To see the other types of publications on this topic, follow the link: AC-ELISA.
Journal articles on the topic 'AC-ELISA'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'AC-ELISA.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Lee, Rachel C., Ru-Dong Wei, and Fun S. Chu. "Enzyme-Linked Immunosorbent Assay for T-2 Toxin Metabolites in Urine." Journal of AOAC INTERNATIONAL 72, no. 2 (1989): 345–48. http://dx.doi.org/10.1093/jaoac/72.2.345.
Full textAbstract:
Abstract A direct competitive enzyme-linked immunosorbent assay (ELISA) for determination of total T-2 toxin metabolites in urine was developed. The assay involves coating anti-3-acetyl-neosolaniol-hemisuccinate- bovine serum albumin conjugate (anti-3-Ac-NEOS-HS-BSA) antibody to the ELISA plate and using 3-Ac-NEOS-HS-peroxidase as the enzyme marker. Competitive ELISA revealed that the antibody had good cross-reactivity with acetyldiacetoxyscirpenol (Ac-DAS), T-2 tetraol tetraacetate, 3'-OH-Ac-T-2, 3-Ac-NEOS, and 3,4,15- triacetyl-12,13-epoxytrichothec-9-en-8-one (Ac-T-2-8-one), but less cross-reactivity with Ac-T-2 toxin and T-2 toxin. All metabolites of T-2 toxin in urine were converted to T-2 tetraol tetraacetate (T-2- 4ol-4Ac) by acetylation of the sample extract before ELISA. To test the ELISA accuracy, a radioimmunoassay (RIA) was performed simultaneously. The linear portion of the standard curve of this direct ELISA for T-2-4ol-4Ac was 0.2-2.0 ng/mL, which was 10 times more sensitive than RIA. The minimum detection level for T-2-4ol- 4Ac was 0.02 ng/mL (0.4 pg/assay) in the absence of urine sample. The overall analytical recoveries for T-2 toxin, HT-2, T-2-4ol, 3'- OH-HT-2, NEOS, and a mixture of these 5 toxins added to the urine samples in the ELISA at concentrations of 0.05 and 0.2 ng/mL were 87 and 94%, respectively.
2
Van Loon, A. M., J. T. M. van der Logt, F. W. A. Heessen, M. C. A. Heeren, and J. Zoll. "Antibody-capture enzyme-linked immunosorbent assays that use enzyme-labelled antigen for detection of virus-specific immunoglobulin M, A and G in patients with varicella or herpes zoster." Epidemiology and Infection 108, no. 1 (1992): 165–74. http://dx.doi.org/10.1017/s095026880004961x.
Full textAbstract:
Antibody-capture enzyme-linked immunosorbent assays (AC-ELISA) which use enzyme-labelled antigen were developed for detection of varicella-zoster virus-(VZV) specific IgM, IgA and IgG antibody in patients with varicella or herpes zoster and in sera from healthy individuals. All 18 patients with varicella developed a VZV-IgM and a VZV-IgG response, 17 also a VZV-IgA response. In contrast, all 19 patients with herpes zoster were shown to be positive for VZV-IgA whereas only 13 of these reacted positively for VZV-IgM. A VZV-IgM response was detected in only two sera from 100 healthy individuals and an IgA response in only one. The presence of virus-specific IgA and IgG in the cerebrospinal fluid as determined by AC-ELISA was a useful indicator of VZV infection of the central nervous system.By AC-ELISA, VZV-IgG was detected predominantly in sera from patients with acute or recent VZV infection. Only 14 sera from 100 healthy individuals were positive for VZV-IgG by AC-ELISA, whereas all were positive by an indirect ELISA. These results indicate that AC-ELISA's may be useful assays for determination for acute or recurrent VZV infection, but are not suitable for determination of past infection with this virus.
3
He, Qigai, Sumathy Velumani, Qingyun Du, et al. "Detection of H5 Avian Influenza Viruses by Antigen-Capture Enzyme-Linked Immunosorbent Assay Using H5-Specific Monoclonal Antibody." Clinical and Vaccine Immunology 14, no. 5 (2007): 617–23. http://dx.doi.org/10.1128/cvi.00444-06.
Full textAbstract:
ABSTRACT The unprecedented spread of highly pathogenic avian influenza virus subtype H5N1 in Asia and Europe is threatening animals and public health systems. Effective diagnosis and control management are needed to control the disease. To this end, we developed a panel of monoclonal antibodies (MAbs) against the H5N1 avian influenza virus (AIV) and implemented an antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) to detect the H5 viral antigen. Mice immunized with denatured hemagglutinin (HA) from A/goose/Guangdong/97 (H5N1) expressed in bacteria or immunized with concentrated H5N2 virus yielded a panel of hybridomas secreting MAbs specific for influenza virus HA. The reactivity of each MAb with several subtypes of influenza virus revealed that hybridomas 3D4 and 8B6 specifically recognized H5 HA. Therefore, purified antibodies from hybridomas 3D4 and 8B6, which secrete immunoglobulin G (IgG) and IgM, respectively, were used as the capture antibodies and pooled hyperimmune guinea pig serum IgG served as the detector antibody. The specificity of the optimized AC-ELISA was evaluated by using AIV subtypes H5 H3, H4, H7, H9, and H10. Specimens containing AIV subtype H5 subtype yielded a specific and strong signal above the background, whereas specimens containing all other subtypes yielded background signals. The detection limits of the AC-ELISA were 62.5 ng of bacterium-expressed H5N1 HA1 protein and 124, 62, and 31 50% tissue culture infective doses of influenza virus subtypes H5N1/PR8, H5N2, and H5N3, respectively. Reconstituted clinical samples consisting of H5 AIVs mixed with pharyngeal-tracheal mucus from healthy chickens also yielded positive signals in the AC-ELISA, and the results were confirmed by reverse transcription-PCR. The tracheal swab samples from H9N2-infected chickens did not give positive signals. Taken together, the newly developed MAb-based AC-ELISA offers an attractive alternative to other diagnostic approaches for the specific detection of H5 AIV.
4
XU, Yi-Chun, Guang S. Zhang, and Fun S. Chu. "Enzyme-Linked Immunosorbent Assay for Deoxynivalenol in Corn and Wheat." Journal of AOAC INTERNATIONAL 71, no. 5 (1988): 945–49. http://dx.doi.org/10.1093/jaoac/71.5.945.
Full textAbstract:
Abstract The availability of antibody against deoxynivalenol (DON) triacetate (Tri-Ac-DON) has enabled development of a direct enzyme-linked immunosorbent assay (ELISA) and an indirect ELISA for DON in corn and wheat. In both assays, DON is extracted from the sample with acetonitrile- water, reacted with acetic anhydride to form Tri- Ac-DON, and diluted in phosphate buffer for analysis. Direct ELISA was found to be the more sensitive procedure. Fewer interferences are evidenced, and the assay is less time consuming than is indirect ELISA. For direct ELISA, recovery of 10-1000 ppb DON added to corn and wheat was 100% (SD 15, CV 15%) and 102.1% (SD 12.2, CV 11.9%), respectively. For indirect ELISA, overall recovery of 10- 1000 ppb DON added to wheat was 121.5% (SD 39.5, CV 32.5%); in the higher concentration range (500-1000 ppb), recovery was 105% (SD 18, CV 17%). The minimal detection level for DON was around 10 ppb. Analysis of 7 naturally contaminated samples for DON showed that the ELISA results agreed well with those obtained by radioimmunoassay and thin-layer chromatography.
5
Zanoni, T. B., I. Z. Carlos, J. O. Tognolli, H. Yamanaka, and A. A. P. Ferreira. "Otimização de ELISA empregando a proteína Tc85-11 e planejamento fatorial." Eclética Química 31, no. 1 (2006): 63–71. http://dx.doi.org/10.1590/s0100-46702006000100008.
Full textAbstract:
A doença de Chagas é causada pelo Trypanosoma cruzi (T. cruzi) e a detecção de anticorpos anti-T. cruzi no soro é um método para diagnosticar a doença. Neste trabalho, ELISA indireto foi otimizado para a detecção de anticorpos no soro de pacientes com doença de Chagas empregando a proteína Tc85-11 (Ag) da superfície do parasita tripomastigota. Na otimização das condições experimentais foi aplicado planejamento fatorial completo para os parâmetros tempo de incubação, diluições do Ag (0,08 mg mL-1), anticorpo primário (Ac) e anti-IgG conjugada com a peroxidase (Ac*). Os melhores resultados foram obtidos nas seguintes condições: 0,14 mg Ag/poço, 60 min para o tempo de incubação, diluições de 1:35 e 1:1000 para Ac e Ac*, respectivamente. O valor do limiar de reatividade ("cut off") foi A450nm = 0,371. O ELISA indireto foi aplicado em amostras de soros de pacientes infectados com doença de Chagas e pacientes com diferentes doenças sistêmicas. A proteína Tc85-11, a qual está envolvida com a adesão do parasita na célula hospedeira, é também apropriada para o diagnóstico sorológico da doença de Chagas.
6
Katawa, Gnatoulma, Christèle Nguepou Tchopba, Marthe Oukoé Amessoudji, et al. "Blood Safety: On-Site Verification Of The Screening Of HIV, HBV And HCV By Enzyme Linked Immuno-Sorbent Assay (ELISA) Kits From Bio-Rad Laboratories At The “Centre National De Transfusion Sanguine” (CNTS) Of Lomé In Togo." European Scientific Journal, ESJ 17, no. 21 (2021): 92. http://dx.doi.org/10.19044/esj.2021.v17n21p92.
Full textAbstract:
Background: Blood transfusion improves health and saves lives. Safe blood must be ensured for our populations. Quality assurance is a process that includes a set of coordinated activities in order to achieve the quality objective. Compliance with the quality management rules of medical biology laboratories requires verification of methods prior to their use. This study aimed to verify the on-site verification of the performance of the Enzyme Linked Immuno-Sorbent Assay (ELISA) method performed at the serology laboratory of the CNTS of Lomé. Methods: The performance of ELISA method performed at the serology laboratory of CNTS for the diagnosis of HIV, Hepatitis B and C with Bio-Rad Genscreen ULTRA-HIV Ag-Ac, Bio-Rad Monolisa-HBs Ag ULTRA and Bio-Rad Monolisa HCV Ag-Ac ULTRA V2 kits respectively was evaluated on repeatability, reproducibility, sensitivity and specificity according to COFRAC's SH GTA 04 reference. Results: The evaluation of the repeatability and reproducibility of each kit used in the laboratory resulted in compliant Coefficients of Variation (CV) with manufacturers’ ones. Sensitivities obtained with Bio-Rad Monolisa HCV Ag-Ac ULTRA V2, Bio-Rad Monolisa HBs Ag ULTRA and Bio-Rad Genscreen ULTRA HIV Ag-Ac kits were 94.59%, 98.08% and 100% respectively. For specificity tests, we found 86.49% with BIO-Rad Genscreen ULTRA-HIV Ag-Ac kit, 94.34% with Bio-Rad Monolisa HCV Ag-Ac ULTRA V2 kit and 97.37% with Bio-Rad Monolisa-HBs Ag ULTRA. Conclusion: In general, results were compliant except HIV diagnosis specificity. This study appears as a contribution to the establishment of a verification file for ELISA method used at the serology laboratory of CNTS of Lomé.
7
Ho, Hui-Ting, Hong-Liang Qian, Fang He, et al. "Rapid Detection of H5N1 Subtype Influenza Viruses by Antigen Capture Enzyme-Linked Immunosorbent Assay Using H5- and N1-Specific Monoclonal Antibodies." Clinical and Vaccine Immunology 16, no. 5 (2009): 726–32. http://dx.doi.org/10.1128/cvi.00465-08.
Full textAbstract:
ABSTRACT Highly pathogenic avian influenza (HPAI) virus of the H5N1 subtype has caused devastating damage to poultry flocks and sporadic human H5N1 infections. There is concern that this virus subtype may gain transmissibility and become pandemic. Rapid diagnosis and surveillance for H5N1 subtype viruses are critical for the control of H5N1 infection. In this study, we report a robust antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) based on H5- and N1-specific monoclonal antibodies (MAbs) for the rapid detection of H5N1 subtype viruses. The H5 hemagglutinin (HA)-specific MAb (2D9) targets a conformational epitope which recognized multiple clades of H5N1 viruses, including clades 0, 1, 2.1, 2.2, 2.3, 4, 7, and 8. The N1 neuraminidase (NA)-specific MAb (8H12) recognized a linear epitope comprising the sequence AELPF. This epitope was 99% conserved in the NA of 708 analyzed H5N1 viruses, while the epitope was absent in NAs of subtypes N2 through N9. The specificity of the AC-ELISA was examined by using 41 H5N1 HPAI strains from multiple clades, 36 non-H5N1 viruses, and 4 influenza B viruses. No cross-reactivity was observed for any of the non-H5N1 viruses tested. The estimated detection limit was 1 to 2 HA titers. It is concluded that this H5N1 AC-ELISA can simultaneously detect H5 and N1 subtype antigens, eliminating the need for secondary testing for the NA subtype. Implementation of this assay in ELISA-like formats suitable for field use, such as dot ELISA, immunofiltration, or electrochemical biosensor technologies, would provide dual on-site detection of H5 and N1 in clinical or environmental specimens.
8
Park, Joung J., and Fun S. Chu. "Assessment of Immunochemical Methods for the Analysis of Trichothecene Mycotoxins in Naturally Occurring Moldy Corn." Journal of AOAC INTERNATIONAL 79, no. 2 (1996): 465–71. http://dx.doi.org/10.1093/jaoac/79.2.465.
Full textAbstract:
Abstract The efficacy of various immunochemical methods for simultaneous analysis of different trichothe-cene mycotoxins in corn samples naturally contaminated with various Fusarium molds was evaluated. Antibodies against either T-2 tetraol tetraacetate (T-2-4ol-4Ac) or deoxynivalenol triacetate (Tri-Ac-DON) were used in the enzyme- linked immunosorbent assay (ELISA) and radioimmunoassay (RIA) for total type A and total DON-related trichothecenes (TCTCs), respectively. Specific antibodies against T-2 toxin were used in an RIA for analysis of T-2 toxin alone. Analytical recoveries of T-2 toxin analyzed as T-2-4ol-4Ac by ELISA and T-2 toxin by RIA at 10-200 ppb were 83.5-123% and 81.8-110.6%, respectively. T-2 toxin accounts for about 30% of total type A TCTCs by both liquid chromatography (LC)-ELISA and RIA methods. The correlation coefficients (r) of total type A TCTC levels versus T-2 toxin level by RIA was 0.725 (p < 0.0001). A good correlation (r = 0.84 and p = 0.04) also was found for T-2 toxin levels obtained by LC-ELISA and RIA methods. In addition to T-2 toxin, HT-2 toxin, diacetoxyscirpenol, and T-2 tetrol were found in samples containing high levels of type A TCTCs by LC-ELISA. For analysis of DON alone, samples were treated with a Sep-Pak C18 cartridge to remove other acetylated DONs before RIA. Recovery of DON after the C18 cartridge treatment was 90%. Overall analytical recoveries of DON as Tri-Ac-DON (sample with no C18 treatment) and DON alone (with C18 treatment) at 10-500 ppb were 81.3-94% and 72.7-104%, respectively. RIA revealed that DON accounts for about 50% of total DON-related TCTCs. The coefficient of correlation between total DON-related TCTCs and DON levels was 0.84 (p < 0.0001).
9
Sawicka-Powierza, Jolanta, Ewa Jablonska, Wioletta Ratajczak-Wrona, et al. "Bone Metabolism Markers and Bone Mineral Density in Patients on Long-Term Acenocoumarol Treatment: A Cross-Sectional Study." Journal of Clinical Medicine 7, no. 10 (2018): 372. http://dx.doi.org/10.3390/jcm7100372.
Full textAbstract:
The aim of this study was to evaluate levels of osteocalcin (OC), osteoprotegerin (OPG) and total soluble receptor activator of nuclear factor-κB ligand (RANKL), and bone mineral density (BMD) in patients on long-term acenocoumarol (AC) treatment. The cross-sectional study was carried out in 42 patients treated long-term with AC and 28 control subjects. Serum concentrations of OC, OPG, and sRANKL were measured using enzyme linked immunosorbent assay (ELISA) kits, and BMD at the femoral neck and lumbar spine were assessed by dual energy X-ray absorptiometry. A significantly decreased concentration of OC was found in AC users compared to control subjects (4.94 ± 2.22 vs. 10.68 ± 4.5; p < 0.001). Levels of OPG, sRANKL logarithm (log), sRANKL/OPG log ratio, and BMD were comparable between. In female AC users, positive correlations between OC and RANKL log, and between OC and RANKL/OPG log ratio (p = 0.017; p = 0.005, respectively), and a negative correlation between OC and OPG (p = 0.027) were found. Long-term AC anticoagulation significantly decreases OC concentration, but does not affect other bone metabolism markers or BMD. Our results also suggest the possibility that long-term treatment with AC may alleviate bone resorption in postmenopausal women.
10
Prado, Mônica Simon, Alessandra Dellavance, Silvia Helena Rodrigues, Valdecir Marvulle, and Luis Eduardo Coelho Andrade. "Changes in the result of antinuclear antibody immunofluorescence assay on HEp-2 cells reflect disease activity status in systemic lupus erythematosus." Clinical Chemistry and Laboratory Medicine (CCLM) 58, no. 8 (2020): 1271–81. http://dx.doi.org/10.1515/cclm-2019-0638.
Full textAbstract:
AbstractBackgroundThe objective of the study was to determine whether the staining pattern and titer of indirect immunofluorescence assay on HEp-2 cells (HEp-2 IFA) are associated with systemic lupus erythematosus (SLE) disease activity.MethodsA total of 269 consecutive patients meeting the ACR and SLICC criteria for SLE were classified into three groups according to the SLE Disease Activity Index 2000 (SLEDAI2K): Remission (SLEDAI2K = 0; n = 47); Intermediate (SLEDAI2K = 1-5; n = 111); Active (SLEDAI2K ≥ 6; n = 111). All subjects were assessed for HEp-2 IFA titer and staining pattern and nine traditional parameters of SLE disease activity. After a 6 to 12-month interval, 101 of the 269 patients were reassessed.ResultsHEp-2 IFA homogeneous nuclear pattern (AC-1) occurred more frequently in the Active Group compared to the Remission Group (p < 0.001). Fine speckled nuclear pattern (AC-4) tended to occur more frequently in the Remission Group compared to the Active Group (p = 0.054). Subjects with AC-1 pattern had higher SLEDAI (8.8 ± 7.6) than those with AC-4 (4.8 ± 5.2) (p < 0.001). HEp-2 IFA titer and anti-nuclear antibody by enzyme-linked immunosorbent assay (ANA-ELISA) values were lower in the Remission Group compared to the other two groups (p < 0.001). Multivariate analyses identified only ELISA anti-dsDNA as an independent variable associated with disease activity. In follow-up analysis, HEp-2 IFA titer decreased significantly in the 33 subjects with decreased disease activity (p = 0.002). Receiver operator characteristic (ROC) curve analysis for determination of disease activity showed equivalent areas under the curve (AUC) for HEp-2 IFA titer and traditional disease activity parameters.ConclusionsHEp-2 IFA pattern and titer can reflect SLE disease activity and may be considered in conjunction with other laboratory and clinical parameters in the assessment of SLE disease activity.
11
Morioka, Chie, Masahito Uemura, Tomomi Matsuyama, et al. "Decreased Activity of Plasma ADAMTS13 Parallels Enhanced Endotoxemia in Patients with Severe Acute Pancreatitis: Relationship to Multiorgan Failure." Blood 112, no. 11 (2008): 4541. http://dx.doi.org/10.1182/blood.v112.11.4541.4541.
Full textAbstract:
Abstract Background: Severe acute pancreatitis (SAP) frequently progresses to pancreatitis-associated multiorgan failure (MOF) with high mortality. Decreased plasma ADAMTS13 activity (ADAMTS13:AC) results in the accumulation of unusually large von Willebrand factor multimers (UL-VWFM) and the formation of platelet thrombi, ultimately leading to MOF. We demonstrated that the imbalance between decreased ADAMTS13:AC and increased UL-VWFM could contribute to SAP pathogenesis through enhanced thrombogenesis, and serve as an early prognostic indicator for SAP patients (Scand J Gastroenterol, 2008, 26:1). Endotoxin has been considered to be the principle activator of the systemic inflammatory response syndrome, which predisposes patients for MOF and/or pancreatic necrosis, ultimately leading to SAP. We investigated the relationship of endotoxin to ADAMTS13:AC and its related parameters, and tried to explore their potential role on the development of MOF in patients with SAP. Methods: We sequentially determined plasma endotoxin concentration, ADAMTS13:AC and its related parameters in 13 SAP patients (APACHE-II score mean 6.6 ± 2.7), who were admitted into intensive care unit of our hospital between 2004 and 2006. Eleven patients were survivors and two were non-survivors whose APACHE II scores were 10 and 12 died of MOF, respectively. The degree of MOF was evaluated according to the SOFA score. Endotoxin concentration was determined by a chromogenic substrate assay (Toxicolor LS –M Set, Seikagaku Kogyo Co.) with kinetic analysis after pretreatment with detergent, Triton X-100, and heating at 70 °C for 10 min. Plasma ADAMTS13:AC was determined by a sensitive chromogenic ELISA (ADAMTS13-act-ELISA: Kainos Inc.). Plasma UL-VWFM was analyzed by a vertical SDS-1.0% agarose gel electrophoresis. Plasma VWF antigen (VWF:AG), interleukin 6 (IL-6), interleukin 8 (IL-8), and tumor necrosis factor -α (TNF-α) were measured by ELISA. Results: In normal healthy controls (n=20), plasma endotoxin concentration was 7.9±1.7 pg/ml (mean ± SD). The concentration in the SAP patients significantly increased at day 1 (means 65 pg/ml, p&lt;0.001) and at day 2 (88 pg/ml, p&lt;0.001) as compared to healthy controls. The values, thereafter, gradually decreased in 8 survivors (55 pg/ml at day 5, 53 pg/ml at day 7, 27 pg/ml at day 14), while in remaining 3 survivors needing necrosectomy, the concentration further increased (98 pg/ml at day 5, 178 pg/ml at day 7), and decreased to 20 pg/ml at day 14 at the recovery phase. In two non-survivors, the endotoxin levels increased from 37 pg/ml at day 1 to 462 pg/ml at day 2 in one needing necrosectomy, and showed 51 pg/ml at day 1 in another at the age of 91. Within 1 or 2 days after admission, the ADAMTS13:AC was lower in SAP patients (mean 29%, p&lt;0.001) than in healthy controls (99%), and gradually recovered in the 11 survivors but further decreased in the 2 non-survivors. On admission, VWF:Ag was higher (402%, p&lt;0.001) in SAP patients than controls (100%). VWF:Ag gradually decreased in the survivors, except in the 3 survivors needing a necrosectomy, but remained high in the non-survivors. UL-VWFM positive patients showed lower ADAMTS13:AC (25% vs. 42%, p&lt;0.05) and higher VWF:Ag ( 481% vs. 332%, p&lt;0.05), resulting in higher ratio of VWF:Ag to ADAMTS13:AC (25.2 vs. 9.1, p&lt;0.02), as compared to UL-VWFM negative ones. Patients with higher endotoxin concentration more than 50 pg/ml showed lower ADAMTS13:AC than those without (22% vs. 43%, p&lt;0.05). Plasma endotoxin concentration positively correlated with the ratio of VWF:Ag to ADAMTS13:AC (r=0.732, p&lt;0.005). The SOFA score correlated positively with plasma endotoxin concentration (r=0.604, p&lt;0.03), IL-8 (r=0.843, p&lt;0.001), and the ratio of VWF:Ag to ADAMTS13:AC (r=0.700, p&lt;0.01), and inversely with the ADAMTS13:AC (r= − 0.601, p&lt;0.03). Conclusion. The imbalance between decreased ADAMTS13:AC and increased UL-VWFM is closely related to enhanced endotoxemia, which may contribute to the development of SAP and subsequent MOF through enhanced thrombogenesis.
12
Xu, Xianghua, Qiang Ma, Hao Qin, Junbo Zhang, Bo Zhang та Honggang Pang. "Anhuienoside C ameliorates atherosclerosis in rats via regulation of the NFκB/eNOS/NO signaling pathway". Tropical Journal of Pharmaceutical Research 19, № 4 (2020): 721–26. http://dx.doi.org/10.4314/tjpr.v19i4.7.
Full textAbstract:
Purpose: To investigate the protective effect of anhuienoside C (AC) against high cholesterol dietinduced atherosclerosis in a rat model.
 Methods: Atherosclerosis was induced in rats by administration of high fat diet for 8 weeks, and AC (20 and 40 mg/kg) was administered orally. The effect of AC was determined by assessing serum lipid profiles and mediators of inflammation, as well as oxidative stress parameters in aortic tissue using enzyme-linked immunosorbent assay (ELISA). Western blot assay and reverse transcription polymerase chain reaction (RT-PCR) were used for the evaluation of protein expressions.
 Results: Serum levels of total cholesterol (TC), triglycerides (TGs), high density lipoprotein (HDL), low density lipoprotein (LDLP), and IL-1β, IL-18, TNF-α and NF-κB were significantly reduced in AC-treated group, relative to atherosclerotic rats (p < 0.01). Moreover, parameters of oxidative stress were attenuated in the aortic tissues of AC-treated group, when compared with atherosclerotic rats. There was significant increase in eNOS expression, and marked decrease in the expressions of MAPK and NF-kB protein in the aortic tissue homogenate of AC treated group, relative to atherosclerotic group (p <0.01). Treatment with AC attenuated the mRNA expressions of ICAM-1, VCAM-1 and MCP-1 in aortic tissue of the atherosclerotic rats.
 Conclusion: These results reveal that AC prevents atherosclerosis in rats by modulating the NFκB/eNOS/NO signaling pathway, and thus, can thus potentially be developed as anti-atherosclerotic agent.
 Keywords: Anhuienoside C, Atherosclerosis, Inflammation, Oxidative stress, Cholesterol
13
DE LOS RIOS, Raúl, Juan MIYAHIRA, Alejandro COLICHON, and Javier CIEZA. "Prevalencia de anticuerpos anti-hepatitis C en pacientes en hemodiálisis crónica." Revista Medica Herediana 8, no. 2 (2013): 67. http://dx.doi.org/10.20453/rmh.v8i2.540.
Full textAbstract:
Objetivo: Determinar la prevalencia de anticuerpos antihepatitis C (Ac HCV) en pacientes en hemodiaÅLlisis croÅLnica, su correlacioÅLn con marcadores de enfermedad hepaÅLtica y los factores de riesgo asociados a la infeccioÅLn. Material y métodos: Se realizoÅL un estudio trasversal y multiceÅLntrico. La poblacioÅLn estuvo compuesta por pacientes con insuficiencia renal croÅLnica (IRC), en programa de hemodiaÅLlisis (HD) croÅLnica intermitente, que acudieron a las sesiones de HD durante los meses de marzo y abril de 1996, en 3 centros de diaÅLlisis de Lima. Para determinar Ac HCV se utilizoÅL la prueba de ELISA de segunda generacioÅLn, asimismo se determinoÅL alanino aminotrasferasa (ALT) y fosfatasa alcalina (FA) en sangre. Resultados: La poblacioÅLn estuvo compuesta por 124 pacientes, 72(58.1%) fueron varones (41.9%), mujeres. La edad promedio fue de 54.98 Å} 14.3 anos. La prevalencia de Ac HCV fue 83.9 Å} 6.5 (IC 95%), no encontraÅLndose diferencia entre los 3 centros de diaÅLlisis. El uÅLnico factor de riesgo asociado a la presencia de Ac HCV (+) fue el tiempo de ALT y FA ni de la causa de la IRC, con la presencia de Ac HCV. Conclusión: La prevalencia de Ac HCV es alta en pacientes en hemodiaÅLlisis croÅLnica y el factor de riesgo asociado a la infeccioÅLn, es el tiempo en programa de hemodiaÅLlisis croÅLnica. (Rev Med Hered 1997; 8: 67-71).
14
Matsumoto, Masanori, Hiromichi Ishizashi, Seiji Kato, et al. "Comprehensive analysis of ADAMTS13 in patients with liver cirrhosis." Thrombosis and Haemostasis 99, no. 06 (2008): 1019–29. http://dx.doi.org/10.1160/th08-01-0006.
Full textAbstract:
SummaryDecreased plasma ADAMTS13 activity (ADAMTS13:AC) results in the accumulation of unusually large von Willebrand factor multimer (UL-VWFM) and the formation of platelet thrombi. It remains controversial whether or not plasma ADAMTS13:AC decreases in patients with liver cirrhosis (LC), and its relationship to clinical features has not been fully investigated. We measured ADAMTS13:AC and its related parameters in plasma in 33 patients with chronic hepatitis (CH) and in 109 patients with LC. ADAMTS13:AC decreased with increasing severity of liver disease (controls means 100%, CH 87%, Child A-LC 79%, Child B-LC 63%, and Child C-LC 31%), and showed severe deficiency (<3% of controls) in five end-stage LC. Activities measured by act-ELISA strongly correlated with those determined by the VWFM assay and ADAMTS13 antigen. Multivariate analysis showed Child-Pugh score and spleen volume independent factors contributing to ADAMTS13:AC. VWFM patterns were normal in 53% of cases, degraded in 31%, and unusually large in 16%. Patients with unusually large VWFM had the lowest ADAMTS13:AC as well as the highest Child-Pugh score, serum creatinine and blood ammonia levels. Plasma inhibitor against ADAMTS13 detected in 83% of patients with severe to moderate ADAMTS13:AC deficiency mostly showed marginal zone between 0.5 and 1.0 BU/ml. The IgG-type autoantibodies specific to plasma derived-ADAMTS13 was detected by Western blot in only five end-stage LC with severe ADAMTS13:AC deficiency. In conclusion, both plasma ADAMTS13 activity and antigen levels decreased with increasing severity of cirrhosis. An imbalance between the decreased ADAMTS13:AC and its increased substrate may reflect the predisposing state for platelet thrombi formation in patients with advanced LC.
15
Tu, Jian, Zhiguang Yu, and Yen-Ho Chu. "Combinatorial search for diagnostic agents: Lyme antibody H9724 as an example." Clinical Chemistry 44, no. 2 (1998): 232–38. http://dx.doi.org/10.1093/clinchem/44.2.232.
Full textAbstract:
Abstract Two peptide libraries, Ac-MXXXXXBBRM and Ac-VXXXXXBBRM, were constructed on TentaGel solid support to search for ligands that bind tightly with the H9724 Lyme antibody. By using an on-bead ELISA, approximately 120 ligands were selected as candidates for further study. Matrix-assisted laser desorption ionization mass spectrometry analysis of the candidate ligands indicated a high rate of occurrence of certain amino acids at the randomized positions. On the basis of the initial screening results, a small library was designed and iteratively synthesized. Subsequent library screenings led to the identification of four peptides, Ac-PQEEGX-NH2 (X = R, K, A, D), that showed specific affinity to the antibody. This combination of solid-phase screening and iterative synthesis is an effective strategy for rapid identification of ligands that bind tightly with disease-specific antibodies and should be applicable, at least in principle, to other ligand-receptor systems. This combinatorial library approach can also be a useful tool for the discovery of novel diagnostic agents.
16
Surikova, Ekaterina I., Elena M. Frantsiyants, Irina A. Goroshinskaya та ін. "Prooxidant effect of α-tocopherol in pancreatic tumors." Journal of Clinical Oncology 38, № 15_suppl (2020): e16698-e16698. http://dx.doi.org/10.1200/jco.2020.38.15_suppl.e16698.
Full textAbstract:
e16698 Background: The coexistence of neuroendocrine tumors and pancreatic adenocarcinoma is rare, and treatment of such mixed tumors is challenging due to the differences in their natural course and response to systemic therapy. There is growing evidence that vitamins affect the biology of pancreatic tumors. The purpose of the study was to measure concentrations of retinol (RET), α-tocopherol (α-TCP) and diene conjugates (DC) in the blood of patients with pancreatic cancer in order to reveal its pathogenetic characteristics. Methods: Blood levels of RET and α-TCP (ELISA methods, Cloud-Clone Corp, USA), their ratio and DC concentrations (biochemical method) were measured before treatment if 42 patients with pancreatic cancer: adenocarcinoma (AC), T1-3N0-1M0, n = 9; AC with a neuroendocrine component (AC+NE) (up to 30%), n = 21; neuroendocrine tumors (NET), T1-3N0-1M0, n = 12. 22 healthy men of similar age were controls. All patients gave their voluntary informed consent for the study. Results: RET levels in all patient were statistically significantly lower than in controls: in AC by 3.8 times, in AC+NE by 1.9 times, in NET by 3.7 times (p = 0.0000). Concentrations of α-TCP in AC were 1.6 times (p = 0.0011) lower than in controls, in AC+NE were similar, and in NET α-TCP was 1.5 times higher than in controls (p = 0.0000). The ratio of α-TCP/RET in all patients significantly exceeded control values: in AC by 2.2 times, in AC+NE by 1.6 times, in NET by 5.7 times (p = 0.0000). Levels of DC in all patients were higher than in controls: in AC by 2.5, in AC+NE by 2.1, in NET by 2.7 times (p = 0.0001). Conclusions: Changes in serum levels of RET and α-TCP differ in patients with AC, NET and mixed tumors, which causes changes in the balance of vitamins and can contribute to a prooxidant effect, as evidenced by an increase in DC levels.
17
Frantsiyants, Elena, Irina A. Goroshinskaya, Ekaterina Igorevna Surikova, et al. "Is there association between characteristics of gastric tumor growth and activation of different growth factor systems?" Journal of Clinical Oncology 36, no. 4_suppl (2018): 29. http://dx.doi.org/10.1200/jco.2018.36.4_suppl.29.
Full textAbstract:
29 Background: Signet-ring cell carcinoma of the stomach (SRCC) is significantly associated with poor prognosis and low treatment effectiveness, compared to adenocarcinoma of the stomach (AC). One of the causes of SRCC aggressive course can be its diffuse invasive growth pattern. The ability of tumor cells to synthesize and/or capture growth factors ensures the independent tumor development. VEGF, EGF, IGFI and EGFII facilitate neoangiogenesis and regulation of malignant processes in paracrine/autocrine mechanisms. The purpose of the study was to find the difference between local levels of VEGF, EGF, IGFI and IGFII in tumor and intact tissues in AC and SRCC. Methods: Levels of VEGF, EGF, EGFR, IGF-I and IGFII were determined by ELISA in tumor and intact gastric tissues of 15 AC patients and 10 SRCC patients (T2-3N0-2M0, G2-3), mean age 62.8±2.38 years. Results: Levels of IGF-I, IGF-II and VEGF in intact gastric tissues were similar in AC and SRCC. EGF and EGFR levels in AC were 2.9 and 1.5 higher than in SRCC. Levels of VEGF in AC tumor tissues, compared to intact gastric tissues, increased by 2.3 times, EGF and EGFR did not change, and IGFI and IGFII decreased by 2.1 and 1.8 times, respectively. Tumor tissues of SRCC patients showed the increased levels of EGF (by 2.9 times) and EGFR (by 1.8 times); VEGF and IGF were similar to the levels in intact tissues. SRCC was characterized by the activation of systems of EGF and IGF, but not VEGF. AC demonstrated the stimulation of VEGFA neoangiogenesis. Conclusions: The activation of systems of EGF and IGF in SRCC could be associated with some characteristics of the diffuse growth pattern and the tumor origin from neuroendocrine cells which facilitates the autocrine/paracrine regulation of the invasive growth. AC requires neoangiogenesis which is realized primarily by the VEGF system.
18
Surikova, Ekaterina Igorevna, Elena Frantsiyants, Irina A. Goroshinskaya, et al. "Does signet-ring cell carcinoma of the stomach (SRCC) need stimulation of neoangiogenesis?" Journal of Clinical Oncology 36, no. 4_suppl (2018): 33. http://dx.doi.org/10.1200/jco.2018.36.4_suppl.33.
Full textAbstract:
33 Background: Tumor neoangiogenesis is a complex coordinated process involving various regulatory molecules. Vascular endothelial growth factors, in particular VEGF-A, are important effectors. A multipotent TGF-β1 cytokine can modulate stromal angiogenesis reactions promoting the tumor growth. Our purpose was to study the function of the system of pro-angiogenic cytokines in tissues of stomach tumors of various histological types - adenocarcinoma (AC) and signet-ring cell carcinoma (SRCC). Methods: The concentrations of VEGF-A, VEGF-R1 and TGF-β1 were studied by ELISA in tumors, peritumoral zone and resection line tissues of gastric cancer patients without preoperative therapy: 15 patients with AC (T2-4N0-2M0, G2-G3, 50-84 years) and 10 patients with SRCC, comparable by sex, age and prevalence of cancer process. Results: Levels of VEGF-A, VEGF-R1 and TGF-β1 in the resection line tissues of AC and SRCC did not differ significantly. VEGF-A in AC tumor tissues exceeded significantly the levels in the resection line (by 2.3 times) and in the peritumoral zone (by 1.8 times). VEGF-A in SRCC tumor tissue did not differ significantly from the levels in the corresponding tissues of the resection line and peritumoral zone, but it was 2.6 times lower than in AC tumor tissues. VEGF-R1 levels in AC and SRCC were similar. TGF-β1 in AC tumor tissues was 3.2 and 2.6 times higher than in the resection line and peritumoral zone, respectively. TGF-β1 in SRCC tumor tissues did not differ from the levels in the peritumoral zone and in healthy tissues; TGF-β1 in tumor tissues was 3.2 times lower in SRCC than in AC. Conclusions: SRCC tumor tissues have significantly lower levels of pro-angiogenic VEGF-А and TGF-β1 cytokines, compared to AC tissues, which can indicate that SRCC has no need to form its own vasculature. It is probably associated with the biological characteristic of this histotype of gastric cancer - diffuse growth pattern, in contrast to the solid structure of AC.
19
Li, Shuli, Greg Maine, Yasuhiro Suzuki, et al. "Serodiagnosis of Recently Acquired Toxoplasma gondii Infection with a Recombinant Antigen." Journal of Clinical Microbiology 38, no. 1 (2000): 179–84. http://dx.doi.org/10.1128/jcm.38.1.179-184.2000.
Full textAbstract:
ABSTRACT A portion of a cDNA encoding a 35-kDa antigen from Toxoplasma gondii was cloned into the CKS expression vector and expressed in Escherichia coli . By using the enzyme-linked immunosorbent assay (ELISA), the recombinant protein (rP35 antigen) was examined for reactivity with immunoglobulin G (IgG) antibodies in the sera of pregnant women. Of these women, 41 had a toxoplasma serologic profile suggestive of recently acquired T. gondii infection (Sabin-Feldman dye test [DT] titers from 1:256 to 1:32,000, positive IgM ELISA titers from 2.3 to 9.7, positive IgA ELISA from 1 to >28, and acute patterns in the differential agglutination [AC/HS] test) (group I), and 50 women had a toxoplasma serologic profile suggestive of infection acquired in the distant past (low DT titers from 1:16 to 1:512, negative IgM ELISA titers from 0 to 0.8, and chronic patterns in the AC/HS test) (group II). The classification of acute or chronic profile was based on the individual's clinical history as well as the combination of the results of the toxoplasma serological profile. An additional group (group III) was composed of sera from 50 women who were seronegative for T. gondii antibodies in the DT. The results revealed that whereas 85.3% of women in group I had IgG antibodies that reacted with the rP35 antigen, only 8% of women in group II had IgG antibodies that reacted with the same antigen. In immunoblots, the rP35 antigen was recognized by IgG antibodies in a pool of sera from individuals with a toxoplasma serologic profile compatible with acute infection but not in a pool of sera from individuals with a serologic profile characteristic of a chronic infection. These results reveal that IgG antibodies against the P35 antigen are produced during the acute stage of the infection but are uncommon in the latent or chronic phase of the infection. Thus, the rP35 antigen may be a useful serologic marker to differentiate between recently acquired infection and that acquired in the more distant past.
20
Luo, Cheng, Qi Chen, Bowen Liu, et al. "The Extracts of Angelica sinensis and Cinnamomum cassia from Oriental Medicinal Foods Regulate Inflammatory and Autophagic Pathways against Neural Injury after Ischemic Stroke." Oxidative Medicine and Cellular Longevity 2021 (June 26, 2021): 1–15. http://dx.doi.org/10.1155/2021/9663208.
Full textAbstract:
The study indicates inflammation and autophagy are closely related to neural apoptosis in the pathology of ischemic stroke. In the study, we investigate the effects and mechanisms of the extracts of Angelica sinensis and Cinnamomum cassia (AC) from oriental medicinal foods on inflammatory and autophagic pathways in rat permanent middle cerebral artery occlusion model. Three doses of AC extract were, respectively, administered for 7 days. It suggests that AC extract treatment ameliorated scores of motor and sensory functions and ratio of glucose utilization in thalamic lesions in a dose-dependent manner. Expression of Iba1 was decreased and CD206 was increased by immunofluorescence staining, western blotting results showed expressions of TLR4, phosphorylated-IKKβ and IκBα, nuclear P65, NLRP3, ASC, and Caspase-1 were downregulated, and Beclin 1 and LC3 II were upregulated. Low concentrations of TNF-α, IL-1β, and IL-6 were presented by ELISA assay. Additionally, caspase 8 and cleaved caspase-3 expressions and the number of TUNEL positive cells in ipsilateral hemisphere were decreased, while the ratio of Bcl-2/Bax was increased. Simultaneously, in LPS-induced BV2 cells, it showed nuclear P65 translocation and secretion of proinflammatory cytokines were suppressed by AC extract-contained cerebrospinal fluid, and its intervened effects were similar to TLR4 siRNA treatment. Our study demonstrates that AC extract treatment attenuates inflammatory response and elevates autophagy against neural apoptosis, which contributes to the improvement of neurological function poststroke. Therefore, AC extract may be a novel neuroprotective agent by regulation of inflammatory and autophagic pathways for ischemic stroke treatment.
21
Mellor, Sally L., Emma M. A. Ball, Anne E. O’Connor та ін. "Activin βC-Subunit Heterodimers Provide a New Mechanism of Regulating Activin Levels in the Prostate". Endocrinology 144, № 10 (2003): 4410–19. http://dx.doi.org/10.1210/en.2003-0225.
Full textAbstract:
Activins are formed by dimerization of β-subunits and, as members of the TGF-β superfamily, have diverse roles as potent growth and differentiation factors. As the biological function of the activin C homodimer (βC-βC) is unknown, we sought to compare activin A (βA-βA), B (βB-βB), and C homodimer bioactivities and to investigate the consequences of activin βC-subunit overexpression in prostate tumor cells. Exogenous activin A and B homodimers inhibited cell growth and activated activin-responsive promoters. In contrast, the activin C homodimer was unable to elicit these responses. We previously showed that the activin βC-subunit heterodimerized with activin βAin vitro to form activin AC. Therefore, we hypothesize that the activin βC-subunit regulates the levels of bioactive activin A by the formation of activin AC heterodimers. To test this hypothesis, we measured activin AC heterodimer production using a novel specific two-site ELISA that we developed for this purpose. In the PC3 human prostate tumor cell line, activin βC-subunit overexpression increased activin AC heterodimer levels, concomitantly reduced activin A levels, and decreased activin signaling. Overall, these data are consistent with a role for the activin βC-subunit as a regulatory mechanism to reduce activin A secretion via intracellular heterodimerization.
22
Sharma, Umesh, Nour-Eddine Rhaleb, Saraswati Pokharel, et al. "Novel anti-inflammatory mechanisms ofN-Acetyl-Ser-Asp-Lys-Pro in hypertension-induced target organ damage." American Journal of Physiology-Heart and Circulatory Physiology 294, no. 3 (2008): H1226—H1232. http://dx.doi.org/10.1152/ajpheart.00305.2007.
Full textAbstract:
High blood pressure (HBP) is an important risk factor for cardiac, renal, and vascular dysfunction. Excess inflammation is the major pathogenic mechanism for HBP-induced target organ damage (TOD). N-acetyl-Ser-Asp-Lys-Pro (Ac-SDKP), a tetrapeptide specifically degraded by angiotensin converting enzyme (ACE), reduces inflammation, fibrosis, and TOD induced by HBP. Our hypothesis is that Ac-SDKP exerts its anti-inflammatory effects by inhibiting: 1) differentiation of bone marrow stem cells (BMSC) to macrophages, 2) activation and migration of macrophages, and 3) release of the proinflammatory cytokine TNF-α by activated macrophages. BMSC were freshly isolated and cultured in macrophage growth medium. Differentiation of murine BMSC to macrophages was analyzed by flow cytometry using F4/80 as a marker of macrophage maturation. Macrophage migration was measured in a modified Boyden chamber. TNF-α release by activated macrophages in culture was measured by ELISA. Myocardial macrophage activation in mice with ANG II-induced hypertension was studied by Western blotting of Mac-2 (galectin-3) protein. Interstitial collagen deposition was measured by picrosirius red staining. We found that Ac-SDKP (10 nM) reduced differentiation of cultured BMSC to mature macrophages by 24.5% [F4/80 positivity: 14.09 ± 1.06 mean fluorescent intensity for vehicle and 10.63 ± 0.35 for Ac-SDKP; P < 0.05]. Ac-SDKP also decreased galectin-3 and macrophage colony-stimulating factor-dependent macrophage migration. In addition, Ac-SDKP decreased secretion of TNF-α by macrophages stimulated with bacterial LPS. In mice with ANG II-induced hypertension, Ac-SDKP reduced expression of galectin-3, a protein produced by infiltrating macrophages in the myocardium, and interstitial collagen deposition. In conclusion, this study demonstrates that part of the anti-inflammatory effect of Ac-SDKP is due to its direct effect on BMSC and macrophage, inhibiting their differentiation, activation, and cytokine release. These effects explain some of the anti-inflammatory and antifibrotic properties of Ac-SDKP in hypertension.
23
Yoshii, Yumi, Masanori Matsumoto, Kurumatani Norio, et al. "Introduction of a Quick Assay for ADAMTS13 Activity Improved a Survival of Acquired TTP Patients Who Received Platelet Transfusions." Blood 124, no. 21 (2014): 4209. http://dx.doi.org/10.1182/blood.v124.21.4209.4209.
Full textAbstract:
Abstract Introduction: Daily plasma exchange (PE) has become a definitive first-line treatment for acquired thrombotic thrombocytopenic purpura (TTP). However, it remains to be controversial whether platelet transfusion is harmful or not for patients with acquired TTP during initial treatment. Some articles showed that platelet transfusion was considered as hazardous because platelet transfusion might generate widespread fresh platelet aggregates in circulation, but others reported that the mortality rate was not different between patients with and without platelet transfusion. Herein, we conducted a retrospective analysis of a large cohort of patients with acquired idiopathic TTP (ai-TTP) in Japan evaluating whether platelet transfusion was associated with unfavorable outcomes. Patients and Methods: Our laboratory has been functioning as a nationwide referral center for thrombotic microangiopathies (TMAs) in Japan. We collected a large dataset of medical information on 1211 patients with TMA from March 2000 to December 2013. Among them, 263 were ai-TTP patients with severe deficiency (<10% of normal controls) of ADAMTS13 activity (ADAMTS13:AC), with positive anti-ADAMTS13 inhibitors. These ai-TTP patients were retrospectively analyzed in detail using reported medical records that contained detailed clinical data and outcome information. ADAMTS13:AC was determined by classic von Willebrand factor multimer (VWF) assay. These results were available within 4 to 7 days in the initial period (March 2000 to March 2005, n=91). Subsequently, with use of a chromogenic ADAMTS13-act-ELISA, reporting occurred within 2 days of obtaining a plasma sample (April 2005 to December 2013, n=172). All plasma samples collected before March 2005 were re-examined by act-ELISA. Results: In 263 ai-TTP patients, 48 patients received platelet transfusions during the initial treatment and 215 did not. Factors associated with increased mortality included age greater than 60 years and presentation with central nervous system (CNS) dysfunction (p<0.05 for each), but not use of platelet transfusions [22.9% (11/48) versus 17.7% (38/215), respectively]. Next, we analyzed the mortality rate in 2 groups categorized by method of ADAMTS13 activity assay. In the initial period using classic VWF assay, mortality of patients with platelet transfusion tended to be higher versus those without platelet transfusions (p=0.051, Log-rank test) as shown in Figure left (Kaplan-Meier survival curve). In contrast, in the latter period using the more rapid act-ELISA, no differences in mortality of patients with versus without platelet transfusions was noted (p=0.52, Figure right). To evaluate whether platelet transfusion is a significant hazard for patients with ai-TTP, Cox-proportional-hazards regression analysis was performed using 5 variables (age, sex, rituximab use, presence of CNS dysfunction, and platelet transfusion). Older age and use of platelet transfusion were independently associated with mortality in the initial period, and age and presence of CNS dysfunction were identified as unfavorable factors in the latter period (Table). Conclusions: Our results clearly indicated that platelet transfusion was harmful in ai-TTP patients with severe deficiency of ADAMTS13:AC before 2005 (when a quick ADAMTS13:AC assay was unavailable). After 2005 (when a quick ADAMTS13:AC assay available), the survival rate of ai-TTP patients with platelet transfusions became almost indistinguishable from those without. This result may indicate that persistent PE after platelet transfusion together with confirmation of severe ADAMTS13:AC reduces risk for aggravated platelet thrombi formation in microvasculatures of patients. However, use of platelet transfusion before PE may lead to serious thrombotic complications in heart and brain, a complication that should be avoided. Figure 1 Figure 1. Disclosures Matsumoto: Alfresa Pharma Corporation: Patents & Royalties. Fujimura:Alfresa Pharma Corporation: Patents & Royalties.
24
Storey, Raul, Joongho Joh, Amy Kwon, A. Bennett Jenson, Shin-je Ghim, and Goetz H. Kloecker. "Detection of Immunoglobulin G against E7 of Human Papillomavirus in Non-Small-Cell Lung Cancer." Journal of Oncology 2013 (2013): 1–5. http://dx.doi.org/10.1155/2013/240164.
Full textAbstract:
Background. A significant number of non-small-cell lung cancers (NSCLC) have human papillomavirus (HPV) DNA integrated in their genome. This study sought to further establish HPV’s possible etiologic link to NSCLC by evaluating an immune response to HPV’s oncogene, E7, in patients with NSCLC.Patients and Methods. Antibodies (IgG) in serum against E7 for HPV 16 and 18 in 100 patients with NSCLC were examined by enzyme-linked immunosorbent assay (ELISA).Results. Sixteen NSCLC patients were found to have a high titration of IgG for HPV oncogenic E7 protein. 23.5% of adenocarcinomas (AC,) and 15.4% of squamous cell carcinomas (SCC) were positive for IgG against HPV E7. HPV-18 (11%) had a slightly higher frequency than HPV-16 (6%). Of the six positive cases for HPV-16, 3 were AC, 2 SCC, and 1 NOS (not otherwise specified). For the 11 HPV-18 positives, 7 were AC, and 4 SCC. The one case with IgG against HPV 16 and 18 was AC. One case had high cross-reactive levels against E7 of HPV 16 and 18. Two (28%) of 7 patients who reported never smoking were positive for HPV, and 12 (13.6%) of 88 smokers were HPV positive.Conclusions. The study detected high levels of IgG against E7 in 16% of NSCLC patients. This adds evidence to a potential role of HPV in the pathogenesis of NSCLC.
25
Pérez-García, Selene, Valentina Calamia, Tamara Hermida-Gómez, et al. "Proteomic Analysis of Synovial Fibroblasts and Articular Chondrocytes Co-Cultures Reveals Valuable VIP-Modulated Inflammatory and Degradative Proteins in Osteoarthritis." International Journal of Molecular Sciences 22, no. 12 (2021): 6441. http://dx.doi.org/10.3390/ijms22126441.
Full textAbstract:
Osteoarthritis (OA) is the most common musculoskeletal disorder causing a great disability and a reduction in the quality of life. In OA, articular chondrocytes (AC) and synovial fibroblasts (SF) release innate-derived immune mediators that initiate and perpetuate inflammation, inducing cartilage extracellular matrix (ECM) degradation. Given the lack of therapies for the treatment of OA, in this study, we explore biomarkers that enable the development of new therapeutical approaches. We analyze the set of secreted proteins in AC and SF co-cultures by stable isotope labeling with amino acids (SILAC). We describe, for the first time, 115 proteins detected in SF-AC co-cultures stimulated by fibronectin fragments (Fn-fs). We also study the role of the vasoactive intestinal peptide (VIP) in this secretome, providing new proteins involved in the main events of OA, confirmed by ELISA and multiplex analyses. VIP decreases proteins involved in the inflammatory process (CHI3L1, PTX3), complement activation (C1r, C3), and cartilage ECM degradation (DCN, CTSB and MMP2), key events in the initiation and progression of OA. Our results support the anti-inflammatory and anti-catabolic properties of VIP in rheumatic diseases and provide potential new targets for OA treatment.
26
Morioka, Chie, Masahito Uemura, Tomomi Matsuyama, et al. "Plasma ADAMTS13 Activity Markedly Decreases in Patients with Severe Acute Pancreatitis: Its Potential Role on the Development of Multiorgan Failure." Blood 110, no. 11 (2007): 2160. http://dx.doi.org/10.1182/blood.v110.11.2160.2160.
Full textAbstract:
Abstract Background: A severe form of acute pancreatitis, severe acute pancreatitis (SAP), frequently develops pancreatitis-associated multiorgan failure (MOF) followed by systemic microcirculatory disturbance with a high mortality. ADAMTS13 has been focused on the occurrence of thrombotic thrombocytopenic purpura (TTP). TTP has been reported to cause acute pancreatitis in a few percents, and recent study indicates that some acute pancreatitis may be a triggering event for TTP. We sequentially determined plasma ADAMTS13 activity (ADAMTS13:AC) and its related parameters in patients with SAP, and thereby, tried to explore their potential role on the development of MOF. Methods: Subjects studied were 13 patients with SAP, who were admitted into the department of emergency and critical care medicine of our hospital. The etiology was alcohol in 7, idiopathic in 3, common bile duct stones in 2, and post endoscopic retrograde cholangiopancreatography in 1. Eleven patients were survivors and two were non-survivors. Two of 4 patients with MOF were non-survivors. The severity was scored according to APACHE-II system. ADAMTS13:AC was determined using a commercially available ADAMTS13-act-ELISA (Kainos Inc., Tokyo). Plasma levels of VWF antigen (VWF:AG), interleukin 6 (IL-6), interleukin 8 (IL-8), and tumor necrosis-α (TNF-α) were measured by ELISA. Unusually large VWF multimer (UL-VWFM) was analyzed by a vertical SDS -1.0% agarose gel electrophoresis system. Results: ADAMTS13:AC significantly decreased at day 1 (mean 39%, p<0.001) and at day 2 (33%, p<0.001) as compared to healthy subjects (99%). The activity, thereafter, gradually recovered (49% at day 5, 58% at day 7, and 70% at day 10) in survivors, whereas in non-survivors, it decreased from 22% at day 1 to 10% at day 2 in one and showed 15% at day 1 in another. The inhibitor against ADAMTS13 was not detected. The VWF:AG increased to 402% at day 1 (p<0.001) and 333% at day 2 (p<0.001) as compared to healthy subjects (100%), and the value, thereafter, remained high (395% at day 5, 428% at day 7, and 382% at day 10). The UL-VWFM could be detected in 7 cases for 3 to 35 days immediately after admission. On admission, patients with detectable UL-VWFM tended to be lower ADAMTS13:AC and higher VWF:Ag than those without, resulting in higher VWF/ADAMTS13 ratio (19.9 vs. 8.9, p<0.01). Patients with MOF showed lower ADAMTS13:AC (20% vs. 40%, p<0.05) and higher VWF:Ag (448% vs. 391%, p<0.05) than those without, resulting in higher VWF/ADAMTS13 ratio (22.9 vs. 11.2, p<0.02). The concentrations of IL-6, IL-8, and TNFα increased, and ADAMTS13:AC correlated with those of IL-6 (r= − 0.51, p<0.05) and IL-8 (r= − 0.66, p<0.02). Furthermore, ADAMTS13:AC negatively correlated with APACHE-II score (r= − 0.67, p<0.02). Conclusion: Markedly decreased ADAMTS13:AC together with increased amounts of UL-VWFM was closely related to the severity of pancreatitis, an intense systemic inflammatory response, and prognosis in patients with SAP. These results indicate that the imbalance between the enzyme and its substrate may involve in the development of acute pancreatitis and subsequent MOF through enhanced thrombogenesis.
27
Vecchié, Alessandra, Aldo Bonaventura, Federico Carbone, et al. "Antiapolipoprotein A-1 Autoantibody Positivity Is Associated with Threatened Abortion." BioMed Research International 2020 (March 7, 2020): 1–8. http://dx.doi.org/10.1155/2020/9309121.
Full textAbstract:
Background. Autoantibodies against apolipoprotein A-1 (anti-ApoA-1 IgG) were demonstrated to be associated with cardiovascular outcomes in several inflammatory diseases. As balanced inflammation is critical for uncomplicated pregnancy, we aimed to investigate the prevalence of anti-ApoA-1 IgG and anti-c-terminal ApoA-1 autoantibodies (Ac-terAA1 IgG) in a cohort of pregnant women and their potential relationship with threatened abortion (TA). Methods. Between 2012 and 2014, 371 consecutive outpatient pregnant women were included in this study and followed until delivery. Anti-ApoA-1 and anti-Ac-terAA1 IgG were measured by ELISA technique on serum samples collected between the 24th and 26th week of pregnancy. Associations with TA were tested using linear regression analysis and C-statistics. Results. Median age was 34 with a prevalence of the Caucasian ethnicity (90.5%). TA occurred in 10 women (2.7%). C-statistics indicated that anti-ApoA-1 and anti-Ac-terAA1 IgG levels upon study inclusion were predictive of TA (0.73, 95% confidence interval [CI] 0.69-0.78, p<0.001 and 0.76, 95% CI 0.71-0.80, p=0.01, respectively). At the prespecified anti-ApoA-1 IgG cutoff, the negative predictive value (NPV) was 100%. For anti-Ac-terAA1 IgG, at the optimal cutoff, the NPV was 99%. Linear regression models indicated that risk associations were independent of age and the presence of autoimmune diseases for both autoantibodies (p<0.001). Anti-Ac-terAA1 IgG-positive individuals were more frequently non-Caucasians (p=0.009). Conclusion. Anti-ApoA-1 and anti-Ac-terAA1 IgG are independently associated with TA during pregnancy with an appealing NPV. The causal biological mechanisms underlying this association as well as the possible clinical relevance of these findings require further investigations.
28
Studenic, Paul, Alessia Alunno, Daniela Sieghart, et al. "Presence of anti-acetylated peptide antibodies (AAPA) in inflammatory arthritis and other rheumatic diseases suggests discriminative diagnostic capacity towards early rheumatoid arthritis." Therapeutic Advances in Musculoskeletal Disease 13 (January 2021): 1759720X2110225. http://dx.doi.org/10.1177/1759720x211022533.
Full textAbstract:
Aims: To determine the diagnostic value of anti-acetylated peptide antibodies (AAPA) in patients with rheumatoid arthritis (RA). Methods: Three acetylated peptides (ac-lysine, ac-lysine.inv and ac-ornithine) derived from vimentin were employed to measure AAPA by enzyme-linked immunosorbent assay (ELISA) in sera of 120 patients with early RA (eRA), 195 patients with established RA (est RA), 99 healthy controls (HC), and 216 patients with other inflammatory rheumatic diseases. A carbamylated and a citrullinated version of the vimentin peptide were used additionally. Receiver operating characteristics and logistic regression analyses were used to assess the discriminative capacity of AAPA. Results: AAPA were detected in 60% of eRA and 68.7% of estRA patients, 22.2% of HC, and 7.1– 30.6% of patients with other rheumatic diseases. Importantly, AAPA were also present in 40% of seronegative RA patients, while antibodies to the carbamylated peptide were detected less frequently. Diagnostic sensitivity of individual peptides for eRA was 28.3%, 35.8%, and 34% for ac-lysine, ac-ornithine, and ac-lysine.inv, respectively. Positive likelihood ratios (LR+) for eRA versus HC were 14.0, 7.1, and 2.1. While the presence of a single AAPA showed varying specificity (range: 84–98%), the presence of two AAPA increased specificity considerably since 26.7% of eRA, as compared with 6% of disease controls, were double positive. Thus, double positivity discriminated eRA from axial spondyloarthritis with a LR+ of 18.3. Remarkably, triple positivity was 100% specific for RA, being observed in 10% of eRA and 21.5% of estRA patients, even in the absence of RF and ACPA. Conclusion: AAPA are highly prevalent in early RA and occur also independently of RF and ACPA, thereby reducing the gap of seronegativity. Furthermore, multiple AAPA reactivity increased the specificity for RA, suggesting high diagnostic value of AAPA testing.
29
Yang, Mei, Jin-tao Fang, Ni-shang Zhang, et al. "Caspase-1-Inhibitor AC-YVAD-CMK Inhibits Pyroptosis and Ameliorates Acute Kidney Injury in a Model of Sepsis." BioMed Research International 2021 (June 10, 2021): 1–9. http://dx.doi.org/10.1155/2021/6636621.
Full textAbstract:
Objective. To observe the protective effect of AC-YVAD-CMK on sepsis-induced acute kidney injury in mice and to explore its possible mechanisms primarily. Methods. Eighteen male C57BL/6 mice were randomly divided into sham-operated group (Control), cecal ligation and puncture group (CLP), and CLP model treated with AC-YVAD-CMK group (AC-YVAD-CMK) ( n = 6 in each group). Mice were sacrificed at 24 h after operation, and blood and kidney tissue samples were collected for analyses. Histologic changes were determined microscopically following HE staining. The expression of Ly-6B and CD68 was investigated using immunohistochemistry. Serum concentrations of creatinine (sCR) and blood urea nitrogen (BUN) were measured. Serum levels of interleukin-1β (IL-1β), interleukin-18 (IL-18), TNF-α, and interleukin-6 (IL-6) were determined by ELISA. The expressions of Caspas-1, NLRP-1, IL-1β, and IL-18 in renal tissues were investigated using Western blot. Immunofluorescence staining was used to detect the expression of GSDMD protein in renal tissues. Results. AC-YVAD-CMK treatment significantly alleviates sepsis-induced acute kidney injury, with decreased histological injury in renal tissues, suppresses the accumulation of neutrophils and macrophages in renal tissues, and decreased sCR and BUN level ( P < 0.05 ). Attenuation of sepsis-induced acute kidney injury was due to the prohibited production of inflammatory cytokines and decrease expression of Caspas-1, NLRP-1, IL-1β, and IL-18 in renal tissues. In addition, AC-YVAD-CMK treatment significantly reduced the expression of GSDMD in renal tissues compared to those observed in controls ( P < 0.05 ). Conclusions. We demonstrated a marked renoprotective effect of caspase-1-inhibitor AC-YVAD-CMK in a rat model of sepsis by inhibition of pyroptosis.
30
Argalasova, Lubica, Ingrid Zitnanova, Diana Vondrova, et al. "Self-Reported Exposure to ETS (Environmental Tobacco Smoke), Urinary Cotinine, and Oxidative Stress Parameters in Pregnant Women—The Pilot Study." International Journal of Environmental Research and Public Health 16, no. 9 (2019): 1656. http://dx.doi.org/10.3390/ijerph16091656.
Full textAbstract:
Background: Exposure to ETS (environmental tobacco smoke) is one of the most toxic environmental exposures. Objective: To investigate the association of ETS with physiological, biochemical, and psychological indicators, as well as with urine antioxidant capacity (AC) and oxidative damage to lipids in a pilot sample of healthy pregnant women. Methods: Exposure to ETS was investigated via a validated questionnaire, and urine cotinine and the marker of oxidative damage to lipids via 8-isoprostane concentrations using an ELISA kit. Urine AC was determined by the spectrophotometric Trolox-equivalent antioxidant capacity (TEAC) method. From a sample of pregnant women (n = 319, average age 30.84 ± 5.09 years) in 80, the levels of cotinine and oxidative stress markers were analyzed. Results: Among the 80 pregnant women, 5% (7.4% confirmed by cotinine) reported being current smokers and 25% reported passive smoking in the household (18.8% confirmed by cotinine). The Kappa was 0.78 for smokers and 0.22 for ETS-exposed nonsmokers. Pregnant women in the ETS-exposed group had significantly reduced AC compared to both the nonsmoker (ETS−) and the smoker groups (p < 0.05). Nonsmokers had significantly lower levels of 8-isoprostane than smokers (p < 0.01) and ETS-exposed nonsmokers (p < 0.05). Correlations between urine levels of cotinine and AC were positive in ETS-exposed nonsmokers. Conclusion: A harmful association of active and passive smoking and oxidative stress parameters among pregnant women has been indicated.
31
Marti, Gerardo A., Ester T. González, Juan J. García, Ana R. Viguera, Diego M. A. Guérin, and María G. Echeverría. "AC-ELISA and RT-PCR assays for the diagnosis of triatoma virus (TrV) in triatomines (Hemiptera: Reduviidae) species." Archives of Virology 153, no. 8 (2008): 1427–32. http://dx.doi.org/10.1007/s00705-008-0130-x.
Full text
32
Zeng, Haijuan, Xuzhao Zhai, Manman Xie, and Qing Liu. "Fluorescein Isothiocyanate Labeling Antigen-Based Immunoassay Strip for Rapid Detection of Acidovorax citrulli." Plant Disease 102, no. 3 (2018): 527–32. http://dx.doi.org/10.1094/pdis-06-17-0903-re.
Full textAbstract:
A simple and fast immunoassay strip to detect Acidovorax citrulli (Ac) using fluorescein isothiocyanate as a marker was developed. Fluorescein isothiocyanate (FITC) was added to sample culture medium for bacteria incubation, and the bacteria could emit a yellow-green fluorescence under ultraviolet light and become a fluorescent probe. This immunofluorescence strip (IFS) was based on the binding between fluorescent bacteria and the unlabeled monoclonal antibody (McAb) immobilized on the test area in nitrocellulose membrane. The detection limit of the strip was 106 CFU/ml with a result that could be observed within 10 min. The IFS could detect eight strains of Ac and display no cross-reactions with 30 other pathogenic strains. The detection results would not be affected by impurities in plant or unknown microorganisms in natural field samples and were consistent with PCR results, indicating that the IFS has high accuracy. This is the first report of using only one unlabeled McAb to develop a direct-type immunofluorescence strip for the rapid detection of Ac. The IFS reduced detection time and simplified operation procedures compared with the traditional enzyme-linked immunosorbent assay (ELISA) and PCR methods. In addition, this simple and inexpensive method will play a significant role in monitoring plant pathogens on field detection.
33
O'Kane, Grainne, Sarah A. McGarrigle, Nadia Rehill, et al. "Levels of oxidative stress and telomeres in Lynch syndrome-associated malignancies." Journal of Clinical Oncology 34, no. 4_suppl (2016): 582. http://dx.doi.org/10.1200/jco.2016.34.4_suppl.582.
Full textAbstract:
582 Background: Lynch Syndrome (LS) is caused by germline mutations in mismatch repair genes (MMR) genes which are critical in maintaining cellular integrity. Failure of the MMR pathway in LS culminates in the hypermutable phenotype of Microsatellite Instability. LS confers an increased risk of malignancy of which colorectal cancer (CRC) is most common. Carriers exhibit significant phenotypic variation in the age of onset of malignancy which cannot be predicted. Telomere length attrition is considered an early step in carcinogenesis and may be accelerated by oxidative stress. We investigated an association between relative telomere length (RTL) and levels of DNA oxidative damage in LS affected carriers (AC), unaffected carriers (UAC) and in patients with MMR- proficient colorectal cancer (MPC). Methods: Peripheral blood mononuclear cells were isolated from patients within each group. DNA was extracted and RTL measured by quantitative polymerase chain reaction (PCR). Real-Time PCR was used to quantitate expression levels of TERT, TERC and DKC1 (telomerase components) from RNA. Serum levels of 8-hydroxydeguanosine (8-OHdG) were measured from patients using the ELISA technique. Pearson’s correlation was used to compare mean RTL, telomerase levels and 8-OHdG between groups. Results: RTL and telomerase components were measured in 27 AC (median age 50yrs) 27 UAC (median age 40yrs) and 27 MPC (median age 66yrs). Corresponding RTLs were 0.89, 0.91 and 1.69 respectively. AC had significantly shorter RTL compared to UAC (p = 0.03) and MPC (p < 0.0001). There we no differences in the mean expression of TERT, TERC or DKC between groups. Younger age of tumour onset was associated with shorter telomere length in both AC (p = 0.0006) and MPC (p < 0.0001). 8-OHdG levels have been measured in 17 AC, 19 UAC and 14 MPC. The mean levels of AC and UAC were not statistically different. However the mean MPC level was significantly less than UAC (p = 0.03) and AC (p < 0.0001). Conclusions: Shortened telomere length is an important step in carcinogenesis. Affected LS patients have shorter telomeres and evidence of higher levels of DNA oxidative stress than patients with MMR-proficient CRC.
34
Kumar, Manoj, Sukdeb Nandi, and Sunil Chidri. "Development of a polyclonal antibody-based AC-ELISA and its comparison with PCR for diagnosis of canine parvovirus infection." Virologica Sinica 25, no. 5 (2010): 352–60. http://dx.doi.org/10.1007/s12250-010-3132-x.
Full text
35
Brown-Glaberman, Ursa, Marilyn Marron, Pavani Chalasani, et al. "Circulating Carbonic Anhydrase IX and Antiangiogenic Therapy in Breast Cancer." Disease Markers 2016 (2016): 1–7. http://dx.doi.org/10.1155/2016/9810383.
Full textAbstract:
Introduction. Carbonic anhydrase IX (CAIX) is a hypoxia regulated metalloenzyme integral to maintaining cellular pH. Increased CAIX expression is associated with poor prognosis in breast cancer. To explore CAIX as a biomarker for breast cancer therapies, we measured plasma CAIX levels in healthy control subjects and in breast cancer patients.Methods. In control subjects we evaluated plasma CAIX stability via commercially available ELISA. We then similarly quantified plasma CAIX levels in (1) locally advanced breast cancer (LABC) patients treated with neoadjuvant paclitaxel + sunitinib (T + S) followed by doxorubicin and cyclophosphamide (AC); (2) metastatic breast cancer (MBC) patients treated with systemic chemotherapy.Results. Plasma CAIX levels were stable at room temperature for at least 48 hours in control subjects. Mean baseline plasma CAIX levels were lower in controls compared to patients with LABC or MBC. In LABC, CAIX levels rose significantly in response to administration of antiangiogenic therapy (T + S) (p=0.02) but not AC (p=0.37). In patients with MBC treated without an antiangiogenic agent CAIX levels did not change with therapy.Conclusions. Our results suggest that CAIX may be an easily obtained, stable measure of tumor associated hypoxia as well as a useful pharmacodynamic biomarker for antiangiogenic therapy.
36
Baysal-Gurel, F., R. Li, K. S. Ling, and S. A. Miller. "First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio." Plant Disease 99, no. 1 (2015): 163. http://dx.doi.org/10.1094/pdis-06-14-0639-pdn.
Full textAbstract:
Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.
37
Miller, B. G., P. H. Jones, S. Rizvi, J. Gibson, and D. Patel. "Enzyme linked immuno-absorbent assay (ELISA) to determine the effectiveness of anti-adhesive factors in blocking the binding of F4(K88)ac E coli to pig intestine." Proceedings of the British Society of Animal Science 2001 (2001): 164. http://dx.doi.org/10.1017/s1752756200005469.
Full textAbstract:
Concern over the use of prophylactic antibiotics and the potential of them being banned has increased interest in other methods of controlling disease. Specifically postweaning diarrhoea in the pig, often associated with E Coli (F4 K88ac) is a candidate for an alternative strategy. If in-feed additives can be demonstrated which effectively block the binding of the F4 (K88)ac pilli to the surface of the pig enterocytes then the severe form of the disease could be controlled without the use of antibiotics. The work reported here provides a screening method to determine whether potential in-feed additives can block the binding of purified F4(K88)ac to isolated brush border membranes taken from neonatal F4(K88)ac positive pigs.
38
Ansari, Wafa Munir, Abdul Khaliq Naveed, Muhammad Nadir Khan, Omer Jamshed Khan, and Dilshad Ahmed Khan. "PREMATURE CORONARY ARTERY DISEASE." Professional Medical Journal 23, no. 08 (2016): 912–17. http://dx.doi.org/10.29309/tpmj/2016.23.08.1662.
Full textAbstract:
Objectives: Interleukin-6 receptor (IL-6R) gene (A>C, rs8192284) polymorphismhas been associated with inflammatory biomarkers. We sought to investigate the association ofIL-6R gene (A>C, rs8192284) polymorphism with IL-6, IL-18 and hS-CRP levels in PCAD. StudyDesign: Case control study. Setting: Army Medical College, National University of Sciencesand Technology, Islamabad, Pakistan Methods: Total 520 subjects were recruited. 281 PCADpatients aged ≤45 years with >70% stenosis in at least one major coronary vessel along with239 age and sex matched controls were recruited. IL-6R polymorphism was determined byTaqMan genotyping while IL-6 and IL-18 levels were measured using ELISA technique and hSCRPon Immulite 2000. Results: The genotype distribution of IL-6R(rs8192284) in the cases andcontrols was: AA-56%(n=143);AC-36% (n=102); and CC-13% (n=36) and AA-59%(n=139);AC-33% (n=80); CC-8% (n=20) respectively. The risk allele frequency was significantly differentbetween the cases and controls (p=0.038) .IL-6 levels were significantly high (p<0.01) whilehS-CRP levels were significantly low (p<0.05) in subjects with IL-6R (rs8192284) CC genotypeas compared to the AC and AA genotypes. Multivariate logistic regression analysis revealedthat IL-18, IL-6 and hS-CRP still remained significant in the prediction of PCAD with a high oddsratio OR (p<0.05). Conclusions: Our study is the first to show that the presence of the IL-6Rrs8192284 is associated with significantly high IL-6 level and significantly low hS-CRP levels inPakistani Premature Coronary Artery Disease Patients.
39
Luzuriaga, Nivia, Xiomara Rivera, Richard Salazar, Nathaly Reyes, and Iván Santiana. "Detección de anticuerpos séricos de influenza aviar tipo A, enfermedad de Newcastle y bronquitis infecciosa y laringotraqueitis infecciosa en aves acuáticas silvestres de tres lagunas andinas del Ecuador." Revista de Investigaciones Veterinarias del Perú 30, no. 3 (2019): 1283–91. http://dx.doi.org/10.15381/rivep.v30i3.16591.
Full textAbstract:
El objetivo del estudio fue determinar la presencia de anticuerpos séricos frente a cuatro patógenos respiratorios (influenza aviar [AI], enfermedad de Newcastle [NDV], bronquitis infecciosa aviar [IBV] y laringotraqueítis infecciosa aviar [ILTV]) que podrían afectar a las aves acuáticas migratorias y residentes de tres lagunas altoandinas del Ecuador. Se colectaron 153 muestras de sangre de aves de siete especies en las lagunas andinas de Colta, Yambo y Yahuarcocha. La presencia de anticuerpos (Ac) contra IBV e ILTV se detectó por un ELISA indirecto (ELISAi) y por la prueba de inhibición de la hemoaglutinación (HI); para NDV e influenza aviar (H5N1 y H7N3) se usó un ELISAc e HI. La seropositividad a NDV fue de 3.2% (5/153), habiendo tres casos en Yahuarcocha en el cormorán neotropical (Phalacrocorax brasilianus), un caso en Colta en la focha andina (Fulica ardesiaca) y uno en Yambo en el pato rojizo andino (Oxyura ferruginea). La seropositividad contra AI fue de 13% (20/153), mayormente en el pato rojizo andino y el zambullidor plateado (Podicceps occipitalis) en Colta, y en el ánade piquiamarillo (Anas georgica), focha andina y pato rojizo andino en Yambo. Asimismo, se encontró Ac séricos contra IBV en dos cormoranes en Yahuarcocha. No se encontraron anticuerpos contra ILTV.
40
Ó, Kleyton Palmeira do, Taciana Furtado de Mendonça-Belmont, Isabela Cristina Cordeiro Farias, et al. "LGALS3 +191A and +292C polymorphisms are associated with a reduction in serum gal-3 levels, but not with the clinical events of individuals with sickle cell anemia." Research, Society and Development 9, no. 9 (2020): e442997314. http://dx.doi.org/10.33448/rsd-v9i9.7314.
Full textAbstract:
Objective: This study aimed to evaluate whether the single nucleotide polymorphisms (SNPs) +191 C>A (rs4644) and +292 A>C (rs4652) of the LGALS3 gene and the serum levels of galectin-3 (gal-3) are associated with clinical events in patients with sickle cell anemia (SCA). Methods: SNP +191 and +292 of the LGALS3 gene were detected by the TaqMan PCR system in real time. Gal-3 levels were measured in serum by ELISA. The study included 322 patients, mean age 36 (21-84). Results: AA and CA genotypes of the +191 region were related to lower levels of gal-3 when compared to CC genotype (p=0.0296). Lower level of gal-3 was also associated with the +191/+292 (AA/CC; CA/CC) diplotypes (p=0.0137) compared to the diplotypes (CC/AA; CC/CC; CC/AC; CA/AC). There was no association between serum levels of galectin-3 and genotype frequencies of the LGALS3 +191 and +292 polymorphisms with clinical events in SCA. Conclusion: The polymorphisms +191 and +292 of the LGALS3 are associated to decrease in serum levels of gal-3. However, no association of polymorphisms and levels of gal-3 with clinical events was observed in patients SCA.
41
Jiang, Feng, Congrong Wang, Rongxia Li, et al. "Serum Proteome Changes in Healthy Subjects with Different Genotypes ofNOS1APin the Chinese Population." Journal of Diabetes Research 2013 (2013): 1–7. http://dx.doi.org/10.1155/2013/357630.
Full textAbstract:
Type 2 diabetes and its chronic complications have become a worldwide epidemic nowadays. However, its molecular mechanism is still unknown. We have previously identified a novel variant rs12742393 ofNOS1APfor type 2 diabetes susceptibility in the Chinese population. In this study, we analyzed the total serum profiling among three genotypes of rs12742393 to discover potential crosstalk under the variant and the disease through proteomic analyses for the first time. We used OFFGEL peptide fractionation, LC-MS/MS analysis, and label-free quantification to profile the fasting human serum samples of the genotypes in rs12742393 (n=4, for CC, AC, and AA, resp.). Four proteins were identified, including apoA4, alpha1-ACT, HABP2, and keratin 10, with blood levels changed significantly between CC and AA homozygotes of rs12742393. Compared with AA group, the levels of apoA4 increased (P=0.000265), whereas the concentration of alpha1-ACT, HABP2, and keratin 10 decreased in CC group (P=0.011116, 0.021175, and 0.015661, resp.). Then we selected additional fasting serum samples for ELISA and western blot validation. However, no significant differences were identified by neither ELISA nor western blot (P>0.05). The protein profiling changes between the genotypes of rs12742393 indicated that this SNP might play a role in the development of type 2 diabetes.
42
Yoshida, Yoko, Ayami Isonishi, Toshiyuki Sado, et al. "Severe Reduction of Free ADAMTS13, Unbound to Von Willebrand Factor, in Plasma Milieu Is a Unique Feature of HELLP Syndrome." Blood 128, no. 22 (2016): 134. http://dx.doi.org/10.1182/blood.v128.22.134.134.
Full textAbstract:
Abstract Introduction Plasma ADAMTS13 exists at least two forms, bound and unbound to vonWillebrandfactor (VWF), of which the former was assumed to be 3% of the total by the immunoprecipitation method (Feyset al., JTH 2009). We have shown that plasma ADAMTS13 consists of 3 group bands, by means of isoelectric focusing (IEF) analysis (Hori et al, Transfusion 2013). Band I (pI4.9-5.6) was assumed to be free ADAMTS13, unbound to VWF, and Band III (pI7.0-7.5) was a complex with high-molecular-weight VWFmultimers(HMW-VWFM). However, the feature of Band II (pI5.8-6.7) was undetermined. HELLP (hemolysis, elevated liver enzymes and low platelet counts) syndrome is a life-threatening thromboembolic complication during pregnancy, and its pathogenesis is not determined. The curative therapy of HELLP syndrome is a termination of pregnancy. It was reported that plasma VWF antigen (VWF: Ag) was remarkably increased (215-422% of the normal) with a mild reduction of ADAMTS13 activity (ADAMTS13: AC) (12-43 % of the normal), but without qualitative analysis of ADAMTS13 antigen (Lattuadaet al.,Haematologica2003). We here analyzed plasma ADAMTS13 antigen in 9 patients with HELLP syndrome using the IEF gel, and revealed a unique picture of severe reduction of Band I (free ADAMTS13), unbound to VWF, that was not seen in plasmas from normal pregnancy. Patients and Methods One hundred twenty-nine normal pregnant women and 9 patients with HELLP syndrome were analyzed under approval by the ethics committees of Nara Medical University. All individuals gave written informed consent to the study. Diagnosis of HELLP syndrome was made by all the following laboratory abnormalities: characteristics peripheral blood smear, serum LDH >600 IU/L (or total bilirubin >1.2 mg/dL), AST >70 IU/L, and platelet counts < 100,000/mm3 (Sibai et al., Am JObstetGynecol 1993). Plasma level of ADAMTS13: AC was determined by chromogenic ADAMTS13-act-ELISA, and VWF: Ag was measured by a sandwich ELISA using a rabbit polyclonal anti-human VWF antibody. As reported previously (Hori et al., Transfusion 2013), the IEF was performed using a large-pore agarose-acrylamide composing gel followed by detection with anti-ADAMTS13 monoclonal antibody. Results In normal women, plasma levels of VWF: Agweremarkedly increased during pregnancy, and the values of third trimester (median 223%) were almost two times higher than those of first trimester (119%). Contrarily,plasma levels ofADAMTS13: AC were significantly decreased in second (68.4%) and third (66.2%) trimester compared with first trimester (84.3%, p<0.01 and p<0.001, respectively). Of note, a reduction in ADAMTS13: AC was significantly prolonged in postpartum period (50.2%, p<0.001), while increased VWF: Ag was rapidly recovered after delivery. Further, the IEF analysis of normal pregnant women showed that Band I was slightly decreased in accord with progression of pregnancy. In puerperium, there was no difference in ADAMTS13: AC between normal pregnant women and patients with HELLP syndrome. However, the values of VWF: Ag of patients with HELLP syndrome (352%) were significantly higher than those of normal pregnant women (178%, p<0.001), in agreement with a previous report. Interestingly, however, here we have shown that 7 out of 9 patients with HELLP syndrome showed severe reduction of Band I in puerperium period by the IEF analysis of ADAMTS13 (Figure). Discussion In normal pregnant women, the decreased ADAMTS13:AC was assumed to reflect a consumption of the enzyme for cleavage of increased VWF. Interestingly, both Band II and III were almost unchanged during normal pregnancy, but Band I slightly decreased in third trimester, concomitantly with a mild reduction of ADAMTS13:AC. In contrast, Band I was severely reduced during the acute phase of HELLP syndrome in 7 out of 9 patients. Our previous report indicated that under high-shear-stress Band I inhibited the VWF-dependent platelet aggregation in a dose-response manner from the initial phase, whereas Band III (+II) worked from the later phase. This result indicates that ADAMTS13 lacking Band I neither readily binds to VWF nor efficiently blocks the heightened high-shear-stress induced platelet aggregation generated by newly produced HMW-VWFM. Our data suggest that ADAMTS13 preparation might be used as a therapeutic option for the treatment of HELLP syndrome, before termination of pregnancy. Disclosures No relevant conflicts of interest to declare.
43
Matsuyama, Tomomi, Masanori Matsumoto, Ayami Isonishi, Shigeko Inokuma, and Yoshihiro Fujimura. "Analysis of ADAMTS13 and Its IgG-Autoantibodies in 170 Patients with Connective Tissue Disease-Associated Thrombotic Microangiopathy Indicates More Than 2 Types on Its Pathogenesis." Blood 110, no. 11 (2007): 1322. http://dx.doi.org/10.1182/blood.v110.11.1322.1322.
Full textAbstract:
Abstract Connective tissue disease (CTD) is sometimes complicated with thrombotic microangiopathy (TMA). Despite of the reports on several sporadic cases with acquired deficiency of ADAMTS13 activity (ADAMTS13:AC), it has been said that a majority of the patients with CTD-TMA have almost normal or slightly reduced levels of ADAMTS13:AC in their plasmas. But this has not been evaluated in a large population of such patients. As a nationwide referral center of TMA during the past 10 years, we were able to identify 783 patients with TMAs across Japan. Among these patients, 188 were categorized into CTD-TMA, of which 170 patients with a set of clinical and laboratory data were extensively analysed in this study. The patient’s categorization and their numbers were the followings; systemic lupus erythematosus (SLE, n=59), systemic sclerosis (SSc, n=40), polymyositis /dermatomyositis (PM/DM, n=9), antiphospholipid syndrome (APS, n=9), Sjögren’s syndrome (SS, n=8), rheumatoid arthritis (RA, n=9), mixed connective tissue disease (MCTD, n=7), overlap syndrome (OS, n=5), vasculitis syndrome (VS, n=8), and others (n=14). Plasma levels of ADAMTS13:AC and its inhibitors were determined by both a classic von Willebrand factor multimer (VWFM) assay and a commercially available ADAMTS13-act-ELISA kit (Kainos Inc., Tokyo), and a high correlation of the values between them was identified (r=0.72). To visualize the IgG-autoantibodies to ADAMTS13 in tested plasmas, western blot (WB) analysis using the purified human plasma derived (pd)-ADAMTS13 (Hiura et al, ISTH abs P-M-295, 2007) was also performed. Severe deficiency of ADAMTS13:AC (<3% of the control) was found in 34 patients with CTD-TMA (34/170, 20%), who had the neutralizing autoantibodies (inhibitors) against ADAMTS13 except for one. Supporing these results, the IgG-autoantibodies were detected in 22 of 34 patients (65%) by the WB method. When these data were analysed separately in a specific category of CTD, the frequency of severe deficiency of ADAMTS13:AC was the following order; SS (5/8, 63%), MCTD (4/7, 57%), APS (4/9,44%), SLE (15/59, 25%), RA (2/9, 22%), PM/DM (1/11, 9%), others (1/14, 7%), SSc (2/40, 5%), OS (0/5, 0%), and VS (0/8, 0%). Further, the plasma levels of ADAMTS13:AC and VWF:AG in the patients with CTD-TMA were 26.1±21.2% and 288±179%, respectively, and the ratio of VWF:AG/ADAMTS13:AC in these patients was extremely high (112±256), as compared to normal control (1.0±0.3). Our data indicate that firstly 20% (34/170) of the patients with CTD-TMA are induced by severe deficiency of ADAMTS13:AC due to its inhibitors. Secondly, the rest 80% are caused by other precipitating factors, which may include the non-neutralizing autoantibodies to ADAMTS13 that reduce plasma level of ADAMTS13:AC by accelerating clearance of the immune complex from circulation or inhibit the enzyme binding to vascular endothelial cell surface, requiring for an efficient cleavage of newly-released unusually large VWFMs. A significant effectiveness of plasma exchange therapy to both the groups of patients with CTD-TMA may reflect this hypotheisis. Thirdly, however, the vascular endothelial cell damages with or without the thickening of small vessel walls in these patients may cause the hemodynamic changes in microcirculation that accelerate platelet aggregation or thrombi formation leading to TMAs.
44
Fujita, Yukiko, Takeshi Doi, Ryoji Maekura, Masami Ito, and Ikuya Yano. "Differences in serological responses to specific glycopeptidolipid-core and common lipid antigens in patients with pulmonary disease due to Mycobacterium tuberculosis and Mycobacterium avium complex." Journal of Medical Microbiology 55, no. 2 (2006): 189–99. http://dx.doi.org/10.1099/jmm.0.46087-0.
Full textAbstract:
Disease due to the Mycobacterium avium complex (MAC) is one of the most important opportunistic pulmonary infections. Since the clinical features of MAC pulmonary disease and tuberculosis (TB) resemble each other, and the former is often difficult to treat with chemotherapy, early differential diagnosis is desirable. The humoral immune responses to both diseases were compared by a unique multiple-antigen ELISA using mycobacterial species-common and species-specific lipid antigens, including glycopeptidolipid (GPL)-core. The results were assessed for two patient groups hospitalized and diagnosed clinically as having TB or MAC pulmonary disease. Diverse IgG antibody responsiveness was demonstrated against five lipid antigens: (1) monoacyl phosphatidylinositol dimannoside (Ac-PIM2), (2) cord factor (trehalose 6,6′-dimycolate) (TDM-T) and (3) trehalose monomycolate from Mycobacterium bovis Bacillus Calmette-Guérin (BCG) (TMM-T), and (4) trehalose monomycolate (TMM-M) and (5) GPL-core from MAC. Anti-GPL-core IgG antibody was critical, and detected only in the primary and the secondary MAC diseases with high positivity, up to 88·4 %. However, IgG antibodies against Ac-PIM2, TDM-T and TMM-T were elevated in both TB and MAC patients. Anti-TMM-M IgG antibody was also elevated in MAC disease preferentially, with a positive rate of 89·9 %, and therefore, it was also useful for the diagnosis of the disease. IgG antibody levels were increased at the early stages of the disease and declined in parallel to the decrease of bacterial burden to near the normal healthy control level, when the anti-mycobacterial chemotherapy was completed successfully. Unexpectedly, about 25 % of hospitalized TB patient sera were anti-GPL-core IgG antibody positive, although the specificity of GPL-core was sufficiently high (95·8 % negative in healthy controls), suggesting that a considerable number of cases of latent co-infection with MAC may exist in TB patients. Taken together, the combination of multiple-antigen ELISA using mycobacterial lipids, including GPL-core and TMM-M, gives good discrimination between healthy controls and sera from patients with TB or MAC disease, although for accurate diagnosis of TB more specific antigen(s) are needed.
45
Yagi, Hideo, Masaki Hayakawa, Naoko Yamaguchi, et al. "Decreased Platelet Thrombus Size, Due to a Heightened Proteolysis of VWF By ADAMTS13, Is Quickly Restored after Valve Replacement in Aortic Stenosis Patients." Blood 124, no. 21 (2014): 2857. http://dx.doi.org/10.1182/blood.v124.21.2857.2857.
Full textAbstract:
Abstract Background: The patients with severe aortic-valve stenosis (AS) are often complicated with bleeding episodes. The association between AS and gastrointestinal bleeding due to angiodysplasia is reported as Heyde's syndrome, which is categorized as one of the acquired von Willebrand disease (AVWD) in cardiovascular disorders. An international survey has shown that Type 2A is the common subtype of AVWD in the patients with AS. AVWD Type 2A is characterized by impaired platelet-dependent VWF function caused by marked decrease or absence of the most hemostatically active HMW-VWFM. In the patients with AS, a significant correlation between the increased high shear stress and loss of HMW-VWFM in vivo. Further, the absence of HMW-VWFM and bleeding tendency are normalized after valve replacement. These results suggest that enhanced proteolysis of von Willebrand factor (VWF) as it passes through the stenotic valve may induce the loss of HMW-VWFM because high shear stress can induce structure changes in VWF, which is sensitive form to the VWF cleaving protease, termed ADAMTS13. Here, we performed investigation of plasma levels of VWF antigen (VWF:Ag), ADAMTS13 activity (ADAMTS13:AC), and platelet thrombus formation in the patients with AS by valve replacement to confirm the pathophysiological mechanism of this rare disease. Patients and Methods: Ten consecutive patients who underwent aortic valve replacement for AS in Nara Medical University Hospital were enrolled in this study. The severity of AS was judged by the American Heart Association guideline. All patients had no bleeding history and received bovine tissue valves replacement followed by administration of warfarin and/or anti-platelet agents for prevention of thrombosis a week after surgery. We collected a series of blood samples from these patients before and day1, 8, 15, 22 after valve replacement. Excluding one patient who developed critical cardiac failure just after valve replacement, 9 patients were eventually evaluated by analyses of VWF:Ag, VWF multimers, ADAMTS13:AC, and mural thrombus formation using flow chamber system. VWF:Ag was measured by sandwich ELISA using a rabbit anti-human VWF polyclonal antiserum. Analysis of VWF multimers was performed according to the method of Ruggeri and Zimmerman. ADAMTS13:AC was measured by a chromogenic ADAMTS13-act-ELISA. Platelet thrombus formation was evaluated by thrombus generation under a high shear stress in a parallel plate flow chamber system. Briefly, whole blood anti-coagulated with argatroban was incubated with the fluorescent dye DiOC6 (1uM), and these samples containing DiOC6 -labeled platelets were perfused for 7 min over a type I collagen-coated glass surface under a high shear rate (1500 s-1). The DiOC6 fluorescence corresponding to the platelets was examined at an excitation wavelength of 488 nm with a barrier filter at 500 nm. The percentage of the area covered by adhering platelets (surface coverage) and each thrombus volume were evaluated. Results: Plasma levels of VWF:Ag before surgery were 78.1 % (median) and those on day 1, 8, 15, 22 after surgery were 130, 224, 155, and 134 %, respectively (Fig 1). Conversely, these levels of ADAMTS13:AC were 50.5, 35.5, 25.5, 25.1, and 30.3 %, respectively (Fig 2). The ratio of VWF:Ag/ADAMTS13:AC at before and day 1, 8, 15, 22 after surgery were 1.6, 4.5, 8.1, 6.1, and 4.1, respectively. In VWF multimer analysis, we found the obvious defect of HMW-VWFM in 7 of 9 patients before surgery, who were diagnosed with severe AS. The remaining two patients had moderate AS with the slight defect of HMW-VWFM. These defects were improved within 14 days after surgery. In platelet thrombus formation, the amount of thrombus volumes significantly increased at day 8, 15, and 22 after compared with before surgery (Fig 3). Conclusion: The dramatic recovery of platelet thrombus formation was observed in the patients with AS by valve replacement. The rapid increment of VWF and normalization of VWFM pattern, together with reduction of ADAMTS13 after valve replacement suggested heightened proteolysis of VWF by ADAMTS13 under high shear stress would be a major cause of this unique bleeding complication. The highest ratio of VWF:Ag/ADAMTS13:AC at day 8 after surgery might imply the necessity of blockade of heightened VWF function with anti-platelet agents. Figure 1 Figure 1. Disclosures Matsumoto: Alfresa Pharma Corporation: Patents & Royalties. Fujimura:Alfresa Pharma Corporation: Patents & Royalties.
46
Moiseenko, Tatiana I., Elena M. Frantsiyants, Valeria A. Bandovkina, Meri L. Adamyan, Natalia D. Cheryarina, and Anna Yu Ardzha. "Prognosis of endometrial cancer depends on intracrine ratio of sex steroids." Journal of Clinical Oncology 39, no. 15_suppl (2021): e17564-e17564. http://dx.doi.org/10.1200/jco.2021.39.15_suppl.e17564.
Full textAbstract:
e17564 Background: Local imbalance of sex steroids (SS) plays a leading role in the development of gynecologic tumors. The purpose of the study was to investigate the effect of changes in SS and E6 protein levels on the course of endometrial cancer (EC). Methods: 50 patients with EC T1-2N0M0 (histologically - endometrioid adenocarcinoma, AC), aged 53.4±3.2 years, were recruited. Levels of SS and E6 protein were determined by standard ELISA systems in tumor samples. The coefficient of estrogens to the amount of testosterone and progesterone – C = (E1+E2):(T+P4) was calculated. Intact endometrium (IE) obtained in surgical treatment for uterine fibroids was used as the intact tissue. Results: AC patients demonstrated elevated estrone (E1) levels, compared to IE: by 2.2 times in 88% and by 5.9 times in 12% cases (p < 0.05). Levels of estradiol (E2) were similar in AC and IE. Progesterone (P4) levels in 32 patients were 1.5 times lower than in IE, and testosterone (T) 1.5 times higher (p < 0.05). P4 in 18 patients was 3 times lower than in IE, and T – 1.4 times lower in 12 women and 2.2 times lower in 6 women (p < 0.05). The C coefficient increased in 32 patients by 1.3 times (p< 0.05), in 12 patients by 2.7 times, in 6 patients by 8.2 times (p < 0.05). E6 protein was found in tumor tissue of 18 patients with elevated C. 6 of 18 women with C = 24.54±2.4 and E6 = 420±32 ng/g of tissue developed recurrence during 6 months, and 12 patients with C = 8.15±1.2 and E6 = 28±2.1 ng/g of tissue developed recurrence in a period of 6 months to 1 year. Women with C = 4.04±0.39 without E6 oncoprotein in tumor tissue had a relapse-free period for more than 1 year. Conclusions: An analysis of C and E6 oncoprotein in tumor tissues allows identification of high-risk patients and a personalized approach to adequate treatment.
47
Robertson, N. L., and K. L. Brown. "First Report of Bean yellow mosaic virus in Alaska from Clover (Trifolium spp.)." Plant Disease 94, no. 3 (2010): 372. http://dx.doi.org/10.1094/pdis-94-3-0372a.
Full textAbstract:
In mid-June 2008, distinct mosaic leaves were observed on a cluster of clover (Trifolium spp.) with light pink and white flowers growing at the edge of a lawn in Palmer, AK. Virus minipurification from leaves of affected clover and protein extractions on a polyacrylamide electrophoresis implicated a ~35-kDa putative coat protein (CP). Subsequent western blots and ELISA with a universal potyvirus antiserum (Agdia Inc., Elkhart, IN) confirmed potyvirus identity. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from the same plant were used for reverse transcription (RT)-PCR. Three sets of degenerate primers that targeted potyvirus-specific genes, HC-Pro (helper component protease) and CI (cylindrical inclusion protein) and the genomic 3′-terminus that included a partial NIb (nuclear inclusion), CP (coat protein), and UTR (untranslated region), produced the expected PCR segments (~0.7, ~0.7, and ~1.6 kbp, respectively) on 1% agarose gels (1). Direct sequencing of the HC-Pro (GenBank No. GQ181115), CI (GQ181116), and CP (GU126690) segments revealed 98, 97, and 99% nucleotide identities (no gaps), respectively, to Bean yellow mosaic virus (BYMV)-chlorotic spot (CS) strain, GenBank No. AB373203. The next closest BYMV percent identity comparisons decreased to 79% for HC-Pro (GenBank No. DQ641248; BYMV-W), 79% for CI (U47033; BYMV-S) partial genes, and 96% for CP (AB041971; BYMV-P242). Mechanical inoculations of purified virus preparations produced local lesions on Chenopodium amaranticolor Coste & A. Reyn. (2 of 5) and C. quinoa Willd. (6 of 7), and mosaic on Nicotiana benthamiana Domin (5 of 5). BYMV was specifically confirmed on tester plants using a double-antibody sandwich (DAS)-ELISA BYMV (strain 204 and B25) kit (AC Diagnostics, Inc., Fayetteville, AR) as directed. The absence of another potyvirus commonly found in clover, Clover yellow vein virus (ClYVV), was verified in parallel DAS-ELISA ClYVV assays (AC Diagnostics, Inc). The BYMV isolate was maintained in N. benthamiana, and virion or sap extracts inoculated to the following host range (number of infected/total inoculated plants [verified by BYMV ELISA]): Cucumis sativus L. ‘Straight Eight’ (0/5), Gomphrena globosa L. (1/4), Nicotiana clevelandii A. Gray (4/7), Phaseolus vulgaris L. ‘Bountiful’ (1/3), Pisum sativum L. (Germplasm Resources Information Network Accession Nos. -PI 508092 (8/12), -W6 17525 (13/13), -W6 17529 (0/13), -W6 17530 (13/14), -W6 17537 (0/12), -W6 17538 (0/12), and -W6 17539 (0/21), Tetragonia tetragoniodes (2/2), Trifolium pretense L. ‘Altaswede’ (6/10), T. repens L. ‘Pilgrim’ (0/8), and Vicia faba L. (1/3). All infected plants had symptoms ranging from systemic mosaic (T. pretense, P. sativum) to leaf distortions (N. clevelandii, Tetragonia tetragoniodes). Interestingly, the host range and genomic sequences of the BYMV Alaskan strain resemble the BYMV-CS (chlorotic spot) strain that was originally isolated from a diseased red clover (T. pretense) plant in Japan more than 40 years ago (2). Although BYMV occurs worldwide and has a wide host range in dictoyledonous and monocotyledonous plants (3), to our knowledge, this is the first report of a natural occurrence of BYMV in Alaska. The incidence and distribution of BYMV in clover and other plant species are not known in Alaska. References: (1) C. Ha et al. Arch. Virol. 153:36, 2008. (2) H. Kume et al. Mem. Fac. Agric. Hokkaido Univ. 7:449, 1970. (3) S. J. Wylie et al. Plant Dis. 92:1596, 2008.
48
Rymut, Sharon M., Rong Deng, Ryan Owen, et al. "1305. Comparison of Pharmacokinetics of DSTA4637S, a novel THIOMABTM Antibody-Antibiotic Conjugate, in Patients with Staphylococcus aureus Bacteremia Receiving Standard-of-Care Antibiotics with Pharmacokinetics in Healthy Volunteers." Open Forum Infectious Diseases 7, Supplement_1 (2020): S666—S667. http://dx.doi.org/10.1093/ofid/ofaa439.1488.
Full textAbstract:
Abstract Background DSTA4637S, a THIOMABTM antibody-antibiotic conjugate against Staphylococcus aureus, is a potential therapy for complicated S. aureus bacteremia. Single doses showed favorable safety and pharmacokinetics (PK) in healthy volunteers (HVs). This study compares HV PK results to PK from a Phase 1b study evaluating multiple doses in patients with bacteremia. Methods In a Phase 1a study, HVs received single intravenous (IV) doses (5, 15, 50, 100, or 150 mg/kg) of DSTA4637S. The Phase 1b, randomized, double-blind, placebo-controlled, multiple ascending-dose study enrolled patients with MRSA or MSSA bacteremia receiving ≥ 4 weeks of standard-of-care (SOC) antibiotics in combination with IV DSTA4637S (15, 45, or 100 mg/kg) weekly (4-6 doses). Intensive PK serum and plasma sampling was performed after first and last doses of DSTA4637S. Total antibody (TAb) was measured in serum by ELISA. DSTA4637S conjugate (ac-dmDNA31) and unconjugated dmDNA31 were measured in plasma with IA-LC-MS/MS and LC-MS/MS, respectively. DSTA4637S PK was analyzed using a non-compartmental approach using WinNonlin. Results DSTA4637S PK data were evaluated in 20 HVs in the Phase 1a study and 19 patients with S. aureus bacteremia in the Phase 1b study. In both HVs and patients, systemic exposures of TAb and ac-dmDNA were generally dose proportional over the dose ranges tested. In patients compared to HVs, Cmax, cycle 1 for ac-dmDNA31 and TAb were reduced 26.7-51.3% and 32.4-44.1%, respectively, contributing to lower patient AUC0-7. Unconjugated dmDNA31 concentrations were low (&lt; 11 ng/mL), peaking 1-2 days after dosing, in both studies. There was no clear association between DSTA4637S exposure (ac-dmDNA31) and demographic factors (age, weight, sex), clinical status (bacteremia at dosing, infection site), adverse events (infusion-related reactions), or exploratory biomarkers (CRP, procalcitonin, inflammatory cytokines). Conclusion DSTA4637S PK analysis demonstrated lower exposures in patients with S. aureus bacteremia compared to HVs. Potential explanations for reduced exposures include factors related to disease status, non-specific organ uptake, and target-mediated clearance. Disclosures Sharon M. Rymut, PhD, Genentech (Employee, Shareholder) Rong Deng, PhD, Roche (Consultant, Employee, Shareholder) Ryan Owen, PhD, Genentech (Employee, Shareholder) Ola Saad, PhD, Genentech - Roche (Employee) Aklile Berhanu, PhD, Genentech, Inc. (Employee, Equity interest (Stock/Stock Options)) Jeremy Lim, PharmD, Roche (Employee, Shareholder) Montserrat Carrasco-Triguero, PhD, Genentech (Employee) Jessica A. Couch, PhD, Genentech (Employee, Shareholder) Melicent C. Peck, MD, PhD, Genentech (Employee)
49
Najwan Abdul Karim Habib Naji Alzubaidi and Syoof Khoman Alwan. "The association between gene polymorphism of certain cytokines (IL-6, IL-10) and hepatitis C virus infection locally." International Journal of Research in Pharmaceutical Sciences 10, no. 3 (2019): 2047–53. http://dx.doi.org/10.26452/ijrps.v10i3.1418.
Full textAbstract:
Thirty blood samples were collected from people infected with HCV and collected 30 blood samples from healthy individuals as a control group. The samples were collected from the virus department at Diwaniyah Teaching Hospital, Women's Hospital and Educational Children and the Blood Bank in Diwaniyah Governorate, during the period from July 2018 until February 2019. Antibodies (Anti-HCV ) to HCV were detected in the infected serum using ELISA technique, and the diagnosis was confirmed Using the polymerase chain reaction test. Select gene polymorphism of interleukin -6 at site 174, which represents 3 genotypes GG, GC, CC in patients with HCV and control group. GG was significantly increased in patients with hepatitis C virus (63.3%) compared to the control group (30 %). The genotypes GC, CC were significantly decreased in patients with hepatitis C virus (16.7% and 20%) compared with the control group (43.3% and 26.7%), respectively. It also identified gene polymorphism of interleukin -10 at site 592, which represented 3 genotypes AA, AC, CC in patients with hepatitis C virus and control group. Genotype AC was significantly increased in patients with hepatitis C virus (53%) compared with the control group (30%). The genotypes CC, AA were significantly decreased in patients with hepatitis C virus (26.7% and 20%) compared with the control group (26.7% and 43.3%) respectively. Conclude from our current study that genotypes or alleles of IL-6 and IL-10 may play an essential role in increasing the risk of HCV in humans or play a vital role for prevention against.
50
Elwan, Nadia, Nadia Elwan, Fathia Assal, et al. "Genetic Susceptibility in Family Members of Egyptian Hepatitis C Virus Infected Patients: Role of Interleukin-12 B Gene Polymorphism." Infectious Disorders - Drug Targets 19, no. 1 (2019): 81–87. http://dx.doi.org/10.2174/1871526518666171227210541.
Full textAbstract:
Aim: The research was conducted to study 1188 AC polymorphism of Interleukin (IL)-12B gene for C/C, A/C and A/A genotypes in families of Hepatitis C virus (HCV) infected patients in Egypt. Methods: Three hundreds HCV patients, 860 family members and 100 healthy subjects were studied. All family members were screened for HCV antibodies by enzyme-linked immunosorbent assay (ELISA). Positive cases were examined using Real-Time polymerase chain reaction (PCR) to confirm the presence of HCV ribonucleic acid (RNA) and detect the viral load. Molecular study of IL-12B gene was carried out on all patients, family members and controls using PCR and restriction enzyme analysis. Results: HCV infection was confirmed in 10.6% of family members. The distribution of IL-12B gene polymorphism in patients was 2.3%, 45.7% and 52% for C/C, A/C and A/A genotypes respectively, in infected family members was 3.3%, 41.7%, 55%, in noninfected family members was 4.5%, 43.5% and 52% for C/C, A/C and A/A genotypes respectively and in control was 5%, 36% and 59% for C/C, A/C and A/A genotypes respectively. The frequency of the C/C, A/C and A/A genotype was not significantly different between the studied groups. Conclusion: IL-12B gene polymorphism has no role in intrafamilial susceptibility of HCV transmission. The distribution of the functional 1188 AC polymorphism of Interleukin (IL)-12B gene for C/C, A/C and A/A genotypes was not significantly different among the studied groups.