Journal articles on the topic 'Academician D.M. Golub'

SUMMARY We discuss the focusing inversion of potential field data for the recovery of sparse subsurface structures from surface measurement data on a uniform grid. For the uniform grid, the model sensitivity matrices have a block Toeplitz Toeplitz block structure for each block of columns related to a fixed depth layer of the subsurface. Then, all forward operations with the sensitivity matrix, or its transpose, are performed using the 2-D fast Fourier transform. Simulations are provided to show that the implementation of the focusing inversion algorithm using the fast Fourier transform is efficient, and that the algorithm can be realized on standard desktop computers with sufficient memory for storage of volumes up to size n ≈ 106. The linear systems of equations arising in the focusing inversion algorithm are solved using either Golub–Kahan bidiagonalization or randomized singular value decomposition algorithms. These two algorithms are contrasted for their efficiency when used to solve large-scale problems with respect to the sizes of the projected subspaces adopted for the solutions of the linear systems. The results confirm earlier studies that the randomized algorithms are to be preferred for the inversion of gravity data, and for data sets of size m it is sufficient to use projected spaces of size approximately m/8. For the inversion of magnetic data sets, we show that it is more efficient to use the Golub–Kahan bidiagonalization, and that it is again sufficient to use projected spaces of size approximately m/8. Simulations support the presented conclusions and are verified for the inversion of a magnetic data set obtained over the Wuskwatim Lake region in Manitoba, Canada.

Outstanding traumatologist-orthopedist, scientist, teacher and health care organizer, founder of a large school of traumatologists and pediatric orthopedists, academician of the USSR Academy of Medical Sciences and the Russian Academy of Medical Sciences, vice-president of the USSR Academy of Medical Sciences, chief traumatologist and chairman of the Academic Council of the USSR Ministry of Health, Honored Scientist of the RSFSR, laureate of the USSR State Prize, Professor Mstislav Vasilievich Volkov was born on June 1, 1923 in Vladivostok. In 1940, he entered the 2nd Moscow Medical Institute, at the beginning of the Great Patriotic War, he joined the people’s militia, served as a signalman, and after demobilization in 1945, he continued his studies at the Institute, after which he studied in a clinical residency, and then in graduate school at the Department of Pediatric Surgery and Orthopedics under the direction of Professor S. D. Ternovsky. In 1952, he defended his candidate’s thesis «Peculiarities of amputation limb stump in children», and in 1961 – his doctoral thesis «Tumors and dysplasia of bones in children». From 1961 to 1984, M. V. Volkov headed the Central Institute of Traumatology and Orthopedics named after N. N. Priorov and at the same time headed the Clinic of pediatric bone pathology and adolescent orthopedics of this Institute. Mstislav Vasilievich made a huge contribution to the development of traumatology and orthopedics. Under his leadership, 48 doctoral and 50 candidate dissertations were prepared, in which the most pressing problems and numerous specific issues of traumatology, adult and pediatric orthopedics were studied. The results of these studies have become widespread in the practical activities of specialized hospitals in the Soviet Union. M. V. Volkov was the author and co-author of 33 inventions. The Volkov-Oganesyan repositioning-compression and hinge-distraction devices have received the greatest popularity and widespread implementation in practice. For 18 years, Mstislav Vasilievich was the chief traumatologist-orthopedist of the USSR Ministry of Health. He has published over 350 scientific papers, 17 monographs and manuals, many of which have been translated into English, French and German. Academician M. V. Volkov died on December 11, 2001 and was buried at the Vostryakovskoye cemetery in Moscow.

The article presents a historical development path of the Laboratory of biochemistry of adaptation and ontogenesis of animals which began with the founding of the Ukrainian Research Institute of Physiology and Biochemistry of Farm Animals in 1960. At the beginning of its existence laboratory was called “The laboratory of higher nervous activity” and was headed by associate professor Dr. I. A. Medyanyk. Since 1962 it was called “The laboratory of neurohumoral regulation” and was headed by Dr. of science, Professor E. M. Berkovych. Since 1963 the laboratory was headed by Dr. of science, Professor Z. P. Skorodynsky. Since 1972 the laboratory was headed by Dr. M. D Hanin, since 1980 — Professor V. M. Holovach, since 1988 — academician of NAAS, Professor V. V. Snitynsky. In 1994 the laboratory was renamed into the laboratory of endocrine regulation. Since 2011 until now the laboratory is called “The laboratory of biochemistry of adaptation and ontogenesis of animals”. From 2011 to 2013 duties of the laboratory head were performed by Dr. O. M. Buchko. From 2013 until now the head of the laboratory is Dr. of science, senior researcher R. Ya. Iskra.

The analysis of the introduction perspectivity of 18 new for the higher spore bearing plants collection of Academician O.V. Fomin Botanical Garden fern species has been carried out. It is established that &ldquo;very perspective&rdquo; there were 11 species and cultivares (<em>Adiantum pedatum</em> L. cv. <em>Minor</em>, <em>A. venustum </em>D. Don, <em>Asplenium fontanum</em> (L.) Bernh. in Schrader, <em>Polystichum andersonii</em> M. Hopkins, <em>P. makinoi </em>(Tagawa) Tagawa, <em>P. neolobatum</em> Nakai, <em>Phyllitis scolopendrium</em> (L.) Newm. cv. <em>Crispa</em>, <em>Phegopteris hexanoptera</em> (Michx.) F&eacute;e, <em>Cyrtomium macrophyllum</em> (Makino) Tagawa, <em>C. lonchitioides</em> (H. Christ) H. Christ, <em>Athyrium filix-femina</em> (L.) Roth cv. <em>Minutissimum</em>). They are recommen ded for wide use in the Polissia and Forrest-Step zones.

The article publishes previously unknown materials for the biographies of academicians V. I. Vernadsky and A. E. Fersman, found by the author in Professor D. P. Grigoriev’s archive, stored in the Russian Mineralogical Society. These are the memoirs of mineralogist A. Ya. Mikey, the autobiography of A. E. Fersman and his personal file, signed by academician V. A. Obruchev. All documents have been deciphered, annotated and commented on by the author. The relevance of the article is the need to defend the priorities of domestic science and technology. The purpose of the work is the fullest possible coverage of the professional and creative activities of V. I. Vernadsky and A. E. Fersman, the introduction of new documents into scientific circulation. These materials introduce information about the repressed Professor A. Ya. Mikey. The citation of famous scientists and travelers I. P. Aliber, A. I. Antipov, A. I. Brodsky, W. Wollaston, V. M. Goldschmidt, P. L. Dravert, L. L. Ivanov, V. I. Kryzhanovsky, S. M. Kurbatov, A. Lacroix, P. M. Leontovsky, G. M. Permikin, R. A. Prendel, K. Rosenbush, E. S. Fedorov, and L. A. Yachevsky should be interesting for a wide range of readers. Attention is drawn to the importance of personal archives in the study of the history of science. The archive of Professor D. P. Grigoriev in letters and other documents reflects a whole layer of pre- and post-war history of Russian mineralogy. The article is dedicated to the 160th anniversary of the birth of V. I. Vernadsky and the 140th anniversary of the birth of A. E. Fersman.

В статье обозначены основные этапы биографии крупного российского ученого. Выявлены основные направления ее деятельности во время работы в Сибирском отделении АН СССР (ныне СО РАН) – как эксперта, модератора, исследователя, организатора, преподавателя, интеллектуального лидера. Показано содержание каждого из обозначенных направлений. Приведены свидетельства учеников и коллег о М. М. Громыко как исследователе, педагоге, деятеле науки. Отмечено появление уже в рассматриваемые годы новых исследовательских интенций. Сделан вывод о том, что в сибирский период определились основные темы дальнейшего научного творчества. The article outlines the main stages of the biography of a major Russian scientist. The main directions of her activity during her work at the Siberian Branch of the Russian Academy of Sciences – as an expert, moderator, researcher, organizer, teacher, intellectual leader – are revealed. The content of each of the indicated directions is shown. The testimonies of students and colleagues about M. M. Gromyko as a researcher, teacher, scientist are given. The appearance of new research intentions has already been noted in the years under review. It is concluded that the main themes of further scientific creativity were determined in the Siberian period. A letter from M. M. Gromyko to academician S. D. Skazkin about the book «Labor traditions of Russian peasants of Siberia (XVIII – first half of the XIX century)» is published as an appendix.

The high incidence of chronic kidney disease worldwide is the most pressing medical and social problem due to progressive growth with the transition to chronic renal failure. Currently, in the general structure of chronic renal failure, up to 40% is due to terminal chronic renal failure requiring replacement renal therapy, particularly hemodialysis, peritoneal dialysis, and kidney transplantation. At the same time, the general structure of dialysis therapy is sharply dominated by hemodialysis (93%). Therefore, the problem of health systems in various countries is the availability of specialized medical care in connection with the development of the latest high-tech scientific and innovative technologies, the increase in the age of patients, as well as the restriction of state financial resources. The Republican Clinical Urological Hospital named after Academician M. D. Javad-zade revealed in dynamics a significant increase in attendance in 2017 by 13.0%, 2018 by 9.9% and 2016 by 5.5%. The trend of increasing hospital hospitalizations was observed in 2017 and 2019 by 42.6% and 16.8%, respectively. Among the hospitalized renal disease in dynamics had a trend of increase, from 2016 to 2019 by 17.3%, 11.7% and 34.7%, respectively. A sharp jump in the incidence of chronic inflammatory kidney diseases was observed in 2016 by 112.5%, bladder and prostate diseases in 2017 by 23.9% and 2018 by 14.0%. The trend of increase of patients receiving dialysis was observed in 2016, 2017 and 2019 by 10.9%, 11.0% and 3.3%, respectively. The increase in the availability of dialysis devices by year was noted by 15.4%, 10.0%, 6.0% and 1.4%, respectively, the frequency of dialysis sessions in 2018 and 2019 by 8.1% and 0.6%. Prevention, early detection, as well as timely treatment of kidney and urinary tract diseases will reduce the number of neglected forms of diseases, delay the dialysis period of treatment of these patients and thus reduce not only the percentage of temporary disability and disability of the population, but also the financial costs of treatment of patients in the future by means of replacement renal therapy.

The high incidence of chronic kidney disease worldwide is the most pressing medical and social problem due to progressive growth with the transition to chronic renal failure. Currently, in the general structure of chronic renal failure, up to 40% is due to terminal chronic renal failure requiring replacement renal therapy, particularly hemodialysis, peritoneal dialysis, and kidney transplantation. At the same time, the general structure of dialysis therapy is sharply dominated by hemodialysis (93%). Therefore, the problem of health systems in various countries is the availability of specialized medical care in connection with the development of the latest high-tech scientific and innovative technologies, the increase in the age of patients, as well as the restriction of state financial resources. The Republican Clinical Urological Hospital named after Academician M. D. Javad-zade revealed in dynamics a significant increase in attendance in 2017 by 13.0%, 2018 by 9.9% and 2016 by 5.5%. The trend of increasing hospital hospitalizations was observed in 2017 and 2019 by 42.6% and 16.8%, respectively. Among the hospitalized renal disease in dynamics had a trend of increase, from 2016 to 2019 by 17.3%, 11.7%, and 34.7%, respectively. A sharp jump in the incidence of chronic inflammatory kidney diseases was observed in 2016 by 112.5%, bladder, and prostate diseases in 2017 by 23.9% and 2018 by 14.0%. The trend of increase of patients receiving dialysis was observed in 2016, 2017, and 2019 by 10.9%, 11.0%, and 3.3%, respectively. The increase in the availability of dialysis devices by year was noted by 15.4%, 10.0%, 6.0%, and 1.4%, respectively, the frequency of dialysis sessions in 2018 and 2019 by 8.1% and 0.6%. Prevention, early detection, as well as timely treatment of kidney and urinary tract diseases will reduce the number of neglected forms of diseases, delay the dialysis period of treatment of these patients and thus reduce not only the percentage of temporary disability and disability of the population but also the financial costs of treatment of patients in the future by means of replacement renal therapy.

Vladimir Dmitrievich Fedorov was born on 21 March 1933 in Moscow. After finishing school he entered in the 2nd Moscow medical Institute named after N. And. Pirogov (1950-1956), where he performed the duties of Secretary of the Bureau of the Komsomol of the course and the member of the Komsomol Committee of the Institute; engaged in experimental work on the defibrillation of the heart. Studied in residency (1956-1958), graduate school (1958-1960), worked as a teaching assistant (1960-1966) and then associate Professor (1966-1971) chair of hospital surgery of the 2nd Moscow state medical Institute. In 1963 he defended his Ph. D. in 1971 doctoral dissertation. In 1972, Vladimir Dmitrievich Fedorov was appointed Director of research laboratory surgery clinic of the Ministry of health of the RSFSR. In 1976, on the initiative of V. D. Fedorov was the first in the USSR Department of Coloproctology of the Central doctors improvement Institute, which he headed for 13 years. In 1982 he was elected a corresponding member, and in 1986, academician of the Academy of medical Sciences (AMS) of the USSR. Since 1988, Vladimir Fyodorov, Director of the Institute of surgery named after AV Vishnevsky Academy of medical Sciences of the USSR. In 1990, V. D. Fedorov elected to the chair of surgery, faculty of postgraduate professional education of Moscow medical Academy named after I. M. Sechenov. Since 1974 he worked as a Deputy chief surgeon of the Medical center of President's Affairs Administration of the Russian Federation.&#x0D; D. Fedorov is the author of over 500 scientific works, including 13 copyright certificates and patents, and 20 monographs. Under his leadership, and counseling are protected by 32 doctoral and 47 master's theses.&#x0D; V. D. Fedorov was an honorary member of the Russian Association of endoscopic surgery and the Association hepatobiliary surgery, Moscow surgical society, surgical scientific societies of Uzbekistan, Kazakhstan and the Saratov region, Chairman of the surgical section and member of the Presidium of scientific medical Council of Ministry of health of the Russian Federation, a member of the Interdepartmental health Council, Deputy chief editor of the journal "Surgery", member of the editorial Board of the journal "Surgical Laparoscopy and Endoscopy" and one of the oldest journals "British Journal of Surgery". For two years he headed the Association of surgeons named after N. And. Pirogov (1992-1994). More than 10 years he was a member of the Presidium of the Russian Academy of medical Sciences and performed the duties of Chairman of the Board of Directors of the institutes of the Russian Academy of medical Sciences. Vladimir Dmitrievich, a foreign member of the Belarusian Academy of medical Sciences (2000) and the Academy of Sciences of Moldova (2003), honorary Professor of the Petrovsky national research center of the Russian Academy of medical Sciences and the Bashkir medical College. Academician V. D. Fedorov is the main national representative in the International society of surgeons (1990) national representative in the International society of University surgeons Coloproctology. Mr Kuznetsov – laureate of the State prize of the USSR (1985) and the RSFSR (1991), RF Government prize (2002), Honored scientist of Russia (1997), awarded the order of red banner of Labor (1976, 1978), Lenin (1983), "For merits before Fatherland" III degree, Friendship of peoples (1993).

B a c k g r o u n d . Scientific archievements of academician Dmytro Bahalii, the author of more than 600 historical studies, in the field of literary studies include only up to fifty works. This article analysis for the first time the Shevchenko studies of D. Bahalii, which he worked on mostly at the end of his life. M e t h o d s . The article wrote using general scientific methods (analysis, synthesis, description, generalization), historical-literary, textological, and source studies (biographical, cultural-historical, comparative, heuristic, critical). R e s u l t s . The work of the scientist in researching of documents and legends about the poet are clarified. The contribution of scientist to establishing the role of the Cyril and Methodius brotherhood in the life and work of T. Shevchenko is outlined. A review of D. Bahalii work aboute the Cyril-Methodius was introduced into scientific circulation. The participation of D. Bahalii in the appearance of some editions of T. Shevchenko's works: "Kobzar" (1918), "Heretic", "Dream. Caucasus: two poems" (both – 1927) was determined. During the preparation of the article, the history of the appearance of 12 drawings for the "Kobzar" (1918) created by Karel Nemets was found out. The employment of the Committee for organizing the publication of T. Shevchenko's works under the leadership of D. Bahalii is outlined. The scientist reviewed the eighth volume of the artistic heritage for a complete collection of works of the poet and artist, prepared by Ol. Novytskyi. For the first time, a number of documents from the archive of D. Bahalii are introduced into scientific circulation, for example, the article "Seventieth anniversary of the death of T. H. Shevchenko", autographs of published works, protocols of 1929–1930th years, official letters. All these materials are stored in the Department of Manuscript Collections and Textology of T. H. Shevchenko Institute of Literature of the National Academy of Sciences of Ukraine (f. 37) C o n c l u s i o n s . D. Bahalii researching in Shevchenko studies includes only three books, several prefaces, and more than ten scientific and scientific popularization articles. As one of the organizers and the first head of the Taras Shevchenko Institute, D. Bahalii together with his employees, despite persistent attempts by the authorities to turn the poet and the Institute named after him into a mouthpiece of the Marxist-Leninist ideology, managed to establish the authority of this institution and lay the foundation for its further development.

Abstract Immune checkpoint blockade is effective for a subset of patients across many cancers, but most patients are refractory to current immunotherapies and new approaches are needed to overcome resistance. The protein tyrosine phosphatase PTPN2 is a central regulator of inflammation, and genetic deletion of PTPN2 on either tumour cells or host immune cells promotes anti-tumour immunity. However, inhibitors of PTPN2 with suitable pharmacokinetic properties for oral administration have not been described. Here, we present the characterization of ABBV-CLS-484 (A484), a potent active site inhibitor of PTPN2 and the closely related phosphatase PTPN1. A484 treatment in vitro amplifies the response to interferon gamma, and monotherapy A484 treatment generates robust anti-tumour immunity in several murine cancer models. Through in vivo studies and single cell transcriptional profiling of tumour-infiltrating lymphocytes (TIL) from A484-treated mice, we show that A484 inflames the tumour microenvironment and promotes CD8+ T cell function by enhancing cytokine signaling and decreasing T cell exhaustion and dysfunction. Our results demonstrate that oral administration of small molecule inhibitors of PTPN2/N1 can induce potent anti-tumour immunity in mouse models. PTPN2/N1 inhibitors offer a promising new strategy for cancer immunotherapy and are currently being evaluated clinically in patients with advanced solid tumours (NCT04777994). More broadly, our study shows that small molecule inhibitors of key intracellular immune regulators can achieve efficacy comparable to current antibody-based immune checkpoint blockade in preclinical models. Finally, to our knowledge A484 represents the first active-site phosphatase inhibitor to enter clinical evaluation for cancer immunotherapy and may pave the way for additional therapeutics targeting this important class of enzymes. Citation Format: Hakimeh Ebrahimi-Nik, Arvin Iracheta-Vellve, Kira E. Olander, Thomas R.G. Davis, Sarah Y. Kim, Mitchell D. Yeary, James C. Patti, Tyler M. Balon, Omar Ismail Avila, Cun Lan Chuong, Meng-Ju Wu, Christina K. Baumgartner, Keith M. Hamel, Kathleen A. McGuire, Rebecca Mathew, Carey Backus, Ian C. Kohnle, Zhaoming Xiong, Elliot P. Farney, Jennifer M. Frost, Geoff T. Halvorsen, Matthew Rees, Andrew Boghossian, Melissa Ronan, Jennifer A. Roth, Todd R. Golub, Gabriel K. Griffin, Nabeel El-Bardeesy, Clay C. Beauregard, Philip R. Kym, Kathleen B. Yates, Robert T. Manguso. Small molecule inhibition of PTPN2/1 inflames the tumour microenvironment and unleashes potent CD8+ T cell immunity [abstract]. In: Proceedings of the AACR Special Conference: Tumor Immunology and Immunotherapy; 2022 Oct 21-24; Boston, MA. Philadelphia (PA): AACR; Cancer Immunol Res 2022;10(12 Suppl):Abstract nr A41.

Background. Keratoconus is a progressive ectatic disease with thinning and bulging of the cornea structure. It is characterized by a bilateral and usually asymmetric course, which is manifested by the formation of irregular astigmatism. Several different combinations of treatments are currently being used to stop the progression of keratoconus and increase visual acuity.&#x0D; Aim. To assess the effectiveness of three-step treatment for progressive keratoconus to stabilize the cornea, eliminate its irregularity and achieve maximum visual acuity.&#x0D; Material and methods. A triple combined treatment was applied to 48 patients (24 women and 24 men) with stage 23 keratoconus (67 eyes) aged 1631 years (mean age 24.40.21 years) at the National Center of Ophthalmology named after Academician Zarifa Aliyeva between 2017 and 2019. It consisted of intrastromal corneal ring implantation, corneal crosslinking after 24 hours, and topography-guided transepithelial photorefractive keratectomy (PRK) after 8 months. All patients underwent complex examinations: uncorrected visual acuity and best spectacle-corrected visual acuity, autorefractometry, non-contact tonometry, corneal topography, tomography, optical coherence tomography of the anterior segment, ultrasound pachymetry. The statistical significance of the difference between the data before and after treatment was assessed by using analysis of variance in the data analysis package of the Microsoft Excel software.&#x0D; Results. Uncorrected visual acuity before surgery was 0.20.041 and ranged between 0.04 and 0.3. Twelve months after surgery, uncorrected visual acuity significantly improved in all patients; its average value was 0.50.048 and ranged between 0.2 and 0.7. An improvement was observed in best spectacle-corrected visual acuity, which ranged between 0.20.5 before surgery and 0.40.8 after surgery. After intrastromal corneal ring implantation + corneal crosslinking + topography-guided transepithelial-PRK, residual refractive errors of the cornea were eliminated. The maximum keratometry (Kmax) decreased from 46.157.3 D to 42.149.9 D (M and SD before surgery 50.01.5 and after surgery 45.21.4, p=0.009), astigmatism also decreased from 5.259.25 to 0.53.25 cyl (M and SD before surgery 4.610.50 and after surgery 4.180.48, p=0.025). No complications were observed during and in the postoperative period.&#x0D; Conclusion. The three-step treatment of progressive keratoconus will avoid the need for keratoplasty and achieve maximum visual acuity, minimize the number of aberrations and halts the progression of keratoconus.

Purpose. From July 1 to July 16, 2019, a base of the West Siberian archaeological detachment of IAE SB RAS in the Vengerovsky District of the Novosibirsk Region became the venue for the field archaeological school “Multidisciplinary research of the Paleometal era multilayer archaeological assemblages”. The school was organized for students, graduate students and young scientists from Novosibirsk State University, Novosibirsk State Pedagogical University, Tomsk State University, Tyumen State University, Altai State Pedagogical University, and Siberian Federal University. Results. As part of the school, students attended nine lectures and participated in four master classes and workshops. The lectures were given by experts of the IAE SB RAS, namely academician V. I. Molodin, doctor of history L. N. Mylnikova, candidate of history I. A. Durakov, candidate of history N. S. Efremova, candidate of history L. S. Kobeleva, candidate of history M. S. Nesterova, candidate of history D. V. Selin. The listeners got acquainted with modern approaches and methods of excavating multilayer archaeological assemblages of the Paleometal era, methods of analyzing the data obtained and interdisciplinary methods for studying archaeological artifacts. Special master classes and participation in the excavation of the sites took place at two multilayer sites Tartas-1 and the burial ground Ust-Tartassky mounds (settlement Karier-Tai-1). Conclusion. The students were exposed to various stages of site studies, such as sampling the horizons of the cultural layer, disassembling objects made for various purposes (pits, burials, foci, ditches), etc. University students obtained advanced training diplomas and certificates of completing a field course.

The school of academician Vladimir Peretz became the basis of modern historical and philological studies of the Russian Middle Ages. Varvara Adrianova-Peretz and Nikolai Gudziy were his students in Kiev and Igor Eremin at Petrograd University. The paper considers the attitude of the older generation of V. N. Peretz’s students to the younger ones by considering the example of I. P. Eremin. The research material is the long-term correspondence of Adrianova-Peretz and Gudziy stored at the Institute of Russian Literature. The letters mainly concern scholarly issues, situation in the Pushkin House, and staff of the Department of Old Russian Literature. Eremin worked in the Department since 1934. In her letters written in the 1930s, Varvara Pavlovna talks about Eremin’s participation in collective works, expresses concern about his personal life and writes about his connections with the Academy of Sciences of Ukraine. Since 1947, when Adrianova-Peretz took over the management of the Department, her relationship with Eremin became quite complicated. While recognizing Eremin’s talent and efficiency, Varvara Pavlovna expressed her preference in organizing the work in the Department not to V. N. Peretz’s pupils (I. P. Eremin and M. O. Skripil) but to her own, D. S. Likhachev, who became the head of the Department in 1954 to work with his own students. Eremin’s activities limited to the Pushkin House were fully concentrated on Leningrad University where he established his own school in the tradition of V. N. Peretz, with L. Dmitriev, N. Demkova, and E. Romodanovskaya being its members.

Работа представляет собой обзор научных исследований влияния антиоксидантов-геропротекторов на старение экспериментальных животных и репликативное старение диплоидных клеток человека, выполненных в отделе кинетики химических и биологических процессов «ХИМБИО» Института химической физики АН СССР под руководством академика Николая Марковича Эмануэля в 1960- 1980- е гг. В работах Н.М. Эмануэля и сотрудников было установлено неизвестное ранее явление взаимодействия ингибиторов свободнорадикальных реакций в процессах окисления органических веществ, заключающееся в регенерации более эффективного ингибитора вследствие переноса атома водорода к его радикалу от молекулы менее эффективного ингибитора. Антиоксиданты поливалентны и могут влиять одновременно на многие процессы старения. Данные научной школы Н.М. Эмануэля по увеличению средней продолжительности жизни на 25,3 % и максимальной продолжительности мышей на 55,8 % под действием антиоксидантов, полученные в результате хорошо обоснованных экспериментальных и теоретических исследований, явились весомым аргументом в пользу свободнорадикальной теории старения. The work is aimed to review the results of scientific studies of the effect of antioxidants-geroprotectors on the aging of experimental animals and the replicative aging of human diploid cells, carried out in the Department of Kinetics of Chemical and Biological Processes «KHIMBIO» of the Institute of Chemical Physics of the USSR Academy of Sciences under the leadership of academician Nikolay Markovich Emanuel in the 1960-1980s after pioneer work by D. Harman. By N.M. Emanuel and colleagues, it was established a previously unknown phenomenon of radical interaction of inhibitors in the oxidation of organic substances, which consists in the regeneration of a more effective inhibitor due to the transfer of a hydrogen atom to its free radical from a molecule of a less effective inhibitor. Antioxidants are polyvalent and can simultaneously affect many stages of aging processes. Data from the N.M. Emanuel scientific school on the increase of the average lifespan of mice by 25,3 % and their maximum lifespan by 55,8 % using antioxidants, discovered at the Institute of Chemical Physics of the USSR Academy of Sciences as a result of well-founded experimental and theoretical studies, became a powerful argument in favor of the free radical theory of aging in 1970-ties. This was further promoted by approaches based on the theory of reliability, the damage theory, and as well as an approach based on oxidative activation of the Nrf2 signaling pathway, which maintains the «nucleophilic tone» of protective oxidoreductases.

BackgroundImmune checkpoint inhibitor therapy, or ICI, is currently the most successful treatment option for patients with renal cell carcinoma (RCC). However, only 20% of patients have a durable response,1 driving a significant need to improve treatment outcomes. The tumor microbiome has recently been shown to play a role in chemotherapy-based treatment outcomes, but, to our knowledge, no study has explored its role in response to ICIs.2–4MethodsTumor samples were collected from 22 patients with RCC as a part of the Total Cancer Care program at The Ohio State University Comprehensive Cancer Center. Raw RNA-seq reads from these biopsies, as well as data on the responses to ICI therapy were collected. Response evaluation was based on RECIST v1.1 criteria with complete or partial response, or stable disease classified as ”Responders,”, and progressive disease classified as ”Non-responsders”. The RNA-seq reads were processed through a pipeline developed by the Spakowicz lab, known as ExoTIC (Exogenous sequences in Tumor and Immune Cells), to carefully identify exogenous sequences.5 6 Reads that don’t align to the human reference genome are meticulously filtered of (1) common laboratory contaminants, (2) taxa that inversely correlate with input RNA quantity, and (3) taxa commonly found in the negative controls of microbiome experiments. DESeq2 was used to perform a differential abundance analysis on the comparison groups at every taxonomic level.ResultsThe 22 patients with RCC range from 22 to 74 years of age at diagnosis, are 72.7% male, and 54.5% responded to ICIs. Exogenous taxa are identified in the tumor RNAseq, including bacteria, fungi, and viruses (figure 1). Within the tumors responsive to immunotherapy, there was found to be a significant enrichment of certain microbial species, including Bacillus thuringiensis, Comamonas testosteroni, Colletotrichum higginsianum, and Elaeis guineesis. Comparatively, the cohort of non-responsive tumors was found to have a significant enrichment of Candidatus Promineofilum breve, Clostridioides difficile, Nocardia cyriacigeorgica, Streptomyces sp. CdTB01, and Streptomyces venezuelae (figure 2).Abstact 942 Figure 1Relative abundances of exogenous taxa found in tumor RNAseq are shown in a stacked bar plotAbstact 942 Figure 2Differential abundance analysis of taxa found within tumor RNAseq data by the exotic pipeline. Colored points represent significantly (pvalue &lt; 0.05) enriched taxa with a high (&gt;2.5) fold-difference in abundance between the groupsConclusionsWe found that prior to ICI treatment the tumor microbiome of patients with RCC whose tumors responded to immunotherapy vary from those that did not respond to treatment. This implies that a therapeutic target to modify the tumor microbiome to improve treatment outcomes. Future research will evaluate whether these correlations are causally associated with outcomes and will evaluate their effect on the tumor microenvironment including immune cell infiltration.AcknowledgementsThe authors acknowledge the support and resources of the Ohio Supercomputing Center (PAS1695).ReferencesCiccarese C, Di Nunno V, Iacovelli R, Massari F. Future perspectives for personalized immunotherapy in renal cell carcinoma. Expert opinion on biological therapy. Taylor &amp; Francis. 2017;17(9):1049–1052.Geller LT, Barzily-Rokni M, Danino T, Jonas OH, Shental N, Nejman D, Gavert N, Zwang Y, Cooper ZA, Shee K, Thaiss CA, Reuben A, Livny J, Avraham R, Frederick DT, Ligorio M, Chatman K, Johnston SE, Mosher CM, Brandis A, Fuks G, Gurbatri C, Gopalakrishnan V, Kim M, Hurd MW, Katz M, Fleming J, Maitra A, Smith DA, Skalak M, Bu J, Michaud M, Trauger SA, Barshack I, Golan T, Sandbank J, Flaherty KT, Mandinova A, Garrett WS, Thayer SP, Ferrone CR, Huttenhower C, Bhatia SN, Gevers D, Wargo JA, Golub TR, Straussman R. Potential role of intratumor bacteria in mediating tumor resistance to the chemotherapeutic drug gemcitabine. Science 2017 September 15;357(6356):1156–1160. PMID: 28912244.Nejman D, Livyatan I, Fuks G, Gavert N, Zwang Y, Geller LT, Rotter-Maskowitz A, Weiser R, Mallel G, Gigi E, Meltser A, Douglas GM, Kamer I, Gopalakrishnan V, Dadosh T, Levin-Zaidman S, Avnet S, Atlan T, Cooper ZA, Arora R, Cogdill AP, Khan MAW, Ologun G, Bussi Y, Weinberger A, Lotan-Pompan M, Golani O, Perry G, Rokah M, Bahar-Shany K, Rozeman EA, Blank CU, Ronai A, Shaoul R, Amit A, Dorf-man T, Kremer R, Cohen ZR, Harnof S, Siegal T, Yehuda-Shnaidman E, Gal-Yam EN, Shapira H, Baldini N, Langille MGI, Ben-Nun A, Kaufman B, Nissan A, Golan T, Dadiani M, Levanon K, Bar J, Yust-Katz S, Barshack I, Peeper DS, Raz DJ, Segal E, Wargo JA, Sandbank J, Shental N, Straussman R. The human tumor microbiome is composed of tumor type–specific intracellular bacteria. Science 2020 May 29;368(6494):973–980.Poore GD, Kopylova E, Zhu Q, Carpenter C, Fraraccio S, Wandro S, Kosciolek T, Janssen S, Metcalf J, Song SJ, Kanbar J, Miller-Montgomery S, Heaton R, Mckay R, Patel SP, Swafford AD, Knight R. Microbi-ome analyses of blood and tissues suggest cancer diagnostic approach. Nature 2020;579(7800):567–574. PMID: 32214244.Malalur, Pannaga, Mo, Xiaokui, Hoyd, Rebecca, Hays, John, Carbone, David, Spakowicz, Daniel. Investigating intra-tumor microbes, blood microbes, and CEA for development of non-invasive biomarkers in colorectal cancer. Journal of Clinical Oncology 2021;39(15_suppl): 3551–3551.Malalur PG, Mo X, Hoyd R, Carbone DP, Spakowicz D. Intra-tumoral microbes and overall survival in colorectal cancer patients. Journal of Clinical Oncology 2020;38(15_suppl):4083–4083.Ethics ApprovalData were obtained through an IRB-approved Honest Broker protocol (2015H0185) supporting the Total Cancer Care protocol 2013H0199.

The article analyzes two unsuccessful attempts of Mikhail Mikhailovich Zavadovsky (1891–1957), prominent specialist in the field of physico-chemical biology, parasitology, endocrinology, and developmental biology, Academician of the Lenin All-Union Academy of Agricultural Sciences (1935), to become a member of the USSR Academy of Sciences that took place in 1938–39 and in 1946 and possible reasons for his failure. The historical literature devoted to Zavadovsky is scarce; the history of his election to the USSR Academy of Sciences has never been studied, and thus, studying it would be an important step towards creating thorough biography of the scientist. When writing this article, such basic methods of historical research as narrative and prosopographic ones have been used. To achieve the declared goal, identification and analysis of relevant archival sources has been carried out. The documents on Zavadovsky?s election discovered to date are preserved in the Archive of the Russian Academy of Sciences; of them of the greatest interest are two scientist’s personal files from the collection of personal files of candidates for full and corresponding members of the USSR Academy of Sciences balloted in 1939, materials from Zavadovsky?s personal fond, and materials from the fonds of the Department of Mathematical and Natural Sciences of the USSR Academy of Sciences, the Department of Biological Sciences of the USSR Academy of Sciences, and the Secretariat of the Presidium of the USSR Academy of Sciences. The article shows that in 1938 Zavadovsky was nominated a candidate for full membership in the USSR Academy of Sciences by a group of scientists representing various research and educational institutions, as well as by the Moscow State University. However, his candidacy did not pass the first filter in the election process, a special commission of the Department of Mathematical and Natural Sciences of the USSR Academy of Sciences, created to discuss candidates for full members of the Academy. Probably, this happened because he had to compete in the elections with T. D. Lysenko and his associates; in any case, there was criticism of Zavadovsky as Lysenko’d antagonist and it even reached public sphere. In 1946, Zavadovsky made a second attempt to be elected, already in status of the Stalin Prize laureate, which he received in the same year; this time he was nominated as a candidate for full member of the USSR Academy of Sciences by the Academic Council of the Faculty of Biology of the Saratov State University. However, he faced certain formal obstacles. The Department of Biological Sciences of the Academy of Sciences of the USSR had five full member vacancies: two in botany, two in microbiology and biochemistry, and one in evolutionary physiology; thus, Zavadovsky, nominated in zoology, was unable to take part in the election for formal reasons. L. S. Stern?s proposal to consider him as physiologist (which was true) could not be implemented, as unidentified government commission classified Zavadovsky as geneticist, and he was to be discussed in this group in the status of a candidate for corresponding member of the Academy. Due to objective reasons, he could not compete with specialists in the field of genetics and was not elected, although showed very decent voting results. Summing up, it can be stated that Zavadovsky failed in his election to the USSR Academy of Sciences not because he did not deserve the title, but for formal, personal, and political reasons.

Introduction. The article is devoted to insufficiently studied history of founding of the leading scientific legal institution of Ukraine. On a purely documentary basis, with the introduction to the scientific circulation of new archival materials the events that accompanied the creation of the State and Law Branch in the AS UkrSSR system are highlighted and analyzed. The circumstances that accompanied the foundation of the Institute were analyzed for the first time in 1999 by the academician Yu. S. Shemshuchenko. The aim of the article. The purpose of this exploration is to complete the scientific reconstruction of the process of founding of our institute through the introduction of new archival documents into the scientific circulation, clarification of the author's idea of creating the institute, deepening of the understanding of the position of the state institutions of the UkrSSR and the USSR and the personal role of the academician V. M. Koretsky in this process. Results. A true history of legal science is only possible on the basis of a critical understanding of the primary sources, the search of which was the most important component of this study. The author analyzed the little-known published documents; the documents from the funds of the Central State Archives of Public Associations of Ukraine, the Central State Archives of Higher Authorities and Administration of Ukraine and the State Archives of the Russian Federation that have been introduced into scientific circulation; generalized information from the materials of the scientific archive of the Koretsky Institute of State and Law and some other primary sources. The question of formation of the idea of creating a legal academic institute and its development in the decisions of state, communist and academic structures is investigated. Particular attention is paid to Professor V. I. Boshko's appeal to the Central Committee of the Communist Party of Ukraine (b) on the expediency of establishing of a Law Institute in the system of the Academy of Sciences of the Ukrainian SSR, registered on April 4, 1947, and the figures of those party functionaries (who also happened to be highly qualified scientists at the same time) directly involved in reviewing this appeal. Сonclusions. Many well-known personalities and qualified scientists have made efforts to establish an academic law institution in Ukraine. At the same time, no confirmation has been found for the thesis about the decisive role of D. Z. Manuilskyi in this process, as well as for the opinion that the academic institution of the legal profile was needed first and foremost for the theoretical substantiation of the international legal personality of the Ukrainian SSR. Ways of further investigation of the problem are proposed, and a proposal for publishing of a large collection of documents and materials on the basis of an in-depth archival search is introduced.

Background. The article highlights the precedent of complex improvisational modeling of semantics in a prose work. The functionality and practice of its implemen-tation in popular intermediate forms with paratextual involvement, in particular, the phe-nomena of visual discourse are considered. Purpose. The figurative solution corresponding to a separate – complementary – model is contained in the concept of publishing M. Prodanovich's novel "Red handker-chief made of pure silk", where in a complementary configuration a combination of in-termediate photographic reproduction of the fresco by Fra Angelico is presented. Results. In the figurative experience, formed in the work of M. Prodanovich's novel “Red handkerchief of pure silk”, improvisation is distinguished, commensurate with the complementary combination of manifestations of intermedia strategy with forms of intertextual relations: in its design, conceptual and purposeful paratextual-intermediate combination, which achieves special significance in empirical terms. A clear precedent testifies to the borderline functionality of paratextuality in its systematic connection with different intermediate variants produced by samples of different types of fine arts. From this definitive position, the nonmonoform system of figurative equiv-alents of different types of comparative strategies, inherent in M. Prodanovich's novel, undoubtedly justifies special attention, where the construction and valence of diverse, commensurate sign systems. The diversity of meaning-making focuses on the modes of supporting humanistic postulates and universal values, which becomes the quintessence for the figurative equivalents of paratextual-intermediate configurations combined in the intermedia-intertextual figurative formula of complementary unity. Key words: paratextuality, intermediality, meaning-making, M. Prodanovich, Fra Angelico. Aidachich, D., 2010. Cruel theater for a cruel reality (about violence in the novel “Elisha in the Land of the Holy Carp” by Mileta Prodanovich). In: Aidachych D. Slavic Studies: Folklore, Literary, Linguistic. Kyiv: VPC “Kyiv University”.(In Ukrainian) Argan, J. K., 1990. History of Italian art, 1. Moscow: Raduga. (In Russian) Bilyk, N. L., 2018. Strategies of comparative studies in the Serbian novel at the turn of the XX–XXI centuries. Kyiv: Osvita Ukrajiny. (In Ukrainian) Božović, G. Literature is the best product of Serbian society. (e-resource). Available: http://www.plastelin.com/content/view/16/89/ [Accessed July 15, 2021] (In Croatian) Conversation with Mileta Prodanovich, 2008. In: Decoration: history, culture, art. Ukrainian-Serbian collection, 1 (3). (In Ukrainian) Genette, G., 1982. Palimpsests: Literature in the second degree. Moscow: Nauchnyj mir. (In Russian) Merenik, L., 2008. Mileta Prodanovych – self-consciousness of a postmodern artist in a time of crisis. In: Decoration: history, culture, art. Ukrainian-Serbian collection, 1 (3). (In Ukrainian) Merenik, L., 2011. Mileta Prodanović: to be in a place, to be, to be everywhere. Belgrade: Fund Vujčić collection. (In Croatian) Mileta Prodanovich: I am "trained" to notice the smallest details: Interview (electronic resource). In: Litakcent. 2009. April 13. Available: http://litakcent.com/2009/04/13/mileta-prodanovych-ja-natrenovanyj-pomichaty-najdribnishi-detali/ [Accessed July 15, 2021] (In Ukrainian) Prodanovic, M., 2008. Red handkerchief made of pure silk. Belgrade: Pillar culture. (In Serbian) Prodanovich, M., 2009. Garden in Venice. The Universe, 5–6. (In Ukrainian) Prodanovich, M., 2013. Ultramarine: Novel. Kyiv: Tempora. (In Ukrainian) Prodanovich, M., 2015. Arcadia. Kyiv: Tempora. (In Ukrainian) Rudnev, V. P., 1999. Dictionary of culture of the twentieth century. Moscow: AGRAF. (In Russian) Shaitanov, I., 2011. Triad of modern comparative studies: globalization – intertext – dialogue of cultures. In: Problems of modern comparative studies. Moscow: Journal “Vo-prosy literatury”. (In Russian) Sivachenko, G. M., 1993. Paradoxes of the Slovak novel. Kyiv: Naukova dumka. (In Ukrainian) Tatarenko, A., 2010. Poetics of form in the prose of postmodernism (the experience of Serbian literature). Lviv: PAIS. (In Ukrainian) Yarmak, V. I, 2010. Stylistic features of the use of preterite verb forms in Mileta Prodanovich's novel "Garden in Venice" and in its translation into Ukrainian. In: Comparative Studies of Slavic Languages and Literatures: In Memory of Academician Leonid Bulakhovsky, 12. (In Ukrainian)

Abstract Immune checkpoint blockade is effective for a subset of patients across many cancers, but most patients are refractory to current immunotherapies and new approaches are needed to overcome resistance. The protein tyrosine phosphatase PTPN2 is a central regulator of inflammation, and genetic deletion of PTPN2 on either tumor cells or host immune cells promotes anti-tumor immunity. However, inhibitors of PTPN2 have not been described. Here, we present the validation of ABBV-CLS-484, a potent catalytic inhibitor of PTPN2 and the closely related phosphatase PTPN1. ABBV-CLS-484 treatment of tumor cells in vitro phenocopies the genetic deletion of PTPN2/N1, causing both amplified transcriptional responses to IFNg and reduced cell viability across human cancer cell lines. Monotherapy ABBV-CLS-484 treatment generates robust anti-tumor immunity in several murine cancer models with efficacy comparable to anti-PD-1 treatment. Through genetic studies, we show that while ABBV-CLS-484 can act on both tumor cells and the host immune system, IFN sensing and PTPN2/N1 expression on tumor cells are not always required for efficacy, suggesting that PTPN2/N1 inhibition on host immune cells may be sufficient for activity of the drug. Through scRNAseq profiling of TILs from both ABBV-CLS-484-treated and anti-PD-1-treated tumors, we show that ABBV-CLS-484 induces unique transcriptional changes to both myeloid and lymphoid populations in the tumor microenvironment which are dominated by enhanced IFN sensing and a shift from suppressive to pro-inflammatory phenotypes. ABBV-CLS-484 treatment enhances the activation and effector functions of CD8+ T cells while decreasing the expression of genes classically associated with T cell exhaustion and dysfunction such as Tox. The efficacy of ABBV-CLS-484 is critically dependent on CD8+ T cells and treatment with ABBV-CLS-484 results in greater levels of T cell infiltration into tumors and a more diverse repertoire of expanded T cell clones relative to anti-PD-1. Thus, the PTPN2/N1 inhibitor ABBV-CLS-484 is a highly effective immunotherapy with monotherapy efficacy across mouse tumor models. Small molecule inhibitors of PTPN2 offer a promising new strategy for cancer immunotherapy by targeting an IFN signaling checkpoint and are currently being evaluated clinically in patients with advanced solid tumors (NCT04777994). Citation Format: Arvin Iracheta-Vellve, Hakimeh Ebrahimi-Nik, Thomas R. Davis, Kira E. Olander, Sarah Y. Kim, Mitchell D. Yeary, James C. Patti, Ian C. Kohnle, Christina K. Baumgartner, Keith M. Hamel, Kathleen A. McGuire, Cun Lan Chuong, Zhaoming Xiong, Elliot P. Farney, Jennifer M. Frost, Matthew Rees, Andrew Boghossian, Melissa Ronan, Jennifer A. Roth, Todd R. Golub, Gabriel K. Griffin, Clay Beauregard, Philip R. Kym, Kathleen B. Yates, Robert T. Manguso. Targeting the immune checkpoint PTPN2 with ABBV-CLS-484 inflames the tumor microenvironment and unleashes potent CD8+ T cell immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 606.

The article is devoted to the publication of materials of several Scythian burials on the Dnipro Pryporyzhya territory in 1927—1932. An archeological expedition was founded under the direction of Academician D. Ya. Yavornytsky, in connection with the construction of the Dnieper Hydroelectric Power Plant. Many Scythian antiquities had been explored in the archaeological sites of other epochs. Its members were actively working well-known archaeologists, beginning specialists and local historians: A. V. Dobrovolskyj, M. Ya. Rudynskyj, S. S. Gamchenko, P. I. Smolichev, M. O. Miller, T. T. Kyraniv, G. G. Martens, V. A. Grinchenko, P. A. Kozar, F. M. Sapyan, L. E. Kistyakivskyj and other. Almost S. Magura conducts his researches in this region.&#x0D; The cemetery at the Gadiucha Balka on the northern right bank of Dnipro river in Zaporoizhya included both barrows and prevailing burials without embankments, and stone laying on the surface. Necropolis was founded in the Vth century BC, and was used in the IVth BC. There is a high percentage of burials with weapons comparing with similar monuments. The most interesting is the burial 3 in group 1. There are two pits without bones under the stone pavement. A set of bronze arrowheads, an iron spear, bits with cheeck-peaces, and also a part of the horn of a deer was founded in this cenotaph.&#x0D; Mound grave predominated over burials without a mound in the necropolis near Dniprozavodbud. Necropolis functioned in the V—IV centuries. BC. Two burials from the grave 36 survived. They belonged to a woman, accompanied by a mirror and a necklace, as well as a warrior with a quiver set. Barrow 4 contained a ruined burial. The skeleton was accompanied by a bronze cheeck-peace.&#x0D; Mound grave burials dominated in the burial groups of the Kichkas while stone pavements were only a quarter. In the grave 6 at the Kichkas railway station, the burial was performed in the pit, where the arrowhead was found. Details of the bridle and bronze knife were founded at the periphery of the complex. The archaeological site refers to the early middlescythian time.&#x0D; Barrow 9 in the village Kushugum was girded with a stone fastener and had 0.79 m height and a diameter — 24 m. Objects of bridle (zoomorphic plates, buckles) was founded in its burial mound. A burial in an oval pit was inside. The skeleton lay stretched out on its back, its head to the west. Arrowheads was in a grave. The burial can be dated the 2nd quarter — the middle of the 5th century BC.&#x0D; It is established that the tradition of the construction of stone piles in the non-kurgan cemeteries on the Lower Dnieper goes back to the Bronze Age and the pre-Scythian period. Perhaps this indicates the residence of a part of the sedentary autochthonous population here for such a long time, which has carried this tradition through the ages.

The main directions and results of the activity of the famous talented scientist and teacher of the Lviv Geodetic School, professor A.L. Ostrovsky. On January 19, 2023, the Lviv geodetic community honored the 100th anniversary of the birth of Ostrovsky Apollinariy Lvovich – an outstanding scientist, professor, teacher known in Ukraine and abroad. Professor A. L. Ostrovsky published more than 200 scientific works, dozens of methodical developments in geodesy, topography; instrument science, he owns 11 copyright certificates and inventions. The birth of the Lviv School of Refraction is connected with the then professors of the Lviv Polytechnic Institute A. D. Motornyy and M. K. Mygal, and the first studies of the influence of atmospheric refraction on geodetic measurements were initiated by A. L. Ostrovsky To a large extent, the success in this work was brought about by the scientific activity of the employees of the branch research laboratory, which was managed by Apollinariy Lvovych in 1979–2006. This is how the Lviv Geodetic School of Refraction, known in the scientific world, was created. For many years, Prof. A. L. Ostrovsky headed the regional specialized Council for the defense of doctoral theses in geodesy, actively worked in the Educational and Methodological Council of the Ministry of Education and Culture of Ukraine, in the editorial boards of all scientific journals on geodesy and engineering geodesy published in Ukraine, and was the first editor-in-chief of the scientific journal Geodynamics. He was the scientific supervisor of almost 30 applicants who worked on candidate and doctoral theses. Among the pupils and students of Prof. A. L. Ostrovsky was an academician of the National Academy of Sciences of Ukraine Ya.S. Yatskiv, more than ten leading geodesist professors, many heads of geodetic enterprises and institutions in Ukraine and abroad. The fruitful scientific, pedagogical and professional activity of Prof. A. L. Ostrovsky brought him well-deserved respect in the scientific world and geodetic production, and was awarded high titles – Honored Worker of Science and Technology of Ukraine, “Honorary Surveyor of the USSR”, “Honorary Surveyor of Ukraine”, awarded with the Order of Merit III degree, and many honorary awards and medals. Professor A. L. Ostrovsky was a scholarship recipient of the President of Ukraine. Evidence of the unparalleled authority and deep respect on the part of the scientific geodetic community for A.L. Ostrovsky is the fact that he was elected as the head and honorary chairman of the organizing committee of the International Scientific and Technical Symposium “Geodetic Environmental Monitoring: GPS and GIS Technologies”, which has been held annually for many years worked in Alushta (Crimea).

Nikolai Nikolaevich Luzin&rsquo;s life (1883&ndash;1950) and work of this outstanding Russian mathematician, member of the USSR Academy of Sciences and foreign member of the Polish Academy of Arts and Sciences, coincides with a very difficult period in Russian history: two World Wars, the 1917 revolution in Russia, the coming to power of the Bolsheviks, the civil war of 1917&ndash;1922, and finally, the construction of a new type of state, the Union of Soviet Socialist Republics. This included collectivization in the agriculture and industrialization of the industry, accompanied by the mass terror that without exception affected all the strata of the Soviet society. Against the background of these dramatic events took place the process of formation and flourishing of Luzin the scientist, the creator of one of the leading mathematical schools of the 20th century, the Moscow school of function theory, which became one of the cornerstones in the foundation of the Soviet mathematical school. Luzin&rsquo;s work could be divided into two periods: the first one comprises the problems regarding the metric theory of functions, culminating in his famous dissertation Integral and Trigonometric Series (1915), and the second one that is mainly devoted to the development of problems arising from the theory of analytic sets. The underlying idea of Luzin&rsquo;s research was the&nbsp;problem of the structure of the arithmetic continuum, which became the super task of his work. The destiny favored the master: the complex turns of history in which he was involved did not prevent, and sometimes even favored the successful development of his research. And even the catastrophe that broke out over him in 1936 &ndash; &ldquo;the case&nbsp;of Academician Luzin&rdquo; &ndash; ended successfully for him.

Electric and magnetic energy densities as well as energy flux (Poynting vector) for radial variant vector beam focusing through a dielectric interface is analyzed numerically based on vector diffraction theory. The electric and magnetic energy densities are tailored by properly manipulating the radial as well as initial phases to generates novel focal patterns in the focal area. These peculiar properties may find applications in fields such as optical trapping, optical recording, magnetic recording, and magnetic resonance microscopy and semiconductor inspection. Full Text: PDF References S.N. Khonina, I. Golub, "Optimization of focusing of linearly polarized light ", Opt. Lett. 36 352 (2011). CrossRef V.V. Kotlyar, S.S. Stafeev, Y. Liu, L. O'Faolain, A. A. Kovalev, "Analysis of the shape of a subwavelength focal spot for the linearly polarized light", Appl. Opt. 52 330 (2013). CrossRef S. Sen, M.A. Varshney, D. Varshney, "Relativistic Propagation of Linearly/Circularly Polarized Laser Radiation in Plasmas", ISRN Optics. 2013 1 (2013). CrossRef M. Martínez-Corral, R. Martínez-Cuenca, I. Escobar, G. Saavedra, "Reduction of focus size in tightly focused linearly polarized beams", Appl. Phys. Lett. 85 4319 (2004) . CrossRef J. Lekner, "Polarization of tightly focused laser beams", Opt. A: Pure Appl. Opt. 5, 6 (2003). CrossRef H. Guo, X. Weng, M. Jiang, Y. Zhao, G. Sui, Q. Hu, Y. Wang, S. Zhuang, "Tight focusing of a higher-order radially polarized beam transmitting through multi-zone binary phase pupil filters", Opt.Express 21, 5363 (2013). CrossRef C.-C. Sun, C.-K. Liu, "Ultrasmall focusing spot with a long depth of focus based on polarization and phase modulation", Opt. Lett. 28, 99 (2003). CrossRef G.H. Yuan, S.B. Wei, X.-C. Yuan, "Nondiffracting transversally polarized beam", Opt. Lett. 36, 3479 (2011). CrossRef P. Yu, S. Chen, J. Li, H. Cheng, Z. Li, W. Liu, B. Xie, Z. Liu, J. Tian, "Generation of vector beams with arbitrary spatial variation of phase and linear polarization using plasmonic metasurfaces", Opt. Lett. 40, 3229 (2015). CrossRef Z. Chen, T. Zeng, B. Qian, "Complete shaping of optical vector beams", J. Ding, Opt. Express 23, 17701 (2015). CrossRef Z. Liu, Y. Liu, Y. Ke, Y. Liu, W. Shu, H. Luo, S. Wen, "Generation of arbitrary vector vortex beams on hybrid-order Poincaré sphere", Photon. Res. 5, 15 (2017). CrossRef Z. Man, Z. Bai, S. Zhang, J. Li, X. Li, X. Ge, Y. Zhang, S. Fu, "Focusing properties of arbitrary optical fields combining spiral phase and cylindrically symmetric state of polarization", J. Opt. Soc. Am. A 35, 1014 (2018). CrossRef Z. Man, S. Fu, G. Wei, "Focus engineering based on analytical formulae for tightly focused polarized beams with arbitrary geometric configurations of linear polarization", J. Opt. Soc. Am. A 34, 1384 (2017). CrossRef Z. Man et al, "Optical cage generated by azimuthal- and radial-variant vector beams", Appl. Opt. 57 (2018). CrossRef S.S. Stafeev, V.V Kotlyar, A.G. Nalimov, E.S. Kozlova, "The Non-Vortex Inverse Propagation of Energy in a Tightly Focused High-Order Cylindrical Vector Beam", IEEE Photon. J., 11, 1 (2019). CrossRef S.S. Stafeev, V.V. Kotlyar, "Elongation of the area of energy backflow through the use of ring apertures", Opt. Commun.450 (2019) 67-71. CrossRef S.S. Stafeev, V.V. Kotlyar, A.G. Nalimov, "Energy backflow in in a tightly focused high-order cylindrical vector beam", Proc. SPIE 11025, 1102518 (2019). CrossRef N.G. Orji, M. Badaroglu, B.M. Barnes, "Metrology for the next generation of semiconductor devices", Nat. Electron. 1, 532 (2018). CrossRef P. Torok, P. Varga, G.R. Booker, "Electromagnetic diffraction of light focused through a planar interface between materials of mismatched refractive indices: structure of the electromagnetic field. I", I, J. Opt. Soc. Am. A 12, 2136 (1995). CrossRef P. Torok, P. Varga, Z. Laczik, G.R. Booker, "Electromagnetic diffraction of light focused through a planar interface between materials of mismatched refractive indices: an integral representation", J. Opt. Soc. Am. A., 12, 325 (1995). CrossRef Z. Zhou, L. Zhu, "Tight focusing of high order axially symmetric polarized beams through a dielectric interface", Optik, 124, 2219 (2013). CrossRef J. Shu, Z. Chen, J. Pu, Y. Liu "Tight focusing of a double-ring-shaped, azimuthally polarized beam through a dielectric interface", J. Opt. Soc. Am. A 31, 1180 (2014). CrossRef K. Hu, Z. Chen, J. Pu., "Generation of super-length optical needle by focusing hybridly polarized vector beams through a dielectric interface", Opt. Lett. 37, 3303 (2012). CrossRef B. Richards, E. Wolf, "Electromagnetic diffraction in optical systems, II. Structure of the image field in an aplanatic system", Proc. R. Soc. London A 253, 358 (1959). CrossRef

Curriculum material is generally considered the subject matter of information, talents, dispositions, understandings, and principles that make up research programs in the field. At a more complex level, the curricula need to contain historical and socio-political strengths, traditions, cultural views, and goals with wide differences in sovereignty, adaptation, and local understanding that encompass a diversity of cultures, laws, metaphysics, and political discourse This study aims to develop a curriculum with local content as a new approach in early childhood science learning. The Local Content Curriculum (LCC) is compiled and developed to preserve the uniqueness of local culture, natural environment, and community crafts for early childhood teachers so that they can introduce local content to early childhood. Research and model development combines the design of the Dick-Carey and Dabbagh models with qualitative and quantitative descriptive analysis. The results showed that local content curriculum products can be supplemented into early childhood curricula in institutions according to local conditions. Curricula with local content can be used as a reinforcement for the introduction of science in early childhood. The research implication demands the concern of all stakeholders to see that the introduction of local content is very important to be given from an early age, so that children know, get used to, like, maintain, and love local wealth from an early age.&#x0D; Keywords: Early Childhood, Scientific Learning, Local Content Curriculum Model&#x0D; References:&#x0D; Agustin, R. S., &amp; Puro, S. (2015). Strategy Of Curriculum Development Based On Project Based Learning (Case Study: SMAN 1 Tanta Tanjung Tabalong South Of Kalimantan ) Halaman : Prosiding Ictte Fkip Uns, 1, 202–206.&#x0D; Agustina, N. Q., &amp; Mukhtaruddin, F. (2019). The Cipp Model-Based Evaluation on Integrated English Learning (IEL) Program at Language Center. English Language Teaching Educational Journal, 2(1), 22. https://doi.org/10.12928/eltej.v2i1.1043&#x0D; Altinyelken, H.K. (2015). Evolution of Curriculum Systems to Improve Learning Outcomes and Reduce Disparities in School Achievement, in Background paper prepared for the Education for All Global Monitoring Report 2015.&#x0D; Andrian, D. (2018). International Journal of Instruction. 11(4), 921–934.&#x0D; Andrian, D., Kartowagiran, B., &amp; Hadi, S. (2018). The instrument development to evaluate local curriculum in Indonesia. International Journal of Instruction, 11(4), 921–934. https://doi.org/10.12973/iji.2018.11458a&#x0D; Aslan, Ö. M. (2018). From an Academician’ s Preschool Diary: Emergent Curriculum and Its Practices in a Qualified Example of Laboratory Preschool. 7(1), 97–110. https://doi.org/10.5430/jct.v7n1p97&#x0D; Bakhtiar, A. M., &amp; Nugroho, A. S. (2016). Curriculum Development of Environmental Education Based on Local Wisdom at Elementary School. International Journal of Learning, Teaching and Educational Research, 3(3), 20–28.&#x0D; Barbarin, O. A., &amp; Wasik, B. H. (2009). Handbook of child development and early education. Guilford Press.&#x0D; Baron-gutty, A. (2018). Provision in Thai basic education”. March.&#x0D; Bodrova, E. (2008). Make-believe play versus academic skills: A Vygotskian approach to today’s dilemma of early childhood education. European Early Childhood Education Research Journal, 16(3), 357–369. https://doi.org/10.1080/13502930802291777&#x0D; Bohling-philippi, V., Crim, C., Cutter-mackenzie, A., Edwards, C., Desjean-perrotta, B., Finch, K., Brien, L. O., &amp; Wilson, R. (2015). International Journal of Early Childhood. 3(1), 1–103.&#x0D; Brooker, L., Blaise, M., &amp; Edwards, s. (2014). The SAGE handbook of play and learning in early childhood. Sage.&#x0D; Broström, S. (2015). Science in Early Childhood Education. Journal of Education and Human Development, 4(2(1)). https://doi.org/10.15640/jehd.v4n2_1a12&#x0D; Childhood, E., Needs, T., &amp; Han, H. S. (2017). Implementing Multicultural Education for Young Children in South Korea: Implementing Multicultural Education for Young Children in South Korea: Early Childhood Teachers’ Needs 1 ). March.&#x0D; Dabbagh, N &amp; Bannan-Ritland, B. (2005). Online Learning: Concepts, Strategies, and Application. Pearson Education, Inc.&#x0D; Dahlberg, G., Moss, P., &amp; Pence, A. (2013). Beyond quality in early childhood education and care: Languages of evaluation. Routledge.&#x0D; Dahlberg, G., Moss, P., &amp; Pence, A. (2013). Beyond quality in early childhood education and care: Languages of evaluation. Routledge.&#x0D; Daryanto. (2014). Pendekatan Pembelajaran Saintifik. Gava Media.&#x0D; Dick, C. &amp; C. (2009). The Sistematic Design of Instruction. Upper Saddle River.&#x0D; Elde Mølstad, C., &amp; Karseth, B. (2016). National curricula in Norway and Finland: The role of learning outcomes. European Educational Research Journal, 15(3), 329–344. https://doi.org/10.1177/1474904116639311&#x0D; Eurydice. (2018). Steering Documents and Types of Activities.&#x0D; Farid, MN. (2012). Peranan Muatan Lokal Materi Batik Tulis Lasem Sebagai Bentuk Pelestarian Budaya Lokal. Jurnal Komunitas, 4(1), 90–121.&#x0D; Fisnani, Y., Utanto, Y., Ahmadi, F., Tengah, J., Technology, E., Semarang, U. N., Education, P. T., Semarang, U. N., &amp; Info, A. (2020). The Development of E-Module for Batik Local Content in Pekalongan Elementary. 9(23), 40–47.&#x0D; Fitriani, R. (2018). The Effect of Scientific Approach Applied on Scientific Literacy to Student Competency at Class VIII Junior High School 12 Padang. International Journal of Progressive Sciences and Technologies (IJPSAT), 7(1), 97–105.&#x0D; Fleer, M. (2015). Pedagogical positioning in play-teachers being inside and outside of children’s imaginary play. Early Child Development and Care, 185(11–12), 1801–1814. https://doi.org/10.1080/ 03004430.2015.1028393&#x0D; Hakk, İ. (2011). Curriculum Reform and Teacher Autonomy in Turkey: The Case of the HistoryTeachi̇ng. International Journal of Instruction, 4(2), 113–128.&#x0D; Haridza, R., &amp; Irving, K. E. (2017). The Evolution of Indonesian and American Science Education Curriculum: A Comparison Study. 9(February), 95–110.&#x0D; Hatch, J. A. (2012). From theory to curriculum: Developmental theory and its relationship to curriculum and instruction in early childhood education. In &amp; D. W. N. File, J. Mueller (Ed.), Curriculum in early childhood education: Re-examined, rediscovered, renewed (pp. 42–53).&#x0D; Hos, R., &amp; Kaplan-wolff, B. (2020). On and Off Script: A Teacher’ s Adaptati on of Mandated Curriculum for Refugee Newcomers in an Era of Standardization On and Off Script: A Teacher’ s Adaptati on of Mandated Curriculum for Refugee Newcomers in an Era of Standardization. Journal of Curriculum and Teaching, 9(1), 40–54. https://doi.org/10.5430/jct.v9n1p40&#x0D; Hosnan, M. (2014). Pendekatan saintifk dan kontekstual dalam pembelajaran abad 21. Ghalia Indonesia.&#x0D; Hussain, A., Dogar, A. H., Azeem, M., &amp; Shakoor, A. (2011). Evaluation of Curriculum Development Process. International Journal of Humanities and Social Science, 1(14), 263–271.&#x0D; Maryono. (2016). The implementation of schools’ policy in the development of the local content curriculum in primary schools in Pacitan , Indonesia. Education Research and Reviews, 11(8), 891–906. https://doi.org/10.5897/ERR2016.2660&#x0D; Masithoh, D. (2018). Teachers’ Scientific Approach Implementation in Inculcating the Students ’ Scientific Attitudes. 6(1), 32–43.&#x0D; Mayfield, B. J. (1995). Educational curriculum. Journal of Nutrition Education, 27(4), 214. https://doi.org/10.1016/s0022-3182(12)80438-9&#x0D; Muharom Albantani, A., &amp; Madkur, A. (2018). Think Globally, Act Locally: The Strategy of Incorporating Local Wisdom in Foreign Language Teaching in Indonesia. International Journal of Applied Linguistics and English Literature, 7(2), 1. https://doi.org/10.7575/aiac.ijalel.v.7n.2p.1&#x0D; Nasir, M. (2013). Pengembangan Kurikulum Muatan Lokal dalam Konteks Pendidikan Islam di Madrasah. Hunafa: Jurnal Studia Islamika, 10(1), 1–18.&#x0D; Nevenglosky, E. A., Cale, C., &amp; Aguilar, S. P. (2019). Barriers to effective curriculum implementation. Research in Higher Education Journal, 36, 31.&#x0D; Nuttal, J. (2013). Weaving Te Whariki: Aotearoa New Zealand’s early childhood curriculum framework in theory and practice (2nd ed.) (2nd ed.). NZCER Press.&#x0D; Oates, T. (2010). Could do better: Using international comparisons to refine the National Curriculum in England.&#x0D; O’Gorman, L., &amp; Ailwood, J. (2012). ‘They get fed up with playing’: Parents’ views on play-based learning in the preparatory year. Contemporary Issues in Early Childhood, 13(4), 266–275. https://doi.org/10.2304/ ciec.2012.13.4.266&#x0D; Orakci, S., Durnali, M., &amp; Özkan, O. (2018). Curriculum reforms in Turkey. In Economic and Geopolitical Perspectives of the Commonwealth of Independent States and Eurasia (Issue July 2019, pp. 225–251). https://doi.org/10.4018/978-1-5225-3264-4.ch010&#x0D; Organization for Economic and Co-Operation and Development. (2019). Change Management: Facilitating and Hindering Factors of Curriculum Implementation. 8th Informal Working Group (IWG) Meeting, 1–25.&#x0D; Poedjiastutie, D., Akhyar, F., Hidayati, D., &amp; Nurul Gasmi, F. (2018). Does Curriculum Help Students to Develop Their English Competence? A Case in Indonesia. Arab World English Journal, 9(2), 175–185. https://doi.org/10.24093/awej/vol9no2.12&#x0D; Prasetyo, A. (2015). Curriculum Development of Early Childhood Education through Society Empowerment as Potential Transformation of Local Wisdom in Learning. Indonesian Journal of Early Childhood Education Studies, 4(1), 30–34. https://doi.org/10.15294/ijeces.v4i1.9450&#x0D; Ramdhani, S. (2019). Integrative Thematic Learning Model Based on Local Wisdom For Early Childhood Character. Indonesian Journal of Early Childhood Education Studies, 8(1), 38–45.&#x0D; Reifel, S. (2014). Developmental play in the classroom. In &amp; S. E. L. Brooker, M. Blaise (Ed.), The SAGE handbook of play and learning in early childhood (pp. 157–168). Sage.&#x0D; Reunamo, J., &amp; Suomela, L. (2013). Education for sustainable development in early childhood education in finland. Journal of Teacher Education for Sustainability, 15(2), 91–102. https://doi.org/10.2478/jtes-2013-0014&#x0D; Saefuddin, A., &amp; Berdiati, I. (2014). Pembelajaran efektif. Remaja Rosda Karya.&#x0D; Sagita, N. I., Deliarnoor, N. A., &amp; Afifah, D. (2019). Local content curriculum implementation in the framework of nationalism and national security. Central European Journal of International and Security Studies, 13(4), 91–103.&#x0D; Saracho, O. (2012). An integrated play-based curriculum for young children. Routledge.&#x0D; Schumacher, D. H. (1995). Five Levels of Curriculum Integration Defined, Refined , and Described. Research in Middle Level Education. https://doi.org/10.1080/10825541.1995.11670055&#x0D; Scott, D. (2014). Knowledge and the curriculum. The Curriculum Journal, 25(1), 14–28. https://doi.org/10.1080/09585176.2013.876367&#x0D; Setiawan, A., Handojo, A., &amp; Hadi, R. (2017). Indonesian Culture Learning Application based on Android. 7(1), 526–535. https://doi.org/10.11591/ijece.v7i1.pp526-535&#x0D; Syarifuddin, S. (2018). The effect of using the scientific approach through concept understanding and critical thinking in science. Jurnal Prima Edukasia, 6(1), 21–31. https://doi.org/10.21831/jpe.v6i1.15312&#x0D; Ulla, M. B., &amp; Winitkun, D. (2017). Thai learners’ linguistic needs and language skills: Implications for curriculum development. International Journal of Instruction, 10(4), 203–220. https://doi.org/10.12973/iji.2017.10412a&#x0D; van Oers, B. (2012). Developmental education: Foundations of a play-based curriculum. In B. van Oers (Ed.), Developmental education for young children: Concept, practice, and implementation (pp. 13–26). Springer.&#x0D; Wahyono, Abdulhak, I., &amp; Rusman. (2017). Implementation of scientific approach-based learning. International Journal of Education Research, 5(8), 221–230.&#x0D; Wahyudin, D., &amp; Suwirta, A. (2017). The Curriculum Implementation for Cross-Cultural and Global Citizenship Education in Indonesia Schools. EDUCARE: International Journal for Educational Studies, 10(1), 11–22.&#x0D; Westbrook, J., Brown, R., Pryor, J., &amp; Salvi, F. (2013). Pedagogy, Curriculum , Teaching Practices and Teacher Education in Developing Countries. December.&#x0D; Wood, E., &amp; Hedges, H. (2016). Curriculum in early childhood education: Critical questions about content, coherence, and control. The Curriculum Journal. https://doi.org/10.1080/09585176.2015.1129981&#x0D;

The highest reed (Phragmites altissimus) is a species with Eurasian-North African range, recently expanding its area of distribution in northern direction (Kapitonova, 2016; Golovanov et al., 2019; Tzvelev, Probatova, 2019). It is known that in the forest zone of both the European and Asian parts of Russia, the highest reed is found only as an invasive plant (Tzvelev, 2011). Communities dominated by P. altissimus are known both within its natural range and in the area of invasion. However, in syntaxonomic reviews, cenoses with this species dominanation are traditionally included by the authors in the ass. Phragmitetum australis Savich 1926 (Golub et al., 1991, 2015; Golub, Chorbadze, 1995; Kipriyanova, 2008; Vegetaсе…, 2011; Golovanov, Abramova, 2012; Chepinoga, 2015). The aim of this work is to establish the syntaxonomic status of communities formed by P. altissimus. The work used 65 geobotanical relevés made within the primary range of the P. altissimus (Astrakhan region and the south of the Tyumen region within the forest-steppe zone) and in the area of its secondary range (the Udmurtian Republic and the taiga zone of the Tyumen region). The relevés were introduced into database developed on the basis of the TURBOVEG program (Hennekens, 1996) and processed using the JUICE program (Tichý, 2002). To assess the abundance of species on the sample plots described, the J. Braun-Blanquet abundance scale was used with the following abundance-coverage scores: r — the species is extremely rare with insignificant coverage, + — the species is rare, the degree of coverage is small, 1 — the number of individuals is large, the degree of coverage is small or the individuals are sparse, but the coverage is large, 2 — the number of individuals is large, the projective cover is from 5 to 25 %, 3 — the number of individuals is any, the projective cover is from 25 to 50 %, 4 — the number of individuals is any, the projective cover is from 50 to 75 %, the number of individuals is any, the cover is more than 75 % (Mirkin et al., 1989). Syntaxonomic analysis was performed using the approach suggested by J. Braun-Blanquet (1964). The names of syntaxa are given according to the “International Code of Phytosociological Nomenclature” (Theurillat et al., 2021). The system of higher syntaxa is given in accordance with “Hierarchical floristic classification…” (Mucina et al., 2016). To identify the main factors determining the differentiation and distribution of the studied communities, the NMDS method was used. For each syntaxon, using the IBIS program (Zverev, 2007), the average indicator values were calculated according to the ecological scales of D. N. Tsyganov (Tsyganov, 1983): soil moisture (Hd), soil nitrogen richness (Nt), and illumination-shading (Lc). Processing was carried out in the PC-ORD v. 6.0 (McCune et Mefford, 2011). The studied communities were assigned to the new ass. Phragmitetum altissimi, 4 subassociations, and 7 variants. The nomenclature type of association is relevé N 20 in Table 3. It is shown that in the communities of the ass. Phragmitetum altissimi, the number of species ranges from 1 to 15 (in average 4). The total projective cover varies from 20 to 100 %. The height of the herbage is 2–5 m; four to five substages are distinguished in it. In the first substage, in addition to P. altissimus, the presence of large cattails (Typha austro-orientalis, T. linnaei, T. latifolia, T. tichomirovii), as well as tall grasses (Calamagrostis pseudophragmites, Phalaroides arundinacea) and Scirpus hippolyti was recorded. The second substage is formed by grasses of medium height (up to 0.8–1 m): Carex riparia, Sparganium erectum, Oenanthe aquatica, Stachys palustris, Lythrum salicaria, Althaea officinalis, Persicaria maculata, P. minor, Cirsium setosum, much less often — Impatiens glandulifera, Urtica dioica, etc. The third substage is not always developed, as a rule, it is very sparse, formed by surface hygrophilic grasses usually no more than 10–20 (25) cm in height (Rorippa amphibia, Galium palustre, Potentilla reptans, Tussilago farfara). The fourth substage is usually sparse; it is formed by rooting (Nymphaea alba) or non-rooting (Salvinia natans, Lemna minor, L. turionifera, Spirodela polyrhiza, Hydrocharis morsus-ranae) hydrophytes floating on the water surface. The fifth substage is formed by non-rooting hydrophytes completely submerged in water (Lemna trisulca, Ceratophyllum demersum), as well as Drepanocladus aduncus and Cladophora sp. Often are out-of-tier vinegrasses (Calystegia sepium, Cynanchum acutum); sprouts of willows (Salix cinerea, S. alba) are also quite common. Communities dominated by P. altissimus are formed in coastal shallow waters, including swampy, stagnant or weakly flowing water bodies with stable or slightly fluctuating water level, with tight bottom or small, sometimes quite thick layer of silty-detrital deposits. Communities also are formed on damp or swampy shores, including disturbed, permanent or temporarily drying water bodies. In anthropogenic habitats, they are developed in watered and damp depressions (ditches), in shallow waters and damp banks of ponds, reservoirs, man-made water bodies, excavations, and watered quarries. Cenoses of the subass. P. a. typicum (Fig. 2) are formed on coastal shallow waters and damp shores of permanent or temporarily drying water bodies, including disturbed ones. Communities of the subass. P. a. caricetosum ripariae are characteristic of swampy coastal areas and swampy shores of water bodies with stable or slightly fluctuating water level; they are distinguished by sparse and relatively low upper substage of the herbage composed of P. altissimus. Communities of the subass. P. a. phalaroidetosum arundinaceae, which occcur in coastal shallow waters (up to 5–10 cm deep) and damp shores of water bodies, are characterized by rather dense upper substage of herbage and temporary drying of the substrate during the growing season. Communities of the subass. P. a. lemnetosum trisulcae are formed in water bodies, the water level in which is subject to fluctuations during the growing season; they are characterized by dense substage of grasses submerged in water and significant thickness of silty bottom sediments.. Communities of the ass. Phragmitetum altissimi are distributed within the primary range of P. altissimus — in the south of the European part of Russia (Astrakhan region) and in the forest-steppe zone of Western Siberia (Tyumen region). They are also found in the area of invasion of the highest reed — in the east of the Russian Plain (Udmurtian Republic), in the taiga zone of Western Siberia (Tyumen region) (Fig. 1). In the secondary range of the highest reed, only cenoses attributed to the subass. P. a. typicum are recorded. Communities belonging to all four subassociations are widespread within the primary range of P. altissimus on the territory of the European part of Russia.

B a c k g r o u n d . Kyiv philosophical school of the second half of the 20th century was presented, first of all, by its creators in the 1960s, namely graduates of the Faculty of Philosophy of the said university and employees of the Institute of Philosophy of the Academy of Sciences of the Ukrainian SSR, headed by its director in 1962–1968, Academician of this Academy of Sciences P. Kopnin. It was under his leadership this school began and made a major contribution to the professional but censored revaluation and destruction of Marxism-Leninism in the Ukrainian SSR. Throughout the 1940s – 1980s, namely since the end of Stalinism to the end of Gorbachev's "perestroika" and the collapse of the USSR, three generations of the creators of this school critically rethought and destructured the Stalinist and other official paradigms of Marxism-Leninism. This problem in their scholarly works and courses of lectures on philosophical subjects was solved mainly by P. Kopnin's students and apologists, his colleagues at the institute and academicians of the said Academy S. Krymskyi, M. Popovych and M. Honcharenko, as well as their colleagues and students, for example A. Yermolenko, Y. Bystrycky, A. Loy, V. Malakhov and S. Proleiev. The purpose of our article is to assess the contribution of the Kyiv philosophical school, namely graduates and professors of the Faculty of Philosophy of Taras Shevchenko Kyiv State University to the destruction of Marxist-Leninist philosophy both in the said university and in philosophical education, science and culture of the Ukrainian SSR since the second half of the 1960s till the end of the 1970s. M e t h o d s . To study this problem, classical and modern methods of both philosophical and historical and philosophical analysis and other humanities were used. In addition to such principles of scientific knowledge as historicism, objectivity and consistency, the author also used historical and logical general methods. Together with the method of biographical analysis of the figures of the said school and the method of sociocultural analysis of the educational, scientific and socio-political processes in the second half of the 20th century in the Ukrainian SSR and the world, methods of comparative historical and structural and functional analysis of the Ukrainian philosophical progress of that time were also used. R e s u l t s . Four main conditional stages of the process of destruction and crisis of the official paradigms of Marxism-Leninism in the Ukrainian SSR, carried out by the creators of the Kyiv philosophical school of the second half of the 20th century, are classified in our preliminary study of this topic in (Vdovychenko, 2023). In that article we systematically examined the first two of these stages for the first time: 1) the initial stage or origins of the critical revision of Stalin's version of Marxism-Leninism (late 1940s – 1950s); 2) the second stage or emergence of a systematic censored critical reassessment of this version and its official successors in the USSR from the Khrushchev "thaw" to the beginning of the "stagnation" (late 1950s – mid 1960s). This article begins the study of the two final stages of this process, namely the third one or the period of public criticism and destruction of a number of official versions of Marxism-Leninism by the sixties philosophers of the Ukrainian SSR (mid-1960s – mid-1980s). It was established that this period was the time of active involvement and, in fact, real integration of philosophical education, science and culture of the Ukrainian SSR into the European and world Postmodern philosophical process, thanks mainly to P. Kopnin and the entire Kyiv philosophical circle. C o n c l u s i o n s . On the basis of rare publications by the participants of the events and the newest projects from the Ukrainian oral history of philosophy, the contribution of the three first generations of the Kyiv philosophical school of the second half of the 20th century to the neo- Marxist and already post-Marxist destruction of Marxism-Leninism during the era of "stagnation" has been systematically revealed for the first time. It was established, that the participation of P. Kopnin and a number of his colleagues from the Ukrainian SSR both in the World Philosophical Congresses since the late 1950s till the mid-1970s, primarily from the XII one in Venice (1958) to the XV in Varna (1973), as well as in many others international forums of these decades, led to serious ideological shifts in Ukrainian philosophy. This Europeanization of it led to a fruitful considering and elaboration by the Kyiv philosophical circle of that time ideas of neo-Marxist revisionism in the context of studies on German classical philosophy and modern European philosophy under the influence of the contemporary "linguistic turn" and "existential neo-Hegelianism". Relying on the neo-Marxist reassessment of Stalinism, the creators of the mentioned school, professors of the Faculty of Philosophy of T. G. Shevchenko Kyiv State University, first of all P. Kopnin and V. Shynkaruk, as it deans, introduced the newest standards of really Europeanized learning of a wide range of philosophical disciplines, in particular the history of foreign Modern and Postmodern philosophy.

The dominance of xeropetrophytic plant communities with original species composition along with high phytocenotic diversity is the first to determine the distinctness of the South Ural low-mountain steppe province within the Ural Mountains. As the zonal steppe ecosystems are totally destroyed and transformed, petrophytic cenoses represent the predominant type of natural vegetation. They are of high conservation importance due to preserving unique biodiversity with a large number of rare and endangered species, relics and endemics (Ryabinina, 2003; Yamalov et al., 2019). Stony steppes in the Southern Urals have been studied for more than 100 years. Initiated in the 1980s, the syntaxonomical research covers now only the limited territories, mainly within the protected areas (Unikalnye ..., 2014; Prirodnye ..., 2018). The recent studies are focused on the relationship between the petrophytic vegetation and macroecological gradients in the context of geographical zonation (Zolotareva et al., 2019; Korolyuk et al., 2020). Our study presents the results of the analysis of 265 relevés of petrophytic communities of the steppe zone, carried out by the authors on the territory of the Gaysky, Kuvandyksky, Saraktashsky and Belyaevsky administrative districts of the Orenburg region, as well as the Khaibullinsky district of the Bashkortostan Republic in 2014–2018 (Fig. 1). Six phytocoenons were identified using the TWINSPAN algorithm followed by manual sorting. They represent the main diversity of petrophytic vegetation in the studied region and differ in the groups of species identified by formal criteria (Korolyuk et al., 2016; Zolotareva et al., 2019). We conducted the cluster analysis to compare these with the petrophytic associations of the Urals: 26 associations from the classes Festuco-Brometea Br.-Bl. et Tx. ex Soó 1947 and Anabasietea cretaceae Golovanov et al. 2021 (Fig. 2, 3). Five communities were assigned to the steppe vegetation, and their position in the syntaxonomical system was determined. Communities 1–3 regarded as typical steppes have similar floristic composition and dominant plants; community 4 is closer to the rich forb-bunchgrass steppes; community 5 and the ass. Anthemido trotzkianae–Thymetum guberlinensis have transitional features to desert steppes. We identified the new alliance Elytrigion pruiniferae all. nov. D. s.: Allium tulipifolium, Alyssum turkestanicum, Artemisia salsoloides, Centaurea turgaica, Elytrigia pruinifera, Ferula tatarica, Linaria uralensis, Poa bulbosa s. l., Polycnemum arvense, Spiraea hypericifolia. Holotypus — the association Elytrigietum pruiniferae Lebedeva ass. nov. Alliance represents xeropetrophytic vegetation of the steppe zone of the South Urals. Its area covers the watersheds of the Sakmara, Ural and Ilek rivers. Its communities were also found on the right bank of the Sakmara river (the Guberlya and Kuragan basins), as well as in the lower part of the Bolshoy Ik river basin. The communities occupy convex slopes and tops of ridges with immature gravelly soils. In the southern part of the alliance distribution area, they are confined to slopes of various shapes and exposures, while in the northern part mainly to convex southern slopes or to the top of the ridges. The alliance represents xerophytic part of the order Helictotricho-Stipetalia. It replaces the more mesophytic alliance Helictotricho desertori–Orostachyion spinosae on the moisture gradient (Korolyuk, 2017). The alliance includes 3 associations and 1 community type. Ass. Elytrigietum pruiniferae Lebedeva ass. nov. (Table 4), holotypus — rel. 1 (field no. 15-086): Orenburg region, Kuvandyk district, 1.5 km southwest of Yalnair village, near-summit convex part of a rocky slope, 51.28635°N, 57.81782°E, 10.06.2015, author — A. Yu. Korolyuk. D. s.: Alyssum turkestanicum, Centaurea turgaica, Elytrigia pruinifera, Linaria uralensis, Poa bulbosa s. l., Polycnemum arvense, Spiraea hypericifolia, Thymus guberlinensis, Tulipa scythica. The association unites petrophytic steppes in hilly lands and low-mountains of the Saraktash, Kuvandyk and Gaysky districts of Orenburg region and on the Turatka mountain in Khaibullinsky district of Bashkiria. The cenoses are confined to convex slopes and tops of ridges. They are developed on gravelly soils on outcrops of basic and metamorphic rocks, less often on sedimentary rocks. There are 4 variants within the association. Ass. Thymo guberlinensis–Galatelletum villosae Yamalov ass. nov. (Table 5), holotypus — rel. 2 (field no. 16-015): Orenburg region, Kuvandyk district, 19 km SW of Zaluzhye village, 51.18268°N, 56.91858°E, author — A. Yu. Korolyuk. D. s.: Astragalus tenuifolius, Ephedra distachya, Galatella villosa, Hedysarum argyrophyllum, Meniocus linifolius, Scorzonera stricta, Stipa lessingiana. The association represents xerophytic stony steppes. They occur in all regions confined mainly to the southern slopes and tops of ridges with fine gravelly soils on sedimentary rocks. There are 4 variants within the association. Ass. Stipo zalesskii–Centauretum turgaicae ass. nov. (Table 6, rel. 7–22), holotypus — rel. 10 (field no. 17-122): Orenburg region, Gaysky district, east of the Kazachya Guberlya village, slightly convex slope of the ridge in the near-top part, 51.14663°N, 58.03227°E, 06.18.2017, author — A. Yu. Korolyuk. D. s.: Amygdalus nana, Campanula sibirica, Carex pediformis, Cephalaria uralensis, Erysimum canescens, Helictotrichon desertorum, Pulsatilla patens, Stipa pulcherrima, S. zalesskii. The association was described in the southeastern part of the Guberlinsky Uplands (Gaysky District). The communities occupy habitats typical for petrophytic steppes — convex slopes and tops of ridges on outcrops of basic and metamorphic rocks. The associations Elytrigio pruiniferae–Stipetum sareptanae Golovanov ass. nov. and Anthemido trotzkianae–Thymetum guberlinensis Golovanov et al., 2021 were described in the study area as well. Ass. Elytrigio pruiniferae–Stipetum sareptanae ass. nov. (Table 7), holotypus — rel. 10 (field no. GY18-043): Orenburg region, Kuvandyk district, 4 km SE Novyi village, Suyunduksai Balka, 51.02067°N, 57.33993°E, author — Ya. M. Golovanov. D. s.: Artemisia lerchiana, Astragalus tenuifolius, Atraphaxis frutescens, Ephedra distachya, Gypsophila rupestris, Hedysarum argyrophyllum, H. razoumovianum, Meniocus linifolius, Sterigmostemum tomentosum. The association is found mainly to the south of the latitudinal section of the Ural River within the Guberlinsky Uplands (Kuvandyk District), as well as of the hilly lands of the South Urals (Saraktashsky District). The communities are confined to slopes of different exposure and steepness on outcrops of sedimentary rocks. The plants of dry and desert steppes, as well as those preferring chalk outcrops, are among the diagnostic species. This brings the association together with desert-steppe communities of the order Agropiretalia Korolyuk et Laktionov 2021, class Artemisietea lerchianae Golub 1994 (Korolyuk, Laktionov, 2021). Nevertheless, the composition and structure of cenoses confirm the assignment of the association to the class Festuco-Brometea. There are 4 variants within the association. The diversity of xeropetrophytic vegetation of the South Urals is much higher than that described in the article. The involvement of data from the adjacent regions of Kazakhstan will facilitate the further development of its syntaxonomical system.

Abstract Chronic myeloid leukemia (CML) and monoclonal gammopathy of undetermined significance (MGUS) are two different hematologic malignancies, the former arising from the myeloid cell lineage, and the latter arising from plasma cells. The concurrent diagnosis of CML and MGUS progression to multiple myeloma (MM) in one patient is an extremely rare event. A 59-year-old male was diagnosed with CML and MGUS with no discomfort in August 2012. Bone marrow (BM) aspiration suggested chronic myelogenous leukemia in chronic phase and perhaps myeloproliferative with 6.5% mature plasma cells (Figure 1A). FISH analysis detected that the BCR-ABL1 expression was 130%. And Next-generation sequencing (NGS) of BM showed: ASXL1 , KMT2D , SPEN , BRINP3 , ANKRD26 , PLCG1 , CUX1 were mutated (Figure 2I). The patient started oral imatinib 400 mg per day and achieved a complete cytogenetic response at 3 months. In September 2019, his IgG levels were 2,790 mg/dl (Figure 2J and serum immunofixation electrophoresis revealed monoclonal (M) protein of IgG-Lambda type (Figure 1E). BM aspiration revealed 9.5% plasma cell infiltration, including 6% mature plasma cells and 3.5% proplasmacyte (Figure 1C and 2H). Flow cytometry in BM showed 6.3% plasmacytoma and abnormal cell expressing CD38+CD138+CD56+CD117+clambda+ (Figure 1F). BM biopsy showed hematopoietic hyperplasia with abnormal growth of immature cells (Figure 1B). Fluorescent in situ hybridization (FISH) was negative. Mutations of KMT2D, SPEN, BRINP3, ANKRD26, PLCG1, CUX1, and ZMYM3 still existed(Figure 2I). In January 2020, examination of a new BM aspiration revealed that mature plasma cells were 3% and plasmablast and proplasmacyte were 4.5% (Figure 2H). In February 2020, he stopped IM therapy with undetectable BCR-ABL1 copies because he met the requirement of stopping TKI therapy . In March 2020, IgG levels were 3520 mg/dl and serum immunofixation electrophoresis still revealed monoclonal (M) protein of IgG-Lambda type. His BM aspiration demonstrated 13.5% plasma cells in April 2020 (Figure 2B and 2H). Flow cytometry in BM showed 6.44% (Figure 2F). BM biopsy showed extremely increased proliferation with abnormal growth of abnormal cells (Figure 2A). FISH demonstrated the presence of t(4;14)(p16;q32)(IGH/FGFR3) , 13q14 deletion（RB-1） and 13q14.3 （D13S319） (Figure 2C, 2D and 2E). The patient was diagnosed as MM (IgGλ type, D-S stage IA; ISS stage II) . BCR-ABL1 copies were still not detected at this point (Figure 2G). The patient continued his follow-up treatment of MM without chemotherapy.However, in June 2020, he was considered to have a molecular relapse with 0.2013% BCR-ABL1 copies in the peripheral blood (Figure 2G). NGS showed that the variant allele fractions of KMT2D, SPEN, BRINP3, ANKRD26, PLCG1, CUX1, and ZMYM3 mutations were similar to former . He restarted 400 mg daily IM therapy and BCR-ABL1 copies were undetectable againafter one month therapy (Figure 2G). BM aspiration revealed that the percentage of plasma cells increased to 25.5% in August 2020 (Figure 2H). Then the patient was started on treatment for ISS stage II standard risk myeloma with ID regimen: ixazomib 4 mg on days 1, 8 , 15 and dexamethasone 20 mg on days 1, 8, 15 , 22 in 28-day cycles. After 6 cycles , the patient got VGPR. BM aspiration demonstrated 13% plasma cells (Figure 2H). And he continued to receive myeloma treatment and imatinib . BCR-ABL1 were &amp;lt;MR4.5 (Figure 2G). Our research indicated that KMT2D mutation may make MGUS progress to MM with NK cells functional defects and then promote the recurrence of BCR-ABL1. Co-existence of these two diseases is rare, therefore, additional investigations are warranted. Acknowledgment:The research was supported by the Public Technology Application Research Program of Zhejiang, China (LGF21H080003), the Key Project of Jinhua Science and Technology Plan, China (2020XG-29 and 2020-3-011), the Academician Workstation of the Fourth Affiliated Hospital of the Zhejiang University School of Medicine (2019-2024), the Key Medical Discipline of Yiwu, China (Hematology, 2018-2020) and the Key Medical Discipline of Jinhua, China (Hematology, 2019-2021). Correspondence to: Dr Jian Huang, Department of Hematology, The Fourth Affiliated Hospital of Zhejiang University School of Medicine. N1 Shangcheng Road. Yiwu, Zhejiang, Peoples R China. Figure 1 Figure 1. Disclosures No relevant conflicts of interest to declare.

Objective: To assess the relationship between Helicobacter pylori (Hp) infection and primary open-angle glaucoma (POAG); and meantime, to explore the possible mechanism of POAG induced by Hp. Methods: 30 consecutive POAG patients, 30 primary angle-closure glaucoma (PACG) and cataract patients were recruited and divided into three groups according to different diseases. The sera and aqueous humor samples were collected and used to detect Hp-specific IgG antibody (Hp-Ab) with dot immunogold filtration assay (DIGFA). 14C-urea breath test (14C-UBT) was carried out to detect Hp infection of all participants. Results: The Hp-Ab positive rate respectively was 76.7% (23/30) and 66.7% in sera samples and aqueous humor samples for POAG group, which was significantly higher than the corresponding data of the other two groups (all P&lt;0.05). In 14C-UBT, the Hp-Ab positive rate was 63.3% in POAG group and it was close to that of serological result detected by DIGFA (P&gt;0.05). There were little numbers of positive ANA and ENA in the three groups and no meaning to make statistically analysis. Conclusions: There is positive association between Hp infection and POAG, and the autoimmune is suggested as one of the key mechanisms in our opinions.&#x0D; Introduction&#x0D; Glaucoma is one of the commonest causes for blindness in the world. Generally, glaucoma is divided into primary open-angle glaucoma (POAG) and primary angle-closure glaucoma (PACG).1 As a leading causes for blindness, the study of POAG causes more and more attention.2,3To our understand, POAG is a chronic optic neuropathy characterized by atrophy and increased cupping of optic disk. To date, many aspects of its pathogenesis remain unknown but some significant risk factors are advanced age, African origin, familial history of glaucoma and elevated intraocular pressure.4,5&#x0D; Helicobacter pylori (Hp) is a Gram-negative and microaerophilic bacterium which plays an important role in the development of various upper gastrointestinal diseases. With the development of studies, some researchers reported that Hp was also associated with some extragastric diseases, such as ischemic heart disease,6 iron-deficient anemia,7 diabetes mellitus,8 and so on. In 2001, Kountouras et al9 established a higher prevalence of Hp infection in the sera of patients with POAG in a Greek population, and suggested a possible causal link between Hp and glaucoma. Subsequently, this finding was evidenced by some scholars in their own studies.10 But the significance of such an association remains uncertain because of the conflicting findings reported by various studies.11-13 Aiming to such a discrepancy, further studies are necessary.14&#x0D; In this study, we just do detect Hp-specific IgG antibodies (Hp-Ab) in the sera and aqueous humor of patients with different ocular diseases, including POAG, PACG and cataract, and attempt to further determine the relationship between Hp infection and POAG and to analyze the possible mechanism of POAG induced by Hp.&#x0D; Abbreviations&#x0D; ANA, antinuclear antibody; ENA, Extractable nuclear antigen; DIGFA, dot immunogold filtration assay; Hp, Helicobacter pylori; Hp-Ab, Hp-specific IgG antibodies; PACG, primary angle-closure glaucoma; POAG, primary open-angle glaucoma; 14C-UBT: 14C-urea breath test.&#x0D; &#x0D; Subjectsand methods&#x0D; Subjects&#x0D; 30 consecutive POAG patients were enrolled with the average age of 68±7.3 y (ranged from 47 to 78 y). The ratio of the male and the female was 11: 19. Meantime, 30 PACG patients and 30 cataract patients were also recruited, and who were matched by age and sex with the POAG patients. According to different diseases, the participants were divided into POAG, PACG and cataract groups, respectively. All of them were excluded from tumor, immunodeficiency, autoimmune and infectious diseases in clinic, and also had no antibiotics and other medicines related to immunopotentiator or immunosuppressive agents in the six months before the experiment. Written informed consents were obtained from all the participants. The study was approved by the local ethics committee.&#x0D; Hp-Ab detection of sera samples&#x0D; 2 ml venous blood was collected from each of the participants. The serum was obtained after centrifugation and used to detect Hp-Ab with dot immunogold filtration assay (DIGFA) according to the manufacturer’s instruction of the reagent kit (MP Biomedicals Asia-Pacific Pte. Ltd., Singapore).&#x0D; Hp-Ab detection of aqueous humor samples&#x0D; About 50 μl aqueous humor sample was aspirated at the beginning of glaucoma surgery from the each of the patients in the three groups, respectively. Hp-Ab was assayed with DIGFA as same as the detection process of venous blood samples.&#x0D; Detection of Hp infection with 14C-urea breath test&#x0D; Referring to Tang’s report,1514C-urea breath test (14C-UBT) was carried out in POAG group with Hp detection instrument-YH04 (Yanghe Medical Equipment Co. Ltd., China).&#x0D; Sera auto-antibodies detection&#x0D; Serum antinuclear antibody (ANA) was detected with the indirect immunofluorescence assay by a commercialized ANA kit. Extractable nuclear antigen (ENA) was assayed with line immunoassay. All reagents were bought from Jiangsu HOB Biotech Group, China.&#x0D; Statistic analysis&#x0D; Using T-test and Chi-square test, all analyses were performed with SPSS 13.0 software. P value less than 0.05 were considered significant.&#x0D; Results&#x0D; 3.1 Hp infection detection in sera and aqueous humor &#x0D; Of the sera samples, there were 23 cases exhibited Hp-Ab-positive in POAG group, and the positive rate was 76.7% which was significantly higher than those of PACG and cataract group (43.3% and 36.6% respectively). In the aqueous humor samples, there were 18 patients with positive Hp-Ab in POAG group, and the positive rate was 66.7%. Compared to each data of the other two groups, the difference was statistically significant (Table 1). In POAG group, the mean positive rate of sera samples was similar to that of aqueous humor and no difference existed between them (P = 0.287).&#x0D; Table 1. The serum and aqueous humor qualitative test results of the patients with glaucoma&#x0D; Hp infection detection with 14C-UBTAH: aqueous humor; a: POAG group vs cataract group; b: POAG group vs PACG group; c: PACG group vs cataract group.&#x0D; In 14C-UBT, there were 19 patients with Hp-Ab-positive, and the positive rate was 63.3%. Compared to the data detected with DIGFA, the difference was not significant (Table 2).&#x0D; Table 2. Comparison of DIGFA and 14C-UBT for diagnosis of Hp infection in POAG group&#x0D; ANA and ENA detection* represents comparison of the positive rate detected with the two methods.&#x0D; There were 4, 2 and 1 patients with ANA-positive in POAG, PACG and cataract group, respectively. The positive ENA in POAG group were SSA, SSB and Ro-52, and the corresponding numbers were 2, 2 and 1. Only Ro-52 showedpositive in PACG group while there was no positive ENA in cataract group (Table 3).&#x0D; Table 3. The results for sera ANA, ENA of the patients of each group&#x0D; Discussion&#x0D; In Greece, a very active research group led by J. Kountouras published several original contributions as well as the reviews concerning the connection between Hp infection and POAG.14,16 In other counties, there were also several papers containing the similar arguments issued, such as India,17 Turkey,18 Korea19 and so on. In China, Hong et al20 detected Hp infection and POAG through 13C-UBT, and also found the positive correlation between them. Since then, there was no relative article issued by Chinese could be found in PubMed and other well-known scientific database. In this study, referring to other researchers’ reports, we designed and carried out the experiments. In the results, we found that the positive rate of sera Hp-Ab was high to 76.7% in POAG patients, which was significantly higher than those of the other two groups. This finding was close to the data of the previous reports2,21 and further verified that there was a positive relation between Hp infection and POAG.&#x0D; In the present study, we also assayed Hp infection with 14C-UBT. Encouragingly, the positive rate of Hp infection was 63.3%, which was very close to 76.7% detected with DIGFA. This result further indicated the existence of the relation between Hp infection and POAG. However, Bagnis et al22 thought that the studies based on Hp serological assessment might be misleading, since serum antibodies were not the sensitive markers of active Hp infection; while 13C-UBT could clarify the actual prevalence of POAG among patients infected by Hp. In fact, there were still deficiencies for 13C- or 14C -UBT, because it was more suitable for the detection of gastrointestinal Hp infection, and to an extent, there were false-negatives in the test.23 This probably was the just reason for what the positive rate in DIGFA was little higher than that in 14C-UBT in this study. As to the cresyl fast violet staining on the histology preparations of tissue samples of trabeculum and iris introduced by Zavos et al,24 although it could provide the direct and strong evidence for Hp infection in the pathophysiology of POAG, the difficult harvest of the sample limited its application. Therefore, in our opinions, the serological assay is suitable to detect Hp infectionand used to assess the relationship between Hp prevalence and POAG.&#x0D; Except for detecting sera Hp-Ab, we also detected Hp-Ab in the aqueous humor collected from the majority of participants. As the results shown, the positive rate of the POAG group was statistically higher than each of the other groups, respectively. This result was consistent with that of the serological assessment and again showed the positive relation between Hp infection and POAG. However, in another similar study, Deshpande et al17 also found a statistically significant difference between the POAG patients and the controls in the concentration of serum Hp-Ab, but they did not find any significant correlations between the Hp concentrations of the aqueous humor of the different patient groups. This disagreement probably associated with the damage degree of blood-brain barrier (BBB), because the sera Hp-Ab could reach the trabeculum and iris under the condition of the BBB disruption.25 According to the results of the present study, we supported the hypothesis related to POAG onset that Hp-Ab in circulation might get through the blood-aqueous humor barrier, further condensed in aqueous humor and finally induced or aggravated glaucomatous damage.2&#x0D; As to the occurrence of POAG, we thought another autoimmune mechanism was most probable and should not be ignored: Hp infection initiated autoimmune response because of the common genetic components shared in Hp and human nerve tissue; and then, cell destruction which mediated by apoptosis direct caused glaucoma.26 Just based on the theory, we designed and detected sera ANA and ENA of the POAG patients and the control participants, and hoped to find any evidences related to autoimmune. As a result, we found that the positive rate of every group was rather low and there was no difference between them. However, this seronegative result can’t deny the hypothesis of autoimmune mechanism in POAG; and the auto-antibodies specific to eyes, such as trabeculum and iris, were suggested to be detected in future study in our opinions.&#x0D; Conclusion&#x0D; The positive association between Hp infection and POAG not only using serum sample but also aqueous humor sample is found in this study. And further, through the experimental data, it is suggested that the autoimmune induced by Hp infection probably is the key mechanism for POAG onset, and Hp detection should be taken as a routinized index applied to the prevention and therapy of POAG in clinic. However, we can not sufficiently investigate the possible mechanism of POAG relates to Hp infection. Is it true that Hp infection only relative to POAG but not a causative factor for POAG?18 What are the initial mechanisms of Hp in POAG if the pathogen takes part in the onset of the disease? Such questions will be the study topics to the medical researchers worldwide in future.&#x0D; Funding&#x0D; This work is supported by the Research Fund for Lin He’s Academician Workstation of New Medicine and Clinical Translation in Jining Medical University(JYHL2018FMS08), and the Project of scientific research support fund for teachers of Jining Medical University (JYFC2018FKJ023).&#x0D; Conflicts of interest&#x0D; There is no any conflict of interest between all of the authors.&#x0D; References:&#x0D; &#x0D; Chan H. H.; Ng Y.F.; Chu P. H. Clin Exp Optom. 2011, 94, 247.&#x0D; Kountouras J.; Mylopoulos N.; Konstas A. G.; Zavos C.; Chatzopoulos D.; Boukla A. Graefe’s Arch Clin Exp Ophthalmo. 2003, l241, 884.&#x0D; Kim E. C.; Park S. H.; Kim M. S. A. J. Pharmacol. Ther. 2010, 26, 563.&#x0D; Cantor L.; Fechtner R. D.; Michael A. J. San Francisco: Foundation of American Academy of Ophthalmology. 2005, 8.&#x0D; Bron A.; Chaine G.; Villain M.; Colin J.; Nordmann J. P.; Renard, J.P.; et al. Fr. Ophtalmol. 2008, 31, 435.&#x0D; Suzuki H.; Franceschi F.; Nishizawa T.; Gasbarini A. Helicobacter. 2011, 16, 65.&#x0D; Xia W.; Zhang X.; Wang J.; Sun C.; Wu L. Br. J. Nutr. 2011, 18, 1.&#x0D; Schimke K.; Chubb S. A.; Davis W. A.; Davis T. M. Atherosclerosis. 2010, 212, 321.&#x0D; Kountouras J.; Mylopoulos N.; Boura P.; Bessas C.; Chatzopoulos D.; Venizelos J.; et al. Opthalmology. 2001, 108, 599.&#x0D; Zaidi M.; Jilani A.; Gupta Y.; Umair S.; Gupta M. Nep. J. Oph. 2009, 1, 129.&#x0D; Galloway P. H.; Warner S. J.; Morshed M. G.; Mikelberg F. S. Ophthalmology. 2003, 110, 922.&#x0D; Abdollahi A.; Zarei R.; Zare M.; Kazemi A.Iran J. Opththalmol. 2005, 18, 15.&#x0D; Kurtz S.; Regenbogen M.; Goldiner I.; Horowitz N.; Moshkowitz M. Glaucoma. 2008, 17, 223.&#x0D; Tsolakin F.; Gogaki E.; Sakkias F.; Skatharoudi C.; Lopatatzidi C.; Tsoulopoulos V.; et al. Ophthalmol. 2012, 6, 45.&#x0D; Tang H. R.; Fan Y. J.; Liu S. Sichuan Da Xue Xue Bao Yi Xue Bao. 2014, 45, 823.&#x0D; Zavous, C.; Kountouras, J. Ophthalmol. 2012, 6, 243.&#x0D; Deshpande N.; Lalitha P.; Krishna das S. R.; Jethani J.; Pillai R. M.; Robin A.; et al. Glaucoma. 2008, 17, 605.&#x0D; Öztürk F.; Kurt E.; Inan U. U.; Erm S. S.; Çetinkaya Z.; Altýndi M. African J. Res. 2009, 3, 560.&#x0D; Kim J. M.; Kim S. H.; Park K. H.; Han S. Y.; Shim H. S. Invest Ophthalmol. Vis. Sci. 2011, 52, 665.&#x0D; Hong Y.; Zhang C. H.; Duan L.; Wang E. Asian J. Ophthalmol. 2007, 9, 205.&#x0D; Samarai V.; Shrif N.; Nateghi S. Glob. J. Health Sci. 2014, 6, 13.&#x0D; Bagnis A.; Izzotti A.; Saccàn S. C. Diagestive and Liver Disease. 2012, 44, 962.&#x0D; Gao F.; Li W. X. Chin. J. Gastroenterol. 2015, 20, 151.&#x0D; Zavos C.; Kountouras J.; Sakkias G.; Venizelos L.; Deretzi G.; Arapoglou, S. Res. 2012, 47, 150.&#x0D; Kountouras J.Br. J. 2009, 93, 1413.&#x0D; Kountouras J.; Gavalas E.; Zavos C.; Stergiopoulos C.; Chatzopoulos D.; Kapetanakis N.; et al. . Hypotheses. 2007, 68, 378.&#x0D;

IntroductionAccording to modern scholars (N. Maslova, B. Astafiev), one of the important reasons for the global planetary crisis, including modern educational system in particular, is violation of the conformity of nature principles in the process of perception and cognition of the world, which is conditioned by the advantages of the development of logical and rational thinking and insufficient development of figurative, spiritual-intuitive thinking in the contemporary school of all levels.The modern system of education at all levels (school, higher education, postgraduate studies, and doctorate) is aimed primarily at the development of mechanisms of the left hemisphere that are rational, logical thinking, and analytical perception of reality.Such a one-way orientation leads to inhibition of right-sided processes, does not contribute to the development of creativity, disclosure and activation of the spiritual and intuitive capabilities of the individual, as well as to alienation of individual from the World, loss of personal sense of integrity, unity with the World; that is, to the disharmony of individual with his/her own nature and environment.Personal development of an individual in modern conditions takes the form of "Homo technicus" ("technical person"), "Homo informaticus" (“informational and technogenic person”), "Нomо соnsumens" (“person who consumes”), "Reified man" ("material surplus person"), "Nomo Festivus" ("person who has fun") (Butenko, 2017). As a result, a person with a technocratic, rational thinking, pragmatic and consumer attitude towards the world is brought up, and as a consequence, harmony in the "man-man", "man-nature", "man-society", "man-universe" systems, and correspondingly, the equilibrium in the integrated information-energy system interaction "Man – Society – Earth –Universe" are violated.Approach In contemporary education of all levels, high ontological and existential goals are not set, and not enough attention is paid to the spiritual and mental health of the individual, in particular to problems of spiritual self-knowledge, self-development, self-regulation and self-realization, thus leading to the formation of consumer psychology, dominance of pragmatic values, loss of spirituality, upbringing of a human – destroyer, a soulless person, but not a creator.One of the ways out from the planetary global crisis in the area of a contemporary education in particular, is the noosphereization of education, the imperative task of which is formation of the noospheric individual, actualization of his/her spiritual and intuitive potential, training of the noosphere integral harmonious bioadequate environmentally healthy mindset, which is based on a conscious total ownership of logical (left cerebral hemisphere) and creative, spiritual-intuitive (right cerebral hemisphere) thinking that, due to correspondence with both huamn nature and the laws of the cosmoplanetary world, will provide the individual with possibilities to adequately and fully (at the information and energy levels) perceive and recognize the surrounding world, and to interact with it on a spiritual basis.Results and Discussion The problem of intuition always remains relevant throughout the history of mankind. Among the scholars of the late XX century - beginning of the XXI century the problem of intuition and harmonization of the activity of the left and right hemispheres of the brain has been studied by such researchers as G. Kurmyshev, N. Maslova, Osho Bhagwan Sri Rajneesh, I. Smokvina and others. Modern psychophysiological science explains the nature of intuitive thinking and cognition: the human mind combines the ability to integrate and develop both intellectual and intuitive knowledge that modern scientists associate with the activity of the left and right cerebral hemispheres. According to psychological science, the two hemispheres of the brain cognize and reflect the surrounding world differently and, thereafter transform information in their own ways. The left hemisphere "sees" objects as discrete, separated; it is responsible for logic and intellect, verbal thinking, application of sign information (reading, counting, language), and is characterized by the ability for logical, rational, mathematical, and scientific thinking. The right hemisphere binds objects into a single whole; it is responsible for emotions, creative thinking, intuition (unconscious processes). Thanks to the right hemisphere, a holistic image of the world is formed, and the left hemisphere gradually collects the model of the world from separate, but carefully studied details. "Left- hemisphered" thinking is associated with the ability for consistent, step-by-step cognition, which has respectively analytical rather than synthetic character. "Right- hemisphered" thinking is linked to the ability for integral, voluminous and complete cognition, space spatial immediate perception of the world in all of its information-energy interrelations and interactions.Logic and intuition, rational and intuitive paths – are different aspects of the unified process of cognition, and if the intellect can be regarded as the earthly beginning in humans, then intuition – is a spiritual primary source, a phenomenon of nonlinear, unearthly thinking, the logic of the Higher Being, the logic of the Almighty. As was very wittily pointed out by Osho Bhagwan Shree Rajneesh, logic – the way our mind cognizes our reality, intuition – is how the spirit passes through the experience of reality (Maslova, 2006). Therefore, logic and intuition are two mutually conditioned mechanisms of scientific cognition that supplement and do not exist in isolation from one another. If the function of intuition in this interaction lies in creative discoveries, inventions, awareness of the true essence of things and phenomena, then the task of the scientific method, acting as an assistant of intuition, is to endeavor to comprehend new ideas, explain them from the point of view of earth science at the logical level, and "adapt" to our reality.Given this, rational and intuitive paths must complement, enrich and explain each other, interact in sync, in synthesis.Intuition is an organic component of the spiritual and psychic nature of the individual. Therefore, the problem of the development of intuition and harmonization of the discourse-logical and spiritual-intuitive components of thinking is extremely important at all levels of contemporary education. This is especially true for student youth, since students are the future spiritual and creative potential of the country, and therefore it is extremely important to reveal and develop their spiritual and intuitive abilities, to harmonize their mental-spiritual sphere, which promotes spiritual self-healing of both the individual and the environment, and harmonization of relations in the world. In the context of the modern information and energy paradigm, intuition is considered as a special mental state of a highly spiritual person, in which he/she deliberately initiates informational and energetic contact with any object of the Universe, in the physical or subtle world, "connects" to its information field, "reads out", "decrypts" and analyzes necessary information. This information-energy interaction is perceived by the individual as the process of connection, merging with the object being studied, which enables instant cognition of its true essence (Smokvina, 2013). As the analysis of the literature on the research problem testifies, if the activity mechanisms of the left hemisphere of the brain are relatively studied in modern science, the problems of the individual’s intuitive updating potential and harmonization of the activity of logical and intuitive cognitive processes are being investigated.According to many scholars, the ability for intuition is inborn in every human; however, unfortunately, in most people it is in a latent state. And only due to intense conscious work of the individual regarding their own spiritual self–cognition and self–perfection, one can discover and develop personal spiritual and intuitive abilities.According to the results of our theoretical study the general conditions contributing to the disclosure and development of intuition are as follows: (Tyurina, 2017) • Ability to cope with one’s own passions, emotions, feelings, thoughts, and achievement of the state of internal silence, voicelessness;• Formed self-motivation for spiritual self–cognition and self–perfection;• Achievement by the individual of the corresponding spiritual level: the higher the spirituality of the human, the more clearly his/her ability is expressed to obtain a higher spiritual knowledge: information and energy interaction, contact with higher levels of psychic reality;• Conscious desire, willingness of the individual to use intuitive cognition that helps overcome information-power resistance, the barrier that exists between a subject and an object, helps create harmony, assonance, interaction with the object being studied;• Intuitive human confidence: deep inner belief in personal intuitive capabilities and ability for intuitive cognition and self-cognition;• Humanistic orientation of the individual and his/her internal psychological properties such as: altruism, active love for all living beings on the Earth, empathy, ability to express compassion, care, and self-consecration, conscious desire to live in harmony with oneself and the world;• Nonjudgmental practice, which consists of the ability of a person to abandon assessments, classifications, analysis, which creates favorable conditions for immersion into the information space around us, makes it possible to connect to the information-energy field (biofield) of the object being studied;• Sense of inner unity with the world, awareness of oneself as a part of mankind, of the Earth, of the Universe, and a feeling of deep responsibility for the world and for ourselves in the world;• Striving for personal self-realization for the benefit of the cosmoplanetary world.In our opinion, the ways of actualization of intuition and harmonization of the activity of logical and intuitive components of the process of cognition should be attributed to the following (Tyurina, 2018):• Concentration, concentration of human consciousness of the subject being studied, deep and thorough knowledge of it.Psychological mood, deep concentration, focus of human consciousness on the subject of research lead to intuitive penetration into its essence, comprehension of the subject of study as if "from within." An intuitive act of cognition is the result of a huge concentration of all human efforts on a particular problem, deep and thorough knowledge of it, mobilization of all its potencies. In particular, for almost 20 years, D. Mandeleev worked continuously on the systematization of chemical elements, and only after that he "saw" his periodic system of elements in his dream. At academician M. Shchetynin school students spend 21 days (6 lessons daily) studying only one academic discipline for the purpose of deep penetration into its essence - information-energy merger, connection with the subject being studied, into a single whole, that is, achieving an intuitive level of comprehension.• Spiritual practices (prayer, meditation).Prayer and meditation are effective ways of spiritualizing a person, awakening and activating his/her intuitive potential. Through prayer, meditation a person learns to adjust to nature and Cosmos, eternity and infinity, the World Harmony, reaches consonance with the World, and permeates its inner essential depth with the heart.It is believed that it is prayer that promotes the spiritual purification of both the human soul and the surrounding world. During a heart-warming prayer a human comes to enlightenment and spiritual enlightenment, intuitive enlightenment.In the process of prayer, meditation, the right and left hemispheres of the brain begin to work synchronously, which makes the brain function in resonance with the Field of Consciousness or the Field of Information - Noosphere.• Spiritual processing of the corresponding religious, spiritual and philosophical sources, fine arts, classical music, information-energy interaction which raises the spiritual level of an individual, awakens his/her intuitive abilities.Spiritual literature is an important way of discovering and developing intuition and harmonizing the activity of intuitive and logical components of thinking, since information and energy interaction with spiritual literature contributes to individual’s spiritual growth, disclosure and development of intuition, and harmonization of personal intuitional and intellectual sphere.It should be noted that various forms of art, in particular, visual and musical, play a special role in the process of disclosure and development, intuition, harmonization of the logical and figurative, spiritual and intuitive perception of reality.The spiritual potential of art is, first of all, that in itself, creating spiritual values, spiritualizes a person, and interprets personality as a phenomenon of a global planetary-cosmic nature. True art has an ecumenical, cosmic dimension. The best masterpieces of world art transfer the idea of unity of humans with the world, their harmonious interaction.The creativity of great artists contributes to the disclosure and development of the personality's spirituality, the heart's perception of the world, the cultivation of the Cosmic Worldview, and directs the person to high ideals.Musical art is one of the most important means of revealing and developing intuition, harmonizing its spiritual and intuitive basis.The results of research by modern scholars show that classical, spiritual music activates the spiritual-intuitive sphere, harmonizes the person, gives a sense of joy and rest, and helps to restore spiritual and mental balance.It has been scientifically proven that classical musical compositions based on the perfection of harmony and rhythm, especially the works of J. Bach, L. Beethoven, J. Brahms, A. Vivaldi, G. Handel, F. List, F. Mendelssohn, A. Mozart, S. Rakhmaninov, O. Scriabin, P. Tchaikovsky, F. Chopin, F. Schubert, R. Schumann and others have a positive effect on the individual on the spiritual, mental and physiological levels, since classical music relates mainly to the natural rhythms of the human body. This music causes not only positive emotions, but also represents a powerful energy force that inspires humans and the world: makes a person more perfect and the world more beautiful.Consequently, fine arts, classical music, contribute to the disclosure and development of the spiritual and intuitive potential of the individual, to harmonization of his/her intuitive-intellectual sphere; they help the person to grow spiritually and be filled with high spiritual energy, accordingly, to change, and improve the natural and social environment.- Bioadequate REAL-methodology of noosphere education (N. Maslova), in which stages of relaxation (accumulation of information, work of the right creative hemisphere in a state of rest), alternating with stages of activity (training of the left hemisphere: logic, analysis, synthesis of information) are presented. As a result, the work of the left and right cerebral hemispheres is synchronized, which promotes harmonization of consciousness, carries a beneficial influence on the spiritual, mental, social and physical health of the student's personality.The fundamental characteristics of the bioadequate method of noospheric education are:1. Health preserving - does not violate the nature of perception, processing and preservation of information.2. Corrective - restores the natural genetic sequence of work with the information and health of the student and the teacher.3. Developing - improves the body's reserves.4. Harmonizing - integrates all systems of the body and personality (Vernadsky, 2002).According to studies of the neuropathologist I. Smokvinova, PhD, bioadequate methods of noosphere education, taking into account the physiological and informational and energy resources of the individual, contribute to the harmonization of the work of the left and right cerebral hemispheres, awaken higher feelings, recharge with life energy, teach the ability to direct vitality to the realization of one’s own higher potential, which also has a beneficial effect on the spiritual, mental and physical health of the individual. Moreover, due to the application of a bioadequate technique, psychological and physiological stress is eliminated, and a positive emotional mood is created that heals the body and the student's psychics (Osho, 2000). According to N. Maslova, holistic thinking contributes to the acquisition of basic energy, biologically adequate to livelihoods programs (Kurmyshev, 2013).Many independent groups of scientists (teachers, psychologists, physicians, biologists) have proved that noosphere education, harmonizing the left and right hemispheres thinking, has a healing effect on the body of both the student and the teacher, contributes to the development of natural creativity.Practical valueResults of our study can be used in lectures and practical classes with students in medical psychology, psychology of creativity, social, general, pedagogical psychology, pedagogy (sections of didactics, spiritual and moral education), sociology, philosophy, etc.ConclusionsThus, the actualization of the spiritual and intuitive potential of the individual and the harmonization of the activity of the left and right cerebral hemispheres stimulates the disclosure of spiritual and creative abilities of the individual, fills the individual with spiritual energy, and the person becomes a source of spiritualization of himself/herself and the world, thus contributing to the spiritual and psychological improvement of society, humanity, and civilization in general, since at the information-energy level, "Man - Society - Earth - Universe" this is the only cosmoplanetary organism, all parts of which are mutually interconnected, interact and stipulate with one another. We consider that it is important in the future to develop appropriate special disciplines for all the sections of modern school and keep working in the direction of developing and incorporating into the content of the curricula, relevant pedagogical technologies aimed at the disclosure and development of the intuitive-mental sphere of the individual

The article is dedicated to the memory of famous representatives of the Ukrainian therapeutic school of three generations: academician M. D. Strazhesko, professor S. Y. Shteinberg, academician L. T. Mala. The life path of prominent Ukrainian doctors has been highlighted, and their scientific heritage and scientific activities in the area of internal diseases have been analyzed. Achievements of N. D. Strazhesko, S. Y. Steinberg and L. T. Mala forever immortalized their names in the line of the most prominent representatives of medical science in Ukraine.

Prof. Nikolai Mikhailovich Popov at a meeting of the 2nd p. May unanimously elected dean of the Medical Faculty of Novorossiysk University.&#x0D; From the 1st to the 5th of June of the current year, the second All-Russian congress on pedagogical psychology will take place in St. Petersburg, in the premises of the Salt Town. The organizing committee includes: chairman, academician V. M. Bekhterev, comrades of the chairman A. A. Krogius, A. F. Lazursky, D. M. Levshin and A. P. Nechaev and members D. A. Dril, M. I Konorov, N. E. Rumyantsev, V. V. Uspensky, G. A. Falbork. L. G. Orshansky, Pr.-Assoc. Zhakov, N. K. Kulman, A. I. Zaginyaev, Ya. I. Dushechkin, S. Yu. Blumenau. V. V. Rakhmanov, N. I. Neklyudova, E. S. Dedyulina and others. The members of the congress can be teachers of higher and secondary educational institutions, doctors and persons who have declared themselves to be published works in the field of psychology and school hygiene. All those interested in educational psychology are allowed as guests.

Проблема трудоустройства выпускников российских университетов не нова и касается каждого выпускника, окончившего высшее учебное заведение. Статья посвящена проблеме совершенствования процесса управления трудоустройством выпускников вуза, пути их решения по средствам сотрудничества работодателей и вузов. В статье описаны информационные потоки при проведении мониторинга трудоустройства как внутри образовательного учреждения, так и при взаимодействии с внешней средой. Приведены примеры основных служб поддержки трудоустройства студентов и обоснованность ведения мониторинга занятости выпускников вузов, также актуальность использования автоматизированной информационной системы содействия трудоустройству (АИСТ). Рассмотрены методики мониторинга трудоустройства и методы качественных исследований: фокус-группы, глубинные интервью, анализ протокола. Описаны основные методы количественных исследований: экспертный опрос, анкетирование, контент-анализ. The problem of employing graduates of Russian universities is not new and concerns every graduate who has graduated from a higher educational institution. The article is devoted to the problem of improving the process of managing the employment of graduates, ways to solve them by means of cooperation between employers and universities. The article describes the information flows during the monitoring of employment both within the educational institution and in interaction with the external environment. Examples of the main student employment support services and the validity of monitoring the employment of university graduates are given, as well as the relevance of using an automated information system for promoting employment (AIST). The methods of monitoring employment and methods of qualitative research are considered: focus groups, in-depth interviews, protocol analysis. The main methods of quantitative research are described: expert survey, questionnaire, content analysis

В данной статье рассматривается проблема учета, контроля и удобного хранения сведений о научноисследовательской деятельности. Важным фактором, обуславливающим необходимость разработки информационной системы, является отсутствие на рынке программного продукта или комплекса, позволяющего использовать его в качестве управления научноисследовательской деятельностью. В ходе исследования проведены: анализ научноисследовательской деятельности преподавателей и сотрудников Грозненского государственного нефтяного технического университета имени академика М.Д. Миллионщикова анализ существующих систем автоматизированного учета данных о научных работах анализ программного обеспечения, необходимый для разработки информационной системы, а также сравнительный анализ антивирусных программ. В результате исследования разработана информационная система учета и контроля научноисследовательской деятельности преподавателей и сотрудников вуза, которая предоставит возможность сотрудникам учебного заведения вести учет результатов своей научной деятельности и формировать различные отчеты. Это существенно повысит эффективность научноисследовательской деятельности вуза и сократит время подготовки и формирования отчетов различных видов. This article deals with the problem of accounting, control and convenient storage of information about research activities. An important factor that necessitates the development of an information system is the lack of a software product or complex on the market that allows it to be used as a management of research activities. In the course of the study, the analysis of the research activities of teachers and employees of the Grozny state oil technical University named after academician M. D. Millionshchikov was carried out analysis of existing systems of automated accounting of data on scientific works analysis of software required for the development of an information system, as well as comparative analysis of antivirus programs. As a result of the study, an information system of accounting and control of research activities of teachers and staff of the University was developed, which will provide an opportunity for employees of the educational institution to keep records of the results of their research activities and generate various reports. This will significantly increase the efficiency of research activities of the University, and reduce the time of preparation and formation of reports of various types.

Background: The aims of this study were the temporal analysis of salivary biomarkers of cellular damage and oxidative stress following of lower third molar surgical removal from healthy patient and without postoperative complications. Material and Methods: Three whole unstimulated saliva samples were collected from each of 17 patients (8 men, 9 women) before surgery, 1 and 7 days after lower third molar surgical removal using the expectoration (or 'spit') method. Salivary flow rate (SFR), pH, buffer capacity (BC) were measured, immediately after collection. The samples were centrifuged and the supernatants were stored in aliquots at -80°C until analysis. Salivary thiobarbituric reacting substances (TBARs), total antioxidant capacity (TAC), haemoglobin (Hb), total protein (TP), uric acid (UA), acid phosphatase (ACP), tartrate-resistant acid phosphatase (TRAP), alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH) were measured by spectrophotometric method. Results: There were no significant differences between pre- and post-surgical SFR, pH, BC, or TP. One day after extraction were detected a significant increases in Hb, TBARs, ACP, TRAP, ALP, AST, ALT, and LDH activities, and decreases of UA and TAC levels were observed. Seven days after extraction, only AST (higher) remained increased compared to pre-surgical levels. Conclusions: The surgical removal of impacted lower third molars increases salivary biomarkers of cellular damage and oxidative stress, and decreases the TAC in the early postoperative. Considering these issues, our data open new perspectives of a possible use of these parameters as biomarkers for screening and monitoring of patients vulnerable to the development of postoperative complications.Descriptors: Saliva; Biomarkers; Oral Surgical Procedures; Oxidative Stress; Enzymes; Thiobarbituric Acid Reactive Substances.ReferencesMajid OW, Mahmood WK. Effect of submucosal and intramuscular dexamethasone on postoperative sequelae after third molar surgery: comparative study. Br J Oral Maxillofac Surg. 2011;49(8):647-52.Larjava H. Oral wound healing : cell biology and clinical management. Oxford: Wiley-Blackwell; 2012. XVI, 408 p.pMohn CE, Steimetz T, Surkin PN, Fernandez-Solari J, Elverdin JC, Guglielmotti MB. Effects of saliva on early post-tooth extraction tissue repair in rats. Wound Repair Regen. 2015;23(2):241-50.Ozmeric N, Mollaoglu N, Elgun S, Devrim E. Impact of chlorhexidine mouth rinse use on postextraction infection via nitric oxide pathway. Inflamm Res. 2010;59(6):437-41.Dos Santos DR, Souza RO, Dias LB, Ribas TB, de Oliveira LCF, Sumida DH et al. The effects of storage time and temperature on the stability of salivary phosphatases, transaminases and dehydrogenase. Arch Oral Biol. 2018;85:160-65.Dabra S, China K, Kaushik A. Salivary enzymes as diagnostic markers for detection of gingival/periodontal disease and their correlation with the severity of the disease. J Indian Soc Periodontol. 2012;16(3):358-64.Cesco Rde T, Ito IY, de Albuquerque RF Jr. Levels of aspartate aminotransferase (AST) in saliva of patients with different periodontal conditions. J Clin Periodontol. 2003;30(8):752-55.Cunha-Correia AS, Hernandes Neto A, Pereira AF, Aguiar SM, Nakamune AC. Enteral nutrition feeding alters antioxidant activity in unstimulated whole saliva composition of patients with neurological disorders. Res Dev Disabil. 2014;35(6):1209-15.Nagler RM, Klein I, Zarzhevsky N, Drigues N, Reznick AZ. Characterization of the differentiated antioxidant profile of human saliva. Free Radic Biol Med. 2002;32(3):268-77.Miricescu D, Totan A, Calenic B, Mocanu B, Didilescu A, Mohora M et al. Salivary biomarkers: relationship between oxidative stress and alveolar bone loss in chronic periodontitis. Acta Odontol Scand. 2014;72(1):42-7.Bansal N, Gupta ND, Bey A, Sharma VK, Gupta N, Trivedi H. Impact of nonsurgical periodontal therapy on total antioxidant capacity in chronic periodontitis patients. J Indian Soc Periodontol. 2017;21(4):291-95.Wang Y, Andrukhov O, Rausch-Fan X. Oxidative stress and antioxidant system in periodontitis. Front Physiol. 2017;8:910.Cutando A, Arana C, Gomez-Moreno G, Escames G, Lopez A, Ferrera MJ et al. Local application of melatonin into alveolar sockets of beagle dogs reduces tooth removal-induced oxidative stress. J Periodontol. 2007;78(3):576-83.Bassoukou IH, Nicolau J, dos Santos MT. Saliva flow rate, buffer capacity, and pH of autistic individuals. Clin Oral Investig. 2009;13(1):23-7.Kamodyova N, Banasova L, Jansakova K, Koborova I, Tothova L, Stanko P et al. Blood contamination in saliva: impact on the measurement of salivary oxidative stress markers. Dis Markers. 2015;2015:479251.Hartree EF. Determination of protein: a modification of the Lowry method that gives a linear photometric response. Anal Biochem. 1972;48(2):422-27.Granjeiro JM, Taga EM, Aoyama H. Purification and characterization of a low-molecular-weight bovine kidney acid phosphatase. An Acad Bras Cienc. 1997;69(4):451-60.Henry RJ, Chiamori N, Golub OJ, Berkman S. Revised spectrophotometric methods for the determination of glutamic-oxalacetic transaminase, glutamic-pyruvic transaminase, and lactic acid dehydrogenase. Tech Bull Regist Med Technol 1960;30:149-66.Huijgen HJ, Sanders GT, Koster RW, Vreeken J, Bossuyt PM. The clinical value of lactate dehydrogenase in serum: a quantitative review. Eur J Clin Chem Clin Biochem. 1997;35(8):569-77.Buege JA, Aust SD. Microsomal lipid peroxidation. Methods Enzymol. 1978;52:302-10.Benzie IF, Strain JJ. The ferric reducing ability of plasma (FRAP) as a measure of "antioxidant power": the FRAP assay. Anal Biochem. 1996;239(1):70-6.Trivedi RC, Rebar L, Berta E, Stong L. New enzymatic method for serum uric acid at 500 nm. Clin Chem. 1978;24(11):1908-11.Shaila M, Pai GP, Shetty P. Salivary protein concentration, flow rate, buffer capacity and pH estimation: A comparative study among young and elderly subjects, both normal and with gingivitis and periodontitis. J Indian Soc Periodontol. 2013;17(1):42-6.Hosseini-Yekani A, Nadjarzadeh A, Vossoughi M, Reza JZ, Golkari A. Relationship between physicochemical properties of saliva and dental caries and periodontal status among female teachers living in Central Iran. J Int Soc Prevent Community Dent. 2018;8(1):48-55.Jafari SM, Motamedi MH, Jafari M, Tabeshfar S, Jafari M, Naghizadeh MM. Impacted lower third molars: Can preoperative salivary pH influence postoperative pain? Natl J Maxillofac Surg. 2010;1(2):123-26.Kejriwal S, Bhandary R, Thomas B, Kumari S. Estimation of levels of salivary mucin, amylase and total protein in gingivitis and chronic periodontitis patients. J Clin Diagn Res. 2014;8(10):ZC56-60.Gutierrez-Corrales A, Campano-Cuevas E, Castillo-Dali G, Serrera-Figallo MA, Torres-Lagares D, Gutierrez-Perez JL. Relationship between salivary biomarkers and postoperative swelling after the extraction of impacted lower third molars. Int J Oral Maxillofac Surg. 2017;46(2):243-49.Hannig C, Spitzmuller B, Hannig M. Transaminases in the acquired pellicle. Arch Oral Biol. 2009;54(5):445-48.Hannig C, Spitzmuller B, Miller M, Hellwig E, Hannig M. Intrinsic enzymatic crosslinking and maturation of the in situ pellicle. Arch Oral Biol. 2008;53(5):416-22.Rodriguez PG, Felix FN, Woodley DT, Shim EK. The role of oxygen in wound healing: a review of the literature. Dermatol Surg. 2008;34(9):1159-69.

Photo by Sharon McCutcheon on Unsplash&#x0D; ABSTRACT&#x0D; COVID-19 highlighted a disproportionate impact upon marginalized communities that needs to be addressed. Specifically, a focus on equity rather than equality would better address and prevent the disparities seen in COVID-19. A distributive justice framework can provide this great benefit but will succeed only if the medical community engages in outreach, anti-racism measures, and listens to communities in need.&#x0D; INTRODUCTION&#x0D; COVID-19 disproportionately impacted communities of color and lower socioeconomic status, sparking political discussion about existing inequities in the US.[1] Some states amended their guidelines for allocating resources, including vaccines, to provide care for marginalized communities experiencing these inequities, but there has been no clear consensus on which guidelines states should amend or how they should be ethically grounded. In part, this is because traditional justice theories do not acknowledge the deep-seated institutional and interpersonal discrimination embedded in our medical system. Therefore, a revamped distributive justice approach that accounts for these shortcomings is needed to guide healthcare decision-making now and into the post-COVID era.&#x0D; BACKGROUND&#x0D; Three terms – health disparity, health inequities, and health equity – help frame the issue. A health disparity is defined as any difference between populations in terms of disease incidence or adverse health events, such as morbidity or mortality. In contrast, health inequities are health disparities due to avoidable systematic structures rooted in racial, social, and economic injustice.[2] For example, current data demonstrate that Black, Latino, Indigenous Americans, and those living in poverty suffer higher morbidity and mortality rates from COVID-19.[3] Finally, health equity is the opportunity for anyone to attain his or her full health potential without interference from systematic structures and factors that generate health inequities, including race, socioeconomic status, gender, ethnicity, religion, sexual orientation, or geography.[4]&#x0D; ANALYSIS&#x0D; Health inequities for people of color with COVID-19 have led to critiques of states that do not account for race in their resource allocation guidelines.[5] For example, the Massachusetts Department of Public Health revised its COVID-19 guidelines regarding resource allocation to patients with the best chance of short-term survival.[6] Critics have argued that this change addresses neither preexisting structural inequities nor provider bias that may have led to comorbidities and increased vulnerability to COVID-19. By failing to address race specifically, they argue the policy will perpetuate poorer outcomes in already marginalized groups. As the inequities in COVID-19 outcomes continue to be uncovered and the data continue to prove that marginalized communities suffered disproportionately, we, as healthcare providers, must reconsider our role in addressing the injustices. Our actions must be ethically grounded in the concept of justice.&#x0D; l. Primary Theories of Justice&#x0D; The principle of justice in medical ethics relates to how we ought to treat people and allocate resources. Multiple theories have emerged to explain how justice should be implemented, with three of the most prominent being egalitarianism, utilitarianism, and distributive. This paper argues that distributive justice is the best framework for remedying past actions and enacting systemic changes that may persistently prevent injustices.&#x0D; An egalitarian approach to justice states all individuals are equal and, therefore, should have identical access to resources. In the allocation of resources, an egalitarian approach would support a strict distribution of equal value regardless of one’s attributes or characteristics. Putting this theory into practice would place a premium on guidelines based upon first-come, first-served basis or random selection.[7] However, the egalitarian approach taken in the UK continues to worsen health inequities due to institutional and structural discrimination.[8]&#x0D; A utilitarian approach to justice emphasizes maximizing overall benefits and achieving the greatest good for the greatest number of people. When resources are limited, the utilitarian principle historically guides decision-making. In contrast to the egalitarian focus on equal distribution, utilitarianism focuses on managing distributions to maximize numerical outcomes. During the COVID-19 pandemic, guidelines for allocating resources had utilitarian goals like saving the most lives, which may prioritize the youthful and those deemed productive in society, followed by the elderly and the very ill. It is important to reconsider using utilitarian approaches as the default in the post-COVID healthcare community. These approaches fail to address past inequity, sacrificing the marginalized in their emphasis on the greatest amount of good rather than the type of good.&#x0D; Finally, a distributive approach to justice mandates resources should be allocated in a manner that does not infringe individual liberties to those with the greatest need. Proposed by John Rawls in a Theory of Justice, this approach requires accounting for societal inequality, a factor absent from egalitarianism and utilitarianism.[9] Naomi Zack elaborates how distributive justice can be applied to healthcare, outlining why racism is a social determinant of health that must be acknowledged and addressed.[10]&#x0D; Until there are parallel health opportunities and better alignment of outcomes among different social and racial groups, the underlying systemic social and economic variables that are driving the disparities must be fixed. As a society and as healthcare providers, we should be striving to address the factors that perpetuate health inequities. While genetics and other variables influence health, the data show proportionately more exposure, more cases, and more deaths in the Black American and Hispanic populations. Preexisting conditions and general health disparities are signs of health inequity that increased vulnerability. Distributive justice as a theoretical and applied framework can be applied to preventable conditions that increase vulnerability and can justify systemic changes to prevent further bias in the medical community.&#x0D; During a pandemic, egalitarian and utilitarian approaches to justice are prioritized by policymakers and health systems. Yet, as COVID-19 has demonstrated, they further perpetuate the death and morbidity of populations that face discrimination. These outcomes are due to policies and guidelines that overall benefit white communities over communities of color. Historically, US policy that looks to distribute resources equally (focusing on equal access instead of outcomes), in a color-blind manner, has further perpetuated poor outcomes for marginalized communities.[11]&#x0D; ll. Historical and Ongoing Disparities&#x0D; Across socio-demographic groups, the medical system exacerbates historical and current inequities. Members of marginalized races,[12] women,[13] LGBTQ people,[14] and poor people[15] experience trauma caused by discrimination, marginalization, and failure to access high-quality public and private goods. Through the unequal treatment of marginalized communities, these historic traumas continue.&#x0D; In the US, people of color do not receive equal and fair medical treatment. A meta-analysis found that Hispanics and Black Americans were significantly undertreated for pain compared to their white counterparts over the last 20 years.[16] This is partly due to provider bias. Through interviewing medical trainees, a study by the National Academy of Science found that half of medical students and residents harbored racist beliefs such as “Black people’s nerve endings are less sensitive than white people’s” or “Black people’s skin is thicker than white people’s skin.”[17] More than 3,000 Indigenous American women were coerced, threatened, and deliberately misinformed to ensure cooperation in forced sterilization.[18] Hispanic people have less support in seeking medical care, in receiving culturally appropriate care, and they suffer from the medical community’s lack of resources to address language barriers.[19] &#x0D; In the US, patients of different sexes do not receive the same quality of healthcare. Despite having greater health needs, middle-aged and older women are more likely to have fewer hospital stays and fewer physician visits compared to men of similar demographics and health risk profiles.[20] In the field of critical care, women are less likely to be admitted to the ICU, less likely to receive interventions such as mechanical ventilation, and more likely to die compared to their male ICU counterparts.[21]&#x0D; In the US, patients of different socioeconomic statuses do not receive the same quality of healthcare. Low-income patients are more likely to have higher rates of infant mortality, chronic disease, and a shorter life span.[22] This is partly due to the insurance-based discrimination in the medical community.[23] One in three deaths of those experiencing homelessness could have been prevented by timely and effective medical care. An individual experiencing homelessness has a life expectancy that is decades shorter than that of the average American.[24]&#x0D; lll. Action Needed: Policy Reform&#x0D; While steps need to be taken to provide equitable care in the current pandemic, including the allocation of vaccines, they may not address the historical failures of health policy, hospital policy, and clinical care to eliminate bias and ensure equal treatment of patients. According to an applied distributive justice framework, inequities must be corrected.&#x0D; Rather than focusing primarily on fair resource allocation, medicine must be actively anti-racist, anti-sexist, anti-transphobic, and anti-discriminatory. Evidence has shown that the health inequities caused by COVID-19 are smaller in regions that have addressed racial wealth gaps through forms of reparations.[25] Distributive justice calls for making up for the past using tools of allocation as well as tools to remedy persistent problems.&#x0D; For example, Brigham and Women’s Hospital in Boston, MA, began “Healing ARC,” a pilot initiative that involves acknowledgement, redress, and closure on an institutional level.[26] Acknowledgement entails informing patients about disparities at the hospital, claiming responsibility, and incorporating community ideas for redress. Redress involves a preferential admission option for Black and Hispanic patients to specialty services, especially cardiovascular services, rather than general medicine. Closure requires that community and patient stakeholders work together to ensure that a new system is in place that will continue to prioritize equity.&#x0D; Of note, redress could take the form of cash transfers, discounted or free care, taxes on nonprofit hospitals that exclude patients of color,[27] or race-explicit protocol changes (such as those being instituted by Brigham and Women’s Hospital that admit patients historically denied access to certain forms of medical care). In New York, for instance, the New York State Bar Association drafted the COVID-19 resolutions to ensure that emergency regulations and guidelines do not discriminate against communities of color, and even mandate that diverse patient populations be included in clinical trials.[28]&#x0D; Also, physicians must listen to individuals from marginalized communities to identify needs and ensure that community members take part in decision-making. The solution is not to simply build new health centers in communities of color, as this may lead to tiers of care. Rather, local communities should have a chance to impact existing hospital policy and should also use their political participation to further their healthcare interests.&#x0D; Distributive justice does not seek to disenfranchise groups that hold power in the system. It aims to transform the system so that those in power do not continue to obtain unfair benefits at the expense of others. The framework accounts for unjust historical oppression and current injustices in our system to provide equitable outcomes to all who access the system. In this vein, we can begin to address the flagrant disparities between communities that have always – and continue to – exist in healthcare today.[29]&#x0D; CONCLUSION&#x0D; As equality focuses on access, it currently fails to do justice. Instead of outcomes, it is time to focus on equity. A focus on equity rather than equality would better address and prevent the disparities seen in COVID-19. A distributive justice framework can gain traction in clinical decision-making guidelines and system-level reallocation of resources but will succeed only if the medical community engages in outreach, anti-racism measures, and listens to communities in need. There should be an emphasis on implementing a distributive justice framework that treats all patients equitably, accounts for historical harm, and focuses on transparency in allocation and public health decision-making.&#x0D; [1] APM Research Lab Staff. 2020. “The Color of Coronavirus: COVID-19 Deaths by Race and Ethnicity in the U.S.” APM Research Lab. https://www.apmresearchlab.org/covid/deaths-by-race.&#x0D; [2] Bharmal, N., K. P. Derose, M. Felician, and M. M. Weden. 2015. “Understanding the Upstream Social Determinants of Health.” California: RAND Corporation 1-18. https://www.rand.org/pubs/working_papers/WR1096.html.&#x0D; [3] Yancy, C. W. 2020. “COVID-19 and African Americans.” JAMA. 323 (19): 1891-2. https://doi.org/10.1001/jama.2020.6548; Centers for Disease Control and Prevention. 2020. “COVID-19 in Racial and Ethnic Health Disparities.” Centers for Disease Control and Prevention. https://www.cdc.gov/coronavirus/2019-ncov/community/health-equity/racial-ethnic-disparities/index.html.&#x0D; [4] Braveman, P., E. Arkin, T. Orleans, D. Proctor, and A. Plough. 2017. “What is Health Equity?” Robert Wood Johnson Foundation. https://www.rwjf.org/en/library/research/2017/05/what-is-health-equity-.html.&#x0D; [5] Bedinger, M. 2020 Apr 22. “After Uproar, Mass. Revises Guidelines on Who Gets an ICU Bed or Ventilator Amid COVID-19 Surge.” Wbur. https://www.wbur.org/commonhealth/2020/04/20/mass-guidelines-ventilator-covid-coronavirus; Wigglesworth, A. 2020 May 11. “Institutional Racism, Inequity Fuel High Minority Death Toll from Coronavirus, L.A. Officials Say.” Los Angeles Times. https://www.latimes.com/california/story/2020-05-11/institutional-racism-inequity-high-minority-death-toll-coronavirus.&#x0D; [6] Executive Office of Health and Human Services Department of Public Health. 2020 Oct 20. “Crises Standards of Care Planning and Guidance for the COVID-19 Pandemic.” Commonwealth of Massachusetts. https://www.mass.gov/doc/crisis-standards-of-care-planning-guidance-for-the-covid-19-pandemic.&#x0D; [7] Emanuel, E. J., G. Persad, R. Upshur, et al. 2020. “Fair Allocation of Scarce Medical Resources in the Time of Covid-19. New England Journal of Medicine 382: 2049-55. https://doi.org/10.1056/NEJMsb2005114.&#x0D; [8] Salway, S., G. Mir, D. Turner, G. T. Ellison, L. Carter, and K. Gerrish. 2016. “Obstacles to "Race Equality" in the English National Health Service: Insights from the Healthcare Commissioning Arena.” Social Science and Medicine 152: 102-110. https://doi.org/10.1016/j.socscimed.2016.01.031.&#x0D; [9] Rawls, J. A Theory of Justice (Revised Edition) (Cambridge, MA: Belknap Press of Harvard University Press, 1999).&#x0D; [10] Zack, N. Applicative Justice: A Pragmatic Empirical Approach to Racial Injustice (New York: The Rowman &amp; Littlefield Publishing Group, 2016).&#x0D; [11] Charatz-Litt, C. 1992. “A Chronicle of Racism: The Effects of the White Medical Community on Black Health.” Journal of the National Medical Association 84 (8): 717-25. http://hdl.handle.net/10822/857182.&#x0D; [12] Washington, H. A. Medical Apartheid: The Dark History of Medical Experimentation on Black Americans from Colonial Times to the Present (New York: Doubleday, 2006).&#x0D; [13] d'Oliveira, A. F., S. G. Diniz, and L. B. Schraiber. 2002. “Violence Against Women in Health-care Institutions: An Emerging Problem.” Lancet. 359 (9318): 1681-5. https://doi.org/10.1016/S0140-6736(02)08592-6.&#x0D; [14] Hafeez, H., M. Zeshan, M. A. Tahir, N. Jahan, and S. Naveed. 2017. “Health Care Disparities Among Lesbian, Gay, Bisexual, and Transgender Youth: A Literature Review. Cureus 9 (4): e1184. https://doi.org/10.7759/cureus.1184; Drescher, J., A. Schwartz, F. Casoy, et al. 2016. “The Growing Regulation of Conversion Therapy.” Journal of Medical Regulation 102 (2): 7-12. https://doi.org/10.30770/2572-1852-102.2.7; Stroumsa, D. 2014. “The State of Transgender Health Care: Policy, Law, and Medical Frameworks.” American Journal of Public Health. 104 (3): e31-8. https://doi.org/10.2105/AJPH.2013.301789.&#x0D; [15] Stepanikova, I., and G. R. Oates. 2017. “Perceived Discrimination and Privilege in Health Care: The Role of Socioeconomic Status and Race.” American Journal of Preventative Medicine. 52 (1s1): S86-s94. https://doi.org/10.1016/j.amepre.2016.09.024; Swartz, K. “Health Care for the Poor: For Whom, What Care, and Whose Responsibility?” In Cancian, M., and S. Danziger (Eds.). Changing Poverty, Changing Policies (New York: Russell Sage Foundation Press, 2009), 69-74.&#x0D; [16] Meghani, S. H., E. Byun, and R. M. Gallagher. 2012. “Time to Take Stock: A Meta-analysis and Systematic Review of Analgesic Treatment Disparities for Pain in the United States.” Pain Medicine 13 (2): 150-74. https://doi.org/10.1111/j.1526-4637.2011.01310.x; Williams, D. R., and T. D. Rucker. 2000. “Understanding and Addressing Racial Disparities in Health Care.” Health Care Financing Review 21 (4): 75-90. https://scholar.harvard.edu/davidrwilliams/dwilliam/publications/understanding-and-addressing-racial-disparities-health.&#x0D; [17] Hoffman, K. M., S. Trawalter, J. R. Axt, and M. N. Oliver. 2016. “Racial Bias in Pain assessment and treatment recommendations, and false beliefs about biological Differences Between Blacks and Whites.” PNAS 113 (16): 4296-4301. https://doi.org/10.1073/pnas.1516047113.&#x0D; [18] Pacheco, C. M., S. M. Daley, T. Brown, M. Filipp, K. A. Greiner, and C. M. Daley. 2013. “Moving Forward: Breaking the Cycle of Mistrust Between American Indians and Researchers.” American Journal of Public Health. 103 (12): 2152-9. https://doi.org/10.2105/AJPH.2013.301480.&#x0D; [19] Velasco-Mondragon, E., A. Jimenez, A. G. Palladino-Davis, D. Davis, and J. A. Escamilla-Cejudo. 2016. “Hispanic Health in the USA: A Scoping Review of the Literature.” Public Health Reviews 37:31. https://doi.org/10.1186/s40985-016-0043-2.&#x0D; [20] Cameron, K. A., J. Song, L. M. Manheim, and D. D. Dunlop. 2010. “Gender Disparities in Health and Healthcare Use Among Older Adults.” Journal of Women’s Health (Larchmt) 19 (9): 1643-50. https://doi.org/10.1089/jwh.2009.1701.&#x0D; [21] Bierman, A. S. 2007. “Sex Matters: Gender Disparities in Quality and Outcomes of Care. Canadian Medical Association Journal 177 (12): 1520-1. https://doi.org/10.1503/cmaj.071541; Fowler, R. A., S. Sabur, P. Li, et al. 2007. “Sex-and Age-based Differences in the Delivery and Outcomes of Critical Care. Canadian Medical Association Journal 177 (12): 1513-9. https://doi.org/10.1503/cmaj.071112.&#x0D; [22] McLaughlin, D. K., and C. S. Stokes. 2002. “Income Inequality and Mortality in US Counties: Does Minority Racial Concentration Matter?” American Journal of Public Health 92 (1): 99-104. https://doi.org/.10.2105/ajph.92.1.99; Shea, S., J. Lima, A. Diez-Roux, N. W. Jorgensen, and R. L. McClelland. 2016. “Socioeconomic Status and Poor Health Outcome at 10 years of Follow-up in the Multi-ethnic Study of Atherosclerosis.” PLoS One 11 (11): e0165651. https://doi.org/10.1371/journal.pone.0165651.&#x0D; [23] Han, X., K. T. Call, J. K. Pintor, G. Alarcon-Espinoza, and A. B. Simon. 2015. “Reports of Insurance-based Discrimination in Health care and its Association with Access to Care.” American Journal of Public Health 105 Suppl 3 (Suppl 3): S517-25. https://doi.org/10.2105/AJPH.2015.302668.&#x0D; [24] Aldridge, R. W., D. Menezes, D. Lewer, et al. 2019. “Causes of Death Among Homeless People: A Population-based Cross-sectional Study of Linked Hospitalization and Mortality Data in England.” Wellcome Open Research 4:49. https://doi.org/10.12688/wellcomeopenres.15151.1.&#x0D; [25] Richardson, E. T., M. M. Malik, W. A. Darity Jr., et al. 2021. “Reparations for Black American Descendants of Persons Enslaved in the U.S. and their Potential Impact on SARS-CoV-2 Transmission.” Social Science and Medicine 276: 113741. https://doi.org/10.1016/j.socscimed.2021.113741.&#x0D; [26] Wispelwey, B., and M. Morse. 2021. “An Antiracist Agenda for Medicine.” Boston Review. http://bostonreview.net/science-nature-race/bram-wispelwey-michelle-morse-antiracist-agenda-medicine.&#x0D; [27] Johnson, S. F., A. Ojo, and H. J. Warraich. 2021. “Academic Health Centers’ Antiracism Strategies Must Extend to their Business Practices.” Annals of Internal Medicine 174 (2): 254-5. https://doi.org/10.7326/M20-6203; Golub, M., N. Calman, C. Ruddock, et al. 2011. “A Community Mobilizes to End Medical Apartheid.” Progress in Community Health Partnerships: Research, Education, and Action 5 (3): 317-25. https://doi.org/10.1353/cpr.2011.0041.&#x0D; [28] New York State Bar Association. 2020. “New York State Bar Association House of Delegates: Revised COVID-19 Resolutions.” https://nysba.org/app/uploads/2020/10/Final-Health-Law-Section-COVID-19-Resolutions_10-8-20-1-1.pdf.&#x0D; [29] Egede, L. E. 2006. “Race, Ethnicity, Culture, and Disparities in Health Care.” Journal of General Internal Medicine 21 (6): 667-669. https://doi.org/10.1111%2Fj.1525-1497.2006.0512.x

Authors: Denise Chroscinski, Darryl Sampey, Alex Hewitt, The Reproducibility Project: Cancer Biology† ### Abstract The [Reproducibility Project: Cancer Biology](https://osf.io/e81xl/wiki/home/) seeks to address growing concerns about reproducibility in scientific research by conducting replications of 50 papers in the field of cancer biology published between 2010 and 2012. This Registered Report describes the proposed replication plan of key experiments from “Melanoma genome sequencing reveals frequent PREX2 mutations” by Berger and colleagues, published in Nature in 2012 (Berger et al., 2012). The key experiments that will be replicated are those reported in Figure 3B and Supplementary Figure S6. In these experiments, Berger and colleagues show that somatic PREX2 mutations identified through whole-genome sequencing of human melanoma can contribute to enhanced lethality of tumor xenografts in nude mice (Figures 3B, S6B, and S6C; (Berger et al., 2012). The Reproducibility Project: Cancer Biology is a collaboration between the [Center for Open Science](http://centerforopenscience.org/) and [Science Exchange](https://www.scienceexchange.com/), and the results of the replications will be published by eLife. ### Introduction Melanoma is a highly aggressive tumor with poor prognosis in the metastatic stage. Based on their association with UV-induced DNA damage, melanomas are often hypermutated, and considerable efforts have been made to sequence such tumors in order to better understand their molecular basis. Many well-known oncogenes are frequently involved in melanoma pathogenesis, including BRAF and NRAS, and significant work has been done to develop targeted kinase inhibitors against these targets (Kunz, 2014). However, even with treatment, melanoma has an extremely high rate of recurrence; thus, there is great interest in identifying novel candidate genes that promote oncogenesis in melanoma, thereby providing additional therapeutic targets. One such candidate is Phosphatidylinositol-3,4,5-trisphosphate RAC Exchanger 2 (PREX2), a 183 kDa protein known to inhibit PTEN phosphatase activity, stimulate PI3K signaling, and suspected to regulate the small GTPase RAC1 (Cerami et al., 2012; Fine et al., 2009). Using whole-genome sequencing of 25 metastatic tumors, Berger and colleagues identified PREX2 as being a highly mutated gene in melanoma. Apart from observing a large subset of BRAF and NRAS mutations, the authors found PREX2 to have a mutation frequency of approximately 14%, with 13 detected non-synonymous point mutations, including 4 nonsense truncation mutations (Berger et al., 2012). In order to demonstrate the biological relevance of specific PREX2 mutations, the authors created transformed melanocyte cell lines that stably expressed various mutated and truncated forms of PREX2. By using these cell lines to create tumor xenografts in nude mice, the authors showed that ectopic expression of mutant PREX2 accelerated tumor formation. Berger and colleagues chose to analyze six representative PREX2 mutations derived from their whole-genome sequencing screen. These variants included three truncation variants and three non-synonymous point mutations predicted to carry functional impact. These mutant PREX2 constructs were packaged into lentiviruses and transduced into TERT-immortalized human melanocytes engineered to express NRAS^G12D. Ectopic expression of various mutant PREX2 isoforms was confirmed by Western blot (Figure S6A). These experiments will be replicated in Protocols 1 and 2. Berger and colleagues next transplanted the melanocytic lines into immunodeficient mice alongside control melanocytes expressing either wild-type PREX2 or GFP (green fluorescent protein). They found that overexpression of all three truncated variants, as well as the point mutation G844D, significantly accelerated tumor growth in vivo, thus affirming the biological relevance of their genomic data (Figures 3B, S6B, and S6C). These key experiments, which support the hypothesis that mutant PREX2 promotes oncogenesis in melanoma, will be replicated in Protocol 3. There is some debate over which mutations observed in various melanoma samples are biologically relevant, including PREX2. Potentially, mutational heterogeneity across tumor samples may contribute to false-positive findings (Lawrence et al., 2013). Various genome-wide screens have yielded conflicting results about which genes are frequently mutated in melanoma. Recently, mutated PREX2 was identified in both the primary tumor and in metastatic tumor tissue from a genomic analysis of a single melanoma patient (Furney et al., 2014; Turajlic et al., 2012). However, five studies failed to identify PREX2 in their genome-wide melanoma screens, including a meta-analysis study that analyzed hundreds of published datasets (Hodis et al., 2012; Krauthammer et al., 2012; Marzese et al., 2014; Ni et al., 2013; Xia et al., 2014). To date, there have been no replication attempts assessing the biological significance of PREX2 mutant isoforms in melanoma. ### Materials and Methods Unless otherwise noted, all protocol information was derived from the original paper, references from the original paper, or information obtained directly from the authors. **Protocol 1: Generation of NRAS^G12D melanocyte cells expressing various mutated forms of PREX2** This protocol describes the generation of pMEL/hTERT/CDK4(R24C)/p53DD/NRAS^G12D (NRASG12D) melanocytes that stably express various mutated forms of PREX2. This protocol details the production of lentivirus for each mutated PREX2 form, as well as the viral transduction of melanocytes and selection for stable-expressing lines using antibiotic resistance. Sampling: - Outline of experimental endpoints: - At the end of this protocol, we will have generated NRASG12D melanocytes stably expressing: - GFP vector (*control*) - WT PREX2 (*control*) - PREX2 Q1430* (*Truncation mutation*) - PREX2 G844D (*Substitution mutation*) Materials and Reagents:    Procedure: Note: All cell lines will be sent for STR profiling and mycoplasma testing. 1. Grow and prepare endotoxin-free plasmid constructs according to the manufacturer’s protocol for the GenElute Endotoxin-free Plasmid Maxiprep Kit. - a. Viral packaging vectors: - i. pMD2-Gag/Pol (~25 µg DNA needed for production of 4 viruses) - ii. pMD2 VSVG (~15 µg DNA needed production of 4 viruses) - iii. RSV REV (~17 µg DNA needed production of 4 viruses) - b. PREX expression vectors: - i. GFP vector (~15 µg DNA needed for virus production) - ii. WT PREX2 (~15 µg DNA needed for virus production) - iii. PREX2 Q1430* (~15 µg DNA needed for virus production) - iv. PREX2 G844D (~15 µg DNA needed for virus production) - Sequence PREX2 plasmids to confirm identity and run on gel to confirm vector integrity. Use the following sequencing primers: - a. CMV forward: CGCAAATGGGCGGTAGGCGTG - b. prex2a-1 forward: ACTGAAATGCTAATGTGTGG - c. prex2a-2 forward: CCTTTTTACTCCAGTGATAAGAGAT - d. prex2a-3 forward: AGTACAGGCGGCCAACGAAG - e. prex2a-4 forward: ATCACAACCATGGCGGCCCCTT - f. prex2a-5 forward: GTAGGCTACTCCTGGCTCTT - g. prex2a-6 forward: AGCTGCCTGTGCAAACACAG - h. prex2a-7 reverse: GACTTCCTTCTGCTTGATAT - i. prex2a-8 reverse: TGCTGGTGAAGGAGGCGATG - j. prex2a-9 reverse: AGAGAATTTAGGCTGGTACA - k. prex2a-10 reverse: ATCCCTTTTCTACCAACTTT - l. prex2a-11 reverse: CTTGCTCCATTCCTAATTTT - m. prex2a-12 reverse: CCTTCTCATGGTTACTACAATATTC - n. V5 reverse: ACCGAGGAGAGGGTTAGGGAT - Using the same primers as above, sequence the endogenous PREX2 gene from cDNA derived from untransfected pMEL/hTERT/CDK4(R24C)/p53DD/NRAS^G12D melanocytes. - a. Melanocytes should be maintained in Ham’s F10 medium supplemented with 10% heat inactivated FBS and 1% penicillin/streptomycin at 37°C with 5% CO2. - b. Manipulate cells via mechanical disruption (i.e., cell scraping) rather than using trypsin-EDTA, as use of trypsin has been shown to degrade the quality of RNA isolated from cultured cells (Vrtacnik et al., 2014) - c. Isolate total RNA using TRI reagent, and generate cDNA as described in the manufacturer’s protocol for SuperScript III cDNA synthesis kit, using OligoDT primers to enrich for mRNA. - d. Use gene-specific primers to sequence the length of the PREX2 gene to determine endogenous mutational status. - On Day 1 of viral production, plate 6 x 106 HEK293T cells in a 10 cm plate. Plate one 10 cm plate for each virus you wish to package (total of 4 plates needed). - a. HEK293T cells should be maintained in DMEM supplemented with 10% FBS at 37°C with 5% CO2. - b. Note: High titer lentivirus is best packaged in early passage, healthy 293T cells. Avoid continuous growth to/from confluence. Routinely split 293T when culture approaches 80% confluence. - On Day 2, create the transfection master mix: (Tube #1) - a. Create a master mix (for the number of transfections being conducted) of Lipofectamine and OptiMEM. - i. Each transfection will require 30 µl of Lipofectamine diluted in 720 µl of OptiMEM. Allow mixture to incubate for 5 min at RT. - For each virus, assemble DNA, packaging vectors, and OptiMEM in a 1.5 mL centrifuge tube. (Tube #2) - a. Plasmid DNA = 10.0 µg - b. Packaging Vector - i. pMD2 Gag/Pol = 5.0 µg - ii. pRESREV = 2.5 µg - iii. pMD2 VSVG = 3.0 µg - c. Bring volume to 750 µl with OptiMEM. - Combine Tube #1 (Lipofectamine/OptiMEM) with Tube #2 (DNA/packaging vector/OptiMEM). After combining, mix by pipetting and allow mixture to incubate for 20 min at RT. - a. While incubating, GENTLY aspirate growth medium from HEK293T cells and pipette 8 ml of OptiMEM to each plate. - b. Add 1.5 ml of transfection mixture to the plate (pipetting directly into the media) and place into the 37°C incubator. - c. Allow minimum 6-8 h for transfection. After transfection completion, remove OptiMEM media and refresh HEK293T plates with 10 ml of growth media (again pipetting gently onto the side of the plate). - On Days 4 (48 hours post transfection) and 5 (72 hours post transfection), collect virus by removing medium and filtering through a 0.45-µm filter into a 50 ml conical tube. Pool fractions from both days. After the two collections, there is a total of 20 ml of virus. Immediately after collection/filtration (for both time points), put the virus on ice and then transfer to 4°C for short term or -80°C for long-term storage. - Infect pMEL/hTERT/CDK4(R24C)/p53DD/NRASG12D melanocytes with virus to generate stable cells lines. - a. Day 1: Seed NRAS^G12D cells at 50% confluence in 6 cm plates. - i. Melanocytes should be maintained in Ham’s F10 medium supplemented with 10% heat inactivated FBS and 1% penicillin/streptomycin at 37°C with 5% CO2. - b. Day 2: Remove media and replace with 3 ml of viral supernatant containing 8 µg/ml polybrene. - i. Incubate cells for 24 h. - c. Day 3: Remove viral media and replace with fresh growth media. - d. Day 4: Replace growth media with fresh media containing 5 µg/ml Blastocidin. - e. Days 4–9: Select cells for ~5 days, confirming that a plate of non-transduced NRAS^G12D cells are negatively selected in parallel. - f. Day 9: Remove Blastocidin media and expand cells into fresh growth media. Collect entire population of transduced cells for further analysis. Deliverables: - Data to be collected: - Sequencing information and gel-verification of PREX2 plasmids cloned into the pLenti6.3/V5 vector - Mycoplasma testing of NRASG12D melanocytes - STR profile of NRASG12D melanocytes - Sample delivered for further analysis: - NRAS^G12D melanocytes stably expressing PREX2 mutant forms for further analysis (Protocols 2 and 3). Confirmatory analysis plan: - Statistical Analysis of the Replication Data: - Not applicable. Known differences from the original study: This replication is only generating stable melanocyte lines for GFP, wild-type PREX2, PREX2 Q1430*, and PREX2 G844D. The original study also included several other PREX2 mutants, including PREX2 K278*, E824*, P948S, and G106E. This replication will include the additional step of sequencing the endogenous PREX2 gene in the NRAS^G12D melanocyte cell line to determine its mutational status. All known differences in reagents and supplies are listed in the materials and reagents section above, with the originally used item listed in the comments section. All differences have the same capabilities as the original and are not expected to alter the experimental design. Provisions for quality control: The cell line used in this experiment will undergo STR profiling to confirm its identity and will be sent for mycoplasma testing to ensure there is no contamination. PREX2 expression constructs obtained from the original authors will be verified for sequence identity and DNA integrity. The endogenous mutational status of PREX2 in NRAS^G12D melanocytes will be assessed. All data obtained from the experiment will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/jvpnw/). **Protocol 2: Confirming ectopic expression of PREX2 mutant isoforms by Western blot** This protocol investigates the expression levels of mutant PREX2 isoforms in virally transduced NRAS^G12D melanocytes that were generated in Protocol 1. This protocol uses an anti-V5 antibody to recognize tagged forms of wild-type and mutant PREX2 (as well as the GFP control), thus verifying the successful lentiviral transduction of expression constructs and providing information about ectopic protein expression levels (as was demonstrated in Figure S6A). Membranes will also be probed with anti-α-tubulin to provide normalized values of relative protein expression. Three original cell lines produced by the original authors will also be included so that protein expression levels can be compared between the two studies. Sampling: - The original data presented is qualitative and this prevents power calculations being performed a priori to determine sample size (number of biological replicates). Instead, we will be including three cell lines originally derived by the authors and analyzing these cell lines in parallel to the newly derived cell lines from Protocol 1. - Three separate lysates will be prepared from each cell line: - GFP vector stable NRAS^G12D cells (control) - Previously generated PREX2 Q1430* stable NRAS^G12D cells (control from original study authors) - Previously generated PREX2 G844D stable NRAS^G12D cells (control from original study authors) - Previously generated WT PREX2 stable NRAS^G12D cells (control from original study authors) - PREX2 WT stable NRAS^G12D cells (from Protocol 1) - PREX2 Q1430* stable NRAS^G12D cells (from Protocol 1) - PREX2 G844D stable NRAS^G12D cells (from Protocol 1) - Blots will be probed with the following antibodies: - Anti-V5 tag - Anti-PREX2 - Anti-alpha tubulin Materials and Reagents:   Procedure: 1. 1. Maintain NRAS^G12D melanocyte lines in Ham’s F10 medium with 10% heat inactivated FBS and 1% penicillin/streptomycin at 37°C with 5% CO2. - Subculture the four cell lines onto three 10 cm plates each, for a total of 12 plates. These plates constitute replicates for each cell line for eventual quantitation of protein expression. Allow cells to grow to log phase. - Place 10 cm plates of log-phase growing cells on ice. Use a cell-scraper to scrape cells (on ice) into a microcentrifuge tube. Add 250 µl of lysis buffer per 10 cm plate. - a. Lysis buffer = 20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% NP40, 1 mM PMSF, 1X Protease Inhibitor Cocktail, and 1X Phosphatase Inhibitor. - b. Prepare three separate lysates for each cell line (one lysate scraped from each plate). - Incubate cells in lysis buffer for 20 min at RT. Centrifuge lysate for 15 min at 14,000 rpm at 4°C. Transfer supernatant to a fresh tube, then add 2X sample loading buffer containing reducing agent. - Load lysate onto a pre-cast polyacrylamide 4-12% Tris-glycine gel with molecular weight ladder. - a. Quantify lysate total protein concentration. - b. Load 30–50 µg of total protein per well. - Perform electrophoresis in standard Tris-Glycine-SDS running buffer. - Transfer the gel onto a nitrocellulose membrane. - a. Transfer buffer = 25 mM Tris-HCl, 192 mM glycine, 20% methanol. - b. Use standard wet-transfer for 1–2 hr; PREX2 is a relatively large protein (runs about 160 kDa). - c. Following protein transfer, stain the membrane with Ponceau-S in order to detect protein levels. Scan image of stained membrane before washing. - Block membrane in 5% milk in 1X TBS with 0.1% Tween-20 (TBS-T) overnight at 4°C on an orbital shaker. - Incubate membranes with primary antibody overnight at 4°C on an orbital shaker. Dilute primary antibodies in 5% bovine serum albumin in TBS-T containing 0.05% sodium azide. - a. Mouse anti-V5; dilute at 1:5000. - b. Mouse anti-PREX2; use at 1 µg/ml, according to manufacturer’s instructions - Wash membranes six times for 10 min each with TBS-T at room temperature (RT). - Incubate membranes with secondary antibody for 40 min at RT on an orbital shaker. Dilute secondary antibody in 5% milk in TBS-T. - a. Horse anti-mouse IgG; dilute at 1:2000 - Wash membranes six times for 10 min each with TBS-T at RT. - Detect chemiluminescent signal with ECL Prime western blotting detection reagent, according to the manufacturer’s instructions. - Strip blots for 15 min in 0.2 M NaOH, then wash membranes six times for 10 min each with TBS-T at RT. - Block membranes in 5% milk in TBS-T for 1 h at RT on an orbital shaker. - Repeat steps 9–13 for anti-α-tubulin primary antibody. Dilute primary antibody at 1:5,000. Use same secondary antibody (at same dilution) as above. - Quantify density of bands and normalize against α-tubulin. Deliverables: - Data to be collected: - Images of probed membranes (full images with ladder) - Scanned images of Ponceau-stained membranes, post-transfer - Densitometric analyses of normalized bands, presented in a bar graph showing standard deviation across replicates for each cell line Confirmatory analysis plan: - Statistical Analysis of the Replication Data: - Means and standard deviations will be computed across replicates for each cell line. - We will perform a 2-way ANOVA (2 x 3 factorial analysis), comparing expression levels of the three PREX2 variants and the two cell-line cohorts (the originally-derived cell lines and the newly-derived cell lines from Protocol 1). This analysis will test two parameters: a) whether the original and replication values are different, and b) if the three PREX2 variants are different. Because our hypothesis is that they are all the same, no individual follow-up tests are needed. Known differences from the original study: This replication is only analyzing protein expression from cell lines engineered to express GFP, wild-type PREX2, PREX2 Q1430*, and PREX2 G844D. The original study also included several other PREX2 mutants, including PREX2 K278*, E824*, P948S, and G106E. This replication includes an antibody probing for PREX2, so that we can better determine its endogenous expression level. Additionally, we are also testing protein expression in the original PREX2 cells lines derived by the original authors, so that we can compare expression levels between the original lines and the replication lines. All known differences in reagents and supplies are listed in the materials and reagents section above, with the originally used item listed in the comments section. All differences have the same capabilities as the original and are not expected to alter the experimental design. Provisions for quality control: The endogenous expression of PREX2 will be assessed in cell lines not overexpressing PREX2 variants. An image of Ponceau-stained membranes (post-transfer) will be included to verify successful protein transfer. All of the raw data, including the image files and quantified bands from the western blot, will be uploaded to the project page on the OSF (https://osf.io/jvpnw/) and made publically available. This experiment is also the quality control for the other replication protocols as it assesses the levels of ectopic PREX2 variant expression in the utilized cell lines. **Protocol 3: Generation of tumor xenografts expressing mutated forms of PREX2** This protocol assesses the propensity of ectopically expressed PREX2 mutations to accelerate tumor formation of immortalized human melanocytes *in vivo*. This protocol utilizes stably-transfected NRAS^G12D human melanocyte lines that were previously generated and analyzed in Protocols 1 and 2. The melanocytic lines are transplanted into immunodeficient mice alongside control melanocytes expressing wild-type PREX2 or GFP (green fluorescent protein). Tumor growth is assessed for 16 weeks, and tumor-free survival is monitored, as depicted in Figure 3B and S6B. Further, confirmatory staining and analysis of tumor tissue will be completed, as depicted in Figure S6C. Sampling: - These experiments will utilize 7, 8, or 14 mice per treatment group, for a total power of ≥80%. - See Power Calculations section for details - Outline of experimental conditions: - NCR-NUDE female mice injected subcutaneously with: - GFP-vector stable NRAS^G12D melanocytes (control) - *n* = 14 - PREX2 WT stable NRAS^G12D melanocytes (control) - *n* = 7 - PREX2 Q1430* NRAS^G12D melanocytes - *n* = 8 - PREX2 G844D NRAS^G12D melanocytes - *n* = 14 Materials and Reagents:  Procedure: 1. Maintain NRAS^G12D cell lines in Ham’s F10 medium with 10% heat inactivated FBS and 1% penicillin/streptomycin at 37°C with 5% CO2. - Resuspend 1x106 cells in a 1:1 ratio of Matrigel and Hanks’ balanced salt solution and keep on ice. The final injection volume should be 100 µl. - Subcutaneously inject 1x10e6 cells with a 26-gauge needle and insulin syringe into 6-8 week old female NCR-NUDE mice. - a. Mice were housed per IACUC regulations, in barrier housing with standard chow and 12 hour light/dark cycles. - b. Anesthetize mice with isofluorane prior to injection. - c. Inject mice subcutaneously on the flank. - Monitor mice 3 times a week for tumor development for 16 weeks. - a. Record date when visible tumor is detected. - Measure tumor volume once weekly. - a. Measure tumor in two directions with calipers. Calculate tumor volume as (length x width^2)/2. - Track survival of mice for 16 weeks, recording dates of euthanasia. - a. Sacrifice mice when tumor volume reaches 1.5 cm3, or if mice become moribund or cachectic. - b. Sacrifice any surviving mice at the end of the study. - Upon euthanasia, harvest and process tumor tissue for further analysis. - a. Harvest one representative tumor per mouse group (total of 4 tumors). - b. Fix tissues in 10% neutral buffered formalin for 24 hr. - c. Dehydrate tissues through graded alcohols and clear in xylene. - d. Infiltrate with, and then embed, tissues in paraffin and section into 5 µm sections. - e. Mount sections onto positively charged slides. - Stain tumor section with H&E; (Total: 1 stained section per tumor = 4 stained sections). - a. Perform H&E; staining by hand using the following procedure: - i. Deparaffinize sections twice in xylene, then rehydrate through graded alcohols (95%, 70%, 50% ETOH) to water. - ii. Stain sections with Carazzi’s hematoxylin, then rinse slides in water. - iii. Stain sections with eosin. - iv. Dehydrate sections through graded alcohols (50%, 70%, 90%), and then place in xylene. - v. Apply coverslips to slides with Permount and store slides at room temperature. - Blindly image stained sections and have images blindly analyzed by a Board Certified Veterinary Pathologist to verify the tumor composition of the tissue sections. Data to be collected: - Deliverables: - Mouse health records (age, time to tumor detection, tumor incidence, date of euthanasia and cause of termination) - Raw and calculated tumor volume measurements for each date/mouse - Kaplan–Meier curves generated for tumor-free survival of each mouse line - Images of H&E; stained tumor sections and pathology report. (Compare to figure S6C) - Pathologist’s report of tissue section evaluation Confirmatory analysis plan: This replication attempt will perform the statistical analyses listed below, compute the effects sizes, compare them against the reported effect size in the original paper and use a meta-analytic approach to combine the original and replication effects, which will be presented as a Forest plot. - Statistical Analysis of the Replication Data: - Comparison of Kaplan-Meier survival curves tracking tumor incidence using Bonferroni’s correction for multiple comparisons. - The authors originally examined the Kaplan-Meier curves for PREX2 mutants and compared the endpoint values of the mutant curves to the endpoint values of the wild-type PREX2 curve using an unpaired, two-tailed t-test. We will replicate their t-tests, but also compare the entire survival curves (each mutant curve versus both wild-type and GFP control) using the Log-rank Mantel-Cox test with Bonferroni’s alpha correction, which we believe is a more appropriate statistical approach. - Comparison of tumor growth rates - We will measure tumor growth rates across all mouse cohorts over the length of the study. These data were collected but not reported or analyzed in the original study. We will plot growth curves for each treatment group and use area under the curve analysis to calculate the mean and std. error. We will then use the means, std. error and n to perform a 1-way ANOVA. Further, we will perform corrected t-tests (Bonferroni correction) to perform pairwise comparisons between PREX2 mutants and either GFP or wild-type controls. Known differences from the original study: This replication is only generating and analyzing xenografts based on the stable melanocyte lines for GFP, wild-type PREX2, PREX2 Q1430*, and PREX2 G844D. The original study also generated and analyzed tumor xenografts using other PREX2 mutant-expressing melanocyte lines, including PREX2 K278*, E824*, P948S, and G106E. In order to sufficiently power all experiments and achieve the necessary number of events for Kaplan–Meier analysis, the duration of this replication will be extended from 9 weeks in the original paper to 16 weeks in the replication. All known differences in reagents and supplies are listed in the materials and reagents section above, with the originally used item listed in the comments section. All differences have the same capabilities as the original and are not expected to alter the experimental design. Provisions for quality control: The genetic integrity, mycoplasma-free purity, and levels of exogenous expression of each NrasG12V melanocyte line used in this experiment have been previously validated in Protocols 1 and 2. All mice will be handled and housed in accordance with the Institutional Animal Care and Use Committee (IACUC). All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/82nfe/) ### Power Calculations **Protocol 3** Summary of original data:  Note: Mantel-Haenszel hazard ratios were generated in Graphpad Prism v. 6.0 following analysis of Kaplan–Meier curves with the Log-rank (Mantel-Cox) test using the Mantel-Haenszel method. Test family: - Log-rank (Mantel-Cox) test with Bonferroni alpha correction for multiple comparisons Power Calculations: - Performed with the Sample Size Calculator hosted by the Clinical &amp; Translational Science Institute (CTSI) at the University of California–San Francisco (http://www.sample-size.net/sample-size-survival-analysis/) (Rubinstein et al., 1981; Schoenfeld, 1983) - To account for multiple comparisons, a corrected alpha value of 0.0125 [0.05/4] was used in determining power calculations.  ### Acknowledgements: The Reproducibility Project: Cancer Biology core team would like to thank the original authors, in particular Levi Garraway, Lynda Chin, and most especially Yonathan Lissanu Deribe, for generously sharing critical information as well as reagents to ensure the fidelity and quality of this replication attempt. We are grateful to Courtney Soderberg at the Center for Open Science for assistance with statistical analyses. We would also like to thanks the following companies for generously donating reagents to the Reproducibility Project: Cancer Biology; BioLegend, Charles River Laboratories, Corning Incorporated, DDC Medical, EMD Millipore, Harlan Laboratories, LI-COR Biosciences, Mirus Bio, Novus Biologicals, and Sigma-Aldrich. ### References 1. Berger, MF, Hodis, E, Heffernan, TP, Deribe, YL, Lawrence, MS, Protopopov, A, Ivanova, E, Watson, IR, Nickerson, E, Ghosh, P, Zhang, H, Zeid, R, Ren, X, Cibulskis, K, Sivachenko, AY, Wagle, N, Sucker, A, Sougnez, C, Onofrio, R, Ambrogio, L, Auclair, D, Fennell, T, Carter, SL, Drier, Y, Stojanov, P, Singer, MA, Voet, D, Jing, R, Saksena, G, Barretina, J, Ramos, AH, Pugh, TJ, Stransky, N, Parkin, M, Winckler, W, Mahan, S, Ardlie, K, Baldwin, J, Wargo, J, Schadendorf, D, Meyerson, M, Gabriel, SB, Golub, TR, Wagner, SN, Lander, ES, Getz, G, Chin, L, and Garraway, LA. 2012. Melanoma genome sequencing reveals frequent PREX2 mutations. *Nature* 485:502-6. 10.1038/nature11071. - Cerami, E, Gao, J, Dogrusoz, U, Gross, BE, Sumer, SO, Aksoy, BA, Jacobsen, A, Byrne, CJ, Heuer, ML, Larsson, E, Antipin, Y, Reva, B, Goldberg, AP, Sander, C, and Schultz, N. 2012. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov 2:401-4. 10.1158/2159-8290.cd-12-0095. Fine, B, Hodakoski, C, Koujak, S, Su, T, Saal, LH, Maurer, M, Hopkins, B, Keniry, M, Sulis, ML, Mense, S, Hibshoosh, H, and Parsons, R. 2009. Activation of the PI3K pathway in cancer through inhibition of PTEN by exchange factor P-REX2a. *Science* 325:1261-5. 10.1126/science.1173569. - Furney, SJ, Turajlic, S, Stamp, G, Thomas, JM, Hayes, A, Strauss, D, Gavrielides, M, Xing, W, Gore, M, Larkin, J, and Marais, R. 2014. The mutational burden of acral melanoma revealed by whole-genome sequencing and comparative analysis. *Pigment Cell Melanoma Res* 10.1111/pcmr.12279. - Hodis, E, Watson, IR, Kryukov, GV, Arold, ST, Imielinski, M, Theurillat, JP, Nickerson, E, Auclair, D, Li, L, Place, C, Dicara, D, Ramos, AH, Lawrence, MS, Cibulskis, K, Sivachenko, A, Voet, D, Saksena, G, Stransky, N, Onofrio, RC, Winckler, W, Ardlie, K, Wagle, N, Wargo, J, Chong, K, Morton, DL, Stemke-Hale, K, Chen, G, Noble, M, Meyerson, M, Ladbury, JE, Davies, MA, Gershenwald, JE, Wagner, SN, Hoon, DS, Schadendorf, D, Lander, ES, Gabriel, SB, Getz, G, Garraway, LA, and Chin, L. 2012. A landscape of driver mutations in melanoma. *Cell* 150:251-63. 10.1016/j.cell.2012.06.024. - Krauthammer, M, Kong, Y, Ha, BH, Evans, P, Bacchiocchi, A, McCusker, JP, Cheng, E, Davis, MJ, Goh, G, Choi, M, Ariyan, S, Narayan, D, Dutton-Regester, K, Capatana, A, Holman, EC, Bosenberg, M, Sznol, M, Kluger, HM, Brash, DE, Stern, DF, Materin, MA, Lo, RS, Mane, S, Ma, S, Kidd, KK, Hayward, NK, Lifton, RP, Schlessinger, J, Boggon, TJ, and Halaban, R. 2012. Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. *Nat Genet* 44:1006-14. 10.1038/ng.2359. - Kunz, M. 2014. Oncogenes in melanoma: an update. *Eur J Cell Biol* 93:1-10. 10.1016/j.ejcb.2013.12.002. - Lawrence, MS, Stojanov, P, Polak, P, Kryukov, GV, Cibulskis, K, Sivachenko, A, Carter, SL, Stewart, C, Mermel, CH, Roberts, SA, Kiezun, A, Hammerman, PS, McKenna, A, Drier, Y, Zou, L, Ramos, AH, Pugh, TJ, Stransky, N, Helman, E, Kim, J, Sougnez, C, Ambrogio, L, Nickerson, E, Shefler, E, Cortes, ML, Auclair, D, Saksena, G, Voet, D, Noble, M, DiCara, D, Lin, P, Lichtenstein, L, Heiman, DI, Fennell, T, Imielinski, M, Hernandez, B, Hodis, E, Baca, S, Dulak, AM, Lohr, J, Landau, DA, Wu, CJ, Melendez-Zajgla, J, Hidalgo-Miranda, A, Koren, A, McCarroll, SA, Mora, J, Lee, RS, Crompton, B, Onofrio, R, Parkin, M, Winckler, W, Ardlie, K, Gabriel, SB, Roberts, CW, Biegel, JA, Stegmaier, K, Bass, AJ, Garraway, LA, Meyerson, M, Golub, TR, Gordenin, DA, Sunyaev, S, Lander, ES, and Getz, G. 2013. Mutational heterogeneity in cancer and the search for new cancer-associated genes. *Nature* 499:214-8. 10.1038/nature12213. - Marzese, DM, Scolyer, RA, Roque, M, Vargas-Roig, LM, Huynh, JL, Wilmott, JS, Murali, R, Buckland, ME, Barkhoudarian, G, Thompson, JF, Morton, DL, Kelly, DF, and Hoon, DS. 2014. DNA methylation and gene deletion analysis of brain metastases in melanoma patients identifies mutually exclusive molecular alterations. *Neuro Oncol* 10.1093/neuonc/nou107. - Ni, TK, Landrette, SF, Bjornson, RD, Bosenberg, MW, and Xu, T. 2013. Low-copy piggyBac transposon mutagenesis in mice identifies genes driving melanoma. *Proc Natl Acad Sci U S A* 110:E3640-9. 10.1073/pnas.1314435110. - Rubinstein, LV, Gail, MH, and Santner, TJ. 1981. Planning the duration of a comparative clinical trial with loss to follow-up and a period of continued observation. *J Chronic Dis* 34:469-79. - Schoenfeld, DA. 1983. Sample-size formula for the proportional-hazards regression model. *Biometrics* 39:499-503. - Turajlic, S, Furney, SJ, Lambros, MB, Mitsopoulos, C, Kozarewa, I, Geyer, FC, Mackay, A, Hakas, J, Zvelebil, M, Lord, CJ, Ashworth, A, Thomas, M, Stamp, G, Larkin, J, Reis-Filho, JS, and Marais, R. 2012. Whole genome sequencing of matched primary and metastatic acral melanomas. *Genome Res* 22:196-207. 10.1101/gr.125591.111. - Vrtacnik, P, Kos, S, Bustin, SA, Marc, J, and Ostanek, B. 2014. Influence of trypsinization and alternative procedures for cell preparation before RNA extraction on RNA integrity. Anal Biochem 463:38-44. 10.1016/j.ab.2014.06.017. Xia, J, Jia, P, Hutchinson, KE, Dahlman, KB, Johnson, D, Sosman, J, Pao, W, and Zhao, Z. 2014. A Meta-analysis of Somatic Mutations from Next Generation Sequencing of 241 Melanomas: A Road Map for the Study of Genes with Potential Clinical Relevance. *Mol Cancer Ther* 13:1918-28. 10.1158/1535-7163.mct-13-0804. ### Author Information † The RP:CB core team consists of Elizabeth Iorns (Science Exchange, Palo Alto, California), William Gunn (Mendeley, London, United Kingdom), Fraser Tan (Science Exchange, Palo Alto, California), Joelle Lomax (Science Exchange, Palo Alto, California), and Timothy Errington (Center for Open Science, Charlottesville, Virginia). **Denise Chroscinski**, Noble Life Sciences, Gaithersburg, Maryland **Darryl Sampey**, BioFactura, Frederick, Maryland **Alex Hewitt**, University of Melbourne, Melbourne, Australia Correspondence to Joelle Lomax, joelle@scienceexchange.com Competing Interests: We disclose that EI, FT, and JL are employed by and hold shares in Science Exchange Inc. The experiments presented in this manuscript will be conducted by SR at the UC Davis Mouse Biology Program and CW at Reveal Biosciences, which are Science Exchange-associated labs. No other authors disclose conflicts of interest related to this manuscript. Funding: The Reproducibility Project: Cancer Biology is funded by the Laura and John Arnold Foundation, provided to the Center for Open Science in collaboration with Science Exchange. The funder had no role in study design or the decision to submit the work for publication

IntroductionAlt, or alternative, accounts are secondary profiles people use in addition to a main account on a social media platform. They are a kind of automediation, a way of representing the self, that deliberately displays a different identity facet, and addresses a different audience, to what someone considers to be their main account. The term “alt” seems to have originated from videogame culture and been incorporated into understandings of social media accounts. A wiki page about alternate accounts on virtual world Second Life calls an alt “an account used by a resident for something other than their usual activity or to do things in privacy” (n.p.).Studying alts gives an insight into practices of managing and contextualising identities on networked platforms that are visible, persistent, editable, associable (Treem and Leonardi), spreadable, searchable (boyd), shareable (Papacharissi "Without"), and personalised (Schmidt). When these features of social media are understood as limitations that lead to context collapse (Marwick and boyd 122; Wesch 23), performative incoherence (Papacharissi Affective 99), and the risk of overexposure, people respond by developing alternative ways to use platforms.Plenty of scholarship on social media identities claims the self is fragmented, multifaceted, and contextual (Marwick 355; Schmidt 369). But the scholarship on multiple account use on single platforms is still emerging. Joanne Orlando writes for The Conversation that teens increasingly have more than one account on Instagram: “finstas” are “fake” or secondary accounts used to post especially candid photos to a smaller audience, thus they are deployed strategically to avoid the social pressure of looking polished and attractive. These accounts are referred to as “fake” because they are often pseudonymous, but the practice of compartmentalising audiences makes the promise that the photos posted are more authentic, spontaneous, and intimate. Kylie Cardell, Kate Douglas, and Emma Maguire (162) argue that while secondary accounts promise a less constructed version of life, speaking back to the dominant genre of aesthetically pleasing Instagram photos, all social media posts are constructed within the context of platform norms and imagined audiences (Litt &amp; Hargittai 1). Still, secondary accounts are important for revealing these norms (Cardell, Douglas &amp; Maguire 163). The secondary account is particularly prevalent on Twitter, a platform that often brings together multiple audiences into a public profile. In 2015, author Emily Reynolds claimed that Twitter alts were “an appealingly safe space compared to main Twitter where abuse, arguments and insincerity are rife” (n.p.).This paper draws on a survey of Twitter users with alts to argue that the strategic use of pseudonyms, profile photos without faces, locked accounts, and smaller audiences are ways to overcome some of the built-in limitations of social media automediality.Identity Is Multiple Chris Poole, founder of anonymous bulletin board 4chan, believes identity is a fluid concept, and designed his platform as a space in which people could connect over interests, not profiles. Positioning 4chan against real-name platforms, he argues:Your identity is prismatic […] we’re all multifaceted people. Google and Facebook would have you believe that you’re a mirror, that there is one reflection that you have, there is one idea of self. But in fact we’re more like diamonds. You can look at people from any angle and see something totally different, but they’re still the same. (n.p.)Claiming that identities are contextual performances stems from longstanding sociological and philosophical work on identity from theorists like Erving Goffman, who in the 1950s proposed a dramaturgical framework of the self to consider interactions as fundamentally social and performative rather than reflecting one core, essential inner self.Social media profiles allow people to use the language of the platform to represent themselves (Marwick 362), meaning identity performances are framed by platform architecture and features, formal and informal rules, and social ties (Schmidt 369). Social media profiles shape how people can engage in how they represent themselves, argue Shelly Farnham and Elizabeth Churchill, who claim that the assumption that a single, unified online identity is sufficient is a problematic trend in platform design. They argue that when facets of their lives are incompatible, people segment those lives into separate areas in order to maintain social norms and boundaries.Sidonie Smith and Julia Watson consider identity multiplicities to be crucial to automediality, which is built on an aesthetic of bricolage and pastiche rather than understanding subjectivity to be the essence of the self. In her work on automediality and online girlhood, Maguire ("Home"; "Self-Branding" 74) argues that an automedial approach attends to how mediation shapes the way selves can be represented online, claiming that the self is brought into being through these mediation practices.This article understands alt accounts as a type of social media practice that Nick Couldry (52) identifies as presencing: sustaining a public presence with media. I investigate presencing through studying alts as a way to manage separate publics, and the tension between public and private, on Twitter by surveying users who have a main and an alt account. Although research into multiple account use is nascent, Alice Marwick lists maintaining multiple accounts as a tactic to mitigate context collapse, alongside other strategies such as using nicknames, only sharing posts when they are appropriate for multiple audiences, and keeping more personal interactions to private messenger and text message.Ben Light argues that while connection is privileged on social media, disconnective practices like editing out, deleting, unfriending, untagging, rejecting follower requests, and in this case, creating alt accounts, are crucial. Disconnecting from some aspects of the social media experience allows people to stay connected on a particular platform, by negotiating the dynamics that do not appeal to them. While the disconnective practice of presencing through an alt has not been studied in detail, research I discuss in the next section focuses on multi-account use to argue that people who have more than one account on a single platform are aware of their audiences, and want control over which people see which posts.Multi-Platform and Multi-Account UseA conference presentation by Frederic Stutzman and Woodrow Hartzog calls maintaining multiple profiles on a single platform a strategy for boundary regulation, through which access is selectively granted to specific people. Stutzman and Hartzog interviewed 20 people with multiple profiles to determine four main motives for this kind of boundary regulation: privacy, identity management, utility (using one profile for a distinct purpose, like managing a restaurant page), and propriety (conforming to social norms around appropriate disclosure).Writing about multiple profiles on Reddit, Alex Leavitt argues that temporary or “throwaway” accounts give people the chance to disclose sensitive or off-topic information. For example, some women use throwaways when posting to a bra sizing subreddit, so men don’t exploit their main account for sexual purposes. Throwaways are a boundary management technique Leavitt considers beneficial for Redditors, and urges platform designers to consider implementing alternatives to single accounts.Jessa Lingel and Adam Golub also call for platforms to allow for multiple accounts, suggesting Facebook should let users link their profiles at a metadata level and be able to switch between them. They argue that this would be especially beneficial for those who take on specific personas, such as drag queens. In their study of drag queens with more than one Facebook profile, Lingel and Golub suggest that drag queens need to maintain boundaries between fans and friends, but creating a separate business page for their identity as a performer was inadequate for the kind of nuanced personal communication they engaged in with their fans. Drag queens considered this kind of communication relationship maintenance, not self-branding. This demonstrates that drag queens on Facebook are attentive to their audience, which is a common feature of users posting to social media: they have an idea, no matter how accurate, of who they are posting to.Eden Litt and Eszter Hargittai (1) call this perception the imagined audience, which serves as a guide for how to present the self and what to post about when an audience is unknown or not physically present. People in their study would either claim they were posting to no-one in particular, or that they had an audience in mind, whether this was personal ties (close friends, family, specific individuals like a best friend), communal ties (people interested in cleaning tips, local art community, people in Portland), professional ties (colleagues, clients, my radio show audience), and phantasmal ties (people with whom someone has an imaginary relationship, like famous people, brands, animals, and the dead).Based on these studies of boundary regulation, throwaway accounts, separate Facebook pages for fans and friends, and imagined audiences on social media, I designed a short survey that would prompt respondents to reflect on their own practices of negotiating platform limitations through their alt account.Asking Twitter about AltsTo research alts, I asked my own Twitter followers to tell me about theirs. I’ve been tweeting from @emvdn since 2010, and I have roughly 5,500 followers, mostly Melbourne academics, writers, and professionals. This method of asking my own Twitter followers questions builds on a study by Alice Marwick and danah boyd, in which they investigated context collapse on social media by tweeting questions like “who do you tweet to?” and monitoring the replies.I sent out a tweet with a link to the survey on 31 January 2018, and left it open for responses until I submitted this draft article on 18 February 2018:I’m writing about alt (alternative/secondary) accounts on social media. If you have an alt account, on Twitter or elsewhere, could you tell me about it, in survey form? (van der Nagel)The tweet was retweeted 161 times, spreading the survey to other accounts and contexts, and I received a total of 326 responses to the survey. For a full list of survey questions, see Appendix. I asked people to choose one alt (if they had more than one), and answer questions about it, including what prompted them to start the account, how they named it, who the audience is for their main and their alt, and how similar they perceived their main and alt to be. I also asked whether they would like to remain anonymous or be quoted under a pseudonym, which I have followed in this article.Of course, by posting the Twitter survey to my own followers, I am necessarily asking a specific group of people whose alt practices might not be indicative of broader trends. Just like any research done on Twitter, this research attracted a particular group: the results of this survey give a snapshot of the followers of a 29 year old female Melbourne academic, and the wider networks it was retweeted into.Although I asked anyone with more than one account on the same platform to fill out the survey, I’ll be focusing on pseudonymous alts here. Not everyone is pseudonymous on their alt: 61 per cent of respondents said they use a pseudonym, and half (51 per cent) said theirs was locked, or unavailable to the public. Some people have an alt in order to distinguish themselves from their professional account, some are connecting with those who share a specific interest, and others deliberately created an alt to harass and troll others on Twitter. But I regard pseudonymous alts as especially important to this article, as they evidence particular understandings of social media.Asking how people named their alt gave me an insight into how they framed it: as another facet of their identity: “I chose something close, but not too close to my main twitter handle,” or directed towards one particular subject they use the alt for: “I wanted a personal account which would be about all sorts, and one just for women’s sport” (Danielle Warby). Some changed the name of their account often, to further hide the account away: “I have renamed it several times, usually referencing in jokes with friends.”Many alt usernames express that the account is an alternative to a main one: people often said their alt username was their main username with a prefix or suffix like “alt,” “locked,” “NSFW” (Not Safe For Work, adult content), “priv” (short for “private”), or “2”, so if their main account was @emvdn, their alt account might be @emvdn_alt. Some used a username or nickname from another part of their life, used a pop culture reference, or wanted a completely random username, so they used a username generator or simply mashed the keyboard to get a string of random characters. Others used their real name for their alt account: “It’s my name. The point wasn’t to hide, it was to separate/segment conversiations [sic]” (knitmeapony).When asked who their audience was for their main and their alt, most people spoke of a smaller, more intimate audience of close friends or trusted accounts. On Twitter, people with locked accounts must approve followers before they can see their tweets, so it’s likely they are thinking of a specific group. One person said their alt was “locked behind a trust-wall (like a paywall, but you need to pay with a life-long friendship).” A few people said their audience for their alt was just one person: themselves. While their main account was for friends, or just “anyone who wants to follow me” (Brisbane blogger), their alt would simply be for them alone, to privately post and reflect.Asking how similar the main and alt account was led people reflecting on how they used multiple accounts to manage their multifaceted identity. “My alt account is just me unfiltered,” said one anonymous respondent, and another called their accounts “two sides of the same coin. Both me, just public and private versions.” One respondent said, “I would communicate differently in the boardroom from the bedroom. And I guess my alt is more like a private bedroom party, so it doesn’t matter if my bra comes off.”Many people signalled their awareness or experience of harassment when asked about benefits or drawbacks of alt accounts: people started theirs to avoid being harassed, bullied, piled-on, or judged. While an alt account gave people a private, safe channel in which to reach close friends and share intimate parts of their life, they also spoke about difficulties with maintaining more than one account, and potential awkwardness if someone requested to follow them that they did not want to connect with.It seemed that asking about benefits and drawbacks of alts led to articulations of labour—keeping accounts separate, and deciding on who to allow into this private space—but fears about social media more generally also surfaced. Although creating an alt meant people were consciously taking steps to compartmentalise their identity, this did not make them feel completely impervious to harassment, context collapse, and overexposure. “Some dingus will screencap and create drama,” was one potential drawback of having an alt: just because confessions and intimate or sexual photos were shared privately doesn’t mean they will stay private. People were keen to acknowledge that alts involved ongoing labour and platform negotiations.Multiple Identity Facets; Multiple AccountsWhen I released the survey, I was expecting most people to discuss their alt, locked, private account, which existed in contrast to their main, unlocked, professional one. Some people did just that, like Sarah:I worked in the media and needed a place to put my thoughts ABOUT my job/the media that I didn’t want my boss reading – not necessarily negative, just private thoughts I wanted to write somewhere.Wanting to maintain a public presence while still having an intimate space for personal self-disclosure was a common theme, which showed an awareness of imagined audiences, and a desire to disconnect from certain audiences, particularly colleagues and family members. Some didn’t necessarily want an intimate alt, but a targeted one: there were accounts for dog photos, weight loss journeys, fandoms, pregnancies, fetishes, a positive academic advice account using a Barbie doll called @barbie_phd, and one for cataloguing laundromats around London. It also seemed alts were contagious: people regularly admitted they began theirs because a friend had one. “Friends were using alts and it looked like a cool world;” “my friends seemed to be having a good time with it, and I wanted to try something they were interested in;” “wanted to be part of the ‘little twitter’ community.”Fluidities I wasn’t expecting also emerged. One respondent considered both of their accounts to be primary:it’s not clear for me which of my accounts is the “alt”. i had my non-professional one first, but i don’t consider either of them secondary, though the professional one is much more active.Along with those that changed the name of their alt often, L said they “initially kept private to only me to rant, record very private thoughts etc., have since extended it to 3 followers.” Platforms encourage continuous, active, engaged participation with ever-expanding networks of followers and friends. As José van Dijck (12) argues, platforms privilege connections, even as they stress human connectedness and downplay the automated connectivity from which they profit. Twitter’s homepage urges people to “follow your interests. Hear what people are talking about. Join the conversation. See what’s happening in the world right now,” and encourages people to keep adding more connections by featuring a recommendation panel that displays suggestions next to the main feed for “who to follow”, and links to import contacts from Gmail and other address books. In this instance, L’s three followers is an act of resistance, a disconnective practice that only links L with the very specific people they want to be an audience for their private thoughts, not to the extended networks of people L knows.ConclusionThis article has provided further evidence that on social media platforms, people don’t just have one account with their real name that faithfully expresses their one true identity. Even among those with alts, practices vary immensely, with some people using their alt as a quieter, more private space, and others creating a public identity and stream of posts catering to a niche audience.When users understand social media’s visibility, persistence, editability, association, spreadability, searchability, shareability, and personalisation as limitations, they seek ways to compartmentalise their identity facets so they can have access to the conversations, contexts, and audiences they want.There is scope for future research in this area on how alts are created, perceived, and managed, and how they relate to the broader social media landscape and its emphasis on real names, expanding networks, and increasingly sophisticated connections between people, platforms, and data. A larger study encompassing multiple platforms and accounts would reveal wider patterns of use and give more insight into this common, yet understudied, disconnective practice of selective presencing.Referencesboyd, danah. It’s Complicated: The Social Lives of Networked Teens. New Haven: Yale UP, 2014.Cardell, Kylie, Kate Douglas, and Emma Maguire. “‘Stories’: Social Media and Ephemeral Narratives as Memoir.” Mediating Memory: Tracing the Limits of Memoir. Eds. Bunty Avieson, Fiona Giles, and Sue Joseph. New York: Routledge, 2018. 157–172.Couldry, Nick. Media, Society, World: Social Theory and Digital Media Practice. Cambridge: Polity P, 2012.Farnham, Shelly D., and Elizabeth F. Churchill. “Faceted Identity, Faceted Lives: Social and Technical Issues with Being Yourself Online.” CSCW ’11: Proceedings of the ACM 2011 Conference on Computer Supported Cooperative Work, Hangzhou, China, 19–23 March 2011. 359–68.Goffman, Erving. The Presentation of Self in Everyday Life. Harmondsworth: Penguin, 1990 [1956].Leavitt, Alex. “‘This Is a Throwaway Account’: Temporary Technical Identities and Perceptions of Anonymity in a Massive Online Community.” Presented at the Computer-Supported Cooperative Work and Social Computing conference, Vancouver, Canada, 14–18 March 2015.Light, Ben. Disconnecting with Social Networking Sites. London: Palgrave Macmillan, 2014.Lingel, Jessa, and Adam Golub. “In Face on Facebook: Brooklyn’s Drag Community and Sociotechnical Practices of Online Communication.” Journal of Computer-Mediated Communication 20.5 (2015): 536–553.Litt, Eden, and Eszter Hargittai. “The Imagined Audience on Social Network Sites.” Social Media + Society 2.1 (2016).Maguire, Emma. “Home, About, Shop, Contact: Constructing an Authorial Persona via the Author Website.” M/C Journal 17.3 (2014). &lt;http://journal.media-culture.org.au/index.php/mcjournal/article/view/821&gt;.———. “Self-Branding, Hotness, and Girlhood in the Video Blogs of Jenna Marbles.” Biography 38.1 (2015): 72–86.Marwick, Alice. “Online Identity.” A Companion to New Media Dynamics. Eds. John Hartley, Jean Burgess and Axel Bruns. Chichester: Wiley-Blackwell, 2013. 355–64.———, and danah boyd. “I Tweet Honestly, I Tweet Passionately: Twitter Users, Context Collapse, and the Imagined Audience.” New Media &amp; Society 13.1 (2011): 114–133.Orlando, Joanne. “How Teens Use Fake Instagram Accounts to Relieve the Pressure of Perfection.” The Conversation, 7 Mar. 2018. &lt;http://theconversation.com/how-teens-use-fake-instagram-accounts-to-relieve-the-pressure-of-perfection-92105&gt;.Papacharissi, Zizi. Affective Publics: Sentiment, Technology, and Politics. Oxford: Oxford Scholarship Online, 2014. DOI: 10.1093/acprof:oso/9780199999736.001.0001.———. “Without You, I’m Nothing: Performances of the Self on Twitter.” International Journal of Communication 6 (2012): 1989–2006.Poole, Chris. “Prismatic Identity.” Chris Hates Writing 9 Oct. 2013 &lt;http://chrishateswriting.com/post/63564095133/prismatic-identity&gt;.Reynolds, Emily. “Alt Twitter: Where Brutal Honesty Hides behind Pseudonyms.” Gadgette 10 Aug. 2015 &lt;https://www.gadgette.com/2015/08/10/welcome-to-alt-twitter-where-brutal-honesty-hides-behind-pseudonyms/&gt;.Schmidt, Jan-Hinrik. “Practices of Networked Identity.” A Companion to New Media Dynamics. Eds. John Hartley, Jean Burgess and Axel Bruns. Chichester: Wiley-Blackwell, 2013. 365–74.Second Life Wiki. “Alternate Account.” Second Life Wiki (2018). &lt;http://secondlife.wikia.com/wiki/Alternate_Account&gt;.Smith, Sidonie, and Julia Watson. “Virtually Me: A Toolbox about Online Self-Presentation.” Identity Technologies: Constructing the Self Online. Eds. Anna Poletti and Julie Rak. Madison: U of Wisconsin P, 2014. 70-95.Stutzman, Frederic D., and Woodrow Hartzog. “Boundary Regulation in Social Media.” CSCW ’12: Proceedings of the ACM 2012 Conference on Computer Supported Cooperative Work, 11–15 February, Seattle, USA (2012).Treem, Jeffrey W., and Paul M. Leonardi. “Social Media Use in Organizations: Exploring the Affordances of Visibility, Editability, Persistence, and Association.” Communication Yearbook 36 (2012): 143–89. Van der Nagel, Emily. “Writing about Alt Accounts.” Twitter 31 Jan. 2018, 4.42 p.m. &lt;https://twitter.com/emvdn/status/958576094713696262&gt;.Van Dijck, José. The Culture of Connectivity: A Critical History of Social Media. Oxford: Oxford UP, 2013.Wesch, Michael. “YouTube and You: Experiences of Self-Awareness in the Context Collapse of the Recording Webcam.” Explorations in Media Ecology 8.2 (2009): 19–34. Appendix: List of Survey QuestionsDemographic informationAll the questions in this survey are optional, so feel free to skip any if you’re not comfortable sharing.How old are you?What is your gender identity?What is your main occupation?What is your city and country of residence?Which social media platforms do you use? Facebook, Twitter, Reddit, Instagram, Snapchat, LinkedIn, Tumblr, YouTube, Tencent QQ, WeChat, KakaoTalk, Renren, other?Which social media platforms do you have an alt account on? Facebook, Twitter, Reddit, Instagram, Snapchat, Google+, Pinterest, LinkedIn, Tumblr, YouTube, Tencent QQ, WeChat, KakaoTalk, Renren, other?Your alt accountThis section asks you to pick one of your alt accounts - for example, your locked account on Twitter separate from your main account, a throwaway on Reddit, or a close-friends-only Facebook account - and tell me about it.Which platform is your alt account on?Is your alt locked (unavailable to the public)? Yes/NoWhat prompted you to start your alt account?Do you use a pseudonym on your alt? Yes/NoDo you use a photo of yourself as the profile image? Yes/NoDo you share photos of yourself on your alt? Yes/NoCan you tell me about how you named your alt?Which account do you use more often? My main/my alt/I use them about the sameWhich has a bigger audience? My main/my alt/They’re about the sameWho is the audience for your main account? Who is the audience for your alt account? What topics would you post about on your alt that you’d never post about on your main? How similar do you think your main and alt accounts are? What are the benefits of having an alt?What are the drawbacks of having an alt? Thank you!If I quote you in my research project, what name/pseudonym would you like me to use? My name/pseudonym is___________ OR I would like to remain anonymous and be assigned a participant number

Authors: Edward Greenfield, Erin Griner, The Reproducibility Project: Cancer Biology† ### Abstract The [Reproducibility Project: Cancer Biology](https://osf.io/e81xl/wiki/home/) seeks to address growing concerns about reproducibility in scientific research by conducting replications of 50 papers in the field of cancer biology published between 2010 and 2012. This Registered Report describes the proposed replication plan of key experiments from “Widespread potential for growth-factor-driven resistance to anticancer kinase inhibitors” by Wilson and colleagues, published in Nature in 2012 (Wilson et al., 2012). The experiments that will be replicated are those reported in Figures 2B and C. In these experiments, Wilson and colleagues show that sensitivity to receptor tyrosine kinase (RTK) inhibitors can be bypassed by various ligands through reactivation of downstream signaling pathways (Figure 2A; Wilson et al, 2012), and that blocking the receptors for these bypassing ligands abrogates their ability to block sensitivity to the original RTK inhibitor (Figure 2C; Wilson et al, 2012). The Reproducibility Project: Cancer Biology is a collaboration between the [Center for Open Science](http://centerforopenscience.org/) and [Science Exchange](https://www.scienceexchange.com/), and the results of the replications will be published by eLife. ### Introduction A recurring theme in treatment of cancer is the acquisition of drug resistance. The effectiveness of therapies targeting specific mutations in receptor tyrosine kinases (RTKs) is limited by the acquisition of resistance to the drugs over the course of treatment (Camidge et al., 2014; Mok et al., 2009). Resistance can be acquired through new mutations that block the action of the RTK inhibitors or their uptake and/or genetic amplification of downstream target genes of the RTK (Chen and Fu, 2011; Gainor and Shaw, 2013; Garrett and Arteaga, 2011; Sequist et al., 2011; Yang, 2013). Several studies, including this work by Wilson and colleagues, elucidated another mechanism for this acquisition of resistance: the engagement of parallel RTK signaling pathways that converge on common downstream survival signals via signals from the tumor microenvironment. In this study, Wilson and colleagues examined several cancer cell lines for ligand-mediated drug resistance (Wilson et al., 2012). In Figure 2B/C, Wilson and colleagues demonstrated that resistance to primary kinase inhibitor treatment can be induced by the addition of rescuing ligands that activate the PI(3)K-AKT and MAPK pro-survival signaling pathways. This resistance can be overcome with the addition of an appropriate secondary kinase inhibitor. Three different cancer cell line models were used to demonstrate this phenomenon. Treatment of A204 (a PDGFR amplified rhabdomyosarcoma cell line) with the ligand FGF activated pFRS2 and pERK, inducing resistance to Sunitinib. The addition of a secondary kinase inhibitor, PD173074, blocked FGF-induced pFRS2 and pERK activation, restoring sensitivity to Sunitinib. Treatment of M14 (a BRAF mutated melanoma cell line) with the ligand NRG1 activated pHER3 and pAKT, inducing partial resistance to PLX4032. The addition of a secondary kinase inhibitor, Lapatinib, blocked NRG1-induced pHER3 and pAKT activation, restoring sensitivity to PLX4032. Treatment of KHM-3S (a EGFR mutated small cell lung cancer cell line) with the ligand HGF activated pMET and pERK, inducing resistance to Erlotinib. The addition of a secondary kinase inhibitor, Crizotinib, blocked HGF-induced pMET and pERK activation, restoring sensitivity to Erlotinib. The cell viability assays examining drug sensitivity and the western blots examining levels of phosphorylated kinases in Figures 2B and 2C respectively, are the key experiments that demonstrate that growth factor ligands can reactivate downstream signaling components important for cancer cell survival, causing resistance to anticancer kinase inhibitors (Wilson et al., 2012). These experiments are replicated in Protocols 1 and 2. Two studies published around the same time as the work of Wilson and colleagues also support the proposed mechanism of acquired resistance to RTK inhibition by signaling from the tumor microenvironment. Straussman and colleagues demonstrated that HGF signaling derived from the tumor microenvironment could bypass EGFR inhibition by activation of MET signaling (Straussman et al., 2012), and Harbinski and colleagues, in an approach similar to Wilson and colleagues, showed multiple growth factor ligands could “bypass” inhibitor-targeted RTKs (Harbinski et al., 2012). Since the publication of Wilson and colleagues’ work, several publications have reported similar results to those being replicated in Protocols 1 and 2. Similar to the experiments with A204 cells above, Welti and colleagues demonstrated that FGF ligands could induce resistance to Sunitinib, which could be reversed by the addition of PD173074 (Welti et al., 2011). These experiments were performed in HUVEC cells, whereas A204 cells were used in the study being replicated. Similar to the experiments on M14 cells above, Montero-Conde and colleagues showed that NRG1 ligand could activate pHER3 and pAKT in the presence of PLX4032, and this activation could be reversed by the addition of Lapatinib (Montero-Conde et al., 2013). These experiments were performed in 8505C cells, whereas M14 cells were used in the study being replicated. Similar to the experiments performed on KHM-S3 cells above, several groups have demonstrated that HGF ligand can induce resistance to Erlotinib, and that this resistance can be reversed by the addition of Crizotinib (Nakade et al., 2014; Nakagawa et al., 2012). These experiments were performed in PC-9 and HCC827 cells, whereas KHM-3S cells were used in the study being replicated. ### Materials and Methods Unless otherwise noted, all protocol information was derived from the original paper, references from the original paper, or information obtained directly from the authors. An asterisk (*) indicates data or information provided by the Reproducibility Project: Cancer Biology core team. A hashtag (#) indicates information provided by the replicating lab. **Protocol 1: Cell viability assays** This protocol describes cell viability assays to determine the IC50 values of three cancer cell lines treated with primary kinase inhibitor alone, primary kinase inhibitor in combination with rescuing ligand, and primary kinase inhibitor in triple combination with rescuing ligand and a drug targeting the rescuing ligand’s receptor tyrosine kinase (RTK) (termed the secondary kinase inhibitor) (Figure 2B). Sampling: -The original data presented is qualitative, and the authors were unable to share the raw data values with the RP:CB core team. This prevents power calculations being performed a priori to determine sample size (number of biological replicates). In order to determine an appropriate number of replicates to perform initially, we have estimated the sample sizes required based on a range of potential variance. We will also determine sample size post hoc as described in Power Calculations. - Please see Power Calculations for details. - Each experiment has three cohorts. In each cohort, a dilution series of the primary kinase inhibitor (10e-4, 10e-3, 10e-2, 10e-1, 10e0 and 10e1 µM) is run three times; once alone, once with the rescuing ligand, and once with both the rescuing ligand and the secondary kinase inhibitor. The effect of the secondary kinase inhibitor alone will also be assessed. Each condition will be run in triplicate. - Cohort 1: A204 cell line - Media only (additional) - Vehicle control - 0.001 µM - 10 µM Sunitinib + no ligand - 0.001 µM - 10 µM Sunitinib + 50 ng/ml FGF - 0.001 µM - 10 µM Sunitinib + 50 ng/ml FGF + 0.5 µM PD173074 - 0.5 µM PD173074 + no ligand (additional) - Cohort 2: M14 cell line - Media only (additional) - Vehicle control - 0.001 µM - 10 µM PLX4032 + no ligand - 0.001 µM - 10 µM PLX4032 + 50 ng/ml NRG1 - 0.001 µM - 10 µM PLX4032 + 50 ng/ml NRG1 + 0.5 µM Lapatinib - 0.5 µM Lapatinib + no ligand (additional) - Cohort 3: KHM-3S cell line - Media only (additional) - Vehicle control - 0.001 µM - 10 µM Erlotinib + no ligand - 0.001 µM - 10 µM Erlotinib + 50 ng/ml HGF - 0.001 µM - 10 µM Erlotinib + 50 ng/ml HGF + 0.5 µM Crizotinib - 0.5 µM Crizotinib + no ligand (additional) *Materials and Reagents:*   *Procedure:* Notes: - All cells will be sent for mycoplasma testing and STR profiling. - Medium for all cell lines: RPMI 1640 supplemented with 10% FBS, 50 U/ml penicillin and 50 µg/ml streptomycin. - Cells maintained at 37˚C in a humidified atmosphere at 5% CO2. 1. Seed 3,000-5,000 cells per well into 96-well plates. For each condition replicate, seed 1 well as the media control, 1 well as the vehicle control, 1 well for treatment with the secondary kinase inhibitor alone and 6 wells per concentration curve (10e-4, 10e-3, 10e-2, 10e-1, 10e0 and 10e1 µM), of which there are three. 1 a. 6 wells per concentration curve x 3 concentration curves = 18 wells + 3 wells = 21 wells per cohort. - 18-24 hr after seeding, treat 3 wells per condition with appropriate treatment (see Sampling). - a. Lab will record the vehicle used to solubilize the drugs. - 72 hr after treatment, fix cells in 4% paraformaldehyde (PFA). - a. Lab will record the PFA incubation time. - Stain with Syto 60 according to manufacturer’s recommendations and assay cell number using an Odyssey with Odyssey Application Software. -a. Include empty wells and media only wells. - Calculate cell viability by dividing the fluorescence from the drug-treated cells by the fluorescence from the control (vehicle) treated cells. Fit normalized data to a sigmoidal dose–response curve. - a. Also calculate the effect of vehicle by dividing the fluorescence from the control vehicle cells by the fluorescence from the media only treated cells (additional control). - b. Determine the IC50 values for each curve. - c. Lab will document the software used to fit the data to a sigmoidal dose-response curve and calculate the IC50 values. - Repeat independently two additional times. Deliverables: - Data to be collected: - Raw fluorescence data and calculated cell viability. - Semi-logarithmic graph for each condition of primary kinase inhibitor (log) vs normalized cell viability (linear) for each cell line (comparable to Figure 2B). - Calculated IC50 for each condition. Confirmatory analysis plan: - Statistical Analysis of the Replication Data: - For each cell line, compare the IC50 of primary kinase inhibitor alone, primary kinase inhibitor + ligand, and primary kinase inhibitor + ligand + secondary kinase inhibitor. - ANOVA - Meta-analysis of original and replication attempt effect sizes: - We will plot the replication data (mean and 95% confidence interval) and will include the original data point, calculated directly from the representative image in Figure 2B, as a single point on the same plot for comparison. Known differences from the original study: - We are including two additional control conditions; - Media alone - To provide a baseline - Treatment of the cells with the secondary kinase inhibitor alone - To assess any effects the secondary kinase inhibitor may have independent of the ligand and primary kinase inhibitor Provisions for quality control: - All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/h0pnz/). - Cell lines will be validated by STR profiling and screened for mycoplasma contamination. - A lab from the Science Exchange network with extensive experience in conducting cell viability assays will perform these experiments. **Protocol 2: Western blot assays** This protocol describes western blot assays to determine the levels of activated phosphorylated signaling pathways in three cancer cell lines treated with primary kinase inhibitor alone, primary kinase inhibitor in combination with rescuing ligand, and primary kinase inhibitor in triple combination with rescuing ligand and a drug targeting the rescuing ligand’s receptor tyrosine kinase (RTK) (termed the secondary kinase inhibitor) (Figure 2C). Sampling: - The original data presented is qualitative. This prevents power calculations being performed a priori to determine sample size (number of biological replicates In order to determine an appropriate number of replicates to perform initially, we have estimated the sample sizes required based on a range of potential variance. We will also determine sample size post hoc as described in Power Calculations. - Please see Power Calculations for details. - Each experiment has three cohorts. Each cohort will consist of cells treated with media alone, with vehicle alone, with the primary kinase inhibitor, with primary kinase inhibitor and the rescuing ligand, and with the primary kinase inhibitor, the rescuing ligand and the secondary kinase inhibitor. The effect of the secondary kinase inhibitor alone will also be assessed. Each condition will be run once (i.e., no technical replicates will be performed). - Cohort 1: A204 cell line - Media only (additional) - Vehicle control - 1 µM Sunitinib + no ligand - 1 µM Sunitinib + 50 ng/ml FGF - 1 µM Sunitinib + 50 ng/ml FGF + 0.5 µM PD173074 - 1 µM PD173074 + no ligand (additional) - Cohort 2: M14 cell line - Media only (additional) - Vehicle control - 1 µM PLX4032 + no ligand - 1 µM PLX4032 + 50 ng/ml NRG1 - 1 µM PLX4032 + 50 ng/ml NRG1 + 0.5 µM Lapatinib - 1 µM Lapatinib + no ligand (additional) - Cohort 3: KHM-3S cell line - Media only (additional) - Vehicle control - 1 µM Erlotinib + no ligand - 1 µM Erlotinib + 50 ng/ml HGF - 1 µM Erlotinib + 50 ng/ml HGF + 0.5 µM Crizotinib - 1 µM Crizotinib + no ligand (additional) - Cohort 4: Positive control cell lines - For Cohort 1: HL60 cells treated with FGF (additional control) - For Cohort 2: MCF7 cells treated with NRG1 (additional control) - For Cohort 3: HEK293 cells treated with HGF (additional control) - Treatment of these cell lines with their cognate growth factor ligands will serve as a positive control for ligand activity. *Materials and Reagents:*   *Procedure:* Notes: - All cells will be sent for mycoplasma testing and STR profiling. - Medium for cell lines: RPMI 1640 supplemented with 10% FBS, 50 U/ml penicillin and 50 µg/ml streptomycin. - MCF7 cells and HEK293 cells are maintained in DMEM + 10% FBS - Cells maintained at 37˚C in a humidified atmosphere at 5% CO2. 1. Seed cells in 6-well plates. - a. Two control and four experimental wells (6 wells total) are needed for each cell line in Cohorts 1-3. - i. Lab will determine and record the number of cells seeded and well size used. - b. *For Cohort 4, seed cells as needed into wells of a 6 well plate. - 18-24 hr after seeding, treat wells in Cohorts 1-3 with conditions as described in the Sampling section. - a. Lab will determine and record vehicle for preparation of drug solutions. - b. Harvest protein as in Step 5 after 2 hr of treatment. - Simultaneously, treat cells in Cohort 4 as follows: - a. HL60 cells. Note: This protocol is based on Krejci et. al., 2003 (Krejci et al., 2003). - i. Serum-starve HL60 cells for 24 hr prior to protein harvesting. - _1. Serum starve = DMEM + 0% FBS - ii. Treat cells for 10 min with 100 ng/mL FGF. - iii. Harvest cell lysates as noted in Step 5. - b. MCF7 cells. Note: This protocol is based on Sarup et. al., 2008 (Sarup et al., 2008). - i. Serum-starve cells for 48 hr prior to protein harvesting. - _1. Serum starve = DMEM + 0.1% BSA - ii. Treat cells with 1 nmol/L NRG1 for 10 min at 37°C. - iii. Harvest cell lysates as noted in Step 5. - c. HEK293 cells. Note: This protocol is based on Wright et. al., 2012 (Wright et al., 2012). - i. Serum-starve HEK293 cells for 24 hr prior to protein harvesting. - _1. Serum starve = DMEM + 0% FBS - ii. Treat cells with 29 ng/mL HGF for 10 min at 37°C. - iii. Harvest cell lysates as noted in Step 5. - #Preparation of cell lysate: - a.Note: from here on, the replicating lab will use their in-house Western Blot protocol, as recommended by the original authors. (#) - b. Harvest cells from the tissue culture plate using 1X Trypsin-EDTA. - c. Wash cells with 1X cold PBS and spin at 1200 RPM for 5 min. - d. Decant the PBS and add lysis buffer to the cell pellet and resuspend well. - e. Incubate at room temperature for 5 min. - f. Spin solution at 13,000 RPM for 30 min at 4°C using a benchtop centrifuge. - g. Collect the lysate/protein sample and store at -20°C or -80°C for later use. - #SDS-PAGE separation: - a. Prepare lysate sample by adding SDS reducing loading dye to ~25-30 µg of protein sample and boiling at 95°C-100°C for 5 min. - i. Lab will record exact amount of protein loaded and provide data from determining protein concentration. - b. Let samples cool on ice and quick-spin the tubes to collect any droplets on the cap of the tube. - c. Prepare the gel for sample loading – insert the gel in the gel box with 1X running buffer and ensure there is no leak. - i. Based on the expected MWs of the targets, lab will determine the optimal percentage gel to use. - d. Load 16 µL of sample (25-30 µg/lane) in each well of the Tris-glycine gel. - e. Run the sample at 175 V for 25 min. - f. Remove the gel from the cassette and rinse with water. - #Transfer and blocking: - a. Transfer protein on the gel to a nitrocellulose membrane for 1 hr at 12V using a semi-dry transfer apparatus, 1X transfer buffer and blotting sheets. - b. Verify the efficiency of the transfer by Ponceau staining of the membrane. - i. Lab will record an image of the Ponceau-stained membrane. - c. Incubate the blots in 5% non-fat skim milk for 1 hr at room temperature. - #Antibody probing: - a. Dilute the primary antibodies according to manufacturer’s recommendations as suggested by the original authors. - i. If the manufacturer recommends a range of dilutions, lab will use a dilution in the middle of the recommended dilution range. - ii. A204: - _ 1. p-PDGFR (goat) - _ 2. PDGFR (rabbit) - _ 3. p-AKT S473 (rabbit) - _ 4. AKT (rabbit) - _ 5. p-ERK T202/Y204 (rabbit) - _ 6. ERK (rabbit) - _ 7. pFRS2 Y196 (rabbit) - _ 8. FRS2 (rabbit) - _ 9. -tubulin (additional control) (rabbit) - ___ a. Loading control - iii. M14: - _ 1. pHER3 Y1289 (rabbit) - _ 2. HER3 (rabbit) - _ 3. p-AKT S473 (rabbit) - _ 4. AKT (rabbit) - _ 5. p-ERK T202/Y204 (rabbit) - _ 6. ERK (rabbit) - _ 7. -tubulin (additional control) (rabbit) - ___ a. Loading control - iv. KHM-3S: - _ 1. p-EGFR Y1068 (rabbit) - _ 2. EGFR (mouse) - _ 3. p-AKT S473 (rabbit) - _ 4. AKT (rabbit) - _ 5. p-ERK T202/Y204 (rabbit) - _ 6. ERK (rabbit) - _ 7. p-MET Y1234/5 (rabbit) - _ 8. MET (rabbit) - _ 9. -tubulin (additional control) (rabbit) - ___ a. Loading control - v. HL60: - _ 1. pERK T202/Y204 (rabbit) - _ 2. ERK (rabbit) - _ 3. -tubulin (additional control) (rabbit) - ___ a. Loading control - vi. MCF7: - _ 1. pHER3 (rabbit) - _ 2. HER3 (rabbit) - _ 3. -tubulin (additional control) (rabbit) - ___ a. Loading control - vii. HEK293: - _ 1. pMET (rabbit) - _ 2. MET (rabbit) - _ 3. -tubulin (additional control) (rabbit) - ___ a. Loading control - ___ b. Add the antibody solutions to the membranes and incubate them for 12 to 16 hr at 4°C. - ___ c. Wash the blots with Tris-buffered saline (TBS) with 0.5% Tween-20 three times for 10 min each wash. - ___ d. Dilute HRP-secondary antibody in 5% milk and add to the blots. - _____ i. Lab will record the dilution factor of the secondary antibody. - ___ e. Incubate at room temperature for 1 hr. - ___ f. Wash blots with TBS + 0.5% Tween-20 four times for 15 min each wash. - #Developing: - a. Remove as much wash buffer as possible. - b. Mix Super Signal West Pico Chemiluminescent Substrate solutions in equal proportions and add it to the blot. - c. Incubate for ~ 1 min. - d. Stick the blot in the developing cassette and develop the blot in the dark. - e. Expose the blot to film for at 3 time points, starting with 15 s. Determine other two time points based on strength of signal in the 15 s exposure. - #Scan film and quantify band intensity using densitometric analysis software. - Repeat independently two additional times. Deliverables: - Data to be collected: - Images of probed membranes (images of full films with molecular weight ladders). - Scanned image of Ponceau-stained membranes after protein transfer. - Quantified signal intensities and bar graphs of mean signal intensities normalized for -tubulin loading and total pan-protein levels. Confirmatory analysis plan: - Statistical Analysis of the Replication Data: - For each cell line, compare the following normalized phosphorylated kinase levels of primary kinase inhibitor alone, primary kinase inhibitor + ligand, and primary kinase inhibitor + ligand + secondary kinase inhibitor. - One-way ANOVA - Note: At the time of analysis, we will generate a histogram of all the data to determine if it follows a Gaussian distribution or not. If it is skewed, we will perform the appropriate transformation in order to proceed with the proposed statistical analysis. - Meta-analysis of original and replication attempt effect sizes: - We will plot the replication data (mean and 95% confidence interval) and will include the original data point, calculated directly from the representative image in Figure 2C, as a single point on the same plot for comparison. Known differences from the original study: - We are including three additional control conditions; - Media alone - To provide a baseline - Treatment of the cells with the secondary kinase inhibitor alone - to assess any effects the secondary kinase inhibitor may have independent of the ligand and primary kinase inhibitor - Treatment of a control cell line with the growth factor ligand alone - To ensure the growth factor ligand is active - FGF should cause phosphorylation of ERK1/2 in HL60 cells - NRG1 should cause phosphorylation of HER3 in MCF7 cells - HGF should cause phosphorylation of MET in HEK293 cells - The original authors recommended that the replicating lab follow a standard Western blot protocol. Provisions for quality control: All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/h0pnz/). - Cell lines will be validated by STR profiling and screened for mycoplasma contamination. - A lab from the Science Exchange network with extensive experience in conducting western blot assays for phosphorylated proteins will perform these experiments. ### Power Calculations **Protocol 1**: The original data presented is qualitative (images of survival curves) and the authors were unable to share the raw data values with the RP:CB core team. To estimate original effect sizes, we determined approximate IC50 concentrations from the original survival curve images. Summary of original data  We have calculated the projected sample size based on a variety of different possible levels of variance using a one-way ANOVA test with an alpha error of 0.05. - These power calculations were performed with G*Power software, version 3.1.7 (Faul et al., 2007). - The F statistic was calculated at http://statpages.org/anova1sm.html. - The nP^2 was calculated using the formula on the spreadsheet accessed from Lakens and colleagues (Lakens, 2013).  For each percent variance, the relative standard deviation of the approximated IC50 was used to calculate the F statistic from a one-way ANOVA analysis, which was converted to nP^2 (the ratio of variance attributed to the effect and the effect plus its associate error variance from the ANOVA), and then used to determine the effect size (Cohen’s f) and the needed sample size to obtain at least 80% power. The actual power obtained is listed.  In order to produce quantitative replication data, we will run the experiment three times. Each time we will quantify the IC50. We will determine the standard deviation of the IC50 across the three biological replicates and combine this with the means from the original study to simulate an effect size. Using this simulated effect size, we will then determine the number of replicates necessary to reach a power of at least 80%. We will then perform additional replicates, if required, to ensure the experiment has more than 80% power to detect the original effect. **Protocol 2**: The original data presented is qualitative (images of Western Blots). We used Image Studio Lite v. 4.0.21 (LICOR) to perform densitometric analysis of the presented bands to quantify the original effect size. Levels of phospho-protein were normalized to total protein and then normalized to the control. Summary of original data  We have calculated the projected sample size based on a variety of different possible levels of variance (Koller and Wätzig, 2005) using a one-way ANOVA test with an alpha error of 0.05. - These power calculations were performed with G*Power software, version 3.1.7 (Faul et al., 2007). - The F statistic was calculated at http://statpages.org/anova1sm.html. - The nP^2 was calculated using the formula on the spreadsheet accessed from Lakens and colleagues (Lakens, 2013).  For each percent variance, the relative standard deviation of the approximated phospho-protein level was used to calculate the F statistic from a one-way ANOVA analysis, which was converted to nP^2 (the ratio of variance attributed to the effect and the effect plus its associate error variance from the ANOVA), and then used to determine the effect size (Cohen’s *f*) and the needed sample size to obtain at least 80% power. The actual power obtained is listed.   In order to produce quantitative replication data, we will run the experiment three times. Each time we will quantify band intensity. We will determine the standard deviation of band intensity across the three biological replicates and combine this with the means from the original study to simulate the original effect size. We will use this simulated effect size to determine the number of replicates necessary to reach a power of at least 80%. We will then perform additional replicates, if required, to ensure the experiment has more than 80% power to detect the original effect. ### Acknowledgements The Reproducibility Project: Cancer Biology core team would like to thank the original authors, in particular Dr. Jeff Settleman, for generously sharing critical information to ensure the fidelity and quality of this replication attempt. We would also like to thanks the following companies for generously donating reagents to the Reproducibility Project: Cancer Biology; BioLegend, Charles River Laboratories, Corning Incorporated, DDC Medical, EMD Millipore, Harlan Laboratories, LI-COR Biosciences, Mirus Bio, Novus Biologicals, and Sigma-Aldrich. ### References 1. Camidge, DR, Pao, W, and Sequist, LV. 2014. Acquired resistance to TKIs in solid tumours: learning from lung cancer. *Nat Rev Clin Oncol* 11:473-81. doi: 10.1038/nrclinonc.2014.104. - Chambers, AF. 2009. MDA-MB-435 and M14 cell lines: identical but not M14 melanoma? *Cancer Res*. 69:5292-93. doi: 10.1158/0008-5472.CAN-09-1528. - Chen, Y-f, and Fu, L-w. 2011. Mechanisms of acquired resistance to tyrosine kinase inhibitors. *Acta Pharmaceutica Sinica B* 1:197-207. doi: 10.1016/j.apsb.2011.10.007. - Gainor, JF, and Shaw, AT. 2013. Emerging Paradigms in the Development of Resistance to Tyrosine Kinase Inhibitors in Lung Cancer. *Journal of Clinical Oncology* 31:3987-96. doi: 10.1200/JCO.2012.45.2029. - Garrett, JT, and Arteaga, CL. 2011. Resistance to HER2-directed antibodies and tyrosine kinase inhibitors: Mechanisms and clinical implications. *cbt* 11:793-800. doi: 10.4161/cbt.11.9.15045. - Harbinski, F, Craig, VJ, Sanghavi, S, Jeffery, D, Liu, L, Sheppard, KA, Wagner, S, Stamm, C, Buness, A, Chatenay-Rivauday, C, Yao, Y, He, F, Lu, CX, Guagnano, V, Metz, T, Finan, PM, Hofmann, F, Sellers, WR, Porter, JA, Myer, VE, Graus-Porta, D, Wilson, CJ, Buckler, A, and Tiedt, R. 2012. Rescue Screens with Secreted Proteins Reveal Compensatory Potential of Receptor Tyrosine Kinases in Driving Cancer Growth. *Cancer Discovery* 2:948-59. doi: 10.1158/2159-8290.CD-12-0237. - Holliday, DL, and Speirs, V. 2011. Choosing the right cell line for breast cancer research. *Breast Cancer Res*. 13:215. doi: 10.1186/bcr2889. - Koller, A, and Wätzig, H. 2005. Precision and variance components in quantitative gel electrophoresis. *Electrophoresis* 26:2470-75. doi: 10.1002/elps.200500024. - Krejci, P, Faitova, J, Laurell, H, Hampl, A, and Dvorak, P. 2003. FGF-2 expression and its action in human leukemia and lymphoma cell lines. *Leukemia* 17:818-20. doi: 10.1038/sj.leu.2402861. - Lakens, D. 2013. Calculating and reporting effect sizes to facilitate cumulative science: a practical primer for t-tests and ANOVAs. *Front Psychol* 4:863. doi: 10.3389/fpsyg.2013.00863. - Mok, TS, Wu, Y-L, Thongprasert, S, Yang, C-H, Chu, D-T, Saijo, N, Sunpaweravong, P, Han, B, Margono, B, Ichinose, Y, Nishiwaki, Y, Ohe, Y, Yang, J-J, Chewaskulyong, B, Jiang, H, Duffield, EL, Watkins, CL, Armour, AA, and Fukuoka, M. 2009. Gefitinib or Carboplatin–Paclitaxel in Pulmonary Adenocarcinoma. *N Engl J Med* 361:947-57. doi: 10.1056/NEJMoa0810699. - Montero-Conde, C, Ruiz-Llorente, S, Dominguez, JM, Knauf, JA, Viale, A, Sherman, EJ, Ryder, M, Ghossein, RA, Rosen, N, and Fagin, JA. 2013. Relief of Feedback Inhibition of HER3 Transcription by RAF and MEK Inhibitors Attenuates Their Antitumor Effects in BRAF-Mutant Thyroid Carcinomas. *Cancer Discovery* 3:520-33. doi: 10.1158/2159-8290.CD-12-0531. - Nakade, J, Takeuchi, S, and Nakagawa, T. 2014. Triple Inhibition of EGFR, Met, and VEGF Suppresses Regrowth of HGF-Triggered, Erlotinib-Resistant Lung Cancer Harboring an EGFR Mutation. *J Thorac Oncol* 9:775-83. doi: 10.1097/JTO.0000000000000170. - Nakagawa, T, Takeuchi, S, Yamada, T, and Nanjo, S. 2012. Combined therapy with mutant-selective EGFR inhibitor and Met kinase inhibitor for overcoming erlotinib resistance in EGFR-mutant lung cancer. *Mol Cancer Ther* 11:2149-57. doi: 10.1158/1535-7163.MCT-12-0195. - Rae, JM, Creighton, CJ, Meck, JM, Haddad, BR, and Johnson, MD. 2007. MDA-MB-435 cells are derived from M14 melanoma cells--a loss for breast cancer, but a boon for melanoma research. *Breast Cancer Res. Treat*. 104:13-19. doi: 10.1007/s10549-006-9392-8. - Sarup, J, Jin, P, Turin, L, Bai, X, Beryt, M, Brdlik, C, Higaki, JN, Jorgensen, B, Lau, FW, Lindley, P, Liu, J, Ni, I, Rozzelle, J, Kumari, R, Watson, SA, Zhang, J, and Shepard, HM. 2008. Human epidermal growth factor receptor (HER-1:HER-3) Fc-mediated heterodimer has broad antiproliferative activity in vitro and in human tumor xenografts. *Molecular Cancer Therapeutics* 7:3223-36. doi: 10.1158/1535-7163.MCT-07-2151. - Sequist, LV, Waltman, BA, Dias-Santagata, D, Digumarthy, S, Turke, AB, Fidias, P, Bergethon, K, Shaw, AT, Gettinger, S, Cosper, AK, Akhavanfard, S, Heist, RS, Temel, J, Christensen, JG, Wain, JC, Lynch, TJ, Vernovsky, K, Mark, EJ, Lanuti, M, Iafrate, AJ, Mino-Kenudson, M, and Engelman, JA. 2011. Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors. *Science Translational Medicine* 3:75ra26-75ra26. doi: 10.1126/scitranslmed.3002003. - Straussman, R, Morikawa, T, Shee, K, Barzily-Rokni, M, Qian, ZR, Du, J, Davis, A, Mongare, MM, Gould, J, Frederick, DT, Cooper, ZA, Chapman, PB, Solit, DB, Ribas, A, Lo, RS, Flaherty, KT, Ogino, S, Wargo, JA, and Golub, TR. 2012. Tumour micro-environment elicits innate resistance to RAF inhibitors through HGF secretion. *Nature* 487:500-04. doi: 10.1038/nature11183. - Welti, JC, Gourlaouen, M, Powles, T, and Kudahetti, SC. 2011. Fibroblast growth factor 2 regulates endothelial cell sensitivity to sunitinib. *Oncogene* 30:1183-93. doi: 10.1038/onc.2010.503. - Wilson, TR, Fridlyand, J, Yan, Y, Penuel, E, Burton, L, Chan, E, Peng, J, Lin, E, Wang, Y, Sosman, J, Ribas, A, Li, J, Moffat, J, Sutherlin, DP, Koeppen, H, Merchant, M, Neve, R, and Settleman, J. 2012. Widespread potential for growth-factor-driven resistance to anticancer kinase inhibitors. *Nature* 487:505-09. doi: 10.1038/nature11249. - Wright, JW, Wilson, WL, Wakeling, V, Boydstun, AS, Jensen, A, Kawas, L, and Harding, JW. 2012. The Hepatocyte Growth Factor/c-Met Antagonist, Divalinal-Angiotensin IV, Blocks the Acquisition of Methamphetamine Dependent Conditioned Place Preference in Rats. *Brain Sciences* 2:298-318. doi: 10.3390/brainsci2030298. - Yang, S-H. 2013. Molecular Basis of Drug Resistance: Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors and Anaplastic Lymphoma Kinase Inhibitors. *Tuberc Respir Dis* 75:188. doi: 10.4046/trd.2013.75.5.188. ### Author Information † The RP:CB core team consists of Elizabeth Iorns (Science Exchange, Palo Alto, California), William Gunn (Mendeley, London, United Kingdom), Fraser Tan (Center for Open Science, Charlottesville, Virginia), Joelle Lomax (Science Exchange, Palo Alto, California), and Timothy Errington (Center for Open Science, Charlottesville, Virginia). **Edward Greenfield**, Monoclonal Antibody Core Facility, The Dana-Farber Cancer Institute, Boston, Massachusetts **Erin Griner**, University of Virginia, Charlottesville, Virginia Correspondence to Fraser Tan, fraser@scienceexchange.com. **Competing Interests**: We disclose that EI, FT, and JL are employed by and hold shares in Science Exchange Inc. The experiments presented in this manuscript will be conducted by EG at the Monoclonal Antibody Core Facility, which is a Science Exchange lab. No other authors disclose conflicts of interest related to this manuscript. **Funding**: The Reproducibility Project: Cancer Biology is funded by the Laura and John Arnold Foundation, provided to the Center for Open Science in collaboration with Science Exchange. The funder had no role in study design or the decision to submit the work for publication.

Authors: David Blum, Samuel LaBarge, The Reproducibility Project: Cancer Biology†* ### Abstract The [Reproducibility Project: Cancer Biology](https://osf.io/e81xl/wiki/home/) seeks to address growing concerns about reproducibility in scientific research by conducting replications of 50 papers in the field of cancer biology published between 2010 and 2012. This Registered Report describes the proposed replication plan of key experiments from “Tumour micro-environment elicits innate resistance to RAF inhibitors through HGF secretion” by Straussman and colleagues, published in Nature in 2012 (Straussman et al., 2012).The key experiments being replicated in this study are from Figures 2A, C and D (and Supplemental Figure 11) and Figure 4C (and Supplemental Figure 19) (Straussman et al., 2012). Figure 2 demonstrates resistance to drug sensitivity conferred by co-culture with some stromal cell lines, and identifies the secreted factor responsible as HGF. In Figure 4, Straussman and colleagues show that blocking the HGF receptor MET abrogates HGF’s rescue of drug sensitivity. The Reproducibility Project: Cancer Biology is a collaboration between the [Center for Open Science](http://centerforopenscience.org/) and [Science Exchange](https://www.scienceexchange.com/), and the results of the replications will be published by eLife. ### Introduction Resistance to oncoprotein-targeted chemotherapy is a common occurrence during cancer treatment and identifying the mechanisms of resistance is important in improving treatment options. Specifically, BRAF-mutant melanomas, which show an initial response to RAF inhibitors, usually become resistant to the therapy (Nickoloff and Vande Woude, 2012). The identification of stroma-mediated resistance in BRAF-mutant melanomas, through the secretion of hepatocyte growth factor (HGF), therefore indicates a potential therapeutic strategy through combination treatment of RAF inhibitors and inhibition of the HGF activated pathway (Straussman et al., 2012). This report is the first to identify paracrine HGF as a potential mechanism for the development of drug resistance (Ghiso and Giordano, 2013; Glaire et al., 2012). In Figure 2A of their paper, Straussman and colleagues tested the effect of fibroblast-conditioned medium on the proliferation of BRAF-mutant melanoma cells grown in the presence of the BRAF inhibitor PLX4720. Using a cell proliferation assay, they reported that fibroblast-conditioned medium rescued BRAF-mutant melanoma cells from PLX4720 sensitivity, which indicated that a secreted factor was involved. This was a key finding demonstrating that the stromal environment of the tumor cells could mediate their response to drug treatment. This experiment will be replicated in Protocol 3. Straussman and colleagues went on to identify the secreted factor responsible for acquired drug resistance as HGF. In Figure 2C, they demonstrate that treating melanoma cell lines with PLX4720 in combination with increasing concentrations of exogenous HGF increased proliferation as compared to treatment with drug alone. This finding showed a similar effect to treatment with conditioned media from stromal cells that secrete HGF (see Figure 2A) and supports the hypothesis that HGF is the growth factor responsible for rescuing melanoma cells from drug sensitivity. This experiment will be replicated in Protocol 4. Straussman and colleagues demonstrated that the HGF-mediated rescue of melanoma cells from drug sensitivity was mediated through HGF’s cognate receptor tyrosine kinase MET by treating melanoma cell lines co-cultured with stromal cell lines in the presence of PLX4720 with the MET inhibitor crizotinib, as shown in Figure 2D and Supplemental Figure 11. Treatment with crizotinib reduced the increase in proliferation due to co-culture with an HGF-secreting stromal cell line. This experiment provided further support for the hypothesis that HGF was responsible for rescue from drug sensitivity, and also provided evidence that that rescue was MET dependent. This experiment is replicated in Protocol 5. Lastly, Straussman and colleagues reported sustained activation of both ERK and AKT in HGF-treated melanoma cells during BRAF inhibition, and to a lesser extent MEK inhibition, as shown in Figure 4C and Supplemental Figure 19 by Western blot. This confirms activation of pro-survival pathways in response to HGF treatment even in the presence of PLX4720. These experiments are replicated in Protocol 6. To date, a direct replication has been reported; Lezcano and colleagues (Lezcano et al., 2014) published a replication of Figure 3 of Straussman et al Nature 2013 wherein Straussman and colleagues evaluated HGF expression in patient-derived primary melanoma samples and observed a negative correlation between expression of HGF and response to therapy (Straussman et al., 2012). While Lezcano and colleagues’ replication also detected the presence of HGF in human melanoma tumor cells and stromal cells with increased expression at disease progression, they did not identify a statistically significant correlation between HGF expression and clinical outcome (Lezcano et al., 2014). While both of the studies come to different conclusions about the association of stromal HGF and clinical outcome, the 95% confidence intervals of the standardized measure of the effect (cohen’s d) for each study substantially overlap. A study published around the same time as the work of Straussman and colleagues supports the negative association between HGF and clinical response to RAF inhibitor treatments through an analysis of HGF levels in patient plasma samples (Wilson et al., 2012). In other systems, additional labs have observed a similar role for HGF in acquired drug resistance. Caenepeel and colleagues reported that HGF rescued melanoma cell lines, notably SK-MEL-5, from BRAF or MEK inhibition using vemurafenib (an analogue of PLX4720) or PD0325901, respectively, and the rescue was attenuated by MET inhibition (Caenepeel et al., 2013). Nakagawa and colleagues observed that tumor-secreted (not stromal secreted) HGF could induce resistance to the VEGFR inhibitor lenvatinib, and that this resistance could be overcome by co-treatment with golvatinib, a MET inhibitor (Nakagawa et al., 2014). Etnyre and colleagues reported that c-MET and BRAF inhibitors had synergistic inhibitory effects when exposed in combination to melanoma cell lines (Etnyre et al., 2013). Casbas-Hernandez and colleagues co-cultured MCF10 cells with immortalized mammoplasty-derived fibroblasts, and observed a correlation between the levels of fibroblast-secreted HGF and the differentiation of the MCF10 cells towards a ductal carcinoma phenotype. They also observed a correlation between HGF expression and the more invasive basal-like tumors as opposed to the less invasive luminal tumors (Casbas-Hernandez et al., 2013). HGF is also being evaluated as a potential biomarker to indicate potential treatment choices (Penuel et al., 2013; Xie et al., 2013). ### Materials and Methods Unless otherwise noted, all protocol information was derived from the original paper, references from the original paper, or information obtained directly from the authors. **Protocol 1: Determining the range of detection of the replicating lab’s plate reader** This is a general protocol that determines the range of detection of the plate reader. Because the plate reader in use by the replicating lab is different than the plate reader used in the original study, we are determining what the range of detection is for the replicating lab’s plate reader. Sampling: - SK-MEL-5 - 8,000 cells/well x 4 replicates - 4,000 cells/well x 4 replicates - 2,000 cells/well x 4 replicates - 1,000 cells/well x 4 replicates - 500 cells/well x 4 replicates -250 cells/well x 4 replicates - 125 cells/well x 4 replicates - 62.5 cells/well x 4 replicates - 31.25 cells/well x 4 replicates - The experiment is done a total of once. Materials and Reagents: - Reagents that are different from ones originally used are noted with an asterisk (*).  Procedure: 1. Seed 4 wells of a 384-well black plate with 8,000 cells/well all the way to 31.25 cells/well (serial 1:2 dilutions) with pLex-TRC206 SK-MEL-5 cells in 60 µl per well using phenol-red free medium using an automated workstation. Note: All cells will be sent for mycoplasma testing and STR profiling. Note: Ensure at least 85% of SK-MEL-5 cells are GFP-positive before start of experiment. Cells can be enriched using FACS or puromycin (0.5-2 µg/ml), however do not grow cells under antibiotic selection on a regular basis. - a. Total wells seeded = 36 - b. Medium for assay: phenol-red free DMEM supplemented with 1 mM sodium pyruvate, 10% FBS, and 1X Pen-Strep-Glut. - c. Fill wells with 60 µl/well of clear media in at least 2 rows and 2 columns around wells that are being included in the experiment. - The next day after seeding, read GFP fluorescence (Synergy HT Microplate Reader). - Subtract the average reading from media-only wells from the wells with cells. Deliverables: - Data to be collected: - Raw GFP fluorescence readings. - Graph of GFP fluorescence readings vs cell number. Confirmatory analysis plan: - Statistical Analysis: - Coefficient of determination of data values. Known differences from the original study: - Synergy HT Microplate Reader used instead of Molecular Devices SpectraMax M5e Microplate Reader – both can detect GFP fluorescence and the Synergy HT Microplate Reader will be evaluated for sensitivity of detection (Protocol 1) and to determine if the gradient is similar to the original study (≤ 5%) (Protocol 2). Provisions for quality control: This protocol will ensure that the replicating lab’s plate reader is comparable to the original lab’s plate reader. - A lab from the Science Exchange network with extensive experience in conducting cell viability assays will perform these experiments. - All cells will be sent for STR profiling to confirm identity and mycoplasma testing to confirm lack of mycoplasma contamination. - SK-MEL-5 cells will be confirmed to have at least 85% of the cells GFP-positive before the start of experiment. **Protocol 2: Determining the detection variability of the replicating lab’s plate reader** This is a general protocol that determines the variability in detection of the plate reader. Because the plate reader in use by the replicating lab is different than the plate reader used in the original study, we are determining what the variability of detection is for the replicating lab’s plate reader. Sampling: - SK-MEL-5: - 2,000 cells/well x 384 replicates - Experiment will be done a total of once. Materials and Reagents: - Reagents that are different from ones originally used are noted with an asterisk (*)  Procedure: 1. Seed all wells of a 384-well black plate with 2,000 pLex-TRC206 SK-MEL-5 cells (provided by authors) in 60 µl per well using phenol-red free medium using an automated workstation. - Note: All cells will be sent for mycoplasma testing and STR profiling. - Note: Ensure at least 85% of SK-MEL-5 cells are GFP-positive before start of experiment. Cells can be enriched using FACS or antibiotics, however do not grow cells under antibiotic selection on a regular basis. - a. Medium for assay: phenol-red free DMEM supplemented with 1 mM sodium pyruvate, 10% FBS, and 1X Pen-Strep-Glut. - b. Fill wells with 60 µl/well of clear media in at least 2 rows and 2 columns around wells that are being included in the experiment. - The next day after seeding, read GFP fluorescence (Synergy HT Microplate Reader). - a. Subtract the average reading from media-only wells from the wells with cells. Deliverables: - Data to be collected: - Raw GFP fluorescence readings. - Difference of each individual well and the average reading across the plate. Confirmatory analysis plan: - Statistical Analysis: - Standard deviation of data values. Known differences from the original study: - Synergy HT Microplate Reader used instead of Molecular Devices SpectraMax M5e Microplate Reader – both can detect GFP fluorescence and the Synergy HT Microplate Reader will be evaluated for sensitivity of detection (Protocol 1) and to determine if the gradient is similar to the original study (≤ 5%) (Protocol 2). Provisions for quality control: This protocol will ensure that the replicating lab’s plate reader is comparable to the original lab’s plate reader. - A lab from the Science Exchange network with extensive experience in conducting cell viability assays will perform these experiments. - All cells will be sent for STR profiling to confirm identity and mycoplasma testing to confirm lack of mycoplasma contamination. - SK-MEL-5 cells will be confirmed to have at least 85% of the cells GFP-positive before the start of experiment. **Protocol 3: Co-culture proliferation assay** This protocol outlines how to culture melanoma cell lines with conditioned medium from three stromal cell lines with or without the RAF inhibitor PLX4720 to analyze cell proliferation rates, as is described in Figure 2A. Sampling: - Experiment to be repeated a total of 4 times for a minimum power of 81%. - See Power Calculations section for details - Each experiment has six conditions to be run in quadruplicate per experiment: - SK-MEL-5 untreated control [additional control] - SK-MEL-5 vehicle (DMSO) control - SK-MEL-5 treated with 2 µM PLX4720 and with unconditioned medium - SK-MEL-5 treated with 2 µM PLX4720 and with conditioned medium from CCD-1090Sk cells that do not secrete HGF - SK-MEL-5 treated with 2 µM PLX4720 and with conditioned medium from PC60163A1 cells that do secrete HGF - SK-MEL-5 treated with 2 µM PLX4720 and with conditioned medium from LL 86 cells that do secrete HGF Materials and Reagents: - Reagents that are different from ones originally used are noted with an asterisk (*)  Procedure: 1. Prepare Pre-Conditioned Medium (PCM); fresh PCM must be prepared the same day it is used in the treatment of SK-MEL-5 cells; this step is repeated three times to ensure fresh PCM is available on the needed day: - a. Three days before the PCM is needed, seed 3 x 10 cm tissue culture plates with 0.5x10e6 LL 86 cells each, 3 x 10 cm tissue culture plates with 1x10e6 PC60163A1 cells each, and 3 x 10 cm tissue culture plates with 2x10e6 CCD-1090Sk cells each (9 plates total) in 10 ml of phenol-red free medium each and grow for 3 days. - b. 3 days after seeding, collect medium from each cell line using the plate closest to 80-90% confluent. - i. 75-95% confluency can be used. - c. Filter through 0.45 µm syringe filter with a 10 ml syringe and dilute filtered PCM 1:1 in fresh phenol-red free medium. Total volume = 20 ml. - i. Use same day. - ii. Do not dilute for day 0 of treatment (these wells will already have 20 µl of media in them). - On day 0, seed 120 wells of a 384-well black plate with 1,900 pLex-TRC206 SK-MEL-5 cells in 20 µl per well using phenol-red free medium using an automated workstation. - Note: - All cells will be sent for mycoplasma testing and STR profiling. - Ensure at least 85% of SK-MEL-5 cells are GFP-positive before start of experiment. Cells can be enriched using FACS or antibiotics, however do not grow cells under antibiotic selection on a regular basis. - Do not exceed a rate of 5-10 µl/sec and do not let the tip end closer than 1mm to the well bottom. - a. Fill wells with 50 µl/well of media in at least 2 rows and 2 columns around wells that are being included in the experiment. - i. Medium for assay: phenol-red free DMEM supplemented with 1 mM sodium pyruvate, 10% FBS, and 1X Pen-Strep-Glut. - b. To wells in step a, add 20 µl of fresh undiluted PCM from appropriate stromal cells generated as described in step 1 (see Sampling section for Cohorts) or phenol-red free medium alone (Cohort 1). - On day 1 after seeding, read GFP fluorescence (Synergy HT Microplate Reader). - a. Subtract the average reading from media-only wells from the wells with cells. - After reading GFP fluorescence, refresh media and add drug using an automated workstation. - a. Change medium for each cohort to 40 µl fresh diluted PCM from appropriate stromal cell lines generated as described in step 1 or phenol-red free medium alone. - b. Within each cohort, add 10 µl of 5X PLX4720, DMSO dilution or 10 µl phenol-red free medium to each appropriate well to bring the final volume per well up to 50 µl. - i. 5X PLX4720: Make up stocks of 10mM PLX4720 in DMSO, then dilute 1:1000 in media to make up 10µM PLX4720. This is a 5X stock. - ii. DMSO dilution: Dilute 1 µl DMSO with 999 µl media. Add 10 µl of this mix to DMSO wells. - __1. These dilutions in media prevent toxicity from excess DMSO. - On day 4 after seeding, read GFP fluorescence. - a. Subtract the average reading from media-only wells from the wells with cells. - After reading GFP fluorescence, change medium in appropriate wells to 40 µl fresh diluted PCM from appropriate stromal cell lines generated as described in step 1 or phenol-red free medium alone using an automated workstation. - a. Add 10 µl of 5X PLX4720, DMSO dilution or 10 µl phenol-red free medium to each appropriate well to bring the final volume per well up to 50 µl. - i. 5X PLX4720: Make up stocks of 10 mM PLX4720 in DMSO, then dilute 1:1000 in media to make up 10 µM PLX4720. This is a 5X stock. - ii. DMSO dilution: Dilute 1 µl DMSO with 999 µl media. Add 10 µl of this mix to DMSO wells. - On day 7 after seeding, read GFP fluorescence and document bright-field and GFP images (BD, Pathway 435 Bioimager). - a. Subtract the average reading from media-only wells from the wells with cells. - Data analysis: - a. Remove background fluorescence by subtracting the average reading from media-only wells from the wells with cells for each plate reading. - b. Subtract the readings of day 1 from the other plates (day 4 and day 7) for the same wells. - c. Average the quadruplicates. - d. Calculate the effect of PLX4720 in the presence or absence of conditioned media by normalizing the number of cells after 7 days of treatment (as measured by GFP fluorescence) to the number of cells present in the SK-MEL-5 vehicle control condition. - Repeat experiment independently three additional times. Deliverables: - Data to be collected: - Raw GFP fluorescence readings from days 1, 4 and 7. - Normalized fluorescence proliferation data. - Fluorescent and bright field micrographs of cells from day 7. - Bar chart of relative proliferation as a % of untreated control for all conditions. (Use data from Day 7 - Day 1 background) (Compare to Figure 2A) - A semi-logarithmic graph of proliferation (log) vs time (linear) over 3 time points after seeding. Confirmatory Analysis Plan: - Statistical Analysis of the Replication Data: - One-way ANOVA comparing the proliferation of PLX4720-treated cells cultured with unconditioned medium, CCD-1090Sk conditioned medium, LL 86 conditioned medium, or PC60163A1 conditioned medium. - Planned comparisons with the Bonferroni correction: - unconditioned medium to PC60163A1 conditioned medium - unconditioned medium to LL 86 conditioned medium - CCD-1090Sk to PC60163A1 conditioned medium - CCD-1090Sk to LL 86 conditioned medium - Meta-analysis of original and replication attempt effect sizes: - Compare the effect sizes of the original data to the replication data and use a meta-analytic approach to combine the original and replication effects, which will be presented as a forest plot. Known differences from original study: - The replication will only use one of the three melanoma cell lines used by the original authors, the SK-MEL-5 cell line. The replication will exclude SK-MEL-28 and G-361 cells. - The replication will include an additional control, untreated SK-MEL-5 cells in addition to the vehicle (DMSO) treated SK-MEL-5 cells used in the original study. - A Synergy HT Microplate Reader will be used instead of a Molecular Devices SpectraMax M5e Microplate Reader – both can detect GFP fluorescence and the Synergy HT Microplate Reader will be evaluated for range of detection (Protocol 1) and detection variability (Protocol 2) - A BD Pathway 435 Bioimager used instead of a Zeiss Axio Observer.Z1 – both are fluorescence microscopes with high-throughput screening capabilities. - The replicating lab does not have a ViCell XR cell viability counter, and thus will seed a larger number of cells per well (1,900 instead of 1,700 cells/well). Provisions for quality control: All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/p4lzc/). - A lab from the Science Exchange network with extensive experience in conducting cell viability assays will perform these experiments. - All cells will be sent for STR profiling to confirm identity and mycoplasma testing to confirm lack of mycoplasma contamination. - SK-MEL-5 cells will be confirmed to have at least 85% of the cells GFP-positive before the start of experiment. **Protocol 4: Recombinant HGF proliferation assay** This protocol assesses changes in proliferation when melanoma cells are treated with the RAF inhibitor PLK4720 with or without HGF, as is described in Figure 2C. The cells are also treated with a MEK inhibitor, PD184352. Sampling: - Experiment to be repeated a total of 3 times for a final power of 99%. - See Power Calculations section for details - Each experiment has 12 conditions to be done in quadruplicate per experiment: - SK-MEL-5 untreated control [additional control] - SK-MEL-5 vehicle (DMSO) control - SK-MEL-5 2 µM PLX4720 + 0 ng/ml HGF - SK-MEL-5 2 µM PLX4720 + 6.25 ng/ml HGF - SK-MEL-5 2 µM PLX4720 + 12.5 ng/ml HGF - SK-MEL-5 2 µM PLX4720 + 25 ng/ml HGF - SK-MEL-5 2 µM PLX4720 + 50 ng/ml HGF - SK-MEL-5 1 µM PD184352 + 0 ng/ml HGF - SK-MEL-5 1 µM PD184352 + 6.25 ng/ml HGF - SK-MEL-5 1 µM PD184352 + 12.5 ng/ml HGF - SK-MEL-5 1 µM PD184352 + 25 ng/ml HGF - SK-MEL-5 1 µM PD184352 + 50 ng/ml HGF Materials and Reagents: - Reagents that are different from the ones originally used are noted with a *.  Procedure: 1. On day 0, seed 48 wells of a 384 well clear-bottom plate with 2,800 pLex-TRC206 SK-MEL-5 cells in 40 µl of phenol-red free medium each using an automated workstation. - Note: - All cells will be sent for mycoplasma testing and STR profiling. - Ensure at least 85% of SK-MEL-5 cells are GFP-positive before start of experiment. Cells can be enriched using FACS or antibiotics, however do not grow cells under antibiotic selection on a regular basis. - Do not exceed a rate of 5-10 µl/sec and do not let the tip end closer than 1 mm to the well bottom. - a. Fill wells with 60 µl/well of clear media in at least 2 rows and 2 columns around wells that are being included in the experiment. - b. Medium of all cell lines for assay: phenol-red free DMEM supplemented with 1 mM sodium pyruvate, 10% FBS, and 1X Pen-Strep-Glut. - On day 1 after seeding, read GFP fluorescence (Synergy HT Microplate Reader). - a. Subtract the average reading from media-only wells from the wells with cells. - After reading GFP fluorescence, add to the appropriate wells; 10 µl 6X HGF or phenol-red free medium alone. Then add to the appropriate wells the following; 10 µl 6X PLX4720, 10 µl 6X PD184352, 10 µl DMSO dilution, or 10 µl phenol-red free medium alone. - a. 6X HGF: Make up stocks of 100 ug/ml HGF, then dilute accordingly to make 6X working concentrations of each required HGF dilution. - b. 6X PLX4720: Make up stocks of 12 mM PLX4720 in DMSO, then dilute 1:1000 in media to make up 12 uM PLX4720 for use at 6X for the assay to avoid excessive DMSO toxicity. - c. 6X PD184352: Make up stocks of 6 mM PD184352 in DMSO, then dilute 1:1000 in media to make up 6 uM PD184352 for use at 6X for the assay to avoid excessive DMSO toxicity. - d. DMSO dilution: Dilute 1 µl DMSO with 999 µl media. Add 10 µl of this mix to DMSO dilution wells. a. These media dilutions are to avoid toxicity from excessive DMSO. - On day 4 after seeding, read GFP fluorescence. - a. Subtract the average reading from media-only wells from the wells with cells. - After reading GFP fluorescence, change medium in all wells to 40 µl fresh phenol-red free medium using an automated workstation. Then add to the appropriate wells; 10 µl 6X HGF or phenol-red free medium alone. Then add to the appropriate wells the following; 10 µl 6X PLX4720, 10 µl 6X PD184352, 10 µl DMSO dilution, or 10 µl phenol-red free medium alone. - a. 6X HGF: Make up stocks of 100 ug/ml HGF, then dilute accordingly to make 6X working concentrations of each required HGF dilution. - b. 6X PLX4720: Make up stocks of 12 mM PLX4720 in DMSO, then dilute 1:1000 in media to make up 12 uM PLX4720 for use at 6X for the assay to avoid excessive DMSO toxicity. - c. 6X PD184352: Make up stocks of 6 mM PD184352 in DMSO, then dilute 1:1000 in media to make up 6 uM PD184352 for use at 6X for the assay to avoid excessive DMSO toxicity. - d. DMSO dilution: Dilute 1 µl DMSO with 999 µl media. Add 10 µl of this mix to DMSO dilution wells. - a. These media dilutions are to avoid toxicity from excessive DMSO. - On day 7 after seeding, read GFP fluorescence and document bright-field and GFP images (BD, Pathway 435 Bioimager). - a. Subtract the average reading from media-only wells from the wells with cells. - Data analysis: - a. Remove background fluorescence by subtracting the average reading from media-only wells from the wells with cells for each plate reading. - b. Subtract the readings of day 1 from the other plates (day 4 and day 7) for the same wells. - c. Average the quadruplicates. - d. Calculate the effect of PLX4720 and PD184352 in the presence or absence of HGF by normalizing the number of cells after 7 days of treatment (as measured by GFP fluorescence) to the number of cells present in the SK-MEL-5 vehicle control condition. - Repeat experiment independently two additional times. Deliverables: - Data to be collected: - Raw GFP fluorescence readings from days 1, 4 and 7. - Normalized fluorescence proliferation data. - Fluorescent and bright field micrographs of cells from day 7. - Bar chart of relative proliferation as a % of untreated control for all conditions. (Use data from Day 7 - Day 1 background) (Compare to Figure 2C) - A semi-logarithmic graph of proliferation (log) vs time (linear) over 3 time points after seeding. Confirmatory Analysis Plan: - Statistical Analysis: - Compare the proliferation rate of PLX4720 treated cells treated with 0, 6.25, 12.5, 25, or 50 ng/ml HGF. Also compare each HGF cohort to the proliferation rate of vehicle treated and untreated cells. - One-way ANOVA - Compare the proliferation rate of PD184352 treated cells treated with 0, 6.25, 12.5, 25, or 50 ng/ml HGF. Also compare each HGF cohort to the proliferation rate of vehicle treated and untreated cells. - One-way ANOVA - Meta-analysis of original and replication attempt effect sizes: - Compare the effect sizes of the original data to the replication data use a meta-analytic approach to combine the original and replication effects, which will be presented as a forest plot. Known differences from original study: - The replication will only use one of the three melanoma cell lines used by the original authors, the SK-MEL-5 cell line. The replication will exclude SK-MEL-28 and G-361 cells. - The replication will include an additional control, untreated SK-MEL-5 cells in addition to the vehicle (DMSO) treated SK-MEL-5 cells used in the original study. - A Synergy HT Microplate Reader used instead of a Molecular Devices SpectraMax M5e Microplate Reader – both can detect GFP fluorescence and the Synergy HT Microplate Reader will be evaluated for range of detection (Protocol 1) and detection variability (Protocol 2) - A BD Pathway 435 Bioimager used instead of a Zeiss Axio Observer.Z1 – both are fluorescence microscopes with high-throughput screening capabilities. - The replicating lab does not have a ViCell XR cell viability counter, and thus will seed a larger number of cells per well (2,800 instead of 2,500 cells/well). Provisions for quality control: All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/p4lzc/). - A lab from the Science Exchange network with extensive experience in conducting cell viability assays will perform these experiments. - All cells will be sent for STR profiling to confirm identity and mycoplasma testing to confirm lack of mycoplasma contamination. - SK-MEL-5 cells will be confirmed to have at least 85% of the cells GFP-positive before the start of experiment. **Protocol 5: Inhibitor proliferation assay** This experiment confirms that the rescue from drug sensitivity is due to HGF signaling by co-treating cells with crizotinib, an inhibitor of MET, the receptor tyrosine kinase for HGF, as seen in Figure 2D and Supplemental Figure 11. Sampling: - Run the experiment six times in total for a minimum power of 80%. - See Power Calculations section for details - Each experiment has 10 cohorts: - Each cohort consists of - SK-MEL-5 cells alone - SK-MEL-5 co-cultured with LL86 cells - SK-MEL-5 co-cultured with CCD-1090Sk cells - __Each condition will be run in quadruplicate. - The cohorts are treated with the following drugs: - Cohort 1: no drug treatment [additional control] - Cohort 2: Treated with vehicle (DMSO) control - Cohort 3: Treated with 0.2 µM crizotinib and vehicle - Cohort 4: Treated with 0.2 µM PHA-665752 and vehicle [additional control] - Cohort 5: Treated with 2 µM PLX4720 and vehicle - Cohort 6: Treated with 2 µM PLX4720 and 0.2 µM crizotinib - Cohort 7: Treated with 2 µM PLX4720 and 0.2 µM PHA-665752 [additional] - Cohort 8: Treated with 1 µM PD184352 and vehicle - Cohort 9: Treated with 1 µM PD184352 and 0.2 µM crizotinib - Cohort 10: Treated with 1 µM PD184352 and 0.2 µM PHA-665752 [additional control] Materials and Reagents: - Reagents that are different from ones originally used are noted with an asterisk (*)  Procedure: 1. On day 0, seed 40 wells of a 384 well clear-bottom plate with 1,900 LL86 stromal cells in 20 µl phenol-red free media, seed 40 wells with 1,900 CCD-1090Sk stromal cells in 20 µl media, and seed 40 wells with phenol-red free medium alone using an automated workstation. - Note: - All cells will be sent for mycoplasma testing and STR profiling. - Ensure at least 85% of SK-MEL-5 cells are GFP-positive before start of experiment. Cells can be enriched using FACS or antibiotics, however do not grow cells under antibiotic selection on a regular basis. - Do not exceed a rate of 5-10 µl/sec and do not let the tip end closer than 1 mm to the well bottom - a. Total wells seeded: 120 - b. Fill wells with 60 µl/well of clear media in at least 2 rows and 2 columns around wells that are being included in the experiment. - c. Medium of all cell lines for assay: phenol-red free DMEM supplemented with 1 mM sodium pyruvate, 10% FBS, and 1X Pen-Strep-Glut. - In wells from Step 1, seed 1,900 pLex-TRC206 SK-MEL-5 cells in 20 µl phenol-red free medium per well using an automated workstation. - On day 1 after seeding, read GFP fluorescence (Synergy HT Microplate Reader). a. Subtract the average reading from media-only wells from the wells with cells. - Add appropriate drugs to each well (final volume = 60 µl). - a. Formulation of drug stock solutions: - i. 6X PLX4720: Make up stocks of 12 mM PLX4720 in DMSO, then dilute 1:1000 in media to make up 12 µM PLX4720 for use at 6X for the assay to avoid excessive DMSO toxicity. - ii. 6X PD184352: Make up stocks of 6 mM PD184352 in DMSO, then dilute 1:1000 in media to make up 6 µM PD184352 for use at 6X for the assay to avoid excessive DMSO toxicity. - iii. 6X crizotinib: Make up stocks of 1.2 mM crizotinib in DMSO, then dilute 1:1000 in media to make up 1.2 µM PD184352 for use at 6X for the assay to avoid excessive DMSO toxicity. - iv. 6X PHA-665752: Make up stocks of 1.2 mM PHA-665752 in DMSO, then dilute 1:1000 in media to make up 1.2 µM PD184352 for use at 6X for the assay to avoid excessive DMSO toxicity. - v. DMSO dilution: Dilute DMSO 1:1000 in medium to avoid excessive DMSO toxicity. - b. Cohort 1: Add 20 µl phenol-red free medium - c. Cohort 2: Add 10 µl DMSO dilution and 10 µl medium - d. Cohort 3: Add 10 µl 6X crizotinib and 10 µl medium - e. Cohort 4: Add 10 µl 6X PHA-665752 and 10 µl medium - f. Cohort 5: Add 10 µl 6X PLX4720 and 10 µl medium - g. Cohort 6: Add 10 µl 6X PLX4720 and 10 µl 6X crizotinib - h. Cohort 7: Add 10 µl 6X PLX4720 and 10 µl 6X PHA-665752 - i. Cohort 8: Add 10 µl 6X PD184352 and 10 µl medium - j. Cohort 9: Add 10 µl 6X PD184352 and 10 µl 6X crizotinib - k. Cohort 10: Add 10 µl 6X PD184352 and 10 µl 6X PHA-665752 - On day 4 after seeding, read GFP fluorescence. - a. Subtract the average reading from media-only wells from the wells with cells. - Change medium in relevant wells to 40 µl fresh media, then add appropriate drugs as per Step 4 using an automated workstation. - On day 7 after seeding, read GFP fluorescence and document bright-field and GFP images (BD, Pathway 435 Bioimager). - a. Subtract the average reading from media-only wells from the wells with cells. - Data analysis: - a. Remove background fluorescence by subtracting the average reading from media-only wells from the wells with cells for each plate reading. - b. Subtract the readings of day 1 from the other plates (day 4 and day 7) for the same wells. - c. Average the quadruplicates. - d. Calculate the effect of PLX4720, PD184352, Crizotinib, PHA-665752, PLX4720 + Crizotinib, PLX4720 + PHA665752, PD184352 + Crizotinib, PD184352 + PHA665752, DMSO, or untreated in the presence or absence of stromal cells by normalizing the number of cells after 7 days of treatment (as measured by GFP fluoresence) to the number of cells present in the vehicle control treated SK-MEL-5 cells alone condition. - Repeat experiment independently five additional times. Deliverables - Data to be collected: - Raw GFP fluorescence readings from days 1, 4 and 7. - Normalized fluorescence proliferation data. - Fluorescent and bright field micrographs of cells from day 7. - Bar chart of relative proliferation as a % of untreated control for all conditions. (Use data from Day 7 - Day 1 background) (Compare to Figure SF11) - A semi-logarithmic graph of proliferation (log) vs time (linear) over 3 time points after seeding. Confirmatory analysis plan: - Statistical Analysis of replication data: - Three-way ANOVA comparing the proliferation of vehicle-treated, PLX4720-treated, or PD184352-treated cells also treated with vehicle, crizotinib, or PHA-665752 cultured with or without stromal cells followed by: - Two-way ANOVA comparing the proliferation of vehicle-treated cells treated with vehicle, crizotinib, or PHA-665752 cultured with or without stromal cells. - Two-way ANOVA comparing the proliferation of PLX4720-treated cells treated with vehicle, crizotinib, or PHA-665752 cultured with or without stromal cells. - Planned comparisons with the Bonferroni correction: - Vehicle-treated LL 86 cells compared to vehicle-treated no stromal cells - Vehicle-treated LL 86 cells compared to vehicle-treated CCD-1090Sk cells - Vehicle-treated LL 86 cells compared to crizotinib-treated LL 86 cells - Vehicle-treated LL 86 cells compared to PHA-665752-treated LL 86 cells - Two-way ANOVA comparing the proliferation of PD184352-treated cells treated with vehicle, crizotinib, or PHA-665752 cultured with or without stromal cells. - Planned comparisons with the Bonferroni correction: -__Vehicle-treated LL 86 cells compared to crizotinib-treated LL 86 cells -__Vehicle-treated LL 86 cells compared to PHA-665752-treated LL 86 cells - Meta-analysis of original and replication attempt effect sizes: - Compare the effect sizes of the original data to the replication data use a meta-analytic approach to combine the original and replication effects, which will be presented as a forest plot. Known differences from original study: - Supplemental Figure 11 tests co-culture of SK-MEL-5 cells with 9 stromal cell lines. We have chosen LL86 cells, which showed the largest rescue of proliferation, and CCD-1090Sk cells, which showed the least rescue. - Additional controls added by the replication team: - Treatment with PHA-665752 - In addition to inhibiting MET, crizotinib also targets ALK, ROS1 and RON. In order to confirm that the effects of crizotinib are due to targeting of MET, we will also use a more selective MET inhibitor, PHA-665752 (Cui, 2014; Parikh et al., 2014). - The replication will include an additional control, untreated SK-MEL-5 cells in addition to the vehicle (DMSO) treated SK-MEL-5 cells used in the original study. - A Synergy HT Microplate Reader used instead of a Molecular Devices SpectraMax M5e Microplate Reader - Both can detect GFP fluorescence and the Synergy HT Microplate Reader will be evaluated for range of detection (Protocol 1) and detection variability (Protocol 2) - A BD Pathway 435 Bioimager used instead of a Zeiss Axio Observer.Z1 - Both are fluorescence microscopes with high-throughput screening capabilities. - The replicating lab does not have a ViCell XR cell viability counter, and thus will seed a larger number of cells per well (1,900 instead of 1,700 cells/well). Provisions for quality control: All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/p4lzc/). - A lab from the Science Exchange network with extensive experience in conducting cell viability assays will perform these experiments. - All cells will be sent for STR profiling to confirm identity and mycoplasma testing to confirm lack of mycoplasma contamination. - SK-MEL-5 cells will be confirmed to have at least 85% of the cells GFP-positive before the start of experiment. **Protocol 6: Inhibitor western blot assay of ERK and AKT signaling** This experiment assesses the protein levels of various activated downstream pathway signaling component proteins in the presence or absence of HGF and drugs, as seen in Figure 4C and Supplemental Figure 19. Sampling: - Repeat the experiment six times in total for a minimum power of 85%. - See Power Calculations section for details - Each experiment contains seven conditions: - SK-MEL-5 cells treated with: - untreated [additional control] - vehicle (DMSO) control - 2 µM PD184352 - 2 µM PLX4720 - 25 ng/ml HGF + vehicle - 25 ng/ml HGF + 2µM PD184352 - 25 ng/ml HGF + 2µM PLX4720 Materials and Reagents: - Reagents that are different from ones originally used are noted with an asterisk (*)   Procedure: 1. On day 0, plate 5x10e5 pLex-TRC206 SK-MEL-5 cells in 2 ml media per well for a total of 7 wells across 2 x 6-well plates. - Note: - All cells will be sent for mycoplasma testing and STR profiling. - Ensure at least 85% of SK-MEL-5 cells are GFP-positive before start of experiment. Cells can be enriched using FACS or antibiotics, however do not grow cells under antibiotic selection on a regular basis. - a. Medium of all cell lines for assay: DMEM supplemented with 10% FBS and 1X Pen-Strep. - On day 1 add the appropriate additives to each well. - a. Formulation of stock solutions: Note: These dilutions are to avoid toxicity from excessive DMSO. - i. 1000X HGF: Make a stock of 25 µg/ml HGF. - ii. 1000X PLX4720: Make a stock of 20 mM PLX4720 in DMSO, then dilute 1:10 in media to make a 2 mM PLX4720 working solution. - iii. 1000X PD184352: Make a stock of 20 mM PD184352 in DMSO, then dilute 1:10 in media to make a 2 mM working solution. - iv. DMSO dilution: Dilute DMSO 1:10 in medium. - b. For media only: add 2 µl media - c. For DMSO: Add 2 µl DMSO dilution - d. For 2 µM PD184352: Add 2 µl 1000X PD184352 - e. For 2 µM PLX4720: Add 2 µl 1000X PLX4720 - f. For 25 ng/ml HGF + DMSO: Add 2 µl 1000X HGF and 2 µl DMSO dilution - g. For 25 ng/ml HGF + 2 µM PD184352: Add 2 µl 1000X HGF and 2 µl 100X PD184352 - h. For 25 ng/ml HGF + 2 µM PLX4720: Add 2 µl 1000X HGF and 2 µl 100X PLX4720. - 24 hr after drug treatment, prepare cells for lysis. - a. Quickly wash cells with ice-cold PBS and remove excess PBS. - b. Add 0.5 ml or less of ice-cold lysis buffer to wells on ice. - i. Lysis Buffer: 50 mM Tris pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP-40, 1mg/ml NaF and one pellet per 10 ml each of PhosSTOP Phosphatase Inhibitor and Complete Mini Protease Inhibitor. - c. Scrape cells off dish with cell scraper. - d. Collect cells in a 1.5 ml centrifuge tube on ice. - e. Incubate on ice for 30 min with periodic vortexing. - f. Spin down at 4˚C and remove supernatant into separate tube. - Determine protein concentration by using the DC Protein Assay Kit II following manufacturer’s instructions. - Mix 50 µg total cell lysate with NuPAGE Sample Reducing Agent and run on two 4-12% Bis-Tris gels with a protein molecular weight marker at 120 V. - Transfer onto membrane using replicating lab’s transfer protocol. - After the transfer, stain the membrane with Ponceau to visualize transferred protein. Image membrane, then wash out the Ponceau stain. [additional quality control step] - Wet membrane with PBS for 5 min, then block membranes in Odyssey blocking buffer (LI-COR, 927-40000) following manufacturer’s instructions. - Probe membrane with the following primary antibodies diluted in Odyssey blocking buffer at 4°C with gentle shaking, overnight. - a. mouse anti-c-Met (Cell Signaling, 3148); 1:1000; 145kDa - b. rabbit anti-pMet Tyr 1349 (Cell Signaling, 3133); 1:1000; 145kDa - c. mouse anti-AKT (Cell Signaling, 2920); 1:2000; 60kDa - d. rabbit anti-pAKT (Cell Signaling, 4060); 1:2000; 60kDa - e. mouse anti-MEK (Cell Signaling, 4694); 1:1000; 45kDa - f. rabbit anti-pMEK (Cell Signaling, 9154); 1:1000; 45kDa - g. mouse anti-ERK (Santa Cruz, 135900); 1:200; 44,42kDa - h. rabbit anti-pERK (Cell Signaling, 4370); 1:2000; 44,42kDa - i. rabbit anti-GAPDH (Cell Signaling, 2118); 1:1000; 37kDa - i. Loading control - j. Note: multiple gels will need to be run to probe for this many proteins. Do not strip between probing with different phospho antibodies, just wash membrane well (4 x 10 min PBS-T) and then add next antibody. Suggest grouping as follows: - i. Gel 1: Probe pAKT [rabbit 60kDa], then pMEK [rabbit 45kDa], then AKT [mouse 60kDa], then MEK [mouse 45kDa], then GAPDH [rabbit 37kDa]. - ii. Gel 2: Probe pMet Tyr 1349 [rabbit 145kDa], then pERK [rabbit 44,42kDa], then c-Met [mouse 145kDa], then ERK [mouse 44,42kDa], then GAPDH [rabbit 37kDa]. - Wash membranes in PBS + 0.1% Tween 20 4 x 5 min. - Detect primary antibodies with anti-rabbit or anti-mouse IRDye secondary antibodies (LICOR) diluted in Odyssey blocking buffer for 30-60 min protected from light following manufacturer’s instructions. - Wash membranes in PBS + 0.1% Tween 20 4 x 5 min. - Rinse membrane with PBS to remove residual Tween 20. - Detect near infrared fluoresence with the Odyssey Infrared Imaging System. - Quantify signal intensity with Odyssey Application Software. - a. For each antibody subtract background intensity from values and then divide by the GAPDH loading control. - b. Calculate the effect of PLX4720, PD184352, or vehicle in the presence or absence of HGF by normalizing the band intensities (after background and loading correction) to the band intensity of the SK-MEL-5 vehicle control condition. - Repeat experiment independently five additional times. Deliverables: - Data to be collected: - Odyssey images of probed membranes (full images with ladder) - Raw and quantifed signal intensities normalized for GAPDH loading and total pan-protein levels. - Bar graphs of normalized mean signal intensities (Compare to Figure S19) Confirmatory Analysis plan: - Statistical Analysis of replication data: - Two-way ANOVA comparing the relative phopho-AKT band intensities of cells treated with vehicle, PLX4720, or PD184352 in the presence or absence of HGF. - Planned comparisons with the Bonferroni correction: - PLX4720-treated cells in the absence of HGF compared to PLX4720-treated cells in the presence of HGF - Two-way ANOVA comparing the relative phopho-ERK band intensities of cells treated with vehicle, PLX4720, or PD184352 in the presence or absence of HGF. - Planned comparisons with the Bonferroni correction: - PLX4720-treated cells in the absence of HGF compared to PLX4720-treated cells in the presence of HGF - Two-way ANOVA comparing the relative phopho-MET (Tyr1349) band intensities of cells treated with vehicle, PLX4720, or PD184352 in the presence or absence of HGF. - Planned comparisons with the Bonferroni correction: - Cells treated in the absence of HGF and treated with vehicle, PLX4720, or PD184352 compared to cells treated in the presence of HGF and treated with vehicle, PLX4720, or PD184352 - Meta-analysis of original and replication attempt effect sizes: - Compare the effect sizes of the original data to the replication data and use a meta-analytic approach to combine the original and replication effects, which will be presented as a forest plot. Known differences from original study: - Provider lab transfer protocol used instead of iBlot Gel Transfer Device (Invitrogen, IB1001) using Program 4 – both are capable of transferring protein efficiently, and to determine completeness of the transfer, the gel may be stained (Step 8). - The replication will include an additional control, untreated SK-MEL-5 cells in addition to the vehicle (DMSO) treated SK-MEL-5 cells used in the original study. - The replication will not include the pMet Tyr1234/5, RAF1, and pRAF1 antibodies included in the original study. Provisions for quality control: All data obtained from the experiment - raw data, data analysis, control data and quality control data - will be made publicly available, either in the published manuscript or as an open access dataset available on the Open Science Framework (https://osf.io/p4lzc/). - A lab from the Science Exchange network with extensive experience in conducting cell viability assays and performing Western blots will perform these experiments. - All cells will be sent for STR profiling to confirm identity and mycoplasma testing to confirm lack of mycoplasma contamination. - SK-MEL-5 cells will be confirmed to have at least 85% of the cells GFP-positive before the start of experiment. ### Power Calculations All calculations are determined in order to reach at least 80% power. **Protocol 1** No power calculations required. **Protocol 2** No power calculations required. **Protocol 3** Summary of original data: Note: Original data values were shared by authors.  - Standard deviation was calculated using formula SD = SEM*(SQRT n) Test family - ANOVA: Fixed effects, omnibus, one-way, alpha error = 0.05 - Power calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). - ANOVA F statistic calculated with Graphpad Prism 6.0 - Partial η2 calculated from (Lakens, 2013) Power calculations for replication:  Test family - two tailed t-test; difference between two independent means, Bonferroni’s correction: alpha error = 0.0125. - Calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). Power Calculations for replication:  **Protocol 4** Summary of original data: Note: Original data values were shared by authors.  Test family: - ANOVA: Fixed effects, omnibus, one way, alpha error = 0.05 - Power calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). - ANOVA F statistic calculated with Graphpad Prism 6.0 - Partial η2 calculated from (Lakens, 2013)  Summary of original data: Note: Original data values were shared by authors.  Test family: - ANOVA: Fixed effects, omnibus, one way, alpha error = 0.05 - Power calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). - ANOVA F statistic calculated with Graphpad Prism 6.0 - Partial η2 calculated from (Lakens, 2013) Power Calculations for replication:  **Protocol 5** Summary of original data: Note: numbers were shared by original authors.  Test family: - 3-way ANOVA Between subjects: Fixed effects, special, main effects and interactions, alpha error = 0.05 - Power calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). - ANOVA F statistic calculated with R software 3.1.1 (R Core Team, 2014) - Partial η2 calculated from (Lakens, 2013) Power Calculations for replication:  Test family: - 2-way ANOVA Between subjects: Fixed effects, special, main effects and interactions, alpha error = 0.05 - Power calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). - ANOVA F statistic calculated with Graphpad Prism 6.0 - Partial η2 calculated from (Lakens, 2013) Power Calculations for replication (BRAF/MEK inhibitor):  Test family: - two tailed *t*-test; difference between two independent means, Bonferroni’s correction: alpha error = 0.0125. - Power calculations were performed for effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). Power Calculations for replication (PLX4720 group):  Test family: - two tailed *t*-test; difference between two independent means, Bonferroni’s correction: alpha error = 0.025. - Power calculations were performed for effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). Power Calculations for replication (PD184352 group):  **Protocol 6** Summary of original data: Note: numbers were estimated from bar chart in Supplemental Figure S19.  Test family: - 2-way ANOVA Between subjects: Fixed effects, special, main effects and interactions, alpha error = 0.05 - Power calculations were performed from effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). - ANOVA F statistic calculated with Graphpad Prism 6.0 - Partial η2 calculated from (Lakens, 2013) Power Calculations for replication:  Test family - two tailed *t*-test; difference between two independent means, Bonferroni’s correction: alpha error = 0.05. - Note: Calculations were performed for effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). Power calculations for replication (pAKT group):  Note: HGF/PD184352 compared to vehicle/PD184352 is not included as the number of needed samples is too large Test family - two tailed *t*-test; difference between two independent means, Bonferroni’s correction: alpha error = 0.05. - Note: Calculations were performed for effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). Power calculations for replication (pERK group):  Note: HGF/PD184352 compared to vehicle/PD184352 is not included as the number of needed samples is too large. Test family - two tailed *t*-test; difference between two independent means, Bonferroni’s correction: alpha error = 0.05. - Note: Calculations were performed for effects reported in original study using G*Power software (version 3.1.7) (Faul et al., 2007). Power calculations for replication (pMET(Tyr1349) group):  ### Acknowledgements The Reproducibility Project: Cancer Biology core team would like to thank the original authors, in particular Ravid Straussman and Michal Barzily-Rokni, for generously sharing critical information and reagents to ensure the fidelity and quality of this replication attempt. We would also like to thank the following companies for generously donating reagents to the Reproducbility Project: Cancer Biology; BioLegend, Charles River Laboratories, Corning Incorporated, DDC Medical, EMD Millipore, Harlan Laboratories, LI-COR Biosciences, Mirus Bio, Novus Biologicals, and Sigma-Aldrich. ### References 1. Caenepeel, S, Cajulis, E, Kendall, R, Coxon, A, and Hughes, P. Targeting HGF-mediated resistance to vemurafenib in V600E BRAF mutant melanoma cell lines. In: *Proceedings of the 104th Annual Meeting of the American Association for Cancer Research*, Washington, DC. 2013. Cancer Res 73: Abstract. doi: 10.1158/1538-7445.AM2013-3405. - Casbas-Hernandez, P, Arcy, MD, Roman-Perez, E, Brauer, HA, McNaughton, K, Miller, SM, Chhetri, RK, Oldenburg, AL, Fleming, JM, Amos, KD, Makowski, L, and Troester, MA. 2013. Role of HGF in epithelial-stromal cell interactions during progression from benign breast disease to ductal carcinoma in situ. *Breast Cancer Research* 15:R82. doi: 10.1186/bcr3476. - Cui, JJ. 2014. Targeting Receptor Tyrosine Kinase MET in Cancer: Small Molecule Inhibitors and Clinical Progress. *J. Med. Chem*. 57:4427-53. doi: 10.1021/jm401427c. - Faul, F, Erdfelder, E, Lang, AG, and Buchner, A. 2007. G* Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. *Behavior research methods* 39:175-91. - Lezcano, C, Lee, C-W, Larson, AR, Menzies, AM, Kefford, RF, Thompson, JF, Mihm, MC, Ogino, S, Long, GV, Scolyer, RA, and Murphy, GF. 2014. Evaluation of stromal HGF immunoreactivity as a biomarker for melanoma response to RAF inhibitors. 1-10. doi: 10.1038/modpathol.2013.226. - Nakagawa, T, Matsushima, T, Kawano, S, Nakazawa, Y, Kato, Y, Adachi, Y, Abe, T, Semba, T, Yokoi, A, Matsui, J, Tsuruoka, A, and Funahashi, Y. 2014. Lenvatinib in combination with golvatinib overcomes hepatocyte growth factor pathway-induced resistance to vascular endothelial growth factor receptor inhibitor. *Cancer Sci* 105:723-30. doi: 10.1111/cas.12409. - Nickoloff, BJ, and Vande Woude, G. 2012. Hepatocyte growth factor in the neighborhood reverses resistance to BRAF inhibitor in melanoma. *Pigment Cell Melanoma Res* 25:758-61. doi: 10.1111/pcmr.12020. - Parikh, R, Wang, P, Beumer, J, Chu, E, and Appleman, L. 2014. The potential roles of hepatocyte growth factor (HGF)-MET pathway inhibitors in cancer treatment. OTT 969. doi: 10.2147/OTT.S40241. - Penuel, E, Li, C, Parab, V, Burton, L, Cowan, KJ, Merchant, M, Yauch, RL, Patel, P, Peterson, A, Hampton, GM, Lackner, MR, and Hegde, PS. 2013. HGF as a Circulating Biomarker of Onartuzumab Treatment in Patients with Advanced Solid Tumors. *Molecular Cancer Therapeutics* 12:1122-30. doi: 10.1158/1535-7163.MCT-13-0015. - Straussman, R, Morikawa, T, Shee, K, Barzily-Rokni, M, Qian, ZR, Du, J, Davis, A, Mongare, MM, Gould, J, Frederick, DT, Cooper, ZA, Chapman, PB, Solit, DB, Ribas, A, Lo, RS, Flaherty, KT, Ogino, S, Wargo, JA, and Golub, TR. 2012. Tumour micro-environment elicits innate resistance to RAF inhibitors through HGF secretion. *Nature* 487:500-04. doi: 10.1038/nature11183. - Wilson, TR, Fridlyand, J, Yan, Y, Penuel, E, Burton, L, Chan, E, Peng, J, Lin, E, Wang, Y, Sosman, J, Ribas, A, Li, J, Moffat, J, Sutherlin, DP, Koeppen, H, Merchant, M, Neve, R, and Settleman, J. 2012. Widespread potential for growth-factor-driven resistance to anticancer kinase inhibitors. *Nature* 487:505-09. doi: 10.1038/nature11249. - Xie, Q, Su, Y, Dykema, K, Johnson, J, Koeman, J, De Giorgi, V, Huang, A, Schlegel, R, Essenburg, C, Kang, L, Iwaya, K, Seki, S, Khoo, SK, Zhang, B, Buonaguro, F, Marincola, FM, Furge, K, Vande Woude, GF, and Shinomiya, N. 2013. Overexpression of HGF Promotes HBV-Induced Hepatocellular Carcinoma Progression and Is an Effective Indicator for Met-Targeting Therapy. *Genes &amp; Cancer* 4:247-60. doi: 10.1177/1947601913501075. ### Author Information † The RP:CB core team consists of Elizabeth Iorns (Science Exchange, Palo Alto, California), William Gunn (Mendeley, London, United Kingdom), Fraser Tan (Science Exchange, Palo Alto, California), Joelle Lomax (Science Exchange, Palo Alto, California), and Timothy Errington (Center for Open Science, Charlottesville, Virginia). David Blum, Bioexpression and Fermentation Facility, University of Georgia, Athens, Georgia Samuel LaBarge, City of Hope, Duarte, California Correspondence to Fraser Tan, fraser@scienceexchange.com. Competing Interests: We disclose that EI, FT, and JL are employed by and hold shares in Science Exchange Inc. The experiments presented in this manuscript will be conducted by EG at the Monoclonal Antibody Core Facility, which is a Science Exchange lab. No other authors disclose conflicts of interest related to this manuscript. Funding: The Reproducibility Project: Cancer Biology is funded by the Laura and John Arnold Foundation, provided to the Center for Open Science in collaboration with Science Exchange. The funder had no role in study design or the decision to submit the work for publication.