Journal articles on the topic '949.522 007 4'

ABSTRACTFaecal egg counts, haematocrits, erythrocyte potassium contents and serum iron concentrations were determined in 1005, 3- to 5-month-old Merino lambs infected with a single dose of 11 000 Haemonchus contortus larvae. Live-weight gain and wool growth also were recorded. Lambs were infected in six different groups over a 3-year period. When infections were terminated after 5 weeks, faecal egg counts in the six infected groups had reached a peak of 5170 to 20 339 eggs per g (average 12 909), haematocrits had declined to between 196 and 309 ml/1 (average 233), erythrocyte potassium contents had risen to between 16·7 and 37·5 mequiv. per 1 (average 31·5) and serum iron concentrations, in some cases following an erratic course, had dropped to between 0·512 and 1·546 mg/1 (average 0·946).Of the three haematological parameters, haematocrit correlated best with faecal egg count (r = 0·7 in four of six infected groups). However, in two groups with low faecal egg counts this correlation was much lower (r = 0·3). Erythrocyte potassium concentration and serum iron concentration significantly correlated with variability of haematocrit not accounted for by faecal egg count, suggesting that both erythropoiesis and iron availability influence the degree of anaemia.The effect of H. contortus infection on productivity of lambs was best predicted by haematocrits: for each further 0·01 proportional decrease in haematocrit, a 0·03 reduction of live-weight gain over a 9-week post-infection period, a 0·007 reduction in clean wool growth and a 0·004 reduction in fibre diameter over a 4- to 9-week period were observed. Some evidence was obtained indicating a tolerance level of anaemia at approximately 280 ml/1 packed cell volume.

Abstract Introduction: Although sleep disturbances, anxiety, and sadness are some of the most common symptoms in patients with chronic anemia, there is little knowledge about sleep structures in patients with chronic anemia such as thalassemia. The aim of this study is to investigate sleep structure in patients with beta-thalassemia minor. Methods: Seventeen drug free subjects with beta-thalassemia minor and age-matched healthy subjects were enrolled in the study. The patients were diagnosed by complete blood count including reticulocyte count and hemoglobin electrophoresis. In addition, blood smear, erythrocyte sedimentation rate, serum level of urea, creatinine, indirect bilirubin, lactate dehydrogenase, ferritin, folate, vitamin B12, and thyroid hormones were determined. The other causes of anemia were ruled out. Subjects also were screened for excessive daytime sleepiness with the Epworth sleepiness scale, and for insomnia using insomnia severity index. All subjects slept in laboratory for two consecutive nights. First night served as adjustment nights. The second night results were used for analysis. Their sleep patterns were compared with healthy normal controls. Sleep was recorded and scored according to the criteria of Rechtschafffen and Kales. Results: Four female and thirteen male patients (mean age, 26.1 ± 5.9 years) completed both nights of sleep recordings. In patients groups, one patient complained snoring and daytime sleepiness. Nine of them complained daytime weakness. Ten patients were anemic (Hb < 13,2 g/dL for men, <11,7 g/dL for women). In polysomnographic investigation, the patients with β-thalassemia minor showed increased total sleep time, sleep period time, PLM index and the increased percentage of REM sleep. The percentage of stage 4, and REM latency are decreased. Sleep fragmentation and periodic leg movement syndrome (PLMS) have been reported. Conclusion: The disturbances of sleep continuity was prominent finding in this polysomnographic study. They also showed decreased REM latency and the increased percentage of REM sleep, although they didn’t have major depressive disorders. Polysomnographic variables in patients with beta-thalassemia minor Polysomnographic variables Thalassemia (n: 17) Normal Controls (n: 17) Results (P value) NS: not sinificant, REM: rapid eye movement, PLM: periodic leg movement Sleep effiency 90.8±4.6 93.7±2.1 NS Total time in bed (min) 467.6±60.1 415.1±51.1 .008 Total sleep time (min) 425.8.4±65.1 388.5±49.2 .031 Sleep period time (min) 453.2.4±62.0 404.4±52.2 .012 Sleep latency (min) 9.9±9.0 8.2±5.2 NS Percentage of stage 1 (SPT) 2.5±1.0 1.8±1.1 NS Percentage of stage 2 (SPT) 61.9±6.9 64.1±7.3 NS Percentage of stage 3 (SPT) 4.8±1.9 6.5±2.4 NS Percentage of stage 4 (SPT) 8.0±6.4 12.2±6.1 .022 Percentage of stage REM (SPT) 16.3±3.8 12.5±3.4 .006 REM latency 67.9±25.0 96.8±32.5 .016 PLM index 7.4 ± 5.7 0.0 .000

Abstract Three chimpanzees experimentally infected with human immunodeficiency virus (HIV) developed significant chronic thrombocytopenia after 5, 4, and 2 years, with peripheral platelet counts averaging 64 ± 19 × 103/μL (P = .004 compared with 228 ± 92 × 103/μL in 44 normal control animals), mean platelet volumes of 11.2 ± 1.8 fL (P &gt; .5 compared with 10.9 ± 0.7 fL in normal controls), endogenous thrombopoietin (TPO) levels of 926 ± 364 pg/mL (P &lt; .001 compared with 324 ± 256 pg/mL in normal controls), uniformly elevated platelet anti-glycoprotein (GP) IIIa49-66 antibodies, and corresponding viral loads of 534, 260, and 15 × 103 RNA viral copies/mL. Pegylated recombinant human megakaryocyte growth and development factor (PEG-rHuMGDF) was administered subcutaneously (25 μg/kg twice weekly for 3 doses) to determine the effects of stimulating platelet production on peripheral platelet concentrations in this cohort of thrombocytopenic HIV-infected chimpanzees. PEG-rHuMGDF therapy increased (1) peripheral platelet counts 10-fold (from 64 ± 19 to 599 ± 260 × 103 platelets/μL;P = .02); (2) marrow megakaryocyte numbers 30-fold (from 11.7 ± 6.5 × 106/kg to 353 ± 255 × 106/kg;P = .04); (3) marrow megakaryocyte progenitor cells fourfold (from a mean of 3.6 ± 0.6 to 14.1 × 103 CFU-Meg/1,000 CD34+ marrow cells); and (4) serum levels of Mpl ligand from 926 ± 364 pg/mL (endogenous TPO) to predosing trough levels of 1,840 ± 353 pg/mL PEG-rHuMGDF (P = .02). The peripheral neutrophil counts were also transiently increased from 5.2 ± 2.6 × 103/μL to 9.9 ± 5.0 × 103/μL (P= .01), but neither the erythrocyte counts nor the reticulocyte counts were altered significantly (P &gt; .1). The serum levels of antiplatelet GPIIIa49-66 antibodies exhibited reciprocal reductions during periods of thrombocytosis (P &lt; .07). PEG-rHuMGDF therapy did not increase viral loads significantly (395, 189, and 53 × 103 RNA viral copies/mL; P &gt; .5 compared with baseline values). The striking increase in peripheral platelet counts produced by PEG-rHuMGDF therapy implies that thrombocytopenia in HIV-infected chimpanzees is attributable to insufficient compensatory expansion in platelet production resulting from HIV-impaired delivery of platelets despite stimulated megakaryocytopoiesis. These data suggest that PEG-rHuMGDF therapy may similarly correct peripheral platelet counts in thrombocytopenic HIV-infected patients.

Three chimpanzees experimentally infected with human immunodeficiency virus (HIV) developed significant chronic thrombocytopenia after 5, 4, and 2 years, with peripheral platelet counts averaging 64 ± 19 × 103/μL (P = .004 compared with 228 ± 92 × 103/μL in 44 normal control animals), mean platelet volumes of 11.2 ± 1.8 fL (P > .5 compared with 10.9 ± 0.7 fL in normal controls), endogenous thrombopoietin (TPO) levels of 926 ± 364 pg/mL (P < .001 compared with 324 ± 256 pg/mL in normal controls), uniformly elevated platelet anti-glycoprotein (GP) IIIa49-66 antibodies, and corresponding viral loads of 534, 260, and 15 × 103 RNA viral copies/mL. Pegylated recombinant human megakaryocyte growth and development factor (PEG-rHuMGDF) was administered subcutaneously (25 μg/kg twice weekly for 3 doses) to determine the effects of stimulating platelet production on peripheral platelet concentrations in this cohort of thrombocytopenic HIV-infected chimpanzees. PEG-rHuMGDF therapy increased (1) peripheral platelet counts 10-fold (from 64 ± 19 to 599 ± 260 × 103 platelets/μL;P = .02); (2) marrow megakaryocyte numbers 30-fold (from 11.7 ± 6.5 × 106/kg to 353 ± 255 × 106/kg;P = .04); (3) marrow megakaryocyte progenitor cells fourfold (from a mean of 3.6 ± 0.6 to 14.1 × 103 CFU-Meg/1,000 CD34+ marrow cells); and (4) serum levels of Mpl ligand from 926 ± 364 pg/mL (endogenous TPO) to predosing trough levels of 1,840 ± 353 pg/mL PEG-rHuMGDF (P = .02). The peripheral neutrophil counts were also transiently increased from 5.2 ± 2.6 × 103/μL to 9.9 ± 5.0 × 103/μL (P= .01), but neither the erythrocyte counts nor the reticulocyte counts were altered significantly (P > .1). The serum levels of antiplatelet GPIIIa49-66 antibodies exhibited reciprocal reductions during periods of thrombocytosis (P < .07). PEG-rHuMGDF therapy did not increase viral loads significantly (395, 189, and 53 × 103 RNA viral copies/mL; P > .5 compared with baseline values). The striking increase in peripheral platelet counts produced by PEG-rHuMGDF therapy implies that thrombocytopenia in HIV-infected chimpanzees is attributable to insufficient compensatory expansion in platelet production resulting from HIV-impaired delivery of platelets despite stimulated megakaryocytopoiesis. These data suggest that PEG-rHuMGDF therapy may similarly correct peripheral platelet counts in thrombocytopenic HIV-infected patients.

<p class="Pa7"><strong>Objective: </strong>Assess the relationship of self-reported sleep quality and possible sleep disorders with disability in a racially diverse sample of community-dwelling older adults.</p><p class="Pa7"><strong>Methods: </strong>Participants included 943 non-demented older African Americans (n=452) and Whites (n=491) from two cohort studies, the Minority Aging Research Study (MARS) and the Rush Memory and Aging Project (MAP). Participants completed a 32-item questionnaire assessing sleep quality and the possible presence of three sleep disorders (sleep apnea, restless leg syndrome [RLS] and REM behavior disorder [RBD]). Disability was assessed with scales that quantified the ability to perform instru­mental activities of daily living (IADL), basic activities of daily living (ADL), and physical mobility activities.</p><p class="Pa7"><strong>Results: </strong>More than half of the participants reported impaired sleep quality (51%), or the possible presence of at least one sleep disorder (57%; sleep apnea 44%, RLS 25% and RBD 7%). Sleep quality was rated poorer in African Americans, those with advancing age and fewer years of educa­tion (all P&lt;.05). Only sleep apnea risk was associated with age (P&lt;.02). In logistic regression models adjusted for age, sex, years of education, and race, both sleep quality and disorders were associated with disability (sleep quality with mobility disabil­ity (P&lt;.001), sleep apnea risk with mobility disability and IADL disability (all P&lt;.001) and RLS symptoms with mobility disability (P&lt;.01).</p><p class="Pa7"><strong>Conclusions: </strong>Results indicate that self-assessed impaired sleep is common in old age and is associated with disability. <em></em></p><p class="Pa7"><em>Ethn Dis.</em>2016;26(4):521-528; doi:10.18865/ ed.26.4.521</p><strong></strong>

Abstract Abstract 4037 Background: Cardiac and pulmonary events are common comorbidities in patients (pts) with multiple myeloma (MM) that typically affect older adults (Robin J, et al. J Med Case Rep. 2008) and are aggravated by chronic anemia and cardiotoxicity of anti-MM agents such as anthracyclines and hematopoietic stem cell transplantation (Chow AW, et al. Intern Med J. 2012). Pts with MM are also predisposed to pulmonary infections, with pneumonia being one of the most common causes of death (Augustson BM, et al. J Clin Oncol.2005). The following abstract summarizes details of the cardiac and pulmonary safety profile from 4 phase 2 studies of carfilzomib (CFZ), a next generation proteasome inhibitor recently approved for the treatment of relapsed and refractory MM. Methods: Included in this analysis were 526 pts with relapsed and/or refractory MM treated with CFZ in the following trials: 003-A0, 003-A1, 004, and 005. In all studies, CFZ was dosed on Days 1, 2, 8, 9, 15, and 16 of a 28-day cycle (C). Doses could be escalated from 20 mg/m2 in C1 to 27 mg/m2 in C2 for all studies except 005 (15 mg/m2 in C1, 20 mg/m2 in C2, and 27 mg/m2in C3). Pts with NYHA class III-IV heart failure and recent MI/unstable angina were excluded. A comprehensive strategy based on Standardized MedDRA Query preferred terms was used wherein clinically related event terms were grouped to determine the most comprehensive occurrences of adverse events (AEs). The cardiac grouping included cardiac arrhythmias, cardiac failure, cardiomyopathy, and ischemic heart disease (IHD). Medical history was analyzed for relevant comorbid conditions, and baseline cardiac risk factor was defined as pts on ≥1 prior cardiac medication. Multiple dyspnea AE terms were grouped as were pulmonary infections from the Infections and Infestations System Organ Classes. Pulmonary AE analyses included dyspnea time-to-event and duration-of-event analyses. Results: In all, 73.6% pts had a medical history of a cardiac event and 70.0% demonstrated baseline cardiac risk factors. The most common cardiac AEs were arrhythmias, the majority of which were low-grade, benign, supra-ventricular events such as tachycardia and palpitations. Congestive heart failure (CHF) events were predominantly Grade (G) 3. There were 4 (0.8%) G5 cardiac SAEs, all cardiac arrest. An additional 4 pts had a cardiac component to their death for a total of 8 (1.5%) deaths on study or within 30 days of treatment with a cardiac component. Of note, 7 of the 8 deaths occurred in pts with baseline cardiac risk factors. Overall, 6 pts (1.1%) had a CFZ dose reduction and 23 (4.4%) discontinued treatment due to a cardiac AE. Cardiac events leading to discontinuation included CHF (1.7%), arrhythmia (1.1%), and IHD (1.0%). In general, the rate of cardiac events decreased over time with increased of number of cycles (C1 52/526 pts, 9.9%; C9–11 3/154 pts, 1.9%). The most commonly reported pulmonary AE was dyspnea (42.2%). Of note, the majority of the dyspnea events were G1 or G2 with 1 G5 dyspnea occurring in the clinical setting of CHF. Dyspnea was reported by a higher percentage of pts in earlier cycles vs later cycles (11.8% in C1; 3.2% in C6), suggesting it is likely not associated with cumulative toxicity. The median duration of a dyspnea event was 8 days and the majority of episodes were transient, with 64% lasting <2 weeks. Notably, no interstitial lung disease (ILD) or pulmonary fibrosis AEs were reported. At least 1 pulmonary infection AE was reported for 18.8% of pts; pneumonia was the most common AE (67 pts, 12.7%) as well as the most common SAE (52 pts, 9.9%). Pulmonary infections resulted in the death of 2 pts. Conclusion: Cardiac event deaths and deaths with a cardiac etiology are not unexpected in this heavily pretreated, late-stage population. Rates reported here are comparable to those noted in the literature for this population. While dyspnea was frequently observed, events were mainly G1 or G2 and transient, and there were no AEs of ILD or pulmonary fibrosis. Pulmonary infection rates were comparable to those previously reported in the literature. Importantly, CFZ discontinuations and dose reductions due to these AEs were uncommon. Cardiac and pulmonary AEs are being further characterized in ongoing randomized clinical trials. Disclosures: Lonial: Millennium: Consultancy; Celgene: Consultancy; Novartis: Consultancy; Bristol Myers Squibb: Consultancy; Onyx Pharmaceuticals: Consultancy; Merck: Consultancy. Off Label Use: Carfilzomib for the treatment of Multiple Myeloma. Niesvizky:Celgene: Consultancy, Research Funding, Speakers Bureau; Millennium: Consultancy, Research Funding, Speakers Bureau; Onyx Pharmaceuticals: Consultancy, Research Funding. McCulloch:Onyx Pharmaceuticals: Employment. Rajangam:Onyx Pharmaceuticals: Employment. Vij:Celgene: Consultancy, Research Funding, Speakers Bureau; Millennium: Speakers Bureau; Onyx Pharmaceuticals: Consultancy, Research Funding.

Objective: To examine racial differences in outcomes with coronary computed to­mographic angiography (CCTA) vs standard emergency department (ED) evaluation for chest pain.Design: Retrospective analysis of the pro­spective, randomized, multicenter Rule Out Myocardial Ischemia/Infarction by Comput­er Assisted Tomography (ROMICAT-II) trial.Setting: ED at nine hospitals in the United States.Participants: 940 patients who were Cau­casian or African American (AA) presenting to the ED with chest pain.Interventions: CCTA or standard ED evalu­ationMain Outcome Measures: Length of stay, hospital admission, direct ED discharge, downstream testing and repeat ED visit or hospitalization for recurrent chest pain at 28 days. Safety end points: missed acute coronary syndrome (ACS) and cumulative radiation exposure during the index visit and follow-up period.Results: 659 (66%) patients self-identified as Caucasian and 281 (28%) self-identified as AA. AA were younger and more often female compared with Caucasians, had a higher prevalence of hypertension (64% vs 49%, P<.001) and diabetes (23% vs 14%, P<.001) and a lower prevalence of hyperlipidemia (28% vs 51%, P<.001). ACS was more frequent among Caucasians (10% vs 2%, P<.001). Randomization to CCTA resulted in a reduction in median LOS for Caucasians (7.4 vs 24.7 hours, P<.001) and AA (8.9 vs. 26.3, P<.001; P-interac­tion=.88). Both AA and Caucasian patients experienced greater radiation exposure and more downstream testing with CCTA compared with standard evaluation.Conclusions: Early CCTA reduced median LOS for both AA and Caucasian patients presenting to the ED with chest pain by ap­proximately 17 hours compared with stan­dard evaluation.Ethn Dis. 2018;28(4):517- 524; doi:10.18865/ed.28.4.517.

AbstractDargaite, ideally BaCa12(SiO4)4(SO4)2O3, is an additional member of the arctite group belonging to minerals with a modular intercalated antiperovskite structure derived from hatrurite. The holotype specimen was found at a small outcrop of larnite pseudoconglomerates in the Judean Mts, West Bank, Palestinian Autonomy. Larnite, fluorellestadite–fluorapatite, brownmillerite, fluormayenite–fluorkyuygenite and ye'elimite are the main minerals of the holotype specimen; ternesite, shulamitite and periclase are noted rarely. Dargaite, nabimusaite and gazeevite occur in linear zones with higher porosity within larnite rocks. Pores are filled with ettringite and Ca-hydrosilicates, less commonly with gibbsite, brucite, baryte, katoite and calciolangbeinite. Dargaite is colourless, transparent with a white streak and has a vitreous lustre. It exhibits pronounced parting and imperfect cleavage along (001). Mohs’ hardness is ~4.5–5.5. The empirical formula is (Ba0.72K0.24Na0.04)Σ1(Ca11.95Mg0.04Na0.01)Σ12([SiO4]0.91 [PO4]0.05[AlO4]0.03[Ti4+O4]0.01)Σ4([SO4]0.84[PO4]0.14[CO3]0.02)Σ2(O2.54F0.46)Σ3. Dargaite is trigonal R$\overline 3 $m, the unit-cell parameters are: a = 7.1874(4) Å, c = 41.292(3) Å, V = 1847.32(19) Å3 and Z = 3. The crystal structure of dargaite was refined from X-ray single-crystal data to R1 = 3.79%. The calculated density is 3.235 g cm–3. The following main Raman bands are distinguished on the holotype dargaite (cm–1): 122, 263, 323, 464, 523, 563, 641 and 644, 829 and 869, 947, 991 and 1116. The formation conditions of dargaite are linked to the local occurrence of pyrometamorphic by-products (gases, fluids and melts) transforming earlier mineral associations at ~900°C.

2002 Background: Our phase IIa study evaluated the safety, toxicity, and clinical activity of the cyclic RGD pentapeptide cilengitide (EMD121974), an inhibitor of integrins avβ3 and avβ5, as a single agent at doses of 500 and 2000 mg in pts with recurrent GBM. Methods: In this multicenter, open-label, randomized, uncontrolled study, pts with GBM and measurable disease that had relapsed after previous temozolomide and radiotherapy were randomized to receive cilengitide at either 500 mg or 2000 mg i.v., 2x/week, until progression. Neurologic exams were performed after every cycle (4 weeks) and MRIs were performed every other cycle. Central, blinded pathology and radiology reviews were performed. The primary endpoint was Progression Free Survival (PFS) at 6 months (6-mth PFS). Secondary endpoints included response, survival, time to disease progression, safety, tolerability and pharmacokinetics (PK). Results: 81 pts accrued (median Karnofsky Performance Status 80%; median age 57 yrs) at 15 sites including 41 at the 500 mg and 40 at the 2000 mg dose levels. Demographic and pretreatment variables were comparable between dose level cohorts. The median number of infusions was 16 [range, 4–179]. PK studies revealed significantly greater exposures among the 2000 mg cohort. Treatment related NCI CTC grade 3 adverse events (AEs) included elevated transaminases (at 500 mg), arthralgia/ myalgia (at 500 mg), and weight increase/ edema (at 2000 mg) in 1 patient, respectively. No grade 4 therapy related AEs were reported. One CTC grade 2 cerebral hemorrhage was reported in a pt at progression. The 6- mth PFS was 16.1% (n=13/81 pts). 10 pts (12.3 %, n=4 with 500 mg, n=6 with 2000 mg) received 12 or more cycles. Six pts (7.4%) remain progression-free and on treatment. Median Overall Survival (mOS) was 6.5 mths [95% CI: 5.2–9.3 mths] in the 500 mg arm and 9.9 mths [95% CI, 6.3–15.7 mths] in the 2000 mg arm. Although not statistically significant, there was a trend towards better tumor control in pts receiving 2000 mg 2x/week. Conclusions: Cilengitide was well tolerated and demonstrated single agent activity in recurrent GBM, with long term disease stabilization in a subset of pts. [Table: see text]

Objective.Identify factors affecting the rate of hand hygiene opportunities in an acute care hospital.Design.Prospective observational study.Setting.Medical and surgical in-patient units, medical-surgical intensive care unit (MSICU), neonatal intensive care unit (NICU), and emergency department (ED) of an academic acute care hospital from May to August, 2012.Participants.Healthcare workers.Methods.One-hour patient-based observations measured patient interactions and hand hygiene opportunities as defined by the “Four Moments for Hand Hygiene.” Rates of patient interactions and hand hygiene opportunities per patient-hour were calculated, examining variation by room type, healthcare worker type, and time of day.Results.During 257 hours of observation, 948 healthcare worker-patient interactions and 1,605 hand hygiene opportunities were identified. Moments 1, 2, 3, and 4 comprised 42%, 10%, 9%, and 39% of hand hygiene opportunities. Nurses contributed 77% of opportunities, physicians contributed 8%, other healthcare workers contributed 11%, and housekeeping contributed 4%. The mean rate of hand hygiene opportunities per patient-hour was 4.2 for surgical units, 4.5 for medical units, 5.2 for ED, 10.4 for NICU, and 13.2 for MSICU (P < .001). In non-ICU settings, rates of hand hygiene opportunities decreased over the course of the day. Patients with transmission-based precautions had approximately half as many interactions (rate ratio [RR], 0.55 [95% confidence interval (CI), 0.37-0.80]) and hand hygiene opportunities per hour (RR, 0.47 [95% CI, 0.29-0.77]) as did patients without precautions.Conclusions.Measuring hand hygiene opportunities across clinical settings lays the groundwork for product use-based hand hygiene measurement. Additional work is needed to assess factors affecting rates in other hospitals and health care settings.

SUMMARYA serological survey has been used to investigate the epidemiology of parvovirus B19 infection in England and Wales. A total of 2835 sera representing the complete age range were selected from a convenience collection obtained in 1996 that reflects the general population and screened for parvovirus B19-specific IgG. Antibody prevalence rose nonlinearly with age from 21% in those aged 1–4 years to >75% in adults aged ⩾45 years. Force-of-infection estimates were similar to those previously made in 1991, being highest in those aged <15 years. There was no association between evidence of previous infection and sex or region. Quantitatively strongest antibody responses were found in those aged 15–34 years and IgG levels in females were 28·5% higher than those found in males (P=0·004, 95% CI 8·2–52·6). Applying the upper 95% confidence interval for the force of infection to maternity estimates for England and Wales in 1996, parvovirus infection in pregnancy was estimated to occur on average in up to 1 in every 512 pregnancies each year. This represents 1257 maternal infections, causing up to an estimated 59 fetal deaths and 11 cases of hydrops fetalis annually. An analysis of all available laboratory-confirmed parvovirus infections found a mean of 944 infections per year in women aged 15–44 years highlighting a need for enhanced surveillance of maternal parvovirus B19 infection in England and Wales, including information on both pregnancy and outcome of pregnancy.

133 Background: Due to the growing concerns about over-diagnosis and overtreatment of localized prostate cancer (PCa), active surveillance (AS) has become an integral part of clinical practice guidelines. However, many men with low-risk PCa still receive primary therapy with surgery or radiation. Little is known about the barriers regarding the use of AS in clinical practice. To address this, we performed a national survey of radiation oncologists and urologists assessing the current attitudes and treatment for patients diagnosed with low-risk PCa. Methods: From January to July of 2017, 915 radiation oncologists and 940 urologists were surveyed about perceptions of AS for low-risk PCa. The survey queried respondents about their opinions and attitudes towards AS and treatment recommendations for a patient having low-risk PCa with clinical factors varying from patient age (55, 65 and 75 years old), PSA (4 and 8 ng per dl), and tumor volume for Gleason 3+3 disease (2, 4 and 6 cores). Pearson chi-square and multivariable logistic regression were used to identify respondent differences in treatment recommendations for low-risk PCa. Results: Overall, the response rate was 37.3% (n = 691) and similar for radiation oncologists and urologists (35.7% vs. 38.7%; p = 0.18). While both radiation oncologists and urologists viewed AS as effective for low-risk PCa (86.5% vs. 92.0%; p = 0.04), radiation oncologists were more likely to respond that AS increases patient anxiety (49.5% vs. 29.5%; p < 0.001). Overall, recommendations varied markedly based on patient age, PSA, number of cores positive for Gleason 3+3 prostate cancer and respondent specialty. For a 55-year-old male patient with a PSA 8 and 6 cores of Gleason 6 PCa, recommendations of AS were low for both radiation oncologists and urologists (4.4 % vs. 5.2%; adjusted OR: 0.6; p = 0.28). For a 75-year-old patient with a PSA 4 and 2 cores of Gleason 6 PCa, radiation oncologists and urologists most often recommended AS (89.6% vs. 83.4%; adjusted OR: 0.5; p = 0.07). Conclusions: While both radiation oncologists and urologists consider AS effective in the clinical management of low-risk PCa, its use varies markedly by patient age, PCa volume, PSA and physician specialty.

Abstract Abstract 1146 Background: The recent proliferation in deep vein thrombosis (DVT) in pediatric patients has been attributed to the improved care of children with serious and life-threatening disorders as well as the prolonged survival of children with chronic disease. Often such treatment involves the insertion of central venous catheters. Yet the incidence of DVT associated with peripherally-inserted central catheters (PICC) and tunneled Lines (TL) has not been investigated in depth. Thus we report a retrospective database study to determine the incidence of DVT in pediatric patients with PICC and TL lines. Methods: Children <18 years of age who were admitted to Children's Hospital Los Angeles from January 1, 2003- December 31, 2009 were eligible for inclusion. Data were extracted from the CHLA hospital discharge database which includes data on all procedures and up to 20 diagnoses per admission. Diagnoses and procedures were identified by International Classification of Disease, Ninth Revision (ICD-9) coding in the hospital discharge database. PICC codes used were: 365.69 and TL codes used were: 365.57, 365.58, 365.60, 365.61, 365.63, 365.65, 365.66. DVT codes were: 415.11, 415.12, 415.19, 452, 453.0, 453.1, 453.3, 453.41, 453.42, 453.8, 453.9. Patient diagnoses other than DVT were grouped according to ICD. 9 coding into categories termed Complex Chronic Conditions (CCC) as previously described. To ensure that the DVT event was related to the individual line insertion, patients were excluded if their lines were placed after three days of hospital admissions and if they received more than one line or more than one type of line. A limitation of the data is the lack of information regarding the length of time the catheters remained in place. Results: Over the 6 year period of this study, 1449 eligible subjects were identified of whom 29 had DVTs (2%). There were 947 PICC insertions and 502 TL insertions. The mean age of PICC patients was 12±4 years and 56% were male. The mean age of TL patients was 8±6 years and 54% were male. There were 9 (0.95%) DVTs in PICC patients, and 20 (3.9%) DVTs in TL patients. The odds ratio for developing a DVT with a TL was 3.6 (p-value.002; confidence interval 1.6–8.1) which remained significant at 3.8 (p=.001; confidence value 1.7–8.55) when controlling for the presence of CCCs. Conclusions: Despite the proliferation in the utilization of PICC in recent years, it appears that they are not associated with a higher risk for DVT than TL, and in fact, the data from this study suggests that TL were associated with more DVT than PICC. Although it is possible that the results could be explained by the fact that TL in general remain in place for a longer period of time than PICC, this study nonetheless provides important reassurance that PICC appear to have relatively low thrombotic potential when compared to TL. Disclosures: No relevant conflicts of interest to declare.

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 μm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

Root-knot nematodes (Meloidogyne spp.) are common parasites attacking turfgrasses in the United States, but the species of these nematodes is typically unresolved unless targeted surveys are performed (3). Using morphometric analysis and an RFLP method (3), an investigation of a golf course green in Florida with a history of infestation by root-knot nematodes was conducted to identify the species present. This ‘Tifdwarf’ bermudagrass (Cynodon dactylon × C. transvaalensis) putting green at the University of Florida Research Unit in Citra, FL, exhibited irregular patches of declining turf. Turf roots in these symptomatic areas had galled root tips with adhering egg masses, characteristic of infection from Meloidogyne spp. Mean populations of 5,149 ± 708 Meloidogyne second stage juveniles per 100 cm3 of soil were extracted from the rhizosphere of these symptomatic plants. Morphological measurements from 20 of these juveniles were slightly less than those published previously for M. marylandi, but were still distinct enough to discriminate them from M. graminis, which commonly infects bermudagrass in Florida (3). Body length averaged 396.1 ± 4.9 (376.7 to 420.0) μm with a mean width of 16.3 ± 0.5 (13.3 to 18.3) μm, stylet lengths were 11.2 ± 0.7 (6.7 to 12.3) μm, tail lengths averaged 54.7 ± 1.9 (47.5 to 65.0) μm with the hyaline region of the tails 9.9 ± 0.7 (8.3 to 14.2) μm. Mature females extracted from symptomatic root tissue lacked a posterior cone-like protuberance of the vulva typical of M. graminis. DNA was extracted from 15 single juveniles using a NaOH digestion method (2). The mitochondrial DNA region was amplified with PCR using the primers C2F3/1108 5′-GGTCAATGTTCAGAAATTTGTGG-3′ and 5′-TACCTTTGACCAATCACGCT-3′ (3). This resulted in a DNA fragment 520 bp in length, which upon digestion with SspI restriction enzyme produced four bands 148, 103, 91, and 67 bp in length, similar to what has been reported for M. marylandi (3). The PCR products were purified with a QIAquick PCR purification kit (QIAGEN, Valencia, CA) and sequenced at the University of Florida, Cancer Research and Genetics Institute. Sequences were compared with those in GenBank by means of BLAST search. The comparison showed a sequence similarity of 98% with M. marylandi (GenBank Accession No. JN241918.1). Although M. marylandi has been reported on bermudagrass in many areas of the United States and other places throughout the world (1,3,4), to our knowledge, this is the first detection of this nematode in Florida. Further studies will be conducted to determine the prevalence, incidence, severity of damage caused by M. marylandi, and determine a possible mode of dispersal on turfgrasses. References: (1) A. M. Golden. J. Nematol. 21:453, 1989. (2) J. Hübschen et al. Euro. J. Plant Pathol. 110:779, 2004. (3) M. A. McClure et al. Plant Dis. 96:635, 2012. (4) Y. Oka et al. Nematol. 5:727, 2003.

Abstract Patients (pts) with cancer receiving chemotherapy commonly have chemotherapy-induced anemia (CIA), often resulting in reduced quality of life. The primary objective of this analysis was to summarize the effectiveness of darbepoetin alfa (DA) administered at 300mcg every 3 weeks (Q3W), in achieving and maintaining a hemoglobin (Hb) target range of 11–13g/dL in pts with hematologic malignancies and CIA, versus pts with solid tumors and CIA. Data for all 1493 pts enrolled in this multicenter, open-label, 16-week study who received at least one dose of DA are included in this exploratory analysis stratified by tumor type. Pts ≥18 years of age receiving multicycle chemotherapy and with Hb &lt;11g/dL were eligible for this study. Hb-based endpoints were adjusted for red blood cell transfusions and analyzed with and without imputing missing Hb values. Pt-reported outcomes were assessed using the Functional Assessment of Cancer Therapy-Fatigue (FACT-F) scale. Most pts were white (79%), 61% were female, and the median age was 64 years (range, 19 to 97). At baseline (BL), 31% of pts had Hb &lt;10g/dL and 61% had Hb ≥10g/dL; the mean (SD) was 10.1 (0.7)g/dL. Hematologic malignancy (14%) was the third most common tumor type after breast (29%) and gastrointestinal (24%); 45% of the hematologic malignancies were non-Hodgkin’s lymphoma (NHL) pts. Hb, transfusion, and FACT-F endpoints are shown in the table. A slightly lower percent of NHL pts achieved the Hb target range recommended by current guidelines (11–13g/dL), compared to pts with other hematologic malignancies or with solid tumors. Similar proportions of pts with hematologic malignancies or solid tumors maintained Hb within the target range. The proportion of pts receiving RBC transfusions from week 5 to the end of study (EOS) was similar for pts with hematologic malignancies and for pts with solid tumors. Improvements in FACT-F scores were seen in all groups, although the mean change was lower in NHL pts compared with other tumor types. Serious adverse events were as expected for this patient population. DA Q3W appears to be effective in achieving and maintaining Hb between 11 to 13g/dL in pts with CIA and hematologic malignancies. Since chemotherapy is often administered Q3W, synchronizing DA treatment with pts’ chemotherapy schedules may simplify the treatment of CIA in these pts. Hematologic - NHL N=98 Hematologic - non-NHL N=118 Solid N=1277 All Tumor Types N=1493 *For pts who achieved target. **For pts available at day 29. K-M=Kaplan Meier. CL=confidence limits Mean (95%CL) BL Hb (g/dL) 10.1 (9.9, 10.2) 10.0 (9.8, 10.1) 10.1 (10.1, 10.2) 10.1 (10.1, 10.2) Pts who achieved ≥ Hb 11g/dL. Crude % (95% CL) 74 (66, 83) 82 (75, 89) 79 (77, 81) 79 (77, 81) Proportion of pts maintaining Hb between 11 and 13g/dL after achieving target - n (%)* 51 (70) 68 (70) 739 (73) 858 (73) Time to target Hb (weeks). K-M Median (95% CL) 7 (6, 8) 6 (4, 7) 4 (4, 5) 4 (4, 5) Transfusions from week 5 to EOS. Crude % (95% CL)** 21 (13, 30) 20 (13, 27) 18 (16, 20) 18 (16, 20) Mean change in FACT-F from BL to week 16 (95% CL) 2.8 (−0.9, 6.5) 5.2 (1.8, 8.6) 4.8 (3.9, 5.7) 4.7 (3.9, 5.6)

Background:Limited real world (RW) data are available for IL-17A blocker ixekizumab (Ixe), approved for psoriatic arthritis (PsA) in EU Feb 2018.Objectives:Describe RW outcomes for PsA patients (pts) receiving Ixe.Methods:Cross-sectional, observational study of PsA pts treated with Ixe in the 2020 Adelphi PsA Plus Program (FR, DE, ES & UK). Rheumatologists recruited the first 6 consecutive consulting Ixe pts and provided demographics, PsA manifestations, clinical measures (66 swollen joint count (SJC), 68 tender joint count (TJC), psoriasis area and severity index [PASI], body surface area [BSA] affected by psoriasis [PsO]), rheumatologist-recorded pt measures (skin/joint pain & fatigue [0-10 numeric rating scales (NRS)], health assessment questionnaire [HAQ-DI]) & prescribed dose. All outcomes recorded for pts with scores available at Ixe initiation (II) & at last assessment (LA).Results:124 rheumatologists provided data for 698 Ixe pts, mean age 49 years (19-79), 48% female, mean BMI 27 (18-44), 56% dermatologist co-managed and mean time diagnosed 6 years (0-35). At Ixe initiation, 78% of pts with known BSA had concomitant mod-sev-PsO defined as BSA≥10% (mean 19.8, n=428) and mean PASI 26.3 (n=164). The predominant PsA phenotype was polyarthritic in 49% (n=345), mono/oligoarthritic in 30% (n=208), axial in 12% (n=81) and enthesitic in 8% (n=55). Previous treatment before Ixe included ≥1 conventional synthetic DMARD (csDMARD) for 71% of pts. Of bio-experienced pts (57%), 40% had received ≥2 biologics. Mean Ixe treatment duration (n=698) 39.4 weeks (wks, 0-170), of which 575 (82%) had received >12 wks of Ixe. 71% of pts received label recommended dose (80mg every 4wks). 52% pts received csDMARD in combination with Ixe. In the RW, Ixe improved TJC, SJC, joint pain, BSA, fatigue and HAQ-DI, Table 1.Table 1.Outcomes for pts receiving Ixe >12weeks (n=575)OverallBSA ≥10% at Ixe initiationMod-sev-PsO physician judgementPredominant mono/oligo arthritisPredominant polyarthritisWith csDMARDWithout csDMARDBSA, n35627025498184188168mean [SD]Ixe initiation (II)19.8 [14.8]24.7 [13.5]23.1 [13.6]17.4 [15.0]20.9 [15.0]21.8 [15.0]17.4 [14.2]Last Assessment (LA)6.6 [7.5]9.3 [8.7]7.9 [7.9]5.0 [6.0]7.6 [8.4]7.3 [7.9]5.9 [7.1]Mean weeks on Ixe43414150414146TJC*, n125728639725669mean [SD, %<5]II12.2 [10.6, 29]14.4 [11.3, 18]12.9 [11.1, 21]6.4 [8.2, 59]15.4 [10.8, 12]13.0 [9.9, 25]11.5 [11.1, 32]LA4.1 [6.4, 77]5.2 [7.7, 71]3.6 [6.3, 80]1.1 [1.4, 97]6.2 [7.7, 64]3.4 [3.9, 73]4.6 [7.8, 80]SJC*, n1458210244846085mean [SD, %<5]II14.8 [13.5, 33]18.8 [14.4, 22]16.3 [13.8, 26]7.2 [8.5, 68]18.2 [13.6, 12]14.5 [12.0, 37]15.1 [14.8, 31]LA4.8 [8.7, 79]7.0 [10.7, 66]5.1 [9.3, 75]0.9 [1.9, 95]6.6 [9.0, 68]3.1 [7.8, 90]5.9 [9.1, 71]Joint pain (NRS 0-10), n575270349166291294281mean [SD]II6.6 [1.7]6.7 [1.7]6.7 [1.7]6.2 [1.8]7.0 [1.5]6.6 [1.7]6.6 [1.6]LA2.7 [1.9]3.0 [2.1]2.8 [2.0]2.1 [1.6]3.0 [2.1]2.8 [1.9]2.5 [1.9]Fatigue (NRS 0-10), n575270349166291294281mean [SD]II5.4 [2.5]5.8 [2.4]5.7 [2.5]4.7 [2.5]5.7 [2.4]5.7 [2.4]5.1 [2.5]LA2.6 [2.1]2.7 [2.1]2.7 [2.2]2.0 [1.9]2.9 [2.2]2.7 [2.1]2.6 [2.1]HAQ DI, n59414210283128mean [SD, %<0.5]II1.8 [0.7, 5]1.9 [0.6, 0]1.8 [0.7, 2]1.9 [0.7, 10]1.8 [0.8, 7]1.9 [0.6, 3]1.7 [0.8, 7]LA0.8 [0.6, 41]0.8 [0.6, 32]0.8 [0.7, 45]0.7 [0.7, 60]0.7 [0.6, 36]0.7 [0.5, 32]0.7 [0.8, 50]*Additional analysis for pts whose fatigue/joint pain rating improved (from ≥4 at Ixe initiation to ≤3 at LA), their mean TJC was 2.7 & SJC 4.3 at LA for fatigue, TJC 1.7 & SJC 2.7 at LA for joint pain.When BSA was not recorded, physician judgement of PsO severity was used. No imputation of missing data.Conclusion:We report RW outcome data amongst pts treated with Ixe including mono/oligo arthritis and a limited sample of enthesitis and dactylitis pts. Our results are consistent with clinical trial populations across disease domains, including an improvement in joint pain.Disclosure of Interests:William Tillett Speakers bureau: AbbVie, Amgen, Celgene, Lilly, Janssen, Novartis, Pfizer Inc. and UCB, Consultant of: AbbVie, Amgen, Celgene, Lilly, Janssen, Novartis, MSD, Pfizer Inc. and UCB, Grant/research support from: AbbVie, Celgene, Eli Lilly & company, Janssen and UCB, Victoria Navarro-Compán Speakers bureau: AbbVie, BMS, Janssen, Eli Lilly & Co, MSD, Novartis, Pfizer, Roche and UCB, Consultant of: AbbVie, BMS, Janssen, Eli Lilly & Co, MSD, Novartis, Pfizer, Roche and UCB, Grant/research support from: AbbVie, BMS, Janssen, Eli Lilly & Co, MSD, Novartis, Pfizer, Roche and UCB, Nicola Booth: None declared., Thorsten Holzkaemper Shareholder of: Eli Lilly & Company, Employee of: Eli Lilly & Company, Julie Hill Shareholder of: Eli Lilly & Company, Employee of: Eli Lilly & Company, Ennio Lubrano Speakers bureau: Alfa-Sigma, Abbvie, Galapagos, Janssen Cilag, Lilly., Consultant of: Alfa-Sigma, Abbvie, Galapagos, Janssen Cilag, Lilly., Tamas Truer Shareholder of: Eli Lilly and Company, Employee of: Eli Lilly and Company.

We propose and analyse a new stochastic competing two-species population dynamics model. Competing algae population dynamics in river environments, an important engineering problem, motivates this model. The algae dynamics are described by a system of stochastic differential equations with the characteristic that the two populations are competing with each other through the environmental capacities. Unique existence of the uniformly bounded strong solution is proven and an attractor is identified. The Kolmogorov backward equation associated with the population dynamics is formulated and its unique solvability in a Banach space with a weighted norm is discussed. Our mathematical analysis results can be effectively utilized for a foundation of modelling, analysis, and control of the competing algae population dynamics. References S. Cai, Y. Cai, and X. Mao. A stochastic differential equation SIS epidemic model with two correlated brownian motions. Nonlin. Dyn., 97(4):2175–2187, 2019. doi:10.1007/s11071-019-05114-2. S. Cai, Y. Cai, and X. Mao. A stochastic differential equation SIS epidemic model with two independent brownian motions. J. Math. Anal. App., 474(2):1536–1550, 2019. doi:10.1016/j.jmaa.2019.02.039. U. Callies, M. Scharfe, and M. Ratto. Calibration and uncertainty analysis of a simple model of silica-limited diatom growth in the Elbe river. Ecol. Mod., 213(2):229–244, 2008. doi:10.1016/j.ecolmodel.2007.12.015. M. G. Crandall, H. Ishii, and P. L. Lions. User's guide to viscosity solutions of second order partial differential equations. Bull. Am. Math. Soc., 27(1):229–244, 1992. doi:10.1090/S0273-0979-1992-00266-5. N. H. Du and V. H. Sam. Dynamics of a stochastic Lotka–Volterra model perturbed by white noise. J. Math. Anal. App., 324(1):82–97, 2006. doi:10.1016/j.jmaa.2005.11.064. P. Grandits, R. M. Kovacevic, and V. M. Veliov. Optimal control and the value of information for a stochastic epidemiological SIS model. J. Math. Anal. App., 476(2):665–695, 2019. doi:10.1016/j.jmaa.2019.04.005. B. Horvath and O. Reichmann. Dirichlet forms and finite element methods for the SABR model. SIAM J. Fin. Math., 9(2):716–754, 2018. doi:10.1137/16M1066117. J. Hozman and T. Tichy. DG framework for pricing european options under one-factor stochastic volatility models. J. Comput. Appl. Math., 344:585–600, 2018. doi:10.1016/j.cam.2018.05.064. G. Lan, Y. Huang, C. Wei, and S. Zhang. A stochastic SIS epidemic model with saturating contact rate. Physica A, 529(121504):1–14, 2019. doi:10.1016/j.physa.2019.121504. J. L. Lions and E. Magenes. Non-homogeneous Boundary Value Problems and Applications (Vol. 1). Springer Berlin Heidelberg, 1972. doi:10.1007/978-3-642-65161-8. J. Lv, X. Zou, and L. Tian. A geometric method for asymptotic properties of the stochastic Lotka–Volterra model. Commun. Nonlin. Sci. Numer. Sim., 67:449–459, 2019. doi:10.1016/j.cnsns.2018.06.031. S. Morin, M. Coste, and F. Delmas. A comparison of specific growth rates of periphytic diatoms of varying cell size under laboratory and field conditions. Hydrobiologia, 614(1):285–297, 2008. doi:10.1007/s10750-008-9513-y. B. \T1\O ksendal. Stochastic Differential Equations. Springer Berlin Heidelberg, 2003. doi:10.1007/978-3-642-14394-6. O. Oleinik and E. V. Radkevic. Second-order Equations with Nonnegative Characteristic Form. Springer Boston, 1973. doi:10.1007/978-1-4684-8965-1. S. Peng. Nonlinear Expectations and Stochastic Calculus under Uncertainty: with Robust CLT and G-Brownian Motion. Springer-Verlag Berlin Heidelberg, 2019. doi:10.1007/978-3-662-59903-7. T. S. Schmidt, C. P. Konrad, J. L. Miller, S. D. Whitlock, and C. A. Stricker. Benthic algal (periphyton) growth rates in response to nitrogen and phosphorus: parameter estimation for water quality models. J. Am. Water Res. Ass., 2019. doi:10.1111/1752-1688.12797. Y. Toda and T. Tsujimoto. Numerical modeling of interspecific competition between filamentous and nonfilamentous periphyton on a flat channel bed. Landscape Ecol. Eng., 6(1):81–88, 2010. doi:10.1007/s11355-009-0093-4. H. Yoshioka, Y. Yaegashi, Y. Yoshioka, and K. Tsugihashi. Optimal harvesting policy of an inland fishery resource under incomplete information. Appl. Stoch. Models Bus. Ind., 35(4):939–962, 2019. doi:10.1002/asmb.2428.

Abstract Abstract 702 Despite that low and intermediate-1 (int-1) IPSS groups are commonly considered as low risk diseases with a median overall survival exceeding 60 months, some of these patients will evolve as higher risk myelodysplastic syndrome (MDS). Recently several new prognosis indexes (PI) have been proposed: The new IPSSr, WPSSr, MD Anderson for lower risk patients (MDA) Index, and the Spanish Group of MDS (GESMD) proposal that considers as high risk those patients with int-1 IPSS and at least one of the following: platelets <30×109/L, granulocytes <0.5×109/L, poor or very poor-risk karyotype or the presence of bone marrow (BM) fibrosis. The aim of the study was to compare the four PI and to analyze which of them was the best to identify patients with the poorest risk (defined as those with a median overall survival (OS) lower than 30 months) and to segregate different risk groups in a population of lower risk MDS patients. Indexes were compared using the Akaike analysis methodology. A total of 2410 patients from the Spanish registry of MDS with low or int-1 IPSS were included. Median age was 74 years (42.6% female). The IPSS value was of: 0, 0.5 and 1 in 1314, 761 and 335 patients, respectively. The four poor risk variables defined by the GESMD confirmed its adverse predictive value for OS: granulocytes <0.5×109/L (n=101, P<0.001), platelets <30×109/L (n=94, P<0.001), poor or very poor risk karyotype (n=35, P=0.007), and BM fibrosis (n=109 of 698 evaluable patients, P<0.001). The presence of at least one of these was associated with adverse prognosis in the int-1 group but not in the low IPSS risk group, thus only the former was considered as high risk. The distribution of patients across the four PI is detailed in the Table. These new PI identified between 16.9% and 46% of patients having a median OS of around 30 months within the int-1 patients (wide line in the table), but none of the PIs could identify such a poor prognosis patients in the low IPSS group. The PI that identified the highest number of patients with shorter OS was the new IPSSr, while MDA IP was the most discriminative in the Akaike analysis. In conclusion, IPSS is not discriminative enough in the int-1 group. In contrast, the application of the new PI can be employed to better identify poor prognosis patients within the int-1 group who could benefit from a high-risk approach. Table. Overall survival and AML evolution according to the different prognostic index. PROGNOSIS INDEX (AIC for the whole population/and for the Int-1) populations) PROGNOSIS GROUP IPSS LOW (N=1314) OS: 87.78 m (95% CI:74.5-101.0) AML EVOLUTION (3 years): 9.1% (95% CI: 6.9-11.3%) IPSS INT-1 (N= 1096) OS: 44.2 m (95% CI:39.1-49.3) AML EVOLUTION (3 years): 26.9% (95% CI: 23-30.8%) N (%) Overall Survival Median (95% CI) months AML evolution (3 years) % (95% CI) N (%) Overall Survival Median (95% CI) months AML evolution (3 years) % (95% CI) GESMD (12566.6/6425.9) LOW 1314 (100) 860 (78.5) 48.1 (40.9-55.3)* 25.1 (20.7-29.5)** HIGH 0 (0) 236 (21.5) 32.7 (39.1-49.3)* 34.3 (24.5-44.1)** MD. Anderson (12381.4/6357.2) LOW 508 (39.3) 130.3 (104.6-157.0)* 9% (5.4-12.6)! 109 (9.9) 115.2 (83.8-146.6)* 15.7 (6.5-24.9)* INT 781 (59.4) 69.7 (62.4-77.1)* 8.9% (6.9-11.9)! 653 (59.6) 51.3 (44.2-58.3)* 23.3 (18.3-28.3)* HIGH 25 (1.9) 58.4* (25.4-91.5)* ——–——–— 334 (30.5) 24.1 (19.3-28.9)* 39.9 (31.3-48.5)* IPSS-R (12409.9/6369.6) VERY LOW 690 (52.5) 118.8 (105.7-131.7)* 6.4% (4.2-8.6)*** 79 (7.2) 113.7 (39.9-187.4)* 17.8 (4.6-31)* LOW 602 (45.8) 65.9 (57.6-74.2)* 11.6% (7.8-15.4)*** 505 (46.1) 60.3 (53.3-67.2)* 18.2 (13.4-23)* INT 22 (1.7) 58.9 (25.2-92.7)* 26% (2-50)*** 416 (38) 30.5 (26.1-34.8)* 38.6 (30-47.2)* HIGH 0 (0) 95 (8.7) 21.2 (16.5-25.9)* 48.5 (32.5-64.5)* VERY HIGH 0 (0) 1 (0.1) WPSS-R (12477.4/6414.7) VERY LOW 517 (39.3) 115.2 (103.0-127.4)* 6.5 (3.7-9.3)$ 76 (6.9) 56.5 (38.2-74.9)* 22.8 (10.6-35)* LOW 524 (39.9) 78.5 (66.7-90.3)* 12.1 (7.7-15.5)$ 289 (26.4) 61.3 (48.3-74.2)* 19.2 (12.4-25.6)* INT 61 (4.6) 46.0 (30.8-61.1)* 13.7 (3.1-24.3)$ 386 (5.2) 42.5 (32.8-52.2)* 27.8 (20.8-34.8)* HIGH 3 (0.2) 185 (16.9) 24.11 (19.4-28.8)* 49.3 (35.7-62.9)* VERY HIGH 0 (0) 4 (0.4) NOT EVAL 209 (15.9) 87.8 (74.6-101.3)* 7.2 (3-11.4)$ 156 (14.2) 48 (30.8-65.2) 18.3 (9.1-27.5)* AIC: Akaike Information Criteria. Int: Intermediate, Not Eval: Not evaluable, CI: Confidence interval. * P<0.001; ** P=0.02; *** P=0.04; ! !P=0.7 $P=0.1 Figure. Actuarial curves of overall survival according to the different PI. Figure. Actuarial curves of overall survival according to the different PI. Disclosures: No relevant conflicts of interest to declare.

Background:Bone marrow edema (BME) on sacroiliac joint (SIJ) MRI is central in the Assessment of SpondyloArthritis International Society classification criteria for axial spondyloarthritis (axSpA). However, BME can be seen in other conditions and healthy persons. The presence of structural lesions may contribute to diagnosing axSpA.Objectives:To investigate the location and distribution of SIJ MRI lesions in patients with axSpA and disc herniation, women with and without post-partum pain (PPP), cleaning staff, runners, and healthy persons.Methods:In a prospective cross-sectional study of 204 participants, MRI of the SIJs was evaluated by two readers. MRI images were scored according to the SPARCC SIJ Inflammation1and Structural (SSS)2lesion definitions. Based on concordant reads, lesions were analysed according to location (unilateral/bilateral SIJ, upper/lower sacral/iliac quadrant/joint half, anterior (slice1-3)/central (slice 4-6)/posterior (slice 7-9) SIJ sections.Results:BME was present in nearly all groups, in all quadrants, and primarily in the anterior SIJ section (Figure 1), but rarely as a bilateral feature, except in axSpA and women with PPP (Table 1). Fat lesion (FAT) was mainly found in axSpA, in all slices, and mostly bilaterally in the sacrum. In the other groups FAT was primarily located in the anterior and central SIJ sections. Sclerosis was only seen in the ilium, and was present in most groups, particularly in women with PPP, often bilaterally. Erosion was only seen in women with PPP (mostly unilaterally) and in axSpA (mainly bilaterally in the ilium). Backfill and ankylosis were only seen in axSpA.Table 1.Participant characteristics and distribution of lesions – unilaterally/bilaterally in iliac/sacral quadrantsAxSpAWomen with post-partum painWomen without post-partum painDisc herniationCleaning staffLong distancerunnersHealthy menNumber of participants41461425262329Age30.9 (6.4)32.6 (3.3)*33.1 (4.1)35.2 (5.7)**39.1 (4.6)***32.7 (6.2)30.9 (6.4)Male sex630***0***440***78100***Low back pain VAS (0-10)3.8 (2.8)5.5 (2.4)**0.4 (0.7)***5.5 (2.4)*0.8 (1.8)***0.2 (0.5)***0.1 (0.3)***HLA-B27 positive8111***7***0***0***4***14***C-Reactive Protein >3 mg/l5917***21**20**15**17**3***Quadrant:UNI / BIUNI / BIUNI / BIUNI / BIUNI / BIUNI / BIUNI / BIBMEIliumUpperLower27 / 722 / 1711 / 915 / 130 / 021 / 00 / 00 / 00 / 40 / 40 / 04 / 00 / 00 / 0SacrumUpperLower29 / 2224 / 2017 / 99 / 929 / 04 / 04 / 04 / 04 / 00 / 00 / 00 / 00 / 00 / 0FATIliumUpperLower20 / 1717 / 292 / 00 / 07 / 07 / 04 / 04 / 00 / 00 / 00 / 00 / 00 / 70 / 3SacrumUpperLower22 / 4417 / 422 / 42 / 20 / 74 / 70 / 40 / 00 / 00 / 04 / 04 / 03 / 33 / 3SclerosisIliumUpperLower5 / 20 / 04 / 49 / 90 / 77 / 04 / 40 / 44 /415 / 00 / 04 / 03 / 70 / 0SacrumUpperLower0 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 0ErosionIliumUpperLower22 / 2417 / 244 / 02 / 20 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 0SacrumUpperLower10 / 522 / 22 / 02 / 20 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 00 / 0Values are % or mean (SD)Mann-Whitney test was applied, tests are patients with axSpA compared with all other groups. P<0.05*; p<0.01**; p<0.001***BI: bilateral; BME: Bone marrow edema; FAT: fat lesion; HLA-B27: Human Leukocyte Antigen B27;UNI: unilateral; VAS: Visual Analogue scaleConclusion:Typical locations of common SIJ lesions in axSpA and non-axSpA were reported. In non-axSpA, except women with PPP, bilateral as well as posterior lesions were rare, while backfill and ankylosis were absent.References:[1]Maksymowych et al,Arthritis Rheum, 2005[2]Maksymowych et al,J of Rheumatol,2015Acknowledgments:Disclosure of Interests: Sengül Seven Grant/research support from: Novartis, Mikkel Ǿstergaard Grant/research support from: AbbVie, Bristol-Myers Squibb, Celgene, Merck, and Novartis, Consultant of: AbbVie, Bristol-Myers Squibb, Boehringer Ingelheim, Celgene, Eli Lilly, Hospira, Janssen, Merck, Novartis, Novo Nordisk, Orion, Pfizer, Regeneron, Roche, Sandoz, Sanofi, and UCB, Speakers bureau: AbbVie, Bristol-Myers Squibb, Boehringer Ingelheim, Celgene, Eli Lilly, Hospira, Janssen, Merck, Novartis, Novo Nordisk, Orion, Pfizer, Regeneron, Roche, Sandoz, Sanofi, and UCB, Lone Morsel-Carlsen: None declared, Inge Juul Sørensen: None declared, Birthe Bonde: None declared, Gorm Thamsborg: None declared, Jens Jørgen Lykkegaard: None declared, Susanne Juhl Pedersen Grant/research support from: Novartis

An experiment was designed to evaluate in vivo and in vitro embryo production following the use of frozen–thawed conventional or Y-sexed semen from a Brangus bull with known high fertility. For in vivo embryo production, Brangus heifers (n = 12) were superovulated twice in a crossover design and inseminated with sexed or conventional semen. On Day 0, all heifers received an intravaginal progesterone device (DIB 1 g, Syntex S.A., Buenos Aires, Argentina) and 2.5 mg oestradiol benzoate and 50 mg progesterone (Progestar, Syntex S.A.) by intramuscular injection (IM). On Day 4, heifers were superstimulated with 200 mg of NIH-FSH-P1 Folltropin-V (Bioniche Animal Health, Belleville, Ontario, Canada) in twice-daily decreasing doses over 4 days. In the a.m. and p.m. of Day 6, all heifers received PGF2a (Ciclase, Syntex) and DIBs were removed in the p.m.. In the a.m. of Day 8, heifers received 100 μg de Gonadolerin (Gonasyn, Syntex S.A.) and were randomly allocated to receive either one straw of conventional semen (24 × 106 sperm per dose) 12 and 24 h later or two straws of sexed semen (2.4 × 106 sperm per dose) 18 and 24 h after GnRH. Ova/embryos were collected nonsurgically on Day 15 and evaluated following IETS recommendations. Means were compared by t-test. Mean ( ± s.e.m.) number of ova/embryos, fertilized ova, and transferable embryos were 14.8 ± 2.7, 9.4 ± 1.8, and 7.1 ± 1.7 v. 16.8 ± 3.1, 9.9 ± 2.5, and 8.1 ± 2.0 for donors inseminated with conventional or sexed semen, respectively (P > 0.6). For in vitro production, oocytes were obtained from 50 ultrasound-guided follicle aspiration (OPU) sessions that was performed at random stages of the oestrous cycle and without superstimulation in 22 Brangus cows and heifers. Oocytes were classified and matured in TCM-199 medium with NaHCO3 and supplemented with 1% fetal bovine serum. Semen samples from the same bull used for in vivo embryo production were selected using Percoll and capacitated in Fert medium and used at a final concentration of sperm/mL for nonsexed semen and 2 × 106 sperm mL–1 for sexed semen. After 16 h (sexed) or 18 h (conventional) in Fert medium, zygotes were denuded and cultured in SOF supplemented with 0.4% BSA under oil at 37°C, 5% CO2 and saturated humidity for 7 days. The total number of oocytes matured and fertilized was 528 and 318 for conventional and sexed semen, respectively. Means were compared by t-test and proportions by chi-squared test. Mean (± s.e.m.) number of cleaved zygotes and blastocysts produced per OPU session did not differ between conventional (11.0 ± 1.4 and 7.1 ± 1.0) and sexed (8.7 ± 0.8 and 4.9 ± 0.7; P > 0.2) semen. However, the proportion of cleaved zygotes and blastocysts produced were significantly higher (P < 0.05) with conventional semen (61.2%; 329/538 and 39.4%; 212/538) than with sexed semen (54.4%; 173/318 and 30.8%; 98/318), respectively. In conclusion, comparable number of embryos can be obtained in vivo with sexed or conventional semen from a bull with proven high fertility. However, the proportion of blastocysts produced in vitro is likely to be reduced following the use of sexed as compared with conventional semen from the same bull.

Abstract Background: Single nucleotide polymorphisms (SNPs) within the genes involving drug detoxification enzymes of anthracyclines could lead to interindividual differences in treatment outcome. Several studies suggested, in different kinds of cancer, that SNPs of genes coding anthracyclines metabolism may influence their effectiveness or toxicity, being well-known their association with cardiotoxicity. The impact of these polymorphisms in adult acute myeloid leukemia (AML) patients treated with the combination of cytarabine and anthracyclines for induction remains undetermined. Methods: SNPs of anthracycline metabolism genes previously associated with clinical significance in other malignances (CBR3:rs1056892, rs8133052, NQO1 rs1800566, NQO2 rs1143684, NOS3:rs1799983, rs2070744, MnSOD rs4880) were evaluated in 225 adult patients at initial diagnosis from AML using a Sequenom (iPLEX) mass spectrometry-based multiplex genotyping assay (Sequenom, San Diego, CA). All patients received induction chemotherapy consisting of idarubicin plus cytarabine (PETHEMA-LMA 99, 2007 and 2010 trials). Efficacy of first induction cycle was evaluated comparing complete remission (CR) vs. partial remission or resistance. Patients dying during induction were considered as no evaluable for efficacy. Based on WHO grading scale, toxicities were grouped as binary variables (grade 0-1 vs. grade 2-4). The grade of toxicity assigned to an organ group was the maximum grade of all the specific toxicities within that group. Hematologic toxicity was measured with the time to neutropenia and thrombocytopenia recovery since first day of chemotherapy. Genotypes were studied with co-dominant model. Association between variables was assessed using linear and logistic regression adjusting for age, gender, ECOG, leukocyte and platelet count at diagnosis (R® version 3.1.2). Results: The median age of patients was 51.1 years (16-78 years). There were no statistically significant differences in CR. Nevertheless, several associations were obtained between NQO1, NQO2, NOS3 and MnSOD polymorphisms and toxicities (significant toxicities were summarized in table 1 and 2). Table 1. Significant association between SNPs in gene metabolizers and different toxicities Toxicity Gene/SNP Genotypes Grade 0-1 n (%) Grade 2-4 n (%) OR (95%IC) P Cardiotoxicity NQO2 rs1143684 TT TC 119 (86.2) 74 (94.9) 19 (13.8) 4 (5.1) 0.26 (0.07-0.77) 0.025 Neurotoxicity NOS3 rs1799983 GG GT 71 (84.5) 101 (94.4) 13 (15.5) 6 (5.6) 0.28 (0.09-0.80) 0.022 Skin toxicity NOS3 rs1799983 GG GT TT 45 (53.6) 78 (72.9) 26 (76.5) 39 (46.4) 29 (27.1) 8 (23.5) 0.44 (0.24-0.82) 0.36 (0.14-0.88) 0.010 0.030 Skin toxicity NQO1 rs1800566 CC CT 78 (60.9) 64 (74.4) 50 (39.1) 29 (25.6) 0.53 (0.28-0.97) 0.042 Skin toxicity NQO2 rs1143684 TT CC 5.49 (1.19-38.9) 0.044 Gastrointestinal toxicity NQO2 rs1143684 TT CC 91 (65.9) 2 (25.0) 47 (34.1) 6 (75.0) 5.5 (1.19-38.99) 0.043 Mucositis NQO1 rs1800566 CC TT 119 (93.0) 8 (72.7) 9 (7.0) 3 (27.3) 6.1 (1.03-33.1) 0.035 Mucositis NQO2 rs1143684 TT CC 128 (92.8) 5 (62.5) 10 (7.2) 3 (37.5) 8.8 (1.53-45.60) 0.010 Nephrotoxicity MnSOD rs4880 TT CC 47 (81.0) 55 (94.8) 11 (19.0) 3 (5.2) 0.23 (0.05-0.86) 0.042 Nephrotoxicity NQO1 rs1800566 CC TT 114 (89.1) 8 (72.7) 14 (10.9) 3 (27.3) 6.66 (1.07-38.35) 0.033 Hepatotoxicity grades 3-4 NOS3 rs2070744 CC CT 19 (24.8) 100 (67.1) 20 (51.3) 49 (32.9) 0.44 (0.20-0.94) 0.035 Table 2. Significant association between SNPs in gene metabolizers and hematologic toxicities Hematologic toxicity Gene/SNP Genotypes Mean days Logarithm of the difference (95%IC) P Time to neutropenia recovery NOS3 rs2070744 CC TT 32.7 26.7 -0.17 (-0.35 to -0.01) 0.048 Time to thrombocytopenia recovery NOS3 rs1799983 GG GT TT 35.6 28.8 30.3 -0.17 (-0.17 to -0.06) -0.15 (-0.28 to -0.01) 0.002 0.034 Conclusions: This study reveals that, as in other cancers, there is a prognostic impact of anthracycline metabolism gene polymorphisms in adult AML patients. Further studies with larger population are needed to validate these associations, which could be useful biomarkers in clinical practice. Disclosures No relevant conflicts of interest to declare.

Abstract In Western countries, mortality among patients with sickle cell disease (SCD) has decreased in the last decades by means of neonatal screening (NS), infectious prophylaxis and care improvements. The major causes of death in children include acute chest syndrome, sepsis, splenic sequestration, stroke, aplastic crisis while in adults end-stage organ failure contributes also to premature death. Hydroxyurea (HU) and stem cell transplantation (SCT) are used in Belgium for more than 20 years but their possible influences on survival have not been yet analyzed. The Belgian SCD Registry was created in 2008 including patients of 8 centres. All available data in 2008 were retrospectively encoded in the database. After 2008 and until 2012, all data were recorded prospectively for already registered patients as well as newly diagnosed subjects. Data were registered from NS or from diagnosis (first contact) until last follow up (FU) visit, SCT or death. Data included diagnosis, demography and outcome data. After SCT, only vital status and cause of death were recorded. Up to date, data from 470 pts are recorded (224 males), 412 are HbSS, 14 HbSβ0, 7 HbSβ+ and 37 HbSC. The median age at diagnosis and at last FU was respectively 0.7 year (y) and 9.9 y. The FU for the whole cohort was 3810 patient-years (PY) and with 136 patients aged over 18y, their FU during adulthood accounted for 520 PY. Thirteen patients died (2.8%). The mortality per 100-PY was 0.34 and the median age at death was 14.5 y (range, 1.5-23.7 y). All deaths occurred in HbSS patients, 5 after SCT and 8 due to an acute event. Complete data set is missing for 3 of the 8 patients. For the 5 well documented SCD related deaths, causes were: hemorrhagic stroke (2), sepsis due to S. pneumoniae (1), aplastic crisis (1) and infection during stay in homeland (1). At last FU, 91 patients were transplanted, 182 were on HU, 7 on HU + chronic transfusion (CT), 19 on CT (4 after HU treatment). The remaining 171 patients never had disease modifying therapy (DMT). Compared with the latter, mortality rate for those on HU was significantly reduced (0.1 vs 0.5/100-PY) while patients on HU have longer FU and are older at last FU (Table 1). Among 91 patients transplanted at a median age 6.9 y, 5 died: 3 from acute transplant related toxicity, 1 from secondary acute myeloblastic leukemia after cGVHD, and 1 is unexplained more than 7 years post SCT. The data issued from the most recent NS cohorts report a low death rate during childhood ranging from 0.13 to 0.52. Even if our Belgian cohort is not exclusively issued from neonatal diagnosis, the observed death rate is low (0.34/100-PY). Several methodological biases are present in this partially retrospective study (incomplete or unavailable data, lost of FU, no information if death occurred before the first contact in a center, …). Nevertheless our low mortality is not underestimated since 1) most patients were followed since infancy and during a long period (3810 PY); 2) the FU during adulthood (period of increased mortality) accounted for 520 PY; 3) our cohort represents a very large part of the Belgian SCD population since a national inquiry performed in 2007 estimated the whole SCD population to 500. The effect of HU on mortality has been reported in adults and more recently in children. Despite longer FU and older age at last FU, our data confirms those previously results With only one case, death by infection is rare while SCT complications contributed to about 40 % of deaths. Even if SCT is the only curative option for SCD, it encompasses a risk of mortality. As life expectancy of SCD patients has been extended which is confirmed by our results (especially for patients on HU), SCT should be reserved for clinically severe cases. Population-based prospective studies evaluating the survival in transplanted and non transplanted patients are needed. Disclosures: No relevant conflicts of interest to declare.

Background:To facilitate earlier diagnosis of spondyloarthritis (SpA), we have previously cross-culturally adapted a self-administered screening questionnaire.Objectives:We aimed to improve the sensitivity of this questionnaire as a screening tool by comparing various scoring methods.Methods:Subjects newly referred to a rheumatology clinic self-administered the questionnaire before seeing a rheumatologist. Identification of axial SpA by the questionnaire using original scoring (Method A) and scoring based on Assessment of SpondyloArthritis International Society (ASAS) inflammatory back pain (IBP) criteria (Method B), ASAS referral criteria (Method C), ASAS classification criteria (Method D) and a combination of ASAS referral and classification criteria (Method E) were compared to classification by the ASAS classification criteria and diagnosis by rheumatologist. Since Methods B-E were based on SpA features, we compared self-reported vs rheumatologist-documented features in subjects with axial SpA.Results:Of 1418 subjects (age: 54 ± 14 years, female: 73%), 39 were classified as axial SpA cases by classification criteria. Methods A-E yielded sensitivities of 39%, 72%, 67%, 49% and 85%, respectively, among patients newly referred to the rheumatology clinic (Table 1). Rheumatologist-documented clinical SpA features exceeded self-report for IBP (62 vs 44%) and uveitis (15 vs 5%). The reverse was true for arthritis (21 vs 80%), enthesitis (28 vs 33%), dactylitis (3 vs 18%), good response to NSAIDs (33 vs 41%) and family history for SpA (5 vs 10%).Table 1.Performance of the five scoring methods for the cross-culturally adapted Hamilton axial SpA questionnaire.Scoring methodSensitivity(95% confidence interval)Specificity(95% confidence interval)Positive predictive value(95% confidence interval)Negative predictive value(95% confidence interval)Method A38.5(23.4 – 55.4)93.7(92.3 – 94.9)14.7(8.5 – 23.1)98.2(97.3 – 98.8)Method B71.8(55.1 – 85.0)73.1(70.7 – 75.4)7.0(4.7 – 10.0)98.9(98.1 – 99.5)Method C66.7(49.8 – 80.9)77.8(75.5 – 80.0)7.8(5.2 – 11.3)98.8(98.0 – 99.4)Method D48.7(32.4 – 65.2)74.9(72.5 – 77.2)5.2(3.2 – 8.0)98.1(97.1 – 98.8)Method E84.6(69.5 – 94.1)37.2(34.6 – 39.8)3.7(2.5 – 5.1)98.8(97.5 – 99.6)Method A: the original scoring defined by the questionnaire developers; Method B: a scoring based on the ASAS IBP criteria; Method C: a scoring based on the ASAS referral criteria; Method D: a scoring based on the ASAS classification criteria for axial and peripheral SpA; Method E: a scoring based on a combination of the ASAS referral and classification criteria.Conclusion:A self-administered questionnaire scored based on a combination of ASAS referral and classification criteria achieved high sensitivity in identifying axial SpA in subjects referred to a rheumatology clinic. This supports its evaluation as a screening tool for axial SpA in the general population.References:[1]Xiang L, Teo EPS, Low AHL, Leung YY, Fong W, Xin X, et al. Cross-cultural adaptation of the Hamilton axial spondyloarthritis questionnaire and development of a Chinese version in a multi-ethnic Asian population. Int J Rheum Dis. 2019;22(9):1652-60.[2]Sieper J, Rudwaleit M, Baraliakos X, Brandt J, Braun J, Burgos-Vargas R, et al. The Assessment of SpondyloArthritis international Society (ASAS) handbook: a guide to assess spondyloarthritis. Annals of the rheumatic diseases. 2009;68 Suppl 2:ii1-44.[3]Poddubnyy D, van Tubergen A, Landewe R, Sieper J, van der Heijde D. Development of an ASAS-endorsed recommendation for the early referral of patients with a suspicion of axial spondyloarthritis. Annals of the rheumatic diseases. 2015;74(8):1483-7.[4]Rudwaleit M, van der Heijde D, Landewe R, Akkoc N, Brandt J, Chou CT, et al. The Assessment of SpondyloArthritis International Society classification criteria for peripheral spondyloarthritis and for spondyloarthritis in general. Annals of the rheumatic diseases. 2011;70(1):25-31.Acknowledgements:This work was supported by a Health Services Research Grant (HSRG) from the Singapore Ministry of Health National Medical Research Council [grant number: NMRC/HSRG/0075/2017].Disclosure of Interests:None declared

Abstract Abstract 2615 Background: The first EORTC-CLG AML pilot study (58872) demonstrated the efficacy of Mitoxantrone (MTZ), substituted for daunorubicin, in the treatment of childhood AML. The subsequent trial (58921) aimed to compare MTZ and Idarubicin (IDA), an anthracycline with a favorable pharmacokinetic profile (such as good CSF penetration) and suggested to be more efficacious than daunorubicin in adult AML trials performed in the last two decades. Methods: Between March 1993 and December 2002, 227 eligible patients (pts) <18y of age with newly diagnosed AML (N=216) or high risk MDS (RAEB & RAEBt, N=11) were randomized in the EORTC phase III 58921 trial to receive either IDA or MTZ in induction and 1st intensification course, each at a dose of 10 mg/m2/d for 3 days in both courses. Concomitant chemotherapy consisted of standard dose Cytarabine (AraC) and Etoposide (Eto) in induction and high-dose AraC (18–36 g/m2) in 1st intensification. Allogeneic stem cell transplantation after 1st intensification was recommended for pts who achieved CR and had an HLA-identical sibling donor. Patients in CR without donor had to receive a 2nd (DCTER = continuous infusion of standard dose AraC, Daunorubicin 4x 20 mg/m2/d, Eto, Dexamethasone, 6-thioguanine) and 3rd intensification course (high dose AraC 12 g/m2 + Eto), followed by maintenance therapy (6-Thioguanine daily + AraC 4 days/month) for 12 months. CNS irradiation after the 3rd intensification for patients with initial WBC counts >=70×10E9/L was abandoned from November 1994 on. Randomization was done centrally. The primary endpoint was EFS; secondary endpoints were OS, CR rate after induction/1st intensification, DFS and toxicity. Intention-to-treat analysis was used. Results: A total of 112 and 115 eligible pts were randomly assigned to receive IDA and MTZ, respectively. The rate of CR after two courses was 79.5% (IDA) vs 85.2% (MTZ). At an overall median follow-up of 9.9 y (range 0.25–16 y), there were 65 vs 59 events in the IDA vs MTZ group: failure to achieve CR (23 vs 17), relapse (35 vs 40), and death without relapse (7 vs 2). The 5-year EFS rate was 42.0% (SE 4.7%) in the IDA group and 48.4% (SE 4.7%) in the MTZ group (hazard ratio (HR) = 1.20, 95% CI 0.84–1.71, 2-sided log rank p=0.29). The 5-year OS rate was comparable in both treatment arms: 59.8% (SE 4.6%) in the IDA group and 57.5% (SE 4.7%) in the MTZ group (HR = 1.03, 95% CI 0.70–1.54, 2-sided log rank p=0.87). In CR patients with (N=46/187) or without (N=141/187) an HLA-identical sibling donor, the 5-year DFS rate from CR was 65.1% (SE 7.1%) and 51.5% (SE 4.2%) respectively (HR=0.65, 95% CI 0.37–1.11, 2-sided log rank p=0.11) and the 5-year OS rate 78.0% (SE 6.1%) and 60.7% (SE 4.1%) respectively (HR=0.53, 95% CI 0.28–1.01, 2-sided log rank p=0.048). This advantage for patients with a donor remained important regarding both DFS (HR=0.60, p=0.07) and OS (HR=0.49, p=0.03), even after adjustment for WBC count at diagnosis, age, cytogenetic features and randomized arm. The interval between start of induction and start of 1st intensification was similar in both arms (median 5.2 weeks). Grade 3–4 infection following the induction course was 37.5% (IDA) vs 25.4% (MTZ); incidence of fever grade 3–4 was 25% (IDA) vs 22.8% (MTZ). In this trial, the cumulative anthracycline dosage (conversion factor 5) was 380 mg/m2. Acute and late-onset cardiotoxicity was comparable in both treatment arms. Conclusion: There was no significant difference in efficacy and in toxicity between the two randomized treatment groups, IDA versus MTZ, although grade 3–4 infection rate following the induction course was slightly higher in the IDA arm. Patients who reached CR and who had a HLA compatible sibling donor had a longer DFS and OS than pts without a donor. Disclosures: No relevant conflicts of interest to declare.

Abstract Introduction: The objectives of this study were to assess the safety, efficacy and dose-response relationship of DU-176b for the prevention of venous thromboembolism (VTE) in Japanese patients after elective total knee arthroplasty (TKA). Changes in biomarkers in relation to VTE and bleeding were also evaluated. Methods: This was a randomized, parallel-group, placebo-controlled, double-blind, doubledummy, multicenter study. DU-176b (5–60 mg QD) or placebo was administered for 11–14 days after TKA. A placebo control was used because at the time no other anticoagulants had been approved for thromboprophylaxis after TKA in Japan. The primary efficacy endpoint included the adjudicated incidence of VTE, including asymptomatic and symptomatic deep vein thrombosis, as evaluated by venograms, and symptomatic pulmonary embolism. The primary safety endpoint included major and clinically relevant bleeding. Secondary efficacy endpoints included the pharmacodynamic (PD) indices prothrombin time (PT), international normalized ratio (INR), activated partial thromboplastin time (APTT), anti-FXa activity and key coagulation biomarkers including prothrombin fragment F1+2, plasmin-α2-plasmin inhibitor complex (PIC), D-dimer, thrombin-antithrombin III complex and soluble fibrin. Secondary safety endpoints included incidence of adverse events (AEs). Results: There were no clinically relevant differences in baseline demographics of the 523 patients randomized. Mean age was 71.1 ± 7.6 years, mean weight was 60.3 ± 9.9 kg and ~78% of patients were female. All DU-176b doses had significantly less VTE than placebo when each DU-176b dose group was compared with placebo (Table), and there was a dose-related response (P &lt;0.001 across DU-176b dose). Paired comparisons showed no significant differences in VTE incidence between the 5 & 15 mg groups or between the 30 & 60 mg groups but significant differences between other paired groups (χ2 test; P&lt;0.001 to P=0.021). PD indices were dose-related (Table, P &lt;0.001 across DU-176b dose). After surgery, coagulation biomarkers increased with a trend for DU-176b to affect these markers more than placebo (Table, P &lt;0.001 across DU-176b dose). The incidence of major and clinically relevant bleeding was comparable across all groups without any significant differences among groups or between DU-176b doses and placebo (Table). There were no trends in other AEs, including liver enzymes, across DU-176b dose. Conclusions: DU-176b demonstrated significant, dose-dependent reductions in VTE after TKA without increases in major or clinically relevant bleeding. There were also consistent dose-dependent changes in PD indices and coagulation biomarkers. The observed dose-dependent decreases in VTE without concomitant increases in bleeding should be further evaluated. Placebo DU-176b 5 mg DU-176b 15 mg DU-176b 30 mg DU-176b 60 mg *P&lt;0.01, **P&lt;0.001, †P=0.445, ‡P=1.00 vs placebo. Primary Efficacy Endpoint: VTE n/N (%) (95% CI) 43/89 (48.3) (37.9–58.7) 26/88 (29.5)* (20.0–39.1) 24/92 (26.1)** (17.1–35.1) 11/88 (12.5)** 5.6–19.4) 8/88 (9.1)** (3.1–15.1) Primary Safety Endpoint: % Major + Clinically Relevant bleeding n/N (%) 4/102 (3.9) 3/103 (2.9)† 5/106 (4.7)‡ 4/103 (3.9)‡ 5/106 (4.7)‡ PD and Coagulation Biomarkers, all data mean ± SD post-operation/pre-treatment initiation 1–3 h post-dose Day 7 N 87 86 91 87 87 86 86 89 87 87 PT (sec) 13.5±0.9 13.3±0.8 13.3±0.7 13.4±0.9 13.1±0.6 12.7±0.6 13.3±0.8** 14.9±1.5** 17.8±2.7** 22.1±5.9** anti-FXa activity (IU/mL) 0.10±0.0 0.10±0.0 0.10±0.0 0.13±0.23 0.10±0.0 0.10±0.0 0.44±0.80** 1.18±0.68** 2.40±1.17** 4.38±2.56** Prothrombin fragment F 1+2 , pM 479.6±229.7 431.4±257.5 468.7±249.0 428.9±269.0 417.9±223.6 588.9±228.9 484.6±184.9* 450.8±158.2** 414.0±172.8** 398.8±147.4** D-dimer μg/mL 12.4±10.5 13.6±10.5 14.3±11.2 12.2±10.3 11.4±10.1 9.4±5.7 7.5±3.7 6.7±2.7** 6.5±3.3** 5.8±2.4**

Abstract Abstract 2565 Poster Board II-542 Sickle cell disease (SCD) is characterized by a hypercoagulable state that may contribute to the initiation and propagation of vaso-occlusion. Platelets (PLTs) circulate in an activated state in SCD individuals and both increased and unaltered platelet aggregation responses to adenosine phosphate (ADP) stimulation have been reported in SCD adults. PLTs play an important role in vascular inflammation, where platelet adhesion to the inflamed vascular wall and thrombus formation can, in turn, trigger platelet release of inflammatory substances that can further activate the endothelium and leukocytes. This study compared the aggregation responses of PLTs from healthy control individuals (CON), steady-state SCD and SCD patients on hydroxyurea therapy (SCDHU; 20–30mg/kg/day) following stimulation with three soluble agonists. Venous blood from CON, SCD and SCDHU subjects was collected in sodium citrate. Platelet rich plasma (PRP; 250 000 PLTs/ml) was separated and preincubated for 3 min (37°C) with 5μM ADP, 1 μg/ml human collagen type I (Col) or 500 mU/ml thrombin (TB). Aggregation was then determined (5 min, 37°C, constant stirring at 1000 rpm) using a Chrono-log® 700 aggregometer and platelet-poor plasma as a reference. PAC-1 and anti-CD49b antibody binding were determined by flow cytometry. Following ADP stimulation, CON and SCD PLTs presented statistically similar aggregations (77.7±4.8%, n=14; 70.8±8.9%, n=5, respectively, p>0.05, ANOVA, Bonferroni); in contrast SCDHU PLT platelet aggregation was significantly lower (60.4±8.2%, n=7; p<0.05) than CON PLT aggregation. In response to TB, CON and SCD PLTs, again, presented statistically similar aggregations (86.5±4.4%, n=15; 85.3±7.5%, n=4; p>0.05), whilst SCDHU PLT aggregation was significantly lower than CON PLT aggregation (70.0±6.6%, n=7). ADP and TB stimulate PLT aggregation largely by activation of the αIIbβ3 integrin. Accordingly, αIIbβ3-integrin activation, as determined by PAC-1 antibody binding was found to be significantly lower on SCDHU PLTs than on SCD PLTs (11.1±3.7%; 28.6±6.4%; 12.4±4.2% PAC-1 binding for CON, SCD, SCDHU PLT, respect., n≥13, p<0.05 SCD comp. CON/SCDHU); furthermore αIIbβ3 activation negatively correlated with levels of fetal hemoglobin (HbF, %) in SCD/SCDHU patients (Spearman r= −0.756, p<0.01, n=24). Interestingly, Col stimulation of SCD PLT (98.6±9.9%, n=5) resulted in a significantly higher aggregation response than that of CON PLT (67.0±5.8%, n=15, p<0.01) and SCDHU PLT aggregation in response to Col was significantly lower than that of SCD PLT (63.8±6.6%, n=6, p<0.01). Expression of the collagen receptor, integrin α2β1, subunit (CD49b) was not altered on SCD or SCDHU PLTs, compared to CON (70.5±4.2%; 70.1±4.6%; 68.5+5.2%, respect., n≥13, p>0.05). Hydroxyurea (HU) therapy was found to be associated with a significant decrease in the aggregation properties of platelets from SCD individuals. Decreased aggregation was coupled with a lower presentation of the αIIbβ3-integrin in its activated conformation, which may occur as a consequence of elevated levels of HbF in these individuals. The mechanism by which HU may decrease PLT aggregation in response to Col is not clear, although activation of the α2β1 integrin and participation of the GPVI collagen receptor should be studied further. Results provide insights into the mechanisms involved in platelet aggregation and activation in SCD and suggest that HU therapy may benefit SCD patients by reducing the aggregation and inflammatory potential of PLTs in the microcirculation. Disclosures: No relevant conflicts of interest to declare.

Abstract Beneficial effects of green tea (GT) consumption have been described, including the ability to reduce cancer development. Polyphenols are the main chemical constituents of GT extract and have been identified as the most effective substances that can inhibit tumorigenesis. Acute myeloid leukemia is an aggressive hematologic malignancy and there is no sufficient evidence that supports a protective role of tea intake on its development. In this concern, the aim of this study was to investigate GT effects in acute promyelocytic leukemia (APL) mice. A total of 1 × 106 leukemic cells obtained from hCG-PML-RARa transgenic mice were injected in the tail vein of 12- to 16-week-old NOD.CB17-Prkdcscid/J mice, after 4-6 h of sublethal cobalt irradiation with 2 Gy. The hematologic counts were monitored weekly, and the following criteria were used for the diagnosis of leukemia: presence of at least 1% of blast in peripheral blood associated with leukocytosis above 30 000 cells/L, hemoglobin levels below 10 g/dL, and thrombocytopenia below 500 × 103 cells/L (He et al, 1997). Twelve days after transplantation, mice were then submitted to daily oral treatment (gavage) with 250 mg/kg/day GT or vehicle only (water) for 5 consecutive days and were sacrificed; bone marrow (BM) and spleens were collected to the assays. Treatment with GT significantly increased the mean number of apoptotic cells in the BM (29.4 ± 5.2 vs untreated 21.0 ± 2.1 %, P < 0.05) and spleen (13.9 ± 3.1 vs untreated 9.2 ± 1.9 % P < 0.05) of mice, evaluated by Annexin V-FITC/PI. GT induced an increase in the median fluorescence intensity (MFI) of cleaved caspase-3 in the BM (83.9 ± 3.6 vs untreated 72.6 ± 4.7, P < 0.05) and in the spleen (75.5 ± 28.2 vs untreated 55.8 ± 7.3, P < 0.01); cleaved caspase-8 in the BM (117.3 ± 9.9 vs untreated 89.1 ± 12.3, P < 0.005) and in the spleen (118.0 ± 31.5 vs untreated 81.5 ± 14.8, P < 0.001); and cleaved caspase-9 in the BM (138.2 ± 52.4 vs untreated 85.8 ± 12.9, P < 0.001) and in the spleen (121.7 ± 49.2 vs untreated 76.5 ± 21.9, P < 0.001) of leukemic mice. Moreover, GT treatment reduced the percentage of CD34+ hematopoietic progenitor cells (32.4 ± 2.3 vs untreated 41.0 ± 0.5 %) as well as of CD117+ cells (33.4 ± 3.7 vs untreated 44.2 ± 1.8 %). We then evaluated the phenotype of cells infiltrated in the spleen. Interestingly, we found that GT induces a decrease in the percentage of CD117+ (40.7 ± 0.3 vs leukemic 44.6 ± 0.9 %) and Gr-1 cells (60.8 ± 0.2 vs untreated 65.6 ± 0.5 %) present in the spleen. We then analyzed the effects of GT in the production of intracellular ROS in the BM subpopulations of CD34+, CD117+ and Gr-1+ cells from leukemic mice. Significant increases in the median fluorescence intensity (MFI) of intracellular ROS production by Gr-1 cells of GT-treated mice were observed (670 ± 103 vs untreated 428.5 ± 5.2). Interestingly, GT induced a reduction of MFI of intracellular ROS production in the CD34+ (167.5 ± 27.1 vs untreated 405.5 ± 73.3) and CD117+ (360 ± 142 vs untreated 1635 ± 40.4) cells. We then studied the expression and localization of CXCR4 and HIF-1α proteins. Studies have shown that ROS increases expression of CXCR4 in cancer and immune cells (Li et al, 2009; Lin et al, 2011; Chetram et al, 2011; 2013) through nuclear translocation of HIF-1α (Lee et al, 2002; Salmeen et al, 2003). Our results showed that GT decreased the MFI of CXCR4 in the leukemic mice (9028 ± 1367 vs untreated 4196 ± 970). Reduction of the nuclear translocation of HIF-1α in GT-treated mice was also observed, using the ImageStream imaging flow. In conclusion, GT treatment in APL mice induces apoptosis of cells in the BM and spleen, confirmed by activation of caspase-3, -8 and -9, probably by modulating the production of intracellular ROS in the leukemic cells. Although GT and its polyphenols are well known as antioxidants, there is evidence that some of the effects of these compounds may be related to induction of oxidative stress in immune cells, which might be responsible for the induction of apoptosis of tumor cells. These pro-oxidant properties may also induce endogenous antioxidant systems in normal tissues that offer protection against cancer. On the other hand, it is possible that, in leukemic cells, which has excessive ROS, the antioxidant effect of GT become more evident. Several potential mechanisms have been proposed including both antioxidant and pro-oxidant effects to polyphenol compounds, but questions remain concerning the relevance of these mechanisms to cancer prevention. Disclosures Torello: Fundação de Amparo à Pesquisa do Estado de São Paulo - Fapesp: Research Funding; Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq: Research Funding. Shiraishi:University of Campinas: Employment.

Abstract Background: Little is reported of the utility of donor lymphocyte infusion (DLI) following HCT for non-malignant disorders (NMD). We describe outcomes after DLI for insufficient donor chimerism after HCT in a large NMD cohort. Patients/Methods: We queried the Institutional BMT Database for patients with NMD receiving DLI for insufficient post-HCT donor chimerism. HLA typing, graft selection and conditioning were per institutional guidelines. The use, timing and dosing of DLI was at the discretion of the treating physician. Donor chimerism values on the myeloid fraction of peripheral blood at pre-DLI and most-recent time-points were reviewed. Patients were considered best DLI responders if donor chimerism improved (pre-DLI to most-recent) and most recent chimerism was ³ 80%. Results: Twenty-three patients (43% female) were identified. Table 1 shows patient, disease, transplant and DLI characteristics. The median zenith chimerism post-HCT (but pre-DLI) was 84% (IQR, 39 - 99%), observed at a median 28 days post-HCT. The median chimerism just prior to first DLI was 40%. The median time to first DLI was 90 days. Patients underwent a median 2 cycles (IQR, 2 - 3; maximum, 5) of DLI; the median cumulative per-patient CD3+ dose was 11.5 x 106/kg. Post DLI, two patients developed aGvHD and 2 patients developed cGvHD. Five patients (22%) were best DLI responders. At a mean 3.6 years post-HCT, they retained mean chimerism of 94% (mean increase from pre-DLI of 37%). Of the 18 non-best responders (78%), median chimerism at last follow-up was 10% (IQR, 2 - 25%). Seven patients underwent repeat HCT. Best response to DLI did not depend on HCT total nucleated cell dose, donor relatedness, serotherapy agent of HCT regimen, chimerism prior to DLI, or total DLI CD3+ dose. Best responders tended to have undergone myeloablative conditioning, be HLA-matched to the donor and receive first DLI later post-HCT (median 102 days, versus 83 days). Conclusions: In a large NMD cohort undergoing DLI after HCT, sustained high donor chimerism response was observed in 22%. Ongoing analyses aim to assess those with intermediate response (many of whom also enjoy improved or stable NMD), as well as the impact of peri-DLI immune suppression on outcomes. Table 1. Patient, Disease and Transplant Characteristics. ID Dx Age (y) at HCT Conditioning/ Serotherapy Donor / Graft HCT TNC(x 108 /kg) Days# to DLI DLI@ CD3+ (x106 /kg) % Chimerism Pre/MRFU aGvHD (grade) / cGvHD Re-HCT? Survival (y#) Notes / Cause of Death 1 ALD 8.1 MA / ATG R / BM 2.16 508 6 92 / 100 n/n n A (10) SD 2 ALD 8.3 NMA / C R / BM 3.17 73 9 59 / 27 n/n n A (6) SD 3 ALD 8.4 NMA / C R / BM 3.97 51 45 44 / 23 n/n n A (4.6) SD 4 ALD 9.9 NMA / C R / BM 2.13 44 17 43 / 17 n/n n A (7.2) SD 5 HLH 18 NMA/ Unk U / BM 1.94 102 1 75 / 100 Y(4)/n n D (0.6) Viral; Resp Failure 6 HLH 1 NMA / C U / BM 9.39 181 3 3 / 4 n/n Y D (1.9) Sepsis 7 Hurler 2.5 MA / ATG R / BM 5.05 193 16 67 / 58 n/n n A (8.3) SD 8 Hurler 1 MA / C R / BM 4.25 305 1 64 / 80 n/n n A (6.7) SD 9 IPEX 1.3 NMA / Unk U / BM 4.99 160 13 44 / 56 n/n n A( 6.4) SD 10 JEB 0.5 NMA / ATG U / BM 5.22 81 6 25 / 13 n/n n D (0.4) Sepsis 11 RDEB 2.8 NMA / ATG R / BM 6.21 274 11 17 / 25 n/n n A (2.1) SD 12 RDEB 6.3 NMA / ATG R / BM 7.28 167 Unk 17 / 6 n/n n A (3.1) SD 13 RDEB 0.9 NMA / ATG U / BM 9.91 98 16 12 / 87 n/n n A (2.7) SD 14 RDEB 3.3 NMA / ATG R / BM 3.53 48 16 10 / 0 n/n Y A (1.6) SD 15 RDEB 0.9 NMA / ATG R / BM 3.35 90 65 40 / 100 n/Y n A (1) SD 16 RDEB 4.9 NMA / ATG R / BM 4.27 133 65 41 / 25 n/n n A (0.8) SD 17 RDEB 0.5 NMA / ATG R / BM 5.5 85 30 71 / 45 n/n n A (0.7) SD 18 SCD 9.1 NMA / ATG U / BM 3.19 34 0.5 0 / 0 n/n n D (13.7) Progressive SCD 19 SCD 10.2 NMA / ATG U / PBSC 0.13 57 12 69 / 4 n/n Y A (10) Rejected re-HCT 20 Thal 2.3 NMA / ATG R / BM 3 84 Unk 15 / 0 n/n Y A (7.3) E, SD 21 Thal 2.8 NMA / ATG U / PBSC 0.22 48 1 40 / 0 Y(2)/Y Y D (2.2) cGvHD 22 Thal 1.7 NMA / C U / PBSC 0.17 69 5 11 / 2 n/n Y A (7.6) E, SD 23 Thal 2.6 MA / ATG R / BM 6.23 159 Unk 17 / 4 n/n Y A (5.3) E, SD # = time referenced to HCT; @ = cumulative CD3+ cell dose; ALD = adrenoleukodystrophy; HLH = hemophagocytic lymphohistiocytosis; IPEX = immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome; JEB = junctional epidermolysis bullosa; RDEB = recessive dystrophic epidermolysis bullosa; SCD = sickle cell disease; Thal = thalassemia; y = years; MA = myeloablative; NMA - non-myeloablative; ATG = anti-thymocyte globulin; C = alemtuzumab; Unk = unknown; R = related; U = unrelated; BM = marrow; PBSC = peripheral blood stem cell; TNC = total nucleated cell dose; Pre = just prior to DLI; MRFU = most recent follow-up; n = no; Y = yes; A = alive; D = dead; SD = stable disease; E = engrafted. Disclosures No relevant conflicts of interest to declare.

Background:C-reactive protein (CRP), an objective marker of inflammation, can be used to monitor treatment response to biologics in patients with axial spondyloarthritis (axSpA) in addition to evaluating signs & symptoms. CRP is not elevated in all patients with active axSpA questioning its validity as a universal biomarker of response. Ixekizumab (IXE) demonstrated efficacy in axSpA treatment irrespective of baseline (BL) CRP levels. However, response to IXE categorized on CRP change from BL is unknown.Objectives:To evaluate response to IXE treatment from BL through week (wk) 16 in patients with axSpA categorized according to change in high sensitivity (hs) CRP.Methods:COAST-V (NCT 02696785),-W (NCT02696798), & -X (NCT02757352), were phase 3, multicentre, randomized, controlled trials, investigating the efficacy of IXE 80 mg every 4 & 2 wks in patients with: r-axSpA naïve to biologic disease-modifying antirheumatic drugs (bDMARDs; COAST-V); or who were inadequate responders/intolerant to tumour necrosis factor inhibitors (TNFi; COAST-W); or who fulfilled Assessment of SpondyloArthritis International Society (ASAS) criteria for non-radiographic (nr)axSpA (COAST-X).This post hoc analysis focuses on approved dosing regimens. Depending on BL and wk 16 hsCRP values, patients were categorised as stable low (hsCRP ≤5 mg/L at BL & ≤5 mg/L at wk 16), normalized (hsCRP >5 mg/L at BL & ≤5 mg/L at wk 16) or elevated (hsCRP >5 mg/L at wk 16, irrespective of BL hsCRP). An absolute cutoff of 5 mg/L was used as the stratification factor in all COAST studies. Data were analyzed by treatment arm. Each trial was analyzed separately.For hsCRP subgroups, patient demographics & other characteristics at BL, as well as trajectory over time for the endpoints ASAS40 & Bath Ankylosing Spondylitis Disease Activity Index (BASDAI) 50 are described. Non-responder imputation was used for missing values.Results:In all studies at BL, disease activity & MRI SPARCC score were higher in normalized & elevated subgroups compared to the stable low subgroup - a.In COAST-V, ASAS40 & BASDAI50 response was observed in IXE-treated patients regardless of hsCRP change status by wk 16 vs placebo. The highest ASAS40 & BASDAI50 response rate was reported in patients with normalized hsCRP - b. Similar findings were observed in COAST-W & -X.Table 1.Baseline Patient demographics & other characteristics - ITT population, per CRP subgroupCOAST-V(r-axSpA, bDMARD naive)COAST-W(r-axSpA, inadequate responders /intolerant to TNFi)COAST-X(non-radiographic axSpA, bDMARD naïve)Stable low (n=79)Norma-lized (n=80)Elevated (n=98)Stable low(n=58)Norma-lized (n=34)Elevated (n=126)Stable low (n=78)Norma-lized(n=40)Elevated (n=81)ParameterAge (years)43.7 (12.1)38.9 (10.9)42.7 (12.0)50.4 (13.3)46.1 (13.8)45.7 (12.5)44.0 (12.8)37.2 (14.6)38.7 (12.8)Male gender, n (%)63 (79.7)71.0 (88.8)78 (79.6)39.0 (67.2)30 (88.2)109 (86.5)35 (44.9)23 (57.5)34 (42)Duration of symptoms since axSpA onset (years)17.5 (11.2)14.4 (9.3)16.1 (9.9)21.7 (12.9)16.8 (11.6)18.9 (10.9)12.1 (9.9)10.3 (9.7)9.5 (9.0)HLA-B27 positive, n (%)69 (87.3)75.0 (93.8)89 (90.8)31.0 (91.2)101 (80.2)101 (80.2)48 (61.5)31 (77.5)67 (82.7)BASDAI Total Score6.5 (1.4)6.7 (1.5)7.0 (1.1)7.4 (1.5)7.3 (1.3)7.4 (1.3)6.9 (1.5)7.1 (1.6)7.2 (1.5)ASDAS Total Score3.1 (0.5)3.9 (0.6)4.2 (0.7)3.5 (0.6)4.3 (0.6)4.4 (0.8)3.2 (0.6)4.2 (0.8)4.2 (0.9)Spinal Pain due to AS7.0 (1.5)7.0 (1.5)7.5 (1.3)7.8 (1.5)7.7 (1.5)7.9 (1.4)7.2 (1.7)7.5 (1.7)7.5 (1.6)Patients with peripheral articular manifestations (>=1 TJC or >=1 SJC)47 (59.5)40 (50)62 (63.3)43 (74.1)24 (70.6)86 (68.3)56 (71.8)33 (82.5)66 (81.5)MRI Spine SPARCC ScoreMRI SIJ SPARCC ScoreMRI SPARCC Score6.7 (11.2)21.8 (27.3)20.7 (25.7)1.2 (2.3)7.0 (7.6)10.4 (17.0)5.2 (6.6)6.1 (8.2)6.2 (10.5)Conclusion:IXE reduced clinical disease activity in patients with axSpA irrespective of hsCRP change from BL to wk 16. Improvement in hsCRP level was associated with overall response rates.Acknowledgements:The authors would like to acknowledge Philana Fernandes, an employee of Eli Lilly and Company, for her for writing and editorial support.Disclosure of Interests:Helena Marzo-Ortega Consultant of: Celgene, Janssen, Eli Lilly, Novartis, Pfizer, UCB, Grant/research support from: Janssen, Novartis, Xavier Juanola: None declared, Tadashi Okano Speakers bureau: Asahi Kasei, Astellas, Abbvie, Ayumi, Chugai, Daiichi-Sankyo, Eisai, Eli Lilly, Janssen, Mitsubishi Tanabe, Novartis, Ono, Pfizer, Sanofi and Takeda, Grant/research support from: Asahi Kasei, Abbvie, Chugai, Eisai, Yves Schymura Employee of: Eli Lilly, Andrew Bradley Shareholder of: Eli Lilly, Employee of: Eli Lilly, Jens Gerwien Shareholder of: Eli Lilly, Employee of: Eli Lilly, Brigitte Monsberger Shareholder of: Eli Lilly, Employee of: Eli Lilly, Soyi Liu Leage Employee of: Eli Lilly, Daniel Aletaha Speakers bureau: Abbvie, Amgen, Celgene, Lilly, Medac, Merck, Novartis, Pfizer, Roche, Sandoz, Sanofi/Genzyme, Grant/research support from: Abbvie, Lilly, Novartis, Roche, Mikkel Østergaard Speakers bureau: Abbvie, Celgene, Eli-Lilly, Janssen, Novartis, Pfizer, Roche, Sanofi and UCB, Consultant of: Abbvie, BMS, Boehringer-Ingelheim, Celgene, Eli-Lilly, Hospira, Janssen, Merck, Novartis, Novo, Orion, Pfizer, Regeneron, Roche, Sandoz, Sanofi and UCB, Grant/research support from: Abbvie, BMS, Merck, Celgene, Novartis

Background:Chronic pain is a common and disabling health problem and those affected may need support with their activities of daily living (ADLs). Currently there are no data quantifying how much social care support people with chronic pain need.Objectives:To describe formal and informal social care use in people with chronic painMethods:Between June-July 2019, previous participants of theCloudy with a Chance of Painstudy were invited to take part in an online survey, adapted from a validated Personal Social Services Research Unit interview survey. It collected data on whether participants with chronic pain needed help with ADLs, how frequently help was needed and who provided it (formal and informal social care). Additional data was collected on demographics, employment status, pain diagnosis, and comorbidities. Descriptive statistics described the burden of social care need and multivariable logistic regression identified factors associated with social care need.Results:There were 981 respondents; 791 (81%) were female, median age 59 years (table 1). In the last month 527(61%) respondents reported needing help with ADLs. Over three-quarters of help was provided informally by family and friends (408 (77%)). For 309 (59%) respondents, help was needed at least daily. In the multivariable logistic regression model, needing help was lower with older age, (OR (95% CI) 0.96 (0.94-0.98), but higher in female gender (OR (95% CI) 1.96 (1.27-3.01), fibromyalgia (OR(95% CI) 2.75(2.53-5.54)), osteoarthritis (OR (95% CI) 1.56 (1.11-2.19)) and multi-morbidity OR (95% CI) 2.13 (1.51-3.01)). Compared to full-time work, respondents who were retired or unable to work were also significantly more likely to need help with ADLs, respective OR (95% CI) 2.16 (1.21-3.84) and 6.98 (3.72-13.08).Table 1.All respondentsn=981Need help$n=527No help$n=337MissingAge med (IQR)59 (50-66)57 (47-64)61 (52-68)5Female n (%)791 (81)452 (86)251 (74)11Employment statusn (%)FTPTSelf-employedStudentHomemakerRetiredUnable to workUnemployed134 (14)169 (17)50 (5)7 (0.7)23 (2)360 (37)221 (23)16 (1.6)54 (10)79 (15)26 (5)4 (0.8)12 (2)151 (29)188 (36)12 (2)70 (21)69 (20)19 (6)2 (0.6)10 (3)143 (42)21 (6)3 (0.9)1Diagnosis reportedn (%)*OsteoarthritisFibromyalgiaRheumatoid arthritisArthritis (type not specified)Ankylosing SpondylitisGoutMigraine/chronic headacheNeuropathic painOther (inc Psoriatic arthritis, hypermobility)929 (95)482 (49)265 (27)205 (21)128 (15)56 (6)18 (2)115 (13)155 (18)272 (29)516 (98)269 (51)207 (39)115 (22)73 (14)33 (6)13 (2)82 (16)120 (23)209 (39)313 (93)160 (47)40 (12)73 (22)55 (16)23 (7)5 (1)33 (10)35 (10)63 (19)11Any MSk diagnosisn (%)828 (95)460 (87)279 (83)64Multi-morbidity∞n (%)712 (82)473 (90)54 (36)0med - median, IQR - interquartile range, MSk – musculoskeletal$117 respondents did not answer the question about whether they did or did not need help with ADLs*some participants reported more than one diagnosis for their painincludes MSK diseases above and the following chronic diseases listed in questionnaire: angina, heart attack, stroke, COPD, diabetes, cancer, parkinson’s, multiple sclerosis, depression, other (participants asked to specify)Conclusion:A high proportion of people with chronic pain needed support with ADLs; for more than half, on a daily or more frequent basis. Interestingly, younger patients were more likely to need help which may reflect responder bias (younger patients with severe pain potentially more likely to respond than those with milder pain). The majority of support was provided informally, and this could be for a number of reasons. For example, lack of awareness/not meeting eligibility/unable to afford formal social care, or preference to be cared for by familiar persons. This should be explored in future research. These results demonstrate the burden of social care may be significantly greater than government and social care organisations are aware, with important implications for policy and planning.Disclosure of Interests:Jenny Humphreys: None declared, Katy Dempsey: None declared, Ollie Phelan: None declared, Laura Boothman: None declared, Louise Cook: None declared, William Dixon Consultant of: Bayer and Google

This paper presents a brief review on the ternary phase equilibria in the ternary AV–BVI–I systems (AV = Sb, Bi; BVI = S, Se, Te). These systems includes the series of ternary compounds those are very attractive source materials for photo-, thermos- and ferroelectric energy transformation along the recently discovered semiconductors that exhibit Rashba-type spin splitting in their surface states. In the Rashba semiconductors, a unique toroidal 3D Fermi surface appears on the crystal surface, which leads to unusual properties that make it possible to realize unique electronic devices based on these compounds. The thorough knowledge on the ternary phase diagram of these systems shed light on the chemical and structural design of new multifunctional materials with tunable properties. This knowledge is very important whenfocusing on the chemistry of such multifunctional materials based on complex element systems. REFERENCES Audzijonis A., Sereika R., Ћaltauskas R. Antiferroelectric phase transition in SbSI and SbSeI crystals. Solid State Commun., 2008, v. 147(3–4), pp. 88–89. https://doi.org/10.1016/j.ssc.2008.05.008 Łukaszewicz K., Pietraszko A., Kucharska M. Diffuse Scattering, Short Range Order and Nanodomains in the Paraelectric SbSI. Ferroelectrics, 2008, v. 375(1), pp.170–177. https://doi.org/1080/00150190802438033 Audzijonis A., Gaigalas G., Ţigas L., Sereika R., Ţaltauskas R., Balnionis D., Rëza A. Electronic structure and optical properties of BiSeI crystal. Phys. Status Solidi B, 2009, v. 246(7), pp. 1702–1708. https://doi.org/10.1002/pssb.200945110 Audzijonis A., Zaltauskas R., Sereika R., Zigas L., Reza A. Electronic structure and optical properties of BiSI crystal. J. Phys. Chem. Solids. 2010, v. 71(6), pp. 884-891. https://doi.org/10.1016/j.jpcs.2010.03.042 Ganose A. M., Butler K. T., Walsh A., Scanlon D. O. Relativistic electronic structure and band alignment of BiSI and BiSeI: candidate photovoltaic materials. J. Mater. Chem. A, 2016, v. 4(6), pp. 2060-2068. https://doi.org/10.1039/c5ta09612j Gerzanich E.I., Fridkin V.M. Ferroelectric materials of type AVBVICVII. Moscow, Nauka Publ., 1982. (in Russ.) Pierrefeu A., Steigmeier E. F., Dorner B. Inelastic neutron scattering in SbSI near the ferroelectric phase transformation. Phys. Status Solidi B, 1977, v. 80(1), pp. 167–171. https://doi.org/10.1002/pssb.2220800119 Žičkus K., Audzijonis A., Batarunas J., Šileika A. The fundamental absorption edge tail of ferroelectric SbSI. Phys. Status Solidi B, 1984, v. 125(2), pp. 645–651. https://doi.org/10.1002/pssb.2221250225 Rao K. K., Chaplot S. L. Dynamics of Paraelectric and Ferroelectric SbSI. Phys. Status Solidi B, 1985, v. 129(2), pp. 471–482. https://doi.org/10.1002/pssb.2221290204 Grigas J., Talik E., Lazauskas V. Splitting of the XPS in ferroelectric SbSI crystals. Ferroelectrics, 2003, v. 284(1), pp. 147–160. https://doi.org/10.1080/00150190390204790 Audzijonis A., Ћaltauskas R., Ћigas L., Vinokurova I. V., Farberovich O. V., Pauliukas A., Kvedaravičius A. Variation of the energy gap of the SbSI crystals at ferroelectric phase transition. Physica B, 2006, v. 371(1), pp. 68–73. https://doi.org/10.1016/j.physb.2005. 09.039 Nowak M., Nowrot A., Szperlich P., Jesionek M., Kępińska M., Starczewska A., Mistewicz K., Stróż D., Szala J., Rzychoń T., Talik E., Wrzalik R. Fabrication and characterization of SbSI gel for humidity sensors. Sens. Actuators A, 2014, v. 210, pp. 119–130. https://doi.org/10.1016/j.sna.2014.02.012 Ishizaka K., Bahramy M. S., Murakawa H., Sakano M., Shimojima T., Sonobe T., Koizumi K., Shin S., Miyahara H., Kimura A., Miyamoto K., Okuda T., Namatame H., Taniguchi M., Arita R., Nagaosa N., Kobayashi K., Murakami Y., Kumai R., Kaneko Y., Onose Y., Tokura Y. Giant Rashba-type spin splitting in bulk BiTeI. Nat. Mater., 2011, v. 10(7), pp. 521–526. https://doi.org/10.1038/nmat3051 Landolt G., Eremeev S. V., Koroteev Yu. M., Slomski B., Muff S., Neupert T., Kobayashi M., Strocov V. N., Schmitt T., Aliev Z. S., Babanly M. B., Amiraslanov I. R., Chulkov E. V., Osterwalder J., Dil J. H. Phys. Rev. Lett., 2012, v. 109(11), p. 116403. https://doi.org/10.1103/physrevlett.109.116403 Bahramy M. S., Yang B.-J., Arita R., Nagaosa N. Emergence of non-centrosymmetric topological insulating phase in BiTeI under pressure. Nature Commun., 2012, v. 3(1), p. 679. https://doi.org/10.1038/ncomms1679 Landolt G., Eremeev S. V., Tereshchenko O. E., Muff S., Slomski B., Kokh K. A., Kobayashi M., Schmitt T., Strocov V. N., Osterwalder J., Chulkov E. V., Dil J. H. Bulk and surface Rashba splitting in single termination BiTeCl. New J. Phys., 2013, v. 15(8), p. 085022. https://doi.org/10.1088/1367-2630/15/8/085022 Fiedler S., Bathon T., Eremeev S. V., Tereshchenko O. E., Kokh K. A., Chulkov E. V., Sessi P., Bentmann H., Bode M., Reinert F. Termination-dependent surface properties in the giant-Rashba semiconducto rsBiTeX(X=Cl, Br, I). Phys. Rev. B., 2015, v. 92(23), p. 235430. https://doi.org/10.1103/physrevb.92.235430 Bahramy M. S., Ogawa N. Bulk Rashba semiconductors and related quantum phenomena. Adv. Mater., 2017, v. 29(25), p. 1605911. https://doi.org/10.1002/adma.201605911 Gottstein G. Physical Foundations of Materials Science. Springer-Verlag Berlin Heidelberg, XIV, 2004, 502 p. Babanly M. B., Chulkov E. V., Aliev Z. S., Shevelkov A. V., Amiraslanov I. R. Phase diagrams in materials science of topological insulators based on metal chalcogenides. Russ. J. Inorg. Chem., 2017, v. 62(13), pp. 1703–1729. https://doi.org/10.1134/s0036023617130034 Žičkus K., Audzijonis A., Batarunas J., Šileika A. The fundamental absorption edge tail of ferroelectric SbSI. Phys. Status Solidi B., 1984, v. 125(2), pp. 645–651. https://doi.org/10.1002/pssb.2221250225 Belyayev L. M., Lyakhovitskaya V. A., Netesov G. B., Mokhosoev M.V., Aleykina S.M. Synthesis and crystallization of antimony sulfoiodide. Izv. Akad. Nauk, Neorg. Mater., 1965, v. 1(12), pp. 2178–2181. (in Russ.) Ryazantsev A. A., Varekha L. M., Popovkin B. A., Lyakhovitskaya V. A., Novoselova A. V. Р–T–x phase diagram of the SbI3–Sb2S3 system. Izv. Akad. Nauk, Neorg. Mater., 1969, v. 5(7), pp. 1296–1297 (in Russ.) Aliev Z. S., Musayeva S. S., Babanly M. B. The phase relationships in the Sb–S–I system and thermodynamic properties of the SbSI. J. Phase Equilib. Diffus., 2017, v. 38, pp. 887–896. https://doi.org/10.1007/s11669-017-0601-4 Lukaszewicz K., Pietraszko A., Stepen’ Damm Yu., Kajokas A. Crystal structure and phase transitions of the ferroelectric antimony sulfoiodide SbSI. Part II. Crystal structure of SbSI in phases I, II and III. Pol. J. Chem., 1997, v. 71, pp. 1852–1857. Itoh K., Matsunaga H. A study of the crystal structure in ferroelectric SbSI. Zeitschrift für Krist., 1980, v. 152(3-4), p. 309–315. https://doi.org/10.1524/zkri.1980.152.3-4.309 Aliev Z. S., Musaeva S. S., Babanly D. M., Shevelkov A. V., Babanly M. B. Phase diagram of the Sb–Se–I system and thermodynamic properties of SbSeI. J. Alloys Compd., 2010, v. 505(2), pp. 450–455. https://doi.org/10.1016/j.jallcom.2010.06.103 Belotskiy D. P., Lapshin V. F., Boychuk R. F., Novalkovskiy N. P. The Sb2Sе3–SbI3 system. Izv. Akad. Nauk, Neorg. Mater., 1972, v. 8(3), pp. 572–574. (in Russ.) Dolgikh V. A., Popovkin B. A., Odin I. N., Novoselova A. V. Р–Т–х phase diagram of the Sb2Sе3–SbI3 system. Izv. Akad. Nauk, Neorg. Mater., 1973, v. 9(6), pp. 919–922. (in Russ.) Rodionov Yu. I., Klokman V. V., Myakishev K. G. The solubility of semiconductor compounds AIIBVI, AIVBIV and AVBVI in halide melts. Russ. J. Inorg. Chem., 1973, v. 17(3), pp. 846–849. (in Russ.) Chervenyuk G. I., Niyger F. V., Belotskiy D. P., Novalkovskiy N. P. Investigation of the phase equilibria in the SbSI–Sb, SbSI–S, SbSI–I systems. Izv. Akad. Nauk, Neorg. Mater., 1977, v. 13(6), pp. 989–991. (in Russ.) Aliev Z. S., Babanly M. B., Babanly D. M., Shevelkov A. V., Tedenac J. C. Phase diagram of the Sb–Te–I system and thermodynamic properties of SbTeI. Int. J. Mat. Res., 2012, v. 103(3), pp. 290–295. https://doi.org/10.3139/146.110646 Belotskiy D. P., Antipov I. N., Nadtochiy V. F., Dodik S.M. Physicochemical investigations of the PbI2–SnI2, CdI2–ZnI2, BiI3–SbI3, Sb2Te3–SbI3, Bi2Te3–BiI3 systems. Izv. Akad. Nauk, Neorg. Mater., 1969, v. 5(10), pp. 1663–1667. (in Russ.) Belotskiy D. P., Dodik S. M., Antipov I. N., Nefedov Z. I. Synthesis and investigation of the telluroiodides of antimony and bismuth. Ukr. Chem. J., 1970, v. 36, pp. 897–900. (in Russ.) Aleshin V. A., Valitova N. R., Popovkin B. A., Novoselova A. V. P-T-x phase diagram of the antimony iodide system – antimony telluride. Izv. Akad. Nauk, Zhur. Fiz. Khim., 1974, v. 48, p. 2395. (in Russ.) Valitova N. R., Popovkin B. A., Novoselova A. V., Aslanov L. A. The compound SbTeI. Izv. Akad. Nauk, Neorg. Mater., 1973, v. 9, pp. 2222–2223. (in Russ.) Turyanitsa I. D., Olekseyuk I. D., Kozmanko I. I. Investigation of the Sb2Te3–SbI3 system and properties of the compound SbTeI. Izv. Akad. Nauk, Neorg. Mater., 1973, v. 9(8), pp. 433–1434. (in Russ.) Voutsas G. P., Rentzeperis P. J. The crystal structure of antimony selenoiodide, SbSeI. Zeitschrift für Kristallographie, 1983, v. 161(1–2), pp. 111–118. https://doi.org/10.1524/zkri.1982.161.1-2.111 Kikuchi A., Oka Y., Sawaguchi E. Crystal Structure Determination of SbSI. J. Phys. Soc. Jap., 1967, v. 23(2), pp. 337–354. https://doi.org/10.1143/jpsj.23.337 Kichambare P., Sharon M. Preparation, characterization and physical properties of mixed Sb1–xBixTeI. Solid State Ionics, 1997, v. 101–103, pp. 155–159. https://doi.org/10.1016/s0167-2738(97)84024-6 Shevelkov A. V., Dikarev E. V., Shpanchenko R. V., Popovkin B.A. Crystal structures of bismuth tellurohalides BiTeX (X = Cl, Br, I) from X-ray powder diffraction data. J. Solid State Chem., 1995, v. 114(2), pp. 379–395. https://doi.org/10.1006/jssc.1995.1058 Aliev Z. S., Jafarov Y. I., Jafarli F. Y., Shevelkov A. V., Babanly M. B. The phase equilibria in the Bi–S–I ternary system and thermodynamic properties of the BiSI and Bi19S27I3 ternary compounds. J. Alloys Compd. 2014, v. 610, pp. 522–528. https://doi.org/10.1016/j.jallcom.2014.05.015 Ryazantsev T. A., Varekha L. M., Popovkin B. A., Novoselova A. V. P-T-x phase diagram of the BiI3–Bi2S3 system. Izv. Akad. Nauk, Neorg. Mater., 1970, v. 6, pp. 1175–1179. (in Russ.) Oppermann H., Petasch U. Zu den pseudobinären Zustandssystemen Bi2Ch3-BiX3 und den ternären Phasen auf diesen Schnitten (Ch = S, Se, Te; X = Cl, Br, I), I: Bismutsulfi dhalogenide/The Pseudobinary Systems Bi2Ch3–BiX3 and the Ternary Phases on their Boundary Lines (Ch = S, Se, Te; X = Cl, Br, I), I: Bismuth Sulfi de Halides. Z. Naturforsch. 2003, v. 58b, pp. 725–740. https://doi.org/10.1515/znb-2003-0803 (in German) Haase-Wessel W. Die Kristallstruktur des Wismutsulfi djodids (BiSJ). Naturwissenschaften, 1973, v. 60, pp. 474–474. https://doi.org/10.1007/bf00592859 (in German) Miehe G., Kupcik V. Die Kristallstruktur des Bi(Bi2S3)9J3. Naturwissenschaften, 1971, v. 58, pp. 219–219. DOI: 10.1007/bf00591851 (in German) Turjanica I. D., Zajachkovskii N. F., Zajachkovskaja N. F., Kozmanko I. I. Investigation of the BiI3–Bi2Se3 system. Izv. Akad. Nauk, Neorg. Mater., 1974, v. 11(10), p. 1884. (in Russ.) Belotskii D. P., Lapsin V. F., Baichuk R. F. The BiI3–Bi2Se3 system. Izv. Akad. Nauk Neorg. Mater., 1971, v. 7(11), p. 1936. (in Russ.) Dolgikh V. A., Odin I. N., Popovkin B. A., Novoselova A. V. P-T-x phase diagram of the BiI3–Bi2Se3 system. Vestn. Mosk. Univ., Dep. VINITI., 1973, v. 23(3), Dep. No. 5683-73. (in Russ.) Dolgikh V. A., Popovkin B. A., Ivanova G. I., Novoselova A. V. Investigation of the sublimation of the SbSeI and BiSeI. Izv. Akad. Nauk, Neorg. Mater., 1975, v. 11(4), p. 637. (in Russ.) Petasch U., Goebel H., Oppermann H. Untersuchungen zum quasibinären System Bi2Se3/BiI3. Z. Anorg. Allg. Chem., 1998, v. 624, p. 1767. https://doi.org/10.1002/(sici)1521-3749(1998110)624:11<1767::aidzaac1767>3.0.co;2-t (in German) Doenges E. Z. Über Chalkogenohalogenide des dreiwertigen Antimons und Wismuts. II. Über Selenohalogenide des dreiwertigen Antimons und Wismuts und über Antimon(III)-selenid Mit 2 Abbildungen. Anorg. Allg. Chem., 1950, v. 263(5–6), pp. 280–291. https://doi.org/10.1002/zaac.19502630508 (in German) Braun T. P., DiSalvo F. J. Bismuth selenide iodide. Acta Crystallogr., 2000, v. C56(1), pp. e1–e2. https://doi.org/10.1107/s0108270199016017 Chervenyuk G. I., Babyuk P. F., Belotskii D. P., Chervenyuk T. G. Phase equilibria in the Bi–Se–I system along the BiSeI–Bi and BiSeI–BiI sections. Izv. Akad. Nauk, Neorg. Mater., 1982, v. 18, pp. 1569–1572. (in Ukr.) Babanly M. B., Tedenac J. C., Aliev Z. S., Balitsky D. M. Phase equilibriums and thermodynamic properties of the system Bi–Te–I. J. Alloys Compd., 2009, v. 481, pp. 349–353. https://doi.org/10.1016/j.jallcom.2009.02.139 Horak J., Rodot H. Preparation de cristaux du compose BiTeI. C. R. Acad. Sci. Paris Serie B, 1968, v. 267(6), pp. 363–366. Valitova N. R., Aleshin V. A., Popovkin B. A., Novoselova A. V. Investigation of the P-T-x phase diagram for the BiI3–Bi2Te3 system. Izv. Akad. Nauk, Neorg. Mater., 1976, v. 12(2), pp. 225–228. (in Russ.) Tomokiyo A., Okada T., Kawanos S. Phase diagram of system (Bi2Te3)–(BiI3) and crystal structure of BiTeI. Jpn. J. Appl. Phys. 1977, v. 16(6), pp. 291–298. https://doi.org/10.1143/jjap.16.291 Evdokimenko L. T., Tsypin M. I. The effect of halogens on the structure and properties of alloys based on Bi2Te3. Izv. Akad. Nauk, Neorg. Mater., 1971, v. 7(8), pp. 1317–1320. (in Russ.) Savilov S. V., Khrustalev V. N., Kuznetsov A. N., Popovkin B. A., Antipin Ju.M. New subvalent bismuth telluroiodides incorporating Bi2 layers: the crystal and electronic structure of Bi2TeI. Russ. Chem. Bull., 2005, v. 54(1), pp. 87–92. https://doi.org/10.1007/s11172-005-0221-8

Abstract Background Binding of E-selectin (E-sel) to sialyl Lex on the leukemic cell surface activates cell survival pathways and promotes chemotherapy resistance in AML. Expression of the E-sel ligand (E-sel-L) is associated with increased relapse and poor survival. Uproleselan (GMI-1271), a novel E-sel antagonist, disrupts cell survival pathway activation, enhances chemotherapy response and protects from toxicity with improved survival in vivo. We added uproleselan to mitoxantrone, etoposide, cytarabine (MEC) chemotherapy for R/R AML patients (pts) and to cytarabine and idarubicin (7+3) induction for older, treatment naïve (TN) AML pts. Here we report on final outcomes and correlative studies. Methods A Phase (Ph) 1/2 trial evaluated safety and efficacy of escalating doses of upro (5-20 mg/kg) combined with MEC in pts with R/R AML. The recommended Ph 2 dose (RP2D) was 10 mg/kg. Ph 2 added pts ≥60 yrs with TN AML treated with upro and 7+3. Uproleselan was given 24 hrs prior, every 12 hrs during and 48 hrs post chemotherapy. Responders could receive consolidation therapy (1 cycle MEC or 1-3 cycles IDAC) with uproleselan. Baseline E-sel-L expression on AML blasts (CD45+,SSC) and leukemic stem cells (LSC, CD34+CD38-CD123+) in blood and bone marrow (BM) was assessed by flow cytometry, for percentage of blasts binding to E-sel-Fc chimeric protein and HECA452 (antibody to sialyl Lex). Post-induction measurable residual disease (MRD-/MRD+) was assessed locally. Results 91 pts were enrolled (Ph 1 R/R=19; Ph 2 R/R=47. TN=25). Median age in R/R pts was 59 yrs (26-84) with 22/66 (33%) primary refractory, 22 (33%) CR1<6 months (m); 17% prior SCT; 50% had adverse risk (ELN). Uproleselan was well tolerated, with no increase in adverse events. Grade 3/4 mucositis was 2% at RP2D. R/R CR/CRi rate was 41% (RP2D), 39% (all doses), 30% (primary refractory/CR1<6m). 11/16 (69%) evaluable pts were MRD- . 42/66 (64%) received further anti-leukemic therapy including 17 (26%) SCT. At RP2D, median (95%CI) OS was 8.8 m (5.7-11.4); remission duration was 9.1 m (3.2-15.2); 1-year OS was 35%. For R/R/MRD-, 1-year OS was 73%. E-sel-L was detectable on BM blasts in all 36 evaluable pts: median expression 26% (1-85) of blasts. In a subset of MRD evaluable pts (N=10), E-sel-L expression was higher in those who were MRD- (55% vs 35%). Functional E-sel binding was higher in those achieving CR/CRi (N=14, p=0.003, at 12 hrs; p=0.001 at 48 hrs post uproleselan). In BM blasts (Figure N=36), LSC expression of E-sel-L correlated with blast E-sel-L (R2=0.75, p<0.0001), consistent with hypothesis that E-sel/E-sel-L interaction may be an LSC mechanism of chemoresistance. R/R responders (CR/CRi) also had higher LSC/E-sel-L expression than non-responders (41% [0-98] vs 19% [0.7-83] p=0.06). Median OS for LSC/E-sel-L ≥10% (N=22) vs LSC/E-sel-L <10% (N=14) was 12.7m (8.3-NR) and 5.2 m (2.3-9.4), respectively (p<0.006). Median age in TN pts was 67 yrs (60-79). 48% had adverse risk (ELN) and 52% secondary AML (sAML). Uproleselan was well tolerated, with no increase in adverse events, no Grade 3/4 mucositis, and mortality 8% (30d) and 12% (60d). CR/CRi was 72% (all), and 69% (sAML). 5/9 (56%) evaluable pts were MRD-. 19/25 (76%) proceeded to further anti-leukemic therapy; 11 (44%) proceeded to SCT. Median (95% CI) EFS, OS, and remission duration were 9.2 m (3.0-12.6), 12.6 m (9.9-NR), and 10.4 m (7.1-17.8) respectively; 1-year OS was 52%. For sAML, median (95% CI) EFS and OS were 7.7 m (1.1-9.5) and 10.5m (4.4-NR), respectively. For TN/MRD-, 1-year OS was 60%. E-sel-L was detectable on BM blasts in all 24 evaluable pts: median expression 31% (2-92) of blasts. In a subset of MRD evaluable pts (N=8), E-sel-L expression was higher in those who were MRD+ (35% vs 8%). In BM blasts (Figure N=24), LSC expression of E-sel-L correlated with blast E-sel-L (R2=0.87, p<0.0001). TN responders (CR/CRi) had LSC/E-sel-L expression similar to non-responders (21% [0-96] vs 21% [0-94] p=NS). Median OS for LSC/E-sel-L ≥10% (N=15) vs LSC/E-sel-L <10% (N=7) was 10.5 m (4.4-NR) and not reached, respectively (p=NS). Conclusion The addition of uproleselan to chemotherapy was well tolerated, with low oral mucositis rates, high remission rates, high MRD- and transplant rates, and promising survival outcomes in pts with R/R and TN AML. High E-sel-L expression is associated with improved remission and survival with uproleselan treatment in R/R AML. Phase III studies in pts with R/R and (older) TN AML are underway. Figure. Figure. Disclosures DeAngelo: Shire: Honoraria; Amgen: Consultancy; BMS: Consultancy; ARIAD: Consultancy, Research Funding; Blueprint Medicines: Honoraria, Research Funding; Takeda: Honoraria; Glycomimetics: Research Funding; Novartis Pharmaceuticals Corporation: Consultancy, Honoraria; Amgen: Consultancy; Novartis Pharmaceuticals Corporation: Consultancy, Honoraria; Incyte: Consultancy, Honoraria; Glycomimetics: Research Funding; Blueprint Medicines: Honoraria, Research Funding; Pfizer Inc: Consultancy, Honoraria; Shire: Honoraria; BMS: Consultancy; Takeda: Honoraria; Incyte: Consultancy, Honoraria; Pfizer Inc: Consultancy, Honoraria; ARIAD: Consultancy, Research Funding. Jonas:Glycomimetics: Research Funding; Genentech/Roche: Research Funding; Celgene: Consultancy, Research Funding; Accelerated Medical Diagnostics: Research Funding; Daiichi Sankyo: Research Funding; Incyte: Research Funding; Esanex: Research Funding; Tolero: Consultancy; Kalobios: Research Funding; LP Therapeutics: Research Funding; Amgen: Consultancy; Pharmacyclics: Research Funding; Forma: Research Funding; AbbVie: Consultancy, Research Funding. Liesveld:Onconova: Other: DSMB; Abbvie: Honoraria. Bixby:GlycoMimetics: Research Funding. Advani:Glycomimetics: Consultancy; Novartis: Consultancy; Amgen: Research Funding; Pfizer: Honoraria, Research Funding. Marlton:GlycoMimetics: Research Funding; Novartis: Honoraria, Membership on an entity's Board of Directors or advisory committees; Roche: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; AbbVie: Honoraria, Membership on an entity's Board of Directors or advisory committees; Astellas: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees; Pfizer: Membership on an entity's Board of Directors or advisory committees. O'Dwyer:Janssen: Membership on an entity's Board of Directors or advisory committees, Research Funding; BMS: Research Funding; Onkimmune: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Research Funding; Celgene: Research Funding; Glycomimetics: Research Funding; Abbvie: Membership on an entity's Board of Directors or advisory committees. Fogler:GlycoMimetics: Employment, Equity Ownership. Wolfgang:GlycoMimetics: Employment, Equity Ownership. Magnani:GlycoMimetics: Employment, Equity Ownership, Membership on an entity's Board of Directors or advisory committees. Thackray:GlycoMimetics: Employment, Equity Ownership. Becker:GlycoMimetics: Research Funding.

Climate change induced sea-level rise (SLR) is on its increase globally. Regionally the lowlands of China, Vietnam, Bangladesh, and islands of the Malaysian, Indonesian and Philippine archipelagos are among the world’s most threatened regions. Sea-level rise has major impacts on the ecosystems and society. It threatens coastal populations, economic activities, and fragile ecosystems as mangroves, coastal salt-marches and wetlands. This paper provides a summary of the current state of knowledge of sea level-rise and its effects on both human and natural ecosystems. The focus is on coastal urban areas and low lying deltas in South-East Asia and Vietnam, as one of the most threatened areas in the world. About 3 mm per year reflects the growing consensus on the average SLR worldwide. The trend speeds up during recent decades. The figures are subject to local, temporal and methodological variation. In Vietnam the average values of 3.3 mm per year during the 1993-2014 period are above the worldwide average. Although a basic conceptual understanding exists that the increasing global frequency of the strongest tropical cyclones is related with the increasing temperature and SLR, this relationship is insufficiently understood. Moreover the precise, complex environmental, economic, social, and health impacts are currently unclear. SLR, storms and changing precipitation patterns increase flood risks, in particular in urban areas. Part of the current scientific debate is on how urban agglomeration can be made more resilient to flood risks. Where originally mainly technical interventions dominated this discussion, it becomes increasingly clear that proactive special planning, flood defense, flood risk mitigation, flood preparation, and flood recovery are important, but costly instruments. Next to the main focus on SLR and its effects on resilience, the paper reviews main SLR associated impacts: Floods and inundation, salinization, shoreline change, and effects on mangroves and wetlands. The hazards of SLR related floods increase fastest in urban areas. This is related with both the increasing surface major cities are expected to occupy during the decades to come and the increasing coastal population. In particular Asia and its megacities in the southern part of the continent are increasingly at risk. The discussion points to complexity, inter-disciplinarity, and the related uncertainty, as core characteristics. An integrated combination of mitigation, adaptation and resilience measures is currently considered as the most indicated way to resist SLR today and in the near future.References Aerts J.C.J.H., Hassan A., Savenije H.H.G., Khan M.F., 2000. Using GIS tools and rapid assessment techniques for determining salt intrusion: Stream a river basin management instrument. Physics and Chemistry of the Earth, Part B: Hydrology, Oceans and Atmosphere, 25, 265-273. Doi: 10.1016/S1464-1909(00)00014-9. Alongi D.M., 2002. Present state and future of the world’s mangrove forests. Environmental Conservation, 29, 331-349. Doi: 10.1017/S0376892902000231 Alongi D.M., 2015. The impact of climate change on mangrove forests. Curr. Clim. Change Rep., 1, 30-39. Doi: 10.1007/s404641-015-0002-x. Anderson F., Al-Thani N., 2016. Effect of sea level rise and groundwater withdrawal on seawater intrusion in the Gulf Coast aquifer: Implications for agriculture. Journal of Geoscience and Environment Protection, 4, 116-124. Doi: 10.4236/gep.2016.44015. Anguelovski I., Chu E., Carmin J., 2014. Variations in approaches to urban climate adaptation: Experiences and experimentation from the global South. Global Environmental Change, 27, 156-167. Doi: 10.1016/j.gloenvcha.2014.05.010. Arustienè J., Kriukaitè J., Satkunas J., Gregorauskas M., 2013. Climate change and groundwater - From modelling to some adaptation means in example of Klaipèda region, Lithuania. In: Climate change adaptation in practice. P. Schmidt-Thomé, J. Klein Eds. John Wiley and Sons Ltd., Chichester, UK., 157-169. Bamber J.L., Aspinall W.P., Cooke R.M., 2016. A commentary on “how to interpret expert judgement assessments of twenty-first century sea-level rise” by Hylke de Vries and Roderik S.W. Van de Wal. Climatic Change, 137, 321-328. Doi: 10.1007/s10584-016-1672-7. Barnes C., 2014. Coastal population vulnerability to sea level rise and tropical cyclone intensification under global warming. BSc-thesis. Department of Geography, University of Lethbridge, Alberta Canada. Be T.T., Sinh B.T., Miller F., 2007. Challenges to sustainable development in the Mekong Delta: Regional and national policy issues and research needs. The Sustainable Mekong Research Network, Bangkok, Thailand, 1-210. Bellard C., Leclerc C., Courchamp F., 2014. Impact of sea level rise on 10 insular biodiversity hotspots. Global Ecology and Biogeography, 23, 203-212. Doi: 10.1111/geb.12093. Berg H., Söderholm A.E., Sönderström A.S., Nguyen Thanh Tam, 2017. Recognizing wetland ecosystem services for sustainable rice farming in the Mekong delta, Vietnam. Sustainability Science, 12, 137-154. Doi: 10.1007/s11625-016-0409-x. Bilskie M.V., Hagen S.C., Medeiros S.C., Passeri D.L., 2014. Dynamics of sea level rise and coastal flooding on a changing landscape. Geophysical Research Letters, 41, 927-934. Doi: 10.1002/2013GL058759. Binh T.N.K.D., Vromant N., Hung N.T., Hens L., Boon E.K., 2005. Land cover changes between 1968 and 2003 in Cai Nuoc, Ca Mau penisula, Vietnam. Environment, Development and Sustainability, 7, 519-536. Doi: 10.1007/s10668-004-6001-z. Blankespoor B., Dasgupta S., Laplante B., 2014. Sea-level rise and coastal wetlands. Ambio, 43, 996- 005.Doi: 10.1007/s13280-014-0500-4. Brockway R., Bowers D., Hoguane A., Dove V., Vassele V., 2006. A note on salt intrusion in funnel shaped estuaries: Application to the Incomati estuary, Mozambique.Estuarine, Coastal and Shelf Science, 66, 1-5. Doi: 10.1016/j.ecss.2005.07.014. Cannaby H., Palmer M.D., Howard T., Bricheno L., Calvert D., Krijnen J., Wood R., Tinker J., Bunney C., Harle J., Saulter A., O’Neill C., Bellingham C., Lowe J., 2015. Projected sea level rise and changes in extreme storm surge and wave events during the 21st century in the region of Singapore. Ocean Sci. Discuss, 12, 2955-3001. Doi: 10.5194/osd-12-2955-2015. Carraro C., Favero A., Massetti E., 2012. Investment in public finance in a green, low carbon economy. Energy Economics, 34, S15-S18. Castan-Broto V., Bulkeley H., 2013. A survey ofurban climate change experiments in 100 cities. Global Environmental Change, 23, 92-102. Doi: 10.1016/j.gloenvcha.2012.07.005. Cazenave A., Le Cozannet G., 2014. Sea level rise and its coastal impacts. GeoHealth, 2, 15-34. Doi: 10.1002/2013EF000188. Chu M.L., Guzman J.A., Munoz-Carpena R., Kiker G.A., Linkov I., 2014. A simplified approach for simulating changes in beach habitat due to the combined effects of long-term sea level rise, storm erosion and nourishment. Environmental modelling and software, 52, 111-120. Doi.org/10.1016/j.envcsoft.2013.10.020. Church J.A. et al., 2013. Sea level change. In: Climate change 2013: The physical science basis. Contribution of working group I to the fifth assessment report of Intergovernmental Panel on Climate Change. Eds: Stocker T.F., Qin D., Plattner G.-K., Tignor M., Allen S.K., Boschung J., Nauels A., Xia Y., Bex V., Midgley P.M., Cambridge University Press, Cambridge, UK. Connell J., 2016. Last days of the Carteret Islands? Climate change, livelihoods and migration on coral atolls. Asia Pacific Viewpoint, 57, 3-15. Doi: 10.1111/apv.12118. Dasgupta S., Laplante B., Meisner C., Wheeler, Yan J., 2009. The impact of sea level rise on developing countries: A comparative analysis. Climatic Change, 93, 379-388. Doi: 10.1007/s 10584-008-9499-5. Delbeke J., Vis P., 2015. EU climate policy explained, 136p. Routledge, Oxon, UK. DiGeorgio M., 2015. Bargaining with disaster: Flooding, climate change, and urban growth ambitions in QuyNhon, Vietnam. Public Affairs, 88, 577-597. Doi: 10.5509/2015883577. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, 2015. Enhancement of coastal protection under the context of climate change: A case study of Hai Hau coast, Vietnam. Proceedings of the 10th Asian Regional Conference of IAEG, 1-8. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, Lan Nguyen Chau, 2017. Climate change impacts on a large-scale erosion coast of Hai Hau district, Vietnam and the adaptation. Journal of Coastal Conservation, 21, 47-62. Donner S.D., Webber S., 2014. Obstacles to climate change adaptation decisions: A case study of sea level rise; and coastal protection measures in Kiribati. Sustainability Science, 9, 331-345. Doi: 10.1007/s11625-014-0242-z. Driessen P.P.J., Hegger D.L.T., Bakker M.H.N., Van Renswick H.F.M.W., Kundzewicz Z.W., 2016. Toward more resilient flood risk governance. Ecology and Society, 21, 53-61. Doi: 10.5751/ES-08921-210453. Duangyiwa C., Yu D., Wilby R., Aobpaet A., 2015. Coastal flood risks in the Bangkok Metropolitan region, Thailand: Combined impacts on land subsidence, sea level rise and storm surge. American Geophysical Union, Fall meeting 2015, abstract#NH33C-1927. Duarte C.M., Losada I.J., Hendriks I.E., Mazarrasa I., Marba N., 2013. The role of coastal plant communities for climate change mitigation and adaptation. Nature Climate Change, 3, 961-968. Doi: 10.1038/nclimate1970. Erban L.E., Gorelick S.M., Zebker H.A., 2014. Groundwater extraction, land subsidence, and sea-level rise in the Mekong Delta, Vietnam. Environmental Research Letters, 9, 1-20. Doi: 10.1088/1748-9326/9/8/084010. FAO - Food and Agriculture Organisation, 2007.The world’s mangroves 1980-2005. FAO Forestry Paper, 153, Rome, Italy. Farbotko C., 2010. Wishful sinking: Disappearing islands, climate refugees and cosmopolitan experimentation. Asia Pacific Viewpoint, 51, 47-60. Doi: 10.1111/j.1467-8373.2010.001413.x. Goltermann D., Ujeyl G., Pasche E., 2008. Making coastal cities flood resilient in the era of climate change. Proceedings of the 4th International Symposium on flood defense: Managing flood risk, reliability and vulnerability, 148-1-148-11. Toronto, Canada. Gong W., Shen J., 2011. The response of salt intrusion to changes in river discharge and tidal mixing during the dry season in the Modaomen Estuary, China.Continental Shelf Research, 31, 769-788. Doi: 10.1016/j.csr.2011.01.011. Gosian L., 2014. Protect the world’s deltas. Nature, 516, 31-34. Graham S., Barnett J., Fincher R., Mortreux C., Hurlimann A., 2015. Towards fair outcomes in adaptation to sea-level rise. Climatic Change, 130, 411-424. Doi: 10.1007/s10584-014-1171-7. COASTRES-D-12-00175.1. Güneralp B., Güneralp I., Liu Y., 2015. Changing global patterns of urban expoàsure to flood and drought hazards. Global Environmental Change, 31, 217-225. Doi: 10.1016/j.gloenvcha.2015.01.002. Hallegatte S., Green C., Nicholls R.J., Corfee-Morlot J., 2013. Future flood losses in major coastal cities. Nature Climate Change, 3, 802-806. Doi: 10.1038/nclimate1979. Hamlington B.D., Strassburg M.W., Leben R.R., Han W., Nerem R.S., Kim K.-Y., 2014. Uncovering an anthropogenic sea-level rise signal in the Pacific Ocean. Nature Climate Change, 4, 782-785. Doi: 10.1038/nclimate2307. Hashimoto T.R., 2001. Environmental issues and recent infrastructure development in the Mekong Delta: Review, analysis and recommendations with particular reference to large-scale water control projects and the development of coastal areas. Working paper series (Working paper No. 4). Australian Mekong Resource Centre, University of Sydney, Australia, 1-70. Hibbert F.D., Rohling E.J., Dutton A., Williams F.H., Chutcharavan P.M., Zhao C., Tamisiea M.E., 2016. Coral indicators of past sea-level change: A global repository of U-series dated benchmarks. Quaternary Science Reviews, 145, 1-56. Doi: 10.1016/j.quascirev.2016.04.019. Hinkel J., Lincke D., Vafeidis A., Perrette M., Nicholls R.J., Tol R.S.J., Mazeion B., Fettweis X., Ionescu C., Levermann A., 2014. Coastal flood damage and adaptation costs under 21st century sea-level rise. Proceedings of the National Academy of Sciences, 111, 3292-3297. Doi: 10.1073/pnas.1222469111. Hinkel J., Nicholls R.J., Tol R.S.J., Wang Z.B., Hamilton J.M., Boot G., Vafeidis A.T., McFadden L., Ganapolski A., Klei R.J.Y., 2013. A global analysis of erosion of sandy beaches and sea level rise: An application of DIVA. Global and Planetary Change, 111, 150-158. Doi: 10.1016/j.gloplacha.2013.09.002. Huong H.T.L., Pathirana A., 2013. Urbanization and climate change impacts on future urban flooding in Can Tho city, Vietnam. Hydrol. Earth Syst. Sci., 17, 379-394. Doi: 10.5194/hess-17-379-2013. Hurlimann A., Barnett J., Fincher R., Osbaldiston N., Montreux C., Graham S., 2014. Urban planning and sustainable adaptation to sea-level rise. Landscape and Urban Planning, 126, 84-93. Doi: 10.1016/j.landurbplan.2013.12.013. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, 2011. Climate change vulnerability and risk assessment study for Ca Mau and KienGiang provinces, Vietnam. Hanoi, Vietnam Institute of Meteorology, Hydrology and Environment (IMHEN), 250p. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, Ca Mau PPC, 2011. Climate change impact and adaptation study in The Mekong Delta - Part A: Ca Mau Atlas. Hanoi, Vietnam: Institute of Meteorology, Hydrology and Environment (IMHEN), 48p. IPCC-Intergovernmental Panel on Climate Change, 2014. Fifth assessment report. Cambridge University Press, Cambridge, UK. Jevrejeva S., Jackson L.P., Riva R.E.M., Grinsted A., Moore J.C., 2016. Coastal sea level rise with warming above 2°C. Proceedings of the National Academy of Sciences, 113, 13342-13347. Doi: 10.1073/pnas.1605312113. Junk W.J., AN S., Finlayson C.M., Gopal B., Kvet J., Mitchell S.A., Mitsch W.J., Robarts R.D., 2013. Current state of knowledge regarding the world’s wetlands and their future under global climate change: A synthesis. Aquatic Science, 75, 151-167. Doi: 10.1007/s00027-012-0278-z. Jordan A., Rayner T., Schroeder H., Adger N., Anderson K., Bows A., Le Quéré C., Joshi M., Mander S., Vaughan N., Whitmarsh L., 2013. Going beyond two degrees? The risks and opportunities of alternative options. Climate Policy, 13, 751-769. Doi: 10.1080/14693062.2013.835705. Kelly P.M., Adger W.N., 2000. Theory and practice in assessing vulnerability to climate change and facilitating adaptation. Climatic Change, 47, 325-352. Doi: 10.1023/A:1005627828199. Kirwan M.L., Megonigal J.P., 2013. Tidal wetland stability in the face of human impacts and sea-level rice. Nature, 504, 53-60. Doi: 10.1038/nature12856. Koerth J., Vafeidis A.T., Hinkel J., Sterr H., 2013. What motivates coastal households to adapt pro actively to sea-level rise and increased flood risk? Regional Environmental Change, 13, 879-909. Doi: 10.1007/s10113-12-399-x. Kontgis K., Schneider A., Fox J;,Saksena S., Spencer J.H., Castrence M., 2014. Monitoring peri urbanization in the greater Ho Chi Minh City metropolitan area. Applied Geography, 53, 377-388. Doi: 10.1016/j.apgeogr.2014.06.029. Kopp R.E., Horton R.M., Little C.M., Mitrovica J.X., Oppenheimer M., Rasmussen D.J., Strauss B.H., Tebaldi C., 2014. Probabilistic 21st and 22nd century sea-level projections at a global network of tide-gauge sites. Earth’s Future, 2, 383-406. Doi: 10.1002/2014EF000239. Kuenzer C., Bluemel A., Gebhardt S., Quoc T., Dech S., 2011. Remote sensing of mangrove ecosystems: A review.Remote Sensing, 3, 878-928. Doi: 10.3390/rs3050878. Lacerda G.B.M., Silva C., Pimenteira C.A.P., Kopp Jr. R.V., Grumback R., Rosa L.P., de Freitas M.A.V., 2013. Guidelines for the strategic management of flood risks in industrial plant oil in the Brazilian coast: Adaptive measures to the impacts of sea level rise. Mitigation and Adaptation Strategies for Global Change, 19, 104-1062. Doi: 10.1007/s11027-013-09459-x. Lam Dao Nguyen, Pham Van Bach, Nguyen Thanh Minh, Pham Thi Mai Thy, Hoang Phi Hung, 2011. Change detection of land use and river bank in Mekong Delta, Vietnam using time series remotely sensed data. Journal of Resources and Ecology, 2, 370-374. Doi: 10.3969/j.issn.1674-764x.2011.04.011. Lang N.T., Ky B.X., Kobayashi H., Buu B.C., 2004. Development of salt tolerant varieties in the Mekong delta. JIRCAS Project, Can Tho University, Can Tho, Vietnam, 152. Le Cozannet G., Rohmer J., Cazenave A., Idier D., Van de Wal R., de Winter R., Pedreros R., Balouin Y., Vinchon C., Oliveros C., 2015. Evaluating uncertainties of future marine flooding occurrence as sea-level rises. Environmental Modelling and Software, 73, 44-56. Doi: 10.1016/j.envsoft.2015.07.021. Le Cozannet G., Manceau J.-C., Rohmer J., 2017. Bounding probabilistic sea-level projections with the framework of the possible theory. Environmental Letters Research, 12, 12-14. Doi.org/10.1088/1748-9326/aa5528.Chikamoto Y., 2014. Recent Walker circulation strengthening and Pacific cooling amplified by Atlantic warming. Nature Climate Change, 4, 888-892. Doi: 10.1038/nclimate2330. Lovelock C.E., Cahoon D.R., Friess D.A., Gutenspergen G.R., Krauss K.W., Reef R., Rogers K., Saunders M.L., Sidik F., Swales A., Saintilan N., Le Xuan Tuyen, Tran Triet, 2015. The vulnerability of Indo-Pacific mangrove forests to sea-level rise. Nature, 526, 559-563. Doi: 10.1038/nature15538. MA Millennium Ecosystem Assessment, 2005. Ecosystems and human well-being: Current state and trends. Island Press, Washington DC, 266p. Masterson J.P., Fienen M.N., Thieler E.R., Gesch D.B., Gutierrez B.T., Plant N.G., 2014. Effects of sea level rise on barrier island groundwater system dynamics - ecohydrological implications. Ecohydrology, 7, 1064-1071. Doi: 10.1002/eco.1442. McGanahan G., Balk D., Anderson B., 2007. The rising tide: Assessing the risks of climate changes and human settlements in low elevation coastal zones.Environment and urbanization, 19, 17-37. Doi: 10.1177/095624780707960. McIvor A., Möller I., Spencer T., Spalding M., 2012. Reduction of wind and swell waves by mangroves. The Nature Conservancy and Wetlands International, 1-27. Merryn T., Pidgeon N., Whitmarsh L., Ballenger R., 2016. Expert judgements of sea-level rise at the local scale. Journal of Risk Research, 19, 664-685. Doi.org/10.1080/13669877.2015.1043568. Monioudi I.N., Velegrakis A.F., Chatzipavlis A.E., Rigos A., Karambas T., Vousdoukas M.I., Hasiotis T., Koukourouvli N., Peduzzi P., Manoutsoglou E., Poulos S.E., Collins M.B., 2017. Assessment of island beach erosion due to sea level rise: The case of the Aegean archipelago (Eastern Mediterranean). Nat. Hazards Earth Syst. Sci., 17, 449-466. Doi: 10.5194/nhess-17-449-2017. MONRE - Ministry of Natural Resources and Environment, 2016. Scenarios of climate change and sea level rise for Vietnam. Publishing House of Environmental Resources and Maps Vietnam, Hanoi, 188p. Montz B.E., Tobin G.A., Hagelman III R.R., 2017. Natural hazards. Explanation and integration. The Guilford Press, NY, 445p. Morgan L.K., Werner A.D., 2014. Water intrusion vulnerability for freshwater lenses near islands. Journal of Hydrology, 508, 322-327. Doi: 10.1016/j.jhydrol.2013.11.002. Muis S., Güneralp B., Jongman B., Aerts J.C.H.J., Ward P.J., 2015. Science of the Total Environment, 538, 445-457. Doi: 10.1016/j.scitotenv.2015.08.068. Murray N.J., Clemens R.S., Phinn S.R., Possingham H.P., Fuller R.A., 2014. Tracking the rapid loss of tidal wetlands in the Yellow Sea. Frontiers in Ecology and Environment, 12, 267-272. Doi: 10.1890/130260. Neumann B., Vafeidis A.T., Zimmermann J., Nicholls R.J., 2015a. Future coastal population growth and exposure to sea-level rise and coastal flooding. A global assessment. Plos One, 10, 1-22. Doi: 10.1371/journal.pone.0118571. Nguyen A. Duoc, Savenije H. H., 2006. Salt intrusion in multi-channel estuaries: a case study in the Mekong Delta, Vietnam. Hydrology and Earth System Sciences Discussions, European Geosciences Union, 10, 743-754. Doi: 10.5194/hess-10-743-2006. Nguyen An Thinh, Nguyen Ngoc Thanh, Luong Thi Tuyen, Luc Hens, 2017. Tourism and beach erosion: Valuing the damage of beach erosion for tourism in the Hoi An, World Heritage site. Journal of Environment, Development and Sustainability. Nguyen An Thinh, Luc Hens (Eds.), 2018. Human ecology of climate change associated disasters in Vietnam: Risks for nature and humans in lowland and upland areas. Springer Verlag, Berlin.Nguyen An Thinh, Vu Anh Dung, Vu Van Phai, Nguyen Ngoc Thanh, Pham Minh Tam, Nguyen Thi Thuy Hang, Le Trinh Hai, Nguyen Viet Thanh, Hoang Khac Lich, Vu Duc Thanh, Nguyen Song Tung, Luong Thi Tuyen, Trinh Phuong Ngoc, Luc Hens, 2017. Human ecological effects of tropical storms in the coastal area of Ky Anh (Ha Tinh, Vietnam). Environ Dev Sustain, 19, 745-767. Doi: 10.1007/s/10668-016-9761-3. Nguyen Van Hoang, 2017. Potential for desalinization of brackish groundwater aquifer under a background of rising sea level via salt-intrusion prevention river gates in the coastal area of the Red River delta, Vietnam. Environment, Development and Sustainability. Nguyen Tho, Vromant N., Nguyen Thanh Hung, Hens L., 2008. Soil salinity and sodicity in a shrimp farming coastal area of the Mekong Delta, Vietnam. Environmental Geology, 54, 1739-1746. Doi: 10.1007/s00254-007-0951-z. Nguyen Thang T.X., Woodroffe C.D., 2016. Assessing relative vulnerability to sea-level rise in the western part of the Mekong River delta. Sustainability Science, 11, 645-659. Doi: 10.1007/s11625-015-0336-2. Nicholls N.N., Hoozemans F.M.J., Marchand M., Analyzing flood risk and wetland losses due to the global sea-level rise: Regional and global analyses.Global Environmental Change, 9, S69-S87. Doi: 10.1016/s0959-3780(99)00019-9. Phan Minh Thu, 2006. Application of remote sensing and GIS tools for recognizing changes of mangrove forests in Ca Mau province. In Proceedings of the International Symposium on Geoinformatics for Spatial Infrastructure Development in Earth and Allied Sciences, Ho Chi Minh City, Vietnam, 9-11 November, 1-17. Reise K., 2017. Facing the third dimension in coastal flatlands.Global sea level rise and the need for coastal transformations. Gaia, 26, 89-93. Renaud F.G., Le Thi Thu Huong, Lindener C., Vo Thi Guong, Sebesvari Z., 2015. Resilience and shifts in agro-ecosystems facing increasing sea-level rise and salinity intrusion in Ben Tre province, Mekong Delta. Climatic Change, 133, 69-84. Doi: 10.1007/s10584-014-1113-4. Serra P., Pons X., Sauri D., 2008. Land cover and land use in a Mediterranean landscape. Applied Geography, 28, 189-209. Shearman P., Bryan J., Walsh J.P., 2013.Trends in deltaic change over three decades in the Asia-Pacific Region. Journal of Coastal Research, 29, 1169-1183. Doi: 10.2112/JCOASTRES-D-12-00120.1. SIWRR-Southern Institute of Water Resources Research, 2016. Annual Report. Ministry of Agriculture and Rural Development, Ho Chi Minh City, 1-19. Slangen A.B.A., Katsman C.A., Van de Wal R.S.W., Vermeersen L.L.A., Riva R.E.M., 2012. Towards regional projections of twenty-first century sea-level change based on IPCC RES scenarios. Climate Dynamics, 38, 1191-1209. Doi: 10.1007/s00382-011-1057-6. Spencer T., Schuerch M., Nicholls R.J., Hinkel J., Lincke D., Vafeidis A.T., Reef R., McFadden L., Brown S., 2016. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Global and Planetary Change, 139, 15-30. Doi:10.1016/j.gloplacha.2015.12.018. Stammer D., Cazenave A., Ponte R.M., Tamisiea M.E., 2013. Causes of contemporary regional sea level changes. Annual Review of Marine Science, 5, 21-46. Doi: 10.1146/annurev-marine-121211-172406. Tett P., Mee L., 2015. Scenarios explored with Delphi. In: Coastal zones ecosystems services. Eds., Springer, Berlin, Germany, 127-144. Tran Hong Hanh, 2017. Land use dynamics, its drivers and consequences in the Ca Mau province, Mekong delta, Vietnam. PhD dissertation, 191p. VUBPRESS Brussels University Press, ISBN 9789057186226, Brussels, Belgium. Tran Thuc, Nguyen Van Thang, Huynh Thi Lan Huong, Mai Van Khiem, Nguyen Xuan Hien, Doan Ha Phong, 2016. Climate change and sea level rise scenarios for Vietnam. Ministry of Natural resources and Environment. Hanoi, Vietnam. Tran Hong Hanh, Tran Thuc, Kervyn M., 2015. Dynamics of land cover/land use changes in the Mekong Delta, 1973-2011: A remote sensing analysis of the Tran Van Thoi District, Ca Mau province, Vietnam. Remote Sensing, 7, 2899-2925. Doi: 10.1007/s00254-007-0951-z Van Lavieren H., Spalding M., Alongi D., Kainuma M., Clüsener-Godt M., Adeel Z., 2012. Securing the future of Mangroves. The United Nations University, Okinawa, Japan, 53, 1-56. Water Resources Directorate. Ministry of Agriculture and Rural Development, 2016. Available online: http://www.tongcucthuyloi.gov.vn/Tin-tuc-Su-kien/Tin-tuc-su-kien-tong-hop/catid/12/item/2670/xam-nhap-man-vung-dong-bang-song-cuu-long--2015---2016---han-han-o-mien-trung--tay-nguyen-va-giai-phap-khac-phuc. Last accessed on: 30/9/2016. Webster P.J., Holland G.J., Curry J.A., Chang H.-R., 2005. Changes in tropical cyclone number, duration, and intensity in a warming environment. Science, 309, 1844-1846. Doi: 10.1126/science.1116448. Were K.O., Dick O.B., Singh B.R., 2013. Remotely sensing the spatial and temporal land cover changes in Eastern Mau forest reserve and Lake Nakuru drainage Basin, Kenya. Applied Geography, 41, 75-86. Williams G.A., Helmuth B., Russel B.D., Dong W.-Y., Thiyagarajan V., Seuront L., 2016. Meeting the climate change challenge: Pressing issues in southern China an SE Asian coastal ecosystems. Regional Studies in Marine Science, 8, 373-381. Doi: 10.1016/j.rsma.2016.07.002. Woodroffe C.D., Rogers K., McKee K.L., Lovdelock C.E., Mendelssohn I.A., Saintilan N., 2016. Mangrove sedimentation and response to relative sea-level rise. Annual Review of Marine Science, 8, 243-266. Doi: 10.1146/annurev-marine-122414-034025.

В данной работе продемонстрирована возможность применения ИК-микроспектроскопии для многомерной визуализации и анализа интеграции с нативными твердыми тканями зуба человека нового поколения биомиметических материалов, воспроизводящих минералорганический комплекс эмали и дентина.На основе ИК-картирования интенсивности конкретной функциональной молекулярной группы с использованием синхротронного излучения найдены и визуализированы характеристические особенности биомиметического переходного слоя в межфазной области эмаль/стоматологический материал и определено расположение функциональных групп, отвечающих процессам интеграции биомиметического композита REFERENCES Rohr N., Fischer J. Tooth surface treatment strategies for adhesive cementation // The Journal of Advanced Prosthodontics, 2017, v. 9(2), pp. 85–92. https://doi.org/10.4047/jap.2017.9.2.85 Pereira C. N. de B., Daleprane B., Miranda G. L. P. de, Magalhães C. S. de, Moreira A. N. Ultramorphology of pre-treated adhesive interfaces between self-adhesive resin cement and tooth structures // Revista de Odontologia da UNESP, 2017, v. 46(5), pp. 249–254. https://doi.org/10.1590/1807-2577.04917 Temel U. B., Van Ende A., Van Meerbeek B., Ermis R. B. Bond strength and cement-tooth interfacial characterization of self-adhesive composite cements //American Journal of Dentistry, 2017, v. 30(4), pp. 205–211. Watson T. F., Atmeh A. R., Sajini S., Cook R. J., Festy F. Present and future of glass-ionomers and calcium-silicate cements as bioactive materials in dentistry: Biophotonics-based interfacial analyses in health and disease // Dental Materials, 2014, v. 30(1), pp. 50–61. https://doi.org/10.1016/j.dental.2013.08.202 Pontes D. G., Araujo C. T. P., Prieto L. T., de Oliveira D. C. R. S., Coppini E. K., Dias C. T. S., Paulillo L. A. M. S. Nanoleakage of fi ber posts luted with different adhesive strategies and the effect of chlorhexidine on the interface of dentin and self-adhesive cements // General Dentistry, 2015, v. 63(3), pp. 31–37. PMID: 25945761 Teaford M. F., Smith M. M., Ferguson W. J. Development, Function and Evolution of Teeth. Cambridge University Press, 2007, 328 p. Dorozhkin S. V. Hydroxyapatite and Other Calcium Orthophosphates: Bioceramics, Coatings and Dental Applications [Hardcover]. Nova Science Publishers, Inc New York, 2017, 462 p. URL: https://istina.msu.ru/publications/book/58538935/ Uskoković V. Biomineralization and biomimicry of tooth enamel. Non-Metallic Biomaterials for Tooth Repair and Replacement. Elsevier, 2013, pp. 20–44. URL:http://linkinghub.elsevier.com/retrieve/pii/B9780857092441500021 Niu L., Zhang W., Pashley D. H., Breschi L., Mao J., Chen J., Tay F. R. Biomimetic remineralization of dentin // Dental Materials, 2014, v. 30(1), pp. 77–96. https://doi.org/10.1016/j.dental.2013.07.013 Cao C., Mei, Li Q., Lo E., Chu C. Methods for Biomimetic Mineralisation of Human Enamel: A Systematic Review // Materials, 2015, v. 8(6), pp. 2873–2886. https://doi.org/10.3390/ma8062873 Chen L., Yuan H., Tang B., Liang K., Li J. Biomimetic remineralization of human enamel in the presence of polyamidoamine dendrimers in vitro // Caries Research, 2015, v. 49(3), pp. 282–290. https://doi.org/10.1159/000375376 Seredin P. V., Goloshchapov D. L., Gushchin M. S., Ippolitov Y. A., Prutskij T. The importance of the biomimetic composites components for recreating the optical properties and molecular composition of intact dental tissues. // Journal of Physics: Conference Series, 2017, v. 917(4), pp. 042019. https://doi.org/10.1088/1742-6596/917/4/042019 Xia Z. Biomimetic Principles and Design of Advanced Engineering Materials. John Wiley & Sons, 2016, 321 p. Dorozhkin S. V. Self-Setting Calcium Orthophosphate Formulations: Cements, Concretes, Pastes and Putties // International Journal of Materials and Chemistry, 2012, v. 1(1), pp. 1–48. https://doi.org/10.5923/j.ijmc.20110101.01 Li H., Gong M., Yang A., Ma J., Li X., Yan Y. Degradable biocomposite of nano calcium-defi cient hydroxyapatite-multi(amino acid) copolymer // International Journal of Nanomedicine, 2012, v. 7, pp. 1287–1295. https://doi.org/10.2147/IJN.S28978 Ruan Q., Zhang Y., Yang X., Nutt S., Moradian-Oldak J. An amelogenin–chitosan matrix promotes assembly of an enamel-like layer with a dense interface// Acta Biomaterialia, 2013, v. 9(7), pp. 7289–7297. https://doi.org/10.1016/j.actbio.2013.04.004 Yao, Shao H., Zhang Q. Development and Characterization of a Novel Amorphous Calcium Phosphate/Multi (Amino Acid) Copolymer Composite for Bone Repair // Journal of Biomaterials and Tissue Engineering, 2015, v. 5(5), pp. 387–390. https://doi.org/10.1166/jbt.2015.1321 Melo M. A. S., Weir M. D., Rodrigues L. K. A., Xu H. H. K. Novel calcium phosphate nanocomposite with caries-inhibition in a human in situ model // Dental Materials, 2013, v. 29(2), pp. 231–240. https://doi.org/10.1016/j.dental.2012.10.010 Wu X.-T., Mei M., Li Q.-L., Cao C., Chen-L., Xia R., Zhang Z.-H., Chu C. A Direct Electric Field-Aided Biomimetic Mineralization System for Inducing the Remineralization of Dentin Collagen Matrix // Materials, 2015, v. 8(12), pp. 7889–7899. https://doi.org/10.3390/ ma8115433 Barghamadi H., Atai M., Imani M., Esfandeh M. Effects of nanoparticle size and content on mechanical properties of dental nanocomposites: experimental versus modeling // Iranian Polymer Journal, 2015, v. 24. (10), pp. 837–848. https://doi.org/10.1007/s13726-015-0369-5 Wang H., Xiao Z., Yang J., Lu D., Kishen A., Li Y., Chen Z., Que K., Zhang Q., Deng X., Yang X., Cai Q., Chen N., Cong C., Guan B., Li T., Zhang X. Oriented and Ordered Biomimetic Remineralization of the Surface of Demineralized Dental Enamel Using HAP@ ACP Nanoparticles Guided by Glycine // Scientifi c Reports, 2017, v. 7(1), рр. 1-13. https://doi.org/10.1038/srep40701 Wu X., Zhao X., Li Y., Yang T., Yan X., Wang K. In situ synthesis carbonated hydroxyapatite layers on enamel slices with acidic amino acids by a novel twostep method // Materials Science & Engineering. C, Materials for Biological Applications, 2015, v. 54, pp. 150–157. httsp://doi.org/10.1016/j.msec.2015.05.006 Aljabo A., Abou Neel E. A., Knowles J. C., Young A. M. Development of dental composites with reactive fi llers that promote precipitation of antibacterial-hydroxyapatite layers // Materials Science and Engineering: C, 2016, v. 60, pp. 285–292. https://doi.org/10.1016/j.msec.2015.11.047 Wang P., Liu P., Peng H., Luo X., Yuan H., Zhang J., Yan Y. Biocompatibility evaluation of dicalcium phosphate/calcium sulfate/poly (amino acid) composite for orthopedic tissue engineering in vitro and in vivo // Journal of Biomaterials Science. Polymer Edition, 2016, v. 27(11), pp. 1170–1186. https://doi.org/10.1080/09205063.2016.1184123 Lübke A., Enax J., Wey K., Fabritius H.-O., Raabe D., Epple M. Composites of fl uoroapatite and methylmethacrylate-based polymers (PMMA) for biomimetic tooth replacement // Bioinspiration & Biomimetics, 2016, v. 11(3), pp. 035001. https://doi.org/10.1088/1748-3190/11/3/035001 Sa Y., Gao Y., Wang M., Wang T., Feng X., Wang Z., Wang Y., Jiang T. Bioactive calcium phosphate cement with excellent injectability, mineralization capacity and drug-delivery properties for dental bio- mimetic reconstruction and minimum intervention therapy. RSC Advances, 2016, v. 6(33), pp. 27349–27359. https://doi.org/10.1039/C6RA02488B Adachi T., Pezzotti G., Yamamoto T., Ichioka H., Boffelli M., Zhu W., Kanamura N. Vibrational algorithms for quantitative crystallographic analyses of hydroxyapatite-based biomaterials: II, application to decayed human teeth // Analytical and Bioanalytical Chemistry, 2015, v. 407(12), pp. 3343–3356. https://doi.org/10.1007/s00216-015-8539-z Mitić Ž., Stolić A., Stojanović S., Najman S., Ignjatović N., Nikolić G., Trajanović M. Instrumental methods and techniques for structural and physicochemical characterization of biomaterials and bone tissue: A review // Materials Science and Engineering: C, 2017, v. 79, pp. 930–949. https://doi.org/10.1016/j.msec.2017.05.127 Optical spectroscopy and computational methods in biology and medicine / Ed. by Barańska M., Dordrecht: Springer, 2014, 540 p. URL: http://link.springer.com/10.1007/978-94-007-7832-0 Hędzelek W., Marcinkowska A., Domka L., Wachowiak R. Infrared Spectroscopic Identifi cation of Chosen Dental Materials and Natural Teeth // Acta Physica Polonica A, 2008, v. 114(2), pp. 471–484. https://doi.org/10.12693/APhysPolA.114.471 Vongsvivut J., Perez-Guaita D., Wood B. R., Heraud P., Khambatta K., Hartnell D., Hackett M. J., Tobin M. J. Synchrotron macro ATR-FTIR microspectroscopy for high-resolution chemical mapping of single cells // The Analyst, 2019, v. 144(10), pp. 3226–3238. https://doi.org/10.1039/c8an01543k Seredin P., Goloshchapov D., Ippolitov Y., Vongsvivut P. Pathology-specifi c molecular profi les of saliva in patients with multiple dental caries—potential application for predictive, preventive and personalised medical services // EPMA Journal, 2018, v. 9(2), pp. 195–203. https://doi.org/10.1007/s13167-018-0135-9 Dusevich V., Xu C., Wang Y., Walker M. P., Gorski J. P. Identifi cation of a protein-containing enamel matrix layer which bridges with the dentine–enamel junction of adult human teeth // Archives of Oral Biology, 2012, v. 57(12), pp. 1585–1594. https://doi.org/10.1016/j.archoralbio.2012.04.014 Seredin P. V., Kashkarov V. M., Lukin A. N., Goloshchapov D. L., Ippolitov Y. A. Research Hydroxyapatite Crystals and Organic Components of Hard Tooth Tissues Affected by Dental Caries Using Ftir-Microspectroscopy and Xrd-Microdiffraction // Condensed Matter and Interphases, 2013, v. 15(3), с. 224–231. URL: http://www.kcmf.vsu.ru/resources/t_15_3_2013_002.pdf Fattibene P., Carosi A., Coste V. D., Sacchetti A., Nucara A., Postorino P., Dore P. A comparative EPR, infrared and Raman study of natural and deproteinated tooth enamel and dentin // Physics in Medicine and Biology, 2005, v. 50(6), pp. 1095. https://doi.org/10.1088/0031-9155/50/6/004 Seredin P., Goloshchapov D., Kashkarov V., Ippolitov Y., Bambery K. The investigations of changes in mineral–organic and carbon–phosphate ratios in the mixed saliva by synchrotron infrared spectroscopy // Results in Physics, 2016, v. 6, pp. 315–321. https://doi.org/10.1016/j.rinp.2016.06.005 Goloshchapov D. L., Kashkarov V. M., Rumyantseva N. A., Seredin P. V., Lenshin A. S., Agapov B. L., Domashevskaya E. P. Synthesis of nanocrystalline hydroxyapatite by precipitation using hen’s eggshell // Ceramics International, 2013, v. 39(4), pp. 4539–4549. https://doi.org/10.1016/j.ceramint.2012.11.050 Goloshchapov D. L., Lenshin A. S., Savchenko D. V., Seredin P.V. Importance of defect nanocrystalline calcium hydroxyapatite characteristics for developing the dental biomimetic composites // Results in Physics, 2019, v. 13, pp. 102158. https://doi.org/10.1016/j.rinp.2019.102158 Nanci A. Ten Cate’s Oral Histology: Development, Structure, and Function. 8th ed., Elsevier Health Sciences, 2013, 400 p. Ippolitov Ju. A. Vozmozhnost’ povyshenija biologicheskoj tropnosti svetootverzhdaemoj bondingovoj sistemy dlja adgezii tverdyh tkanej zuba k plombirovochnomu material [The possibility of increasing the biological tropism of the lightcuring bonding system for adhesion of hard tooth tissues to the filling material]. Volgogradskij nauchno-medicinskij zhurnal, 2010, v. 4 (28), pp. 31–34. URL: https://www.volgmed.ru/uploads/journals/articles/1293119124-bulletin-2010-4-815.pdf Seredin P., Goloshchapov D., Prutskij T., Ippolitov Y. Phase Transformations in a Human Tooth Tissue at the Initial Stage of Caries. PLoS ONE, 2015, v. 10(4), pp. 1–11. https://doi.org/10.1371/journal.pone.0124008 Seredin P. V., Goloshchapov D. L., Prutskij T., Ippolitov Yu. A. A Simultaneous Analysis of Microregions of Carious Dentin by the Methods of Laser- Induced Fluorescence and Raman Spectromicroscopy. Optics and Spectroscopy, 2018, v. 125(5), pp. 803–809. https://doi.org/10.1134/S0030400X18110267 Seredin P. V., Goloshchapov D. L., Prutskij T., Ippolitov Yu. A. Fabrication and characterisation of composites materials similar optically and in composition to native dental tissues. Results in Physics, 2017, v. 7, pp. 1086–1094. https://doi.org/10.1016/j.rinp.2017.02.025

Abstract The relationship between exposure to famine in early life and the risk of ascending aorta dilatation (AAD) in adulthood is still unclear; therefore, we aimed to examine the association in the Chinese population. We investigated the data of 2598 adults who were born between 1952 and 1964 in Guangdong, China. All enrolled subjects were categorised into five groups: not exposed to famine, exposed during fetal period, and exposed during early, mid or late childhood. AAD was assessed by cardiac ultrasound. Multivariate logistic regression and interaction tests were performed to estimate the OR and CI on the association between famine exposure and AAD. There were 2598 (943 male, mean age 58·3 ± 3·68 years) participants were enrolled, and 270 (10·4 %) subjects with AAD. We found that famine exposure (OR = 2·266, 95 % CI 1·477, 3·477, P = 0·013) was associated with elevated AAD after adjusting for multiple confounders. In addition, compared with the non-exposed group, the adjusted OR for famine exposure during fetal period, early, mid or late childhood were 1·374 (95 % CI 0·794, 2·364, P = 0·251), 1·976 (95 % CI 1·243, 3·181, P = 0·004), 1·929 (95 % CI 1·237, 3·058, P = 0·004) and 2·227 (95 % CI 1·433, 3·524, P < 0·001), respectively. Subgroup analysis showed that the effect of famine exposure on the association with AAD was more pronounced in female, current smokers, people with BMI ≥ 24 kg/m2 and hypertensive patients. We observed that exposure to famine during early life was linked to AAD in adulthood.

Abstract Introduction The tobacco-specific nitrosamines (TSNAs) are an important group of carcinogens found in tobacco and tobacco smoke. To describe and characterize the levels of TSNAs in the Population Assessment of Tobacco and Health (PATH) Study Wave 1 (2013–2014), we present four biomarkers of TSNA exposure: N′-nitrosonornicotine, N′-nitrosoanabasine, N′-nitrosoanatabine, and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL) which is the primary urinary metabolite of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone. Methods We measured total TSNAs in 11 522 adults who provided urine using automated solid-phase extraction coupled to isotope dilution liquid chromatography–tandem mass spectrometry. After exclusions in this current analysis, we selected 11 004 NNAL results, 10 753 N′-nitrosonornicotine results, 10 919 N′-nitrosoanatabine results, and 10 996 N′-nitrosoanabasine results for data analysis. Geometric means and correlations were calculated using SAS and SUDAAN. Results TSNA concentrations were associated with choice of tobacco product and frequency of use. Among established, every day, exclusive tobacco product users, the geometric mean urinary NNAL concentration was highest for smokeless tobacco users (993.3; 95% confidence interval [CI: 839.2, 1147.3] ng/g creatinine), followed by all types of combustible tobacco product users (285.4; 95% CI: [267.9, 303.0] ng/g creatinine), poly tobacco users (278.6; 95% CI: [254.9, 302.2] ng/g creatinine), and e-cigarette product users (6.3; 95% CI: [4.7, 7.9] ng/g creatinine). TSNA concentrations were higher in every day users than in intermittent users for all the tobacco product groups. Among single product users, exposure to TSNAs differed by sex, age, race/ethnicity, and education. Urinary TSNAs and nicotine metabolite biomarkers were also highly correlated. Conclusions We have provided PATH Study estimates of TSNA exposure among US adult users of a variety of tobacco products. These data can inform future tobacco product and human exposure evaluations and related regulatory activities.

Over-activation of the renin-angiotensin system (RAS) at the paraventricular nucleus of the hypothalamus (PVN) enhances the central immune response contributing to the development and maintenance of neurogenic hypertension. Astrocytes contribute to the production and secretion of pro-inflammatory cytokines (PICs) and are a vital component of the innate immune response in the brain. The contribution of astrocyte activation during hypertension has not been investigated and the actions of prorenin (PRO) on this cell type are undefined. Astrocytes cultured from the hypothalamus of normotensive rats (Sprague Dawley; SD) or spontaneously hypertensive rats (SHR; a model of neurogenic hypertension), contain (pro)renin receptor mRNA. When compared with non-treated cells (SD: 1.0 ± 0.04; SHR: 1.0 ± 0.05), treatment of SD cultures with PRO (60 nM; 3 h) increased the mRNA levels (normalized to GAPDH) of the PICs interleukin-6 (IL-6; 2.5 ± 0.3), interleukin-1β (IL-1β; 46.7 ± 12.1) and tumor necrosis factor-α (TNF-α; 13.8 ± 2.9) (n=6; p<0.05). In SHR cells, the PIC levels after PRO treatment were 5.0 ± 0.9 (IL-6), 133.6 ± 34.9 (IL-1β) and 59.9 ± 30.8 (TNF-α) (n=5). PIC production by PRO was significantly (p < 0.05) enhanced in SHR cultures. Treatment of astrocytes with angiotensin II (Ang II; 100 nM) or angiotensin III (Ang III; 100 nM & 1 μM) failed to increase PIC mRNA levels. PRO treatment also increased the levels of lipocalin-2 (LCN-2; p < 0.05), an early marker of astrogliosis, in astrocytes from both strains and this effect was enhanced in SHR cells (3.1 ± 0.6 vs. 6.7 ± 2.4). Evidence of astrogliosis (p < 0.05) was apparent in the PVN of adult SHR brain at different stages of hypertension development (9, 12 and 16 weeks of age; 10.6 ± 0.5, 9.9 ± 0.7 and 8.9 ± 0.7 [astroglial fractional area in PVN; AfaPVN], n=4 per age group), based on glial fibrillary acidic protein (GFAP) immunostaining and quantification using Image J. Age-matched SD or Wistar Kyoto rats exhibited lower GFAP-positive staining in the PVN (6.2 ± 0.6; 4.7 ± 1.3; 5.2 ± 1.2, AfaPVN, n=4 per age group). Our findings indicate that PRO, not Ang II or III, activates hypothalamic astrocytes inducing a pro-inflammatory response, possibly contributing to the astrogliosis observed in the PVN of adult SHR.

Abstract Study question Can the use of Theophylline recover motility of frozen surgically retrieved sperms in case of absence of motility after thawing? Summary answer Theophylline allows to recover motility of thawed surgically retrieved sperms. The utilization of sperms with or without pharmacological activation gives comparable clinical outcomes. What is known already Testicular sperm motility is usually poor. A method is needed to detect viable sperm for ICSI when motility is totally absent after freezing/thawing. Hypo-osmotic swelling test, mechanical touch technique, laser-assisted immotile sperm selection, birefringence-polarization microscopy and exposure to pharmacological stimulation are techniques used for this purpose. Among pharmacological agents Dimethylxanthine Theophylline is a phosphodiesterase inibitor that improves sperm motility by promoting an increase in intracellular cyclic AMP levels. Few studies report that it is efficient for recovery of sperm motility in cases of thawed testicular and retrograde ejaculation samples improving reproductive outcomes. Study design, size, duration Retrospective analysis of sixty frozen surgical sperm cycles (45 patients) utilized from February 2018 to November 2020. After thawing, samples were divided in two Groups according to motility recovery. Group A: presence of motility, Group B: absence of motility. Group B was treated with Theophilline and motility was re-assessed after incubation. Activated sperms were utilized for ICSI when available. Sperm motility recovery, fertilization, pregnancy rate/transfer, implantation and miscarriage rate were evaluated in both Groups. Participants/materials, setting, methods Surgical specimens were treated and concentrated in SpermRinse™ Medium (Vitrolife) and then cryopreservated in nitrogen vapor in TEST Yolk Buffer (Irvine Scientific). After thawing, only samples with no motility recovery were treated with a brief incubation in Theophylline (GM501 SpermMobil, Gynemed) and washed in Polyvinylpyrrolidone (ICSITM Vitrolife) before injection. ICSI was performed in all cases approximately 4–5 hours after sperm thawing. After fertilization check, transfer was scheduled in day 2. Main results and the role of chance Women’s age Group A (34,39±2,29 M±SD) and group B (35,87±4,34 M±SD) and men’s age Group A (37,31±5,12 M±SD) and group B (40,89±8.15 M±SD) were not significantly different (P= .328 and P=.218) respectively. Group A: 13/60 cycles (21.7%) (9 patients). Pre freezing and post thawing total motility percentage were 34.0±19.0 (M±SD) and 13.5±15.6 (M±SD) respectively (39.8% recovery). Group B: 47/60 cycles (78.3%) (36 patients). Pre freezing total motility percentage was 5.3±8.5 (M±SD) and no motility was recovered post thawing (0%). After treatment with Theophylline total motility was 1.8±1.8 (M±SD) (33.5% recovery). Motile sperms were utilized in all cases except from two in the Group B. Number of injected oocytes was 2.8±1.1 (M±SD) in Group A and 4.3±3.1 (M±SD) in Group B (P=.004) respectively. Fertilisation rate (63.1% and 45.4%, P=.066), Number of embryos transferred (1.8±0.7 M±SD and 1.6±0.7 M±SD, P=.271), Pregnancy rate/Transfer (54.5% and 37.1%, P=.502), Implantation rate (30.0% and 27.8%, P=.919) and Miscarriage rate (33.3% and 30.7%, P=.675) were not statistically significant between Group A and B respectively. In the two cases of group B injected with immotile sperm, fertilization rate was 0% (0/3) and 50% (2/4). Limitations, reasons for caution A larger study is needed to investigate the recovery of sperms motility (and/or their activation) and clinical outcomes, in particular referring to the origin of sampling (epididymal aspirate and testicular tissue) and type of azoospermia (obstructive and non-obstructive). Wider implications of the findings: Theophylline is an effective tool for sperm motility recovery after thawing allowing to inject viable sperm and facilitating laboratory handling. Trial registration number Not applicable

Abstract Funding Acknowledgements no funding sources exists OnBehalf RIGHT Heart International NETwork (RIGHT-NET) Purpose Exercise stress echocardiography (ESE) is a well-validated tool in ischemic and valvular heart diseases. The aim of this study is to assess the ESE feasibility for the evaluation of the right heart pulmonary circulation unit (RH-PCU) in a large cohort of subjects, from healthy individuals and elite athletes to patients with overt or at risk of developing pulmonary hypertension. Methods: 954 subjects [mean age 54.2 ± 16.4 years, 430 women] [254 healthy volunteers, 40 elite athletes, 363 patients with cardiovascular risk factors, 25 with pulmonary arterial hypertension, 149 with connective tissue diseases, 81 with left heart and valvular diseases, 42 with lung diseases], underwent standardized semi-recumbent cycle ergometer ESE with an incremental workload of 25 watts every 2 minutes up to symptom-limited maximal tolerated workload. ESE parameters of right heart structure, function and pressures were obtained according current recommendations. Results: The success rate for the evaluation of the RV function at peak exercise was 903/940 (96%) for tricuspid annular plane systolic excursion (TAPSE), 667/751 (89%) for tissue Doppler–derived tricuspid lateral annular systolic velocity (S’) and 425/772 (63%) for right ventricular fractional area change (RVFAC). Right ventricular–right atrial pressure gradient [RV-RA gradient = 4 x tricuspid regurgitation velocity2] was obtained in 894/954 patients (93.7 %) at rest and in 816/954 (85.5%) at peak exercise. At peak exercise, pulmonary acceleration time (AcT) was feasible among 435/545 (82.5%) patients (Table 1). Conclusions: In daily ESE monitoring of TAPSE and S’ resulted to be less challenging than of RV FAC. ESE was a feasible tool for the evaluation of RV-RA gradient and pulmonary AcT. Table 1 Parameters Rest mean ± SD Peak mean ± SD P value Assessed n (%) Feasibility at rest n (%) Feasibility at peak n (%) RVED area (cm2) 17.4 ± 5.7 17.4 ± 5.8 0.9 672 632 (94.0) 425 (63.2) RVES area (cm2) 9.7 ± 4.3 9.6 ± 4.9 0.7 672 632 (94.0) 425 (63.2) TAPSE (mm) 22.9 ± 3.9 27.4 ± 5.5 &lt;0.001 940 922 (98.1) 903 (96.0) S’(cm/s) 13.1 ± 2.9 18.5 ± 5.0 &lt;0.001 751 746 (99.4) 667 (88.8) RVFAC (%) 45.7 ± 10 46.7 ± 11 0.121 672 632 (94.0) 425 (63.2) RV-RA gradient (mmHg) 24.3 ± 15 42.5 ± 20 &lt;0.001 954 894 (93.7) 816 (85.5) Pulmonary AcT (m/s) 129 ± 31 116 ± 35 &lt;0.001 545 527( 96.7) 435 (82.5) RVED, right ventricle end diastolic area; RVES, right ventricle end systolic area; p values indicate differences at rest and peak exercise. The term “assessed” indicates that an attempt was done in order to measure the parameter. The term “feasibility” indicates that it was possible to measure the parameter that was assessed.

Background: Circulating endothelial progenitor cells (EPCs) are reduced in hypertension that correlates inversely with its mortality, but the mechanisms are poorly understood. DOCA-salt and ET B receptor deficiency rats (ET B −/ −) have salt-sensitive hypertension, characterized by increased ET-1 and oxidative stress levels. We hypothesized that ET A receptor activation and ET B receptor deficiency reduce circulating EPCs in adult male DOCA-salt rats. Methods and Results: Systolic blood pressure (SBP) was higher in DOCA-salt (4-wk regimen) vs. Sham rats (199.3 ± 4.8 vs. 133.4 ± 4.6 mmHg, n =8 –15, p<.05), which was significantly reduced by in vivo treatment with ET A antagonist ABT-627 (5 mg/kg/d) or NADPH oxidase inhibitor apocynin (1.5 mmol/L) (167.8 ± 6.8 and 156.9 ± 16.6 mmHg, respectively). Flow cytometry showed that circulating CD34- and Flk-1-positive EPCs were significantly lower in DOCA vs. Sham rats (31.5 ± 0.2 vs. 18.3 ± 0.8% and 21.1 ± 0.9 vs. 16.3 ± 0.7%, respectively, n=7– 8, p<.05). Dil-acLDL and isolectin double-stainings also showed reduced EPCs in DOCA vs. Sham rats (4.5 ± 0.4 vs. 10.2 ± 0.3 cells/hpf, n=5–15, p<.01), which was rescued by in vivo treatment with ABT-627 (10.1 ± 1.7) or apocynin (8.9 ± 0.8). Real-time RT-PCR and fluorescence confocal microscopy showed that ET A and ET B receptor mRNA and proteins were present in EPCs of SD rats. Intracellular ROS level was increased by >50% in EPCs of DOCA vs. Sham rats (DCF fluorescence, n = 9 –11, p<.05). Apoptosis was increased by >80% in EPCs of DOCA vs. Sham rats, which was reversed by ABT-627 or apocynin (TUNEL assay, n=5– 6, p<.05). EPCs were significantly lower in ET B −/ − vs. ET B +/+ rats (6.3 ± 0.6 cells/hpf, n =7– 8), paralleled with higher SBP (telemetry 151 ± 1.2 vs. 129 ± 0.9 mmHg, n = 6), plasma ET-1 level (5.2 ± 0.3 vs. 3.6 ± 0.1 pg/ml, n = 5–12), and suppressed telomerase activity (354.6 ± 105.5 vs. 83.3 ± 26.2%, n = 3) (all p<.05). ET-1 treatment (10 nM, 48 hrs) also reduced EPCs of normal rats (6.9 ± 0.1 vs. 10.3 ± 0.3 cells/hpf, n = 5– 6, p<.05), which was rescued by ABT-627 (9.9 ± 0.3), but not by ET B antagonist BQ788 (7.6 ± 0.4). Conclusion: ET A activation and ET B deficiency reduce circulating EPCs in DOCA-salt and ET B −/ − rats, in part, due to NADPH oxidase-induced oxidative stress, apoptosis, and telomerase inactivation.