from healthy individuals and elite athletes to patients with overt or at risk of developing pulmonary hypertension. Methods: 954 subjects [mean age 54.2 ± 16.4 years, 430 women] [254 healthy volunteers, 40 elite athletes, 363 patients with cardiovascular risk factors, 25 with pulmonary arterial hypertension, 149 with connective tissue diseases, 81 with left heart and valvular diseases, 42 with lung diseases], underwent standardized semi-recumbent cycle ergometer ESE with an incremental workload of 25 watts every 2 minutes up to symptom-limited maximal tolerated workload. ESE parameters of right heart structure, function and pressures were obtained according current recommendations. Results: The success rate for the evaluation of the RV function at peak exercise was 903/940 (96%) for tricuspid annular plane systolic excursion (TAPSE), 667/751 (89%) for tissue Doppler–derived tricuspid lateral annular systolic velocity (S’) and 425/772 (63%) for right ventricular fractional area change (RVFAC). Right ventricular–right atrial pressure gradient [RV-RA gradient = 4 x tricuspid regurgitation velocity2] was obtained in 894/954 patients (93.7 %) at rest and in 816/954 (85.5%) at peak exercise. At peak exercise, pulmonary acceleration time (AcT) was feasible among 435/545 (82.5%) patients (Table 1). Conclusions: In daily ESE monitoring of TAPSE and S’ resulted to be less challenging than of RV FAC. ESE was a feasible tool for the evaluation of RV-RA gradient and pulmonary AcT. Table 1 Parameters Rest mean ± SD Peak mean ± SD P value Assessed n (%) Feasibility at rest n (%) Feasibility at peak n (%) RVED area (cm2) 17.4 ± 5.7 17.4 ± 5.8 0.9 672 632 (94.0) 425 (63.2) RVES area (cm2) 9.7 ± 4.3 9.6 ± 4.9 0.7 672 632 (94.0) 425 (63.2) TAPSE (mm) 22.9 ± 3.9 27.4 ± 5.5 &lt;0.001 940 922 (98.1) 903 (96.0) S’(cm/s) 13.1 ± 2.9 18.5 ± 5.0 &lt;0.001 751 746 (99.4) 667 (88.8) RVFAC (%) 45.7 ± 10 46.7 ± 11 0.121 672 632 (94.0) 425 (63.2) RV-RA gradient (mmHg) 24.3 ± 15 42.5 ± 20 &lt;0.001 954 894 (93.7) 816 (85.5) Pulmonary AcT (m/s) 129 ± 31 116 ± 35 &lt;0.001 545 527( 96.7) 435 (82.5) RVED, right ventricle end diastolic area; RVES, right ventricle end systolic area; p values indicate differences at rest and peak exercise. The term “assessed” indicates that an attempt was done in order to measure the parameter. The term “feasibility” indicates that it was possible to measure the parameter that was assessed.

RESUMO Objetivo Analisar a complexidade do cuidado de enfermagem com o uso da escala de Perroca em uma Unidade de Cuidados Paliativos. Método Estudo retrospectivo descritivo com análise quantitativa. Resultados Entre 2008 e 2016, foram internados 2.486 pacientes, a mediana de tempo de internação foi de 12 dias. Desses pacientes, 1.568 tiveram pelo menos uma avaliação pela escala de Perroca, classificados em cuidados mínimos ou intermediários (910, 58%), obtendo alta (602, 66%). Como cuidados semi-intensivos e intensivos, foram 658 (42%) pacientes, dentre os quais 64% morreram e apenas 36% receberam alta hospitalar. Conclusão A escala Perroca é uma ferramenta para identificar os pacientes com maior necessidade de cuidados e de possível prognóstico para os pacientes internados.

Background: Blackbuck is the most elegant member of the antelope family has long been associated with Indian culture. Wildlife parasitic diseases represent an important field of investigation as they may have a significant impact on wild animal health and are responsible for one-third of total losses due to all animal diseases. Adequate information on epidemiology of helminthic infections is a crucial requirement for the sustainable control of GIH in black bucks in near future.Methods: A total of 632 faecal samples were collected from Tal-Chhapar Sanctuary of Rajasthan during summer, rainy and winter season from November 2018 to September 2019 and examined qualitatively by faecal floatation and sedimentation techniques for helminth eggs and quantitatively by modified McMaster egg counting technique.Result: Coprological examination of samples revealed an overall prevalence of 72.46% for gastrointestinal helminths (GIH) with a mixed infection of 38.92%. Among different helminths recorded with their respective prevalences (%) were, Strongyle (56.80%), Strongyloides sp. (40.98%), Trichuris sp. (8.22%), Marshallagia sp. (6.64%) and Ascaris sp. (5.22%). Quantitative analysis revealed egg per gram of faeces ranging from 200-1200 and 200-900 with an average of 561.11 ± 67.74 and 469.23 ± 62.50 for strongyle and Strongyloides sp., respectively. Statistical analysis using multivariate binary logistic regression model revealed highly significant difference (P less than 0.01) in the prevalence of GIH infection among different seasons. The coproculture study revealed Bunostomum sp. (42%) as the major contributor of strongyle nematode population, followed by Haemonchus sp. (31%), Trichostrongylus sp. (26%) and Strongyloides sp. (1%).

Background In patients with obstructive hypertrophic cardiomyopathy, surgical myectomy (SM) is indicated for severe symptoms. We sought to compare long‐term outcomes of patients with obstructive hypertrophic cardiomyopathy where SM was based on guideline‐recommended Class I indication (Functional Class or FC ≥3 or angina/exertional syncope despite maximal medical therapy) versus earlier (FC 2 and/or impaired exercise capacity on exercise echocardiography with severe obstruction). Methods and Results We studied 2268 consecutive patients (excluding <18 years, ≥ moderate aortic stenosis and subaortic membrane, 56±14 years, 55% men), who underwent SM at our center between June 2002 and March 2018. Clinical data, including left ventricular outflow tract gradient, were recorded. Death and/or appropriate internal defibrillator discharge were primary composite end points. One thousand three hundred eighteen (58%) patients met Class I indication and 950 (42%) underwent earlier surgery; 222 (10%) had a history of obstructive coronary artery disease. Basal septal thickness, and resting and maximal left ventricular outflow tract gradient were 2.0±0.3 cm, 61±44 mm Hg, and 100±31 mm Hg, respectively. At 6.2±4 years after SM, 248 (11%) had composite events (13 [0.6%] in‐hospital deaths). Age (hazard ratio [HR], 1.61; 95% CI, 1.26–1.91), obstructive coronary artery disease (HR, 1.46; 95% CI, 1.06–1.91), and Class I versus earlier SM (HR, 1.61; 95% CI, 1.14–2.12) were associated with higher primary composite events (all P <0.001). Earlier surgery had better longer‐term survival (similar to age‐sex‐matched normal population) versus surgery for Class I indication (76 [8%] versus 193 [15%], P <0.001). Conclusions In patients with obstructive hypertrophic cardiomyopathy, earlier versus surgery for Class I indication had a better long‐term survival, similar to the age‐sex‐matched US population.