To see the other types of publications on this topic, follow the link: Alga.
Journal articles on the topic 'Alga'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Alga.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Jain, Sumita, and Dennis E. Ohman. "Deletion of algK in Mucoid Pseudomonas aeruginosa Blocks Alginate Polymer Formation and Results in Uronic Acid Secretion." Journal of Bacteriology 180, no. 3 (February 1, 1998): 634–41. http://dx.doi.org/10.1128/jb.180.3.634-641.1998.
Full textAbstract:
ABSTRACT Chronic pulmonary infection with Pseudomonas aeruginosais a common and serious problem in patients with cystic fibrosis (CF). The P. aeruginosa isolates from these patients typically have a mucoid colony morphology due to overproduction of the exopolysaccharide alginate, which contributes to the persistence of the organisms in the CF lung. Most of the alginate biosynthetic genes are clustered in the algD operon, located at 34 min on the chromosome. Alginate biosynthesis begins with the formation of an activated monomer, GDP-mannuronate, which is known to occur via the products of the algA, algC, andalgD genes. Polymannuronate forms in the periplasm, but the gene products involved in mannuronate translocation across the inner membrane and its polymerization are not known. One locus of the operon which remained uncharacterized was a new gene called algKbetween alg44 and algE. We sequencedalgK from the mucoid CF isolate FRD1 and expressed it inEscherichia coli, which revealed a polypeptide of the predicted size (52 kDa). The sequence of AlgK showed an apparent signal peptide characteristic of a lipoprotein. AlgK-PhoA fusion proteins were constructed and shown to be active, indicating that AlgK has a periplasmic subcellular localization. To test the phenotype of an AlgK− mutant, the algK coding sequence was replaced with a nonpolar gentamicin resistance cassette to avoid polar effects on genes downstream of algK that are essential for polymer formation. The algKΔ mutant was nonmucoid, demonstrating that AlgK was required for alginate production. Also, AlgK− mutants demonstrated a small-colony phenotype on L agar, suggesting that the loss of AlgK also caused a growth defect. The mutant phenotypes were complemented by a plasmid expressingalgK in trans. When the algKΔ mutation was placed in an algJ::Tn501background, where algA was not expressed due to polar transposon effects, the growth defect was not observed. AlgK− mutants appeared to accumulate a toxic extracellular product, and we hypothesized that this could be an unpolymerized alginate precursor. High levels of low-molecular-weight uronic acid were produced by the AlgK− mutant. When AlgK−culture supernatants were subjected to dialysis, high levels of uronic acids diffused out of the dialysis sac, and no uronic acids were detectable after extensive dialysis. In contrast, the mucoid wild-type strain produced only polymerized uronic acids (i.e., alginate), whereas the algKΔ algJ::Tn501 mutant produced no uronic acids. Thus, the alginate pathway in an AlgK− mutant was blocked after transport but at a step before polymerization, suggesting that AlgK plays an important role in the polymerization of mannuronate to alginate.
2
Reiter, Michael A. "Development of Benthic Algal Assemblages Subjected to Differing Near-Substrate Hydrodynamic Regimes." Canadian Journal of Fisheries and Aquatic Sciences 46, no. 8 (August 1, 1989): 1375–82. http://dx.doi.org/10.1139/f89-176.
Full textAbstract:
Recent research concerning benthic algae in streams suggests that the near-substrate hydrodynamic regime may affect the composition of benthic algal assemblages. Algae from local streams were allowed to colonize laboratory flumes containing substrates of different sizes under two velocity regimes to determine whether benthic algal assemblages were affected by substrate size or hydrodynamics. While all hydrodynamic parameters except for local velocity diverged among flumes with different substrate sizes, cell counts per unit area of substrate and the relative proportions of different forms of algae remained similar overall. Much of the similarity appears to be attributable to the dominant filamentous algae. "Blooms" of one or two species were detected on occasion, but did not affect overall similarity (though they may affect local recolonization). The results, if extrapolated, suggest that hydrodynamic conditions alone may not be responsible for the variation in algal assemblages seen in the field, and that the morphological form of the alga may be more important than the species of alga when determining its response to hydrodynamic conditions.
3
Rico Taareluan, Rico, Letha L. Wantania, Elvy L. Ginting, Remy E. P. Mangindaan, Deislie R. H. Kumampung, Reni Lusia Kreckhoff, and Stnly Wullur. "AMPLIFIKASI GEN 16S-rRNA BAKTERI EPIFIT PADA ALGA MERAH Kappaphycus alvarezii." JURNAL PESISIR DAN LAUT TROPIS 8, no. 1 (January 15, 2020): 116. http://dx.doi.org/10.35800/jplt.8.1.2020.27696.
Full textAbstract:
Bacteria are microscopic organism found living in marine algae. So far, species of bacteria in marine algae are not well known. In this study, epiphytic bacteria in algal species of Kappaphycus alvarezii (red algae) were isolated to amplify their 16S-rRNA gene. Sample K.alvarezii was collected from the island of Nain. The isolated epiphytic bacteria from the red algae K.alvarezii were grown in Nutrient Broth (NB) media. DNA extraction was carried out using InnuPREP DNA Mini Kit. 16SrRNA genes was performed using primer pair of 8F and 1492R. Two different character of epiphytic bacteria were successfully isolated from K. alvarezii. 16S-rRNA genes from the two isolates was successfully amplified, indicated by the presence of DNA band in each sample gel electrophoreses at around 1500 bp.Keywords : Amplification, 16S-rRNA Genes, Kappapchycus alvarezii, Bacterial, Epiphytic Abstrak Bakteri adalah organisme mikroskopis yang ditemukan hidup di alga laut. Sejauh ini, spesies bakteri di alga laut belum dikenal. Dalam penelitian ini, bakteri epifit pada spesies alga Kappaphycus alvarezii (alga merah) diisolasi untuk memperkuat gen 16S-rRNA mereka. Sampel K.alvarezii dikumpulkan dari pulau Nain. Bakteri epifit terisolasi dari alga merah K.alvarezii ditanam dalam media Nutrient Broth (NB). Ekstraksi DNA dilakukan dengan menggunakan InnuPREP DNA Mini Kit. Gen 16S-rRNA dilakukan dengan menggunakan pasangan primer 8F dan 1492R. Dua karakter bakteri epifit yang berbeda berhasil diisolasi dari K. alvarezii. Gen 16S-rRNA dari dua isolat berhasil diamplifikasi, ditunjukkan oleh adanya pita DNA pada setiap sampel gel elektroforesis sekitar 1500 bp. Kata Kunci: Amplifikasi, gen 16S-rRNA, Kappapycus alvarezii, Bakteri, Epifit
4
Lin, Rui, and G. Patrick Ritz. "Reflectance FT-IR Microspectroscopy of Fossil Algae Contained in Organic-Rich Shales." Applied Spectroscopy 47, no. 3 (March 1993): 265–71. http://dx.doi.org/10.1366/0003702934066794.
Full textAbstract:
A microscope sampling accessory interfaced to a Fourier transform infrared (FT-IR) spectrometer has been employed to characterize the remains of individual microscopic fossil algae and algal colonies contained in organic-rich shales. The microspectrometer is able to measure reflectance IR spectra of samples with cross-sectional areas as small as 20 × 20 microns. The fossil algae studied include the colonial green alga Botryococcus braunii, the unicellular green alga Tasmanites, and an unidentified filamentous alga. It was found that IR spectra of the fossil algae, in common, contain intense aliphatic C-H stretching bands in the 2900-cm−1 region relative to the C=C stretching band at 1600 cm−1. The carboxylic acid C=O stretching band at 1710 cm−1 is moderately intense. The relative intensities of these bands vary among the three different fossil algae. Maximum-likelihood spectral restoration and subsequent curve fitting of the stretching vibrations of the aliphatic C-H bands provide greater insight into the aliphatic structures of fossil algae. The CH2/CH3 intensity ratio can be calculated and used to assess the relative average aliphatic chain length and the degree of branching.
5
Sugiarto, Kristi Aji, Desy MH Mantiri, Nickson J. Kawung, Rizald M. Rompas, Sandra O. Tilaar, and Adnan Wantasen. "PENGARUH LOGAM BERAT TIMBAL TERHADAP PERTUMBUHAN ALGA Halimeda opuntia YANG DIKULTUR DALAM WADAH TERKONTROL." JURNAL PESISIR DAN LAUT TROPIS 8, no. 3 (September 30, 2020): 17. http://dx.doi.org/10.35800/jplt.8.3.2020.32239.
Full textAbstract:
Heavy metal is a very dangerous pollutant waste for it cannot be destroyed (non-degradable) and over time it will accumulate in the ocean. This study aims to determine the lead content in sediment, water and algal thallus as well as to determine the algae growth that has been treated with lead. The research method used was a completely randomized design (CRD) which consisted of 3 treatments, using different treatments for each sample. The highest metal content obtained in the sediment was 5,124 ppm, in the water was 0.120 ppm, and in the algae thallus was 4,816 ppm respectively. The results showed that Halimeda opuntia algae can grow even in an environment contaminated with lead heavy metal and can become a bioremediation agent by absorbing lead heavy metal. Keywords: Halimeda opuntia, Lead Heavy Metal, Algae Culture, Bioremediation Logam berat merupakan salah satu limbah pencemar yang sangat berbahaya karena tidak dapat dihancurkan (non degradable) dan dapat terakumulasi di perairan laut. Penelitian ini bertujuan untuk mengetahui kandungan timbal pada sedimen, air dan thallus alga yang dikultur serta mengetahui pertumbuhan alga yang telah diberi perlakuan timbal. Metode penelitian mengunakan metode Rancangan Acak Lengkap (RAL) yang terdiri dari 3 perlakuan, dengan menggunakan perlakuan yang berbeda pada tiap sampel dan kontrol. Kandungan logam tertinggi yang didapatkan pada sedimen yaitu sebesar 5,124 ppm, pada air sebesar 0,120 ppm, dan pada thallus alga sebesar 4,816 ppm. Hasil yang diperoleh yaitu alga Halimeda opuntia dapat bertumbuh walaupun dalam lingkungan yang tercemar logam berat timbal serta mampu menjadi agen bioremediasi dengan menyerap logam berat timbal. Kata kunci: Halimeda opuntia, Logam BeratTimbal, Kultur Alga, Bioremediasi
6
Hultgren, Kristin M., and Hannah Mittelstaedt. "Color change in a marine isopod is adaptive in reducing predation." Current Zoology 61, no. 4 (August 1, 2015): 739–48. http://dx.doi.org/10.1093/czoolo/61.4.739.
Full textAbstract:
Abstract Although background matching is a common form of camouflage across a wide diversity of animals, there has been surprisingly little experimental work testing the fitness consequences of this camouflage strategy, especially in marine ecosystems. In this study, we tested whether color camouflage enhances survival of the intertidal marine isopod Pentidotea (Idotea) wosnesenskii, quantified patterns of camouflage in different algal habitats, and examined how algal diet affected color change and growth using laboratory assays. In the field, isopods collected from two differently colored algal habitats (the brown alga Fucus distichus and the red alga Odonthalia floccosa) matched the color of their respective algal habitats, and also differed significantly in body size: smaller red isopods were found on red algae, while larger brown isopods were found on brown algae. Predation experiments demonstrated these color differences had fitness benefits: brown isopods that matched their brown algae habitats survived at higher rates than red unmatched isopods. Surprisingly, despite the propensity of isopods to match their algal habitats, algal diet had no effect on color change in color change experiments. Instead, isopods in all treatments turned browner, matching the color of the algal habitat that many isopods are found on as adults. In summary, our data supported our hypothesis that background matching serves an adaptive function in reducing predation, with important evolutionary implications for explaining the wide variation in color change mechanisms in idoteid isopods.
7
Mirzayanti, Yustia Wulandari, Dian Yanuarita Purwaningsih, Siti Nur Faida, and Nurza Istifara. "Proses Ekstraksi Minyak Alga Chlorella.sp menggunakan Metode Sokhletasi." Reka Buana : Jurnal Ilmiah Teknik Sipil dan Teknik Kimia 5, no. 1 (March 16, 2020): 12. http://dx.doi.org/10.33366/rekabuana.v5i1.1555.
Full textAbstract:
Chlorella.sp is a type of green algae and has no flagella. One of the advantages of algae Chlorella.sp is that it has a high reproductive rate. Chlorella.sp algae is one of the algae that has oil content from its body mass. This study aims to determine the effect of the amount of solvent, extraction time on the Chlorella.sp algae oil extraction process using methanol solvent through the sokhletation method. Also, knowing the composition of fatty acids and acid numbers from algae oil Chlorella.sp. The ratio of Chlorella.sp algae: the amount of methanol solvent used are 1: 6; 1: 9 and 1:12 gr/ml. Then for the extraction time variation are 4; 4,5; 5; 5.5 and 6 hours. Chlorella.sp algae oil extraction process using sokhletation method is carried out at 70oC. The best results through the% yield and number parameters obtained by 17.98% Chlorella.sp algae oil yield ratio of 1:12 and the extraction time for 5.5 hours. Chlorella.sp algae oil has an acid number of 3.14 mg NaOH/g. Based on the results of the GC-MS test it is known that Chlorella.sp algae are dominated by linoleic acid by 55.01%area. ABSTRAKChlorella.sp merupakan jenis alga berwarna hijau dan tidak memiliki flagella. Salah satu kelebihan dari alga Chlorella.sp yaitu memiliki tingkat reproduksi yang tinggi. Alga Chlorella.sp merupakan salah satu alga yang memiliki kandungan minyak dari massa tubuhnya. Penelitian ini bertujuan untuk mengetahui pengaruh jumlah pelarut, waktu ekstraksi pada proses ekstraksi minyak alga Chlorella.sp menggunakan pelarut methanol melalui metode sokhletasi. Selain itu, mengetahui komposisi asam lemak dan bilangan asam dari minyak alga Chlorella.sp. Variasi rasio perbandingan antara alga Chlorella.sp : jumlah pelarut metanol yang digunakan yaitu 1:6; 1:9 dan 1:12 gr/ml. kemudian untuk variasi waktu ekstraksi adalah 4; 4,5; 5; 5,5 dan 6 jam. Proses ekstraksi minyak alga Chlorella.sp menggunakan metode sokhletasi dilakukan pada temperatur 70oC. Hasil terbaik melalui parameter %yield dan bilangan diperoleh sebesar 17,98% yield minyak alga Chlorella.sp dengan ratio perbandingan 1:12 dan waktu ekatraksi selama 5,5 jam. Minyak alga Chlorella.sp memiliki bilangan asam sebesar 3,14 mgNaOH/g. Berdasarkan hasil uji GC-MS diketahui bahwa untuk alga jenis Chlorella.sp didominasi oleh asam linoleat sebesar 55,01%area.
8
Pulukadan, Irma, Rene Ch Keppel, and Grevo S. Gerung. "A study on bioecology of macroalgae, genus Caulerpa in northern Minahasa Waters, North Sulawesi Province." AQUATIC SCIENCE & MANAGEMENT 1, no. 1 (April 30, 2013): 26. http://dx.doi.org/10.35800/jasm.1.1.2013.1965.
Full textAbstract:
Alga is a marine resource of potential to fisheries and marine sector. It has an important economic value to promote the economy in Indonesia. Nowdays, algae have been used as a relatively high value fisheries commodity since it has been used for food, industrial, pharmaceutical and cosmetic raw materials. This important potential needs to be supported with understanding of its biology and ecology, so that its utilization could increase the livelihood of the coastal villagers. This study was aimed at inventorying and identifying the members of genus Caulerpa found in North Minahasa Regency waters and studying some biological and ecological aspects of the algae in the area. Resuls showed that there were 7 species recorded, Caulerpa racemosa, C. racemosa var. macrophysa, C. sertularioides, C. taxifolia, C. serrulata,C. lentillifera and C. peltata. Ecologically, the environmental parameters, such as water temperature, salinity, pH, dissolved oxygen, turbidity, were in tolerable ranges for algal growth. Bottom substrate supported the growth of genus Caulerpa as well© Saat ini alga dijadikan sebagai komoditas hasil perikanan dengan nilai ekonomis yang relatif tinggi karena manfaatnya sebagai bahan makanan serta bahan baku industri, farmasi, dan kosmetik. Potensi yang cukup penting ini harus ditunjang dengan ilmu pengetahuan tentang biologi dan ekologi dari alga laut, sehingga pemanfaatannya dapat meningkatkan taraf hidup masyarakat pesisir. Penelitian tentang kajian bioekologi alga makro genus Caulerpa di perairan Minahasa Utara ini dilaksanakan dan diharapkan dapat memberikan informasi ilmiah tentang bioekologi alga makro genus Caulerpa, sehingga dapat dimanfaatkan untuk pengembangan pemanfaatan bagi kepentingan masyarakat pesisir khususnya dan industri alga makro umumnya. Penelitian ini bertujuan untuk menginventarisasi dan mengidentifikasi alga makro genus Caulerpa di perairan Kabupaten Minahasa Utara, dan mengkaji aspek bioekologinya. Hasil penelitian menunjukkan bahwa ditemukan 7 spesies, yaitu Caulerpa racemosa, C. racemosa var. macrophysa, C. sertularioides, C. taxifolia, C. serrulata, C. lentillifera dan C. peltata. Parameter lingkungan seperti suhu, salinitas, pH, oksigen terlarut, tingkat kecerahan air berada pada kisaran yang dapat ditolerir untuk pertumbuhan alga makro, sedangkan substrat juga mendukung pertumbuhan alga makro ini©
9
Davy, Simon K., Donelle A. Trautman, Michael A. Borowitzka, and Rosalind Hinde. "Ammonium excretion by a symbiotic sponge supplies the nitrogen requirements of its rhodophyte partner." Journal of Experimental Biology 205, no. 22 (November 15, 2002): 3505–11. http://dx.doi.org/10.1242/jeb.205.22.3505.
Full textAbstract:
SUMMARY Symbioses between sponges and algae are abundant in the nutrient-poor waters of tropical reefs, yet very little is known of the nutritional interactions that may promote this abundance. We measured nitrogen flux between the sponge Haliclona cymiformis and its symbiotic partner,the rhodophyte Ceratodictyon spongiosum, and assessed the potential importance of this flux to the symbiosis. While the association can take up dissolved inorganic nitrogen (DIN) as ammonium and nitrate from the surrounding sea water, enrichment of the water with nitrate did not affect its rates of photosynthesis and respiration. Much of the DIN normally assimilated by the alga is waste ammonium excreted by the sponge. A nitrogen budget for the symbiosis shows that the nitrogen required for algal growth can potentially be provided by sponge catabolism alone, but that only a small amount of nitrogen is available for translocation back to the sponge in organic compounds. The stable isotope composition (δ15N) was consistent with our interpretation of the sponge supplying excretory DIN to its algal partner, while the results also suggested that this DIN limits nitrogen deficiency in the alga. If our observations are typical of sponge—alga symbioses, then the supply of excretory nitrogen could be a major reason why so many algae form symbioses with sponges on coral reefs.
10
Ginting, Elvy Like, Liviani Rangian, Letha L. Wantania, and Stenly Wullur. "Isolation of Symbiotic Bacteria with Red Algae from Tongkaina Waters, North Sulawesi." JURNAL ILMIAH PLATAX 7, no. 2 (July 7, 2019): 395. http://dx.doi.org/10.35800/jip.7.2.2019.23728.
Full textAbstract:
This study aims to isolate symbiotic bacteria with red algae from the waters of Tongkaina, North Sulawesi. The red algae taken were red algae that are similar to the genus Portieria and Gracilaria. Bacteria were cultured and isolated using Nutrient Agar (NA) + sea water. Before bacteria from red algae samples were cultured, each sample of red algae was crushed, homogenized and diluted. The results of this study, 5 bacterial isolates were successfully isolated from red algae similar to Portieria sp. and 5 bacterial isolates from red algae similar to Gracilaria sp. Each bacterial isolate has different morphological characteristics such as shape, colour, elevation, and edges. Of the 10 bacterial isolates, 3 bacterial cells are gram-positive cocci (round), and 7 of them are gram-negative bacilli (rod).Keywords: Red algae, bacteria, isolation, symbionts ABSTRAKTujuan dari penelitian ini adalah untuk mengisolasi bakteri simbion dengan alga merah dari perairan Tongkaina, Sulawesi Utara. Alga merah yang diambil adalah alga merah yang mirip dengan genus Portieria dan Gracilaria. Bakteri ditumbuhkan dan diisolasi menggunakan media Nutrien Agar (NA) + air laut. Sebelum bakteri dari sampel alga merah ditumbuhkan, masing-masing sampel alga merah digerus, dihomogeniasi dan diencerkan. Hasil penelitian ini, 5 isolat bakteri berhasil diisolasi dari alga merah mirip Portieria sp. dan 5 isolat bakteri dari alga merah mirip Gracilaria sp. Masing-masing isolat bakteri memiliki karakteristik morfologi yang berbeda seperti bentuk, warna, elevasi, dan tepian. Dari 10 isolat bakteri tersebut, 3 sel bakteri bersifat gram positif dengan bentuk bulat, dan 7 diantaranya bersifat gram negatif dengan bentuk batang.Kata kunci: Alga merah, bakteri, isolasi, simbion
11
Tampanguma, Biondi, Grevo Gerung, Calvyn Sondak, Billy Wagey, Indri Manembu, and Khristin Kondoy. "Identifikasi jenis alga Koralin di pulau Salawati, Waigeo Barat kepulauan Raja Ampat dan pantai Malalayang kota Manado." JURNAL PESISIR DAN LAUT TROPIS 5, no. 1 (February 1, 2017): 9. http://dx.doi.org/10.35800/jplt.5.1.2017.14986.
Full textAbstract:
Alga koralin merupakan kelompok alga laut (seaweed) yang diklasifikasikan kedalam Divisi Rhodophyta, Kelas Florideophyceae, Ordo Cryptonemiales, Famili Corallinaceae. Secara morfologi (external appearance) kelompok famili ini terbagi atas 2 bagian, yaitu: alga koralin bersegmen (articulated/geniculated Coralline Algae) dan alga koralin tidak bersegmen (non-articulated/nongeniculated Coralline Algae). Tujuan penelitian ini dilakukan untuk mengidentifikasi jenis alga koralin dan mendeskripsikan morfologi alga koralin. Pengambilan sampel dilakukan di Pulau Salawati, Waigeo Barat Kepulauan Raja Ampat dan Pantai Malalayang Kota Manado. Pengambilan sampel dilakukan dengan bantuan peralatan SCUBA dan diambil pada kedalaman 1-5 meter dengan menggunakan metode survey jelajah. Setiap alga koralin yang di ambil dimasukan ke dalam plastik sampel. Sampel alga koralin di bawah ke Laboratorium Biologi Kelautan FPIK UNSRAT. Selanjutnya, setiap alga diidentifikasi, dicatat dan didokumentasi menggunakan kamera. Penelitian ini berhasil mengidentifikasi berjumlah 4 spesies alga koralin. Keempat spesies tersebut yaitu 1 Mastophora rosea dari Waigeo Barat, 2 dari Pulau Salawati Amphiroa rigida dan Galaxaura rugosa, dan 1 dari Pantai Malalayang Peyssonnelia caulifera.
12
El Semary, Nermin Adel, Howrah Mahdi, Abrar Alnoaim, Kawther Heji Alsofan, Sarah Ibrahim Almsthi, and Wed Saleh Albader. "Use of algae from an oasis in Saudi Arabia in production of biofuel and bio-fertilizer." Bangladesh Journal of Botany 47, no. 3 (October 28, 2018): 523–31. http://dx.doi.org/10.3329/bjb.v47i3.38721.
Full textAbstract:
AlAhsa oasis in Saudi Arabia is one of the largest oases in the world. Algae, from this region have been under-explored in the past decades. A study was conducted with Chlorococcum strain to produce biofuel alongside the seaweed Hormophysa cuneiformis. Gas Chromatography/Mass Spectrometry of fatty acid composition showed that the biodiesel obtained had limited number of unsaturated fatty acids as compared to the number of saturated fatty acids present, which indicates the stability of the produced biodiesel. Thereby the use of algal biomass for the production of biofuel is feasible. Moreover, the biomass may serve other different biotechnological applications. To further test this hypothesis, the aqueous extract of two different algae; one derived from the blue green alga (cyanobacterium) Phormidium sp. and the other from brown alga Hormophysa cuneiformis was used as liquid biofertiliser at concentrations of 50 and 10% of both algae. Sterilized Vigna seeds were soaked in the extracts for two days. Seeds were sown in sterilized soil and the germination percentage as well as shoot and root lengths were recorded for developing seedlings. The results showed that there was a significant increase in seed germination rate compared to control. Similarly, there was a significant increment in the length of root and root system compared to control with the 50% aqueous extract concentration being highest in growth parameters for brown alga followed by blue-green alga possibly due to the presence of growth stimulants in these extracts.
13
Kapetanovic, Radomir, Dusan Sladic, Simeon Popov, Mario Zlatovic, Zoran Kljajic, and Miroslav Gasic. "Sterol composition of the Adriatic sea algae Ulva lactuca, Codium dichotomum, Cystoseira adriatica and Fucus virsoides." Journal of the Serbian Chemical Society 70, no. 12 (2005): 1395–400. http://dx.doi.org/10.2298/jsc0512395k.
Full textAbstract:
The sterol composition of two green algae and two brown algae from the South Adriatic was determined. In the green alga Ulva lactuca, the principal sterols were cholesterol and isofucosterol. In the brown alga Cystoseira adriatica, the main sterols were cholesterol and stigmast-5-en-3?-ol, while the characteristic sterol of the brown algae, fucosterol, was found only in low concentration. The sterol fractions of the green alga Codium dichotomum and the brown alga Fucus virsoides contained practically only one sterol each, comprising more than 90 % of the total sterols (clerosterol in the former and fucosterol in the latter).
14
Hotter, Vivien, David Zopf, Hak Joong Kim, Anja Silge, Michael Schmitt, Prasad Aiyar, Johanna Fleck, et al. "A polyyne toxin produced by an antagonistic bacterium blinds and lyses a Chlamydomonad alga." Proceedings of the National Academy of Sciences 118, no. 33 (August 13, 2021): e2107695118. http://dx.doi.org/10.1073/pnas.2107695118.
Full textAbstract:
Algae are key contributors to global carbon fixation and form the basis of many food webs. In nature, their growth is often supported or suppressed by microorganisms. The bacterium Pseudomonas protegens Pf-5 arrests the growth of the green unicellular alga Chlamydomonas reinhardtii, deflagellates the alga by the cyclic lipopeptide orfamide A, and alters its morphology [P. Aiyar et al., Nat. Commun. 8, 1756 (2017)]. Using a combination of Raman microspectroscopy, genome mining, and mutational analysis, we discovered a polyyne toxin, protegencin, which is secreted by P. protegens, penetrates the algal cells, and causes destruction of the carotenoids of their primitive visual system, the eyespot. Together with secreted orfamide A, protegencin thus prevents the phototactic behavior of C. reinhardtii. A mutant of P. protegens deficient in protegencin production does not affect growth or eyespot carotenoids of C. reinhardtii. Protegencin acts in a direct and destructive way by lysing and killing the algal cells. The toxic effect of protegencin is also observed in an eyeless mutant and with the colony-forming Chlorophyte alga Gonium pectorale. These data reveal a two-pronged molecular strategy involving a cyclic lipopeptide and a conjugated tetrayne used by bacteria to attack select Chlamydomonad algae. In conjunction with the bloom-forming activity of several chlorophytes and the presence of the protegencin gene cluster in over 50 different Pseudomonas genomes [A. J. Mullins et al., bioRxiv [Preprint] (2021). https://www.biorxiv.org/content/10.1101/2021.03.05.433886v1 (Accessed 17 April 2021)], these data are highly relevant to ecological interactions between Chlorophyte algae and Pseudomonadales bacteria.
15
Ben-Amotz, A., S. Mokady, and M. Avron. "The β-carotene-rich alga Dunaliella bardawil as a source of retinol in a rat diet." British Journal of Nutrition 59, no. 3 (May 1988): 443–49. http://dx.doi.org/10.1079/bjn19880053.
Full textAbstract:
1. Dunaliella bardawil, a β-carotene-accumulating alga, has been tested as a source of retinol and β-carotene in a diet given to rats. The β-carotene in this alga is composed of about equal amounts of the 9-cis and all-trans isomers. Male weanling rats were fed on a retinol-deficient diet for 60 d. Thereafter, the rats were divided into groups and fed on a diet deficient in retinol or supplemented with retinol, synthetic β-carotene, dry alga or an algal oil-extract. Following further growth for 7 d, samples were taken for liver analyses of retinol, retinol isomers and β-carotene.2. Liver analyses revealed a comparable content of retinol and normal conversion rates in the rats grown on the diets supplemented with synthetic or natural β-carotene. Rats fed on the alga and the algal-oil-supplemented diets accumulated 9-cis retinol in addition to the all-trans isomer. Rats fed on synthetic β-carotene, alga and algal oil had a liver retinol: β-carotene value of about 3:1.3. These studies demonstrate the possibility of using dried D. bardawil or an oil extract of the alga as a dietary natural β-carotene supplement which satisfies the total requirement of retinol in rats.4. Rats fed on alga or on algal oil, accumulated in the liver 9-cis β-carotene and all-trans β-carotene in a ratio similar to that present in the alga.
16
Alfasane, Md Almujaddade, Md Miraj Kobad Chowdhury, and Maliha Mehnaz. "Molecular characterization and new reports of two green algae from Bangladesh." Bangladesh Journal of Plant Taxonomy 26, no. 1 (June 25, 2019): 39–45. http://dx.doi.org/10.3329/bjpt.v26i1.41915.
Full textAbstract:
This communication portrays the molecular characterization and confirms the new reports of two fresh water green algae namely, Pithophora polymorpha Wittrock and Spirogyra maxima (Hassall) Wittrock from Bangladesh. The samples of these algal species were cultured and partial 18S rDNA was sequenced and analysed for their molecular identification. It was found that the primers reported here could sufficiently identify these algae as P. polymorpha and S. maxima. Furthermore, the Neighbour joining (NJ) tree generated from 18s rDNA sequences suggested that Spirogyra maxima of Bangladesh is distantly related to the cluster of S. juergensii and S. platensis. Pithophora polymorpha along with P. roettleri, P. sano and Pithophora sp. seems to form a strongly supported monophyletic group. The alga AP1 clusters with Pithophora and the alga AS1 clusters with Spirogyra. This study is the first-time report of molecular identification of Bangladeshi algae and a landmark towards the future exploration of thealgal biodiversity of Bangladesh.
17
Figueiredo, Joana, Luís Narciso, Ralph Turingan, and Junda Lin. "Efficiency of using emerald crabs Mithraculus sculptus to control bubble alga Ventricaria ventricosa (syn. Valonia ventricosa) in aquaria habitats." Journal of the Marine Biological Association of the United Kingdom 88, no. 1 (February 2007): 95–101. http://dx.doi.org/10.1017/s0025315408000192.
Full textAbstract:
Ornamental crabs of the genus Mithraculus (Decapoda: Brachyura: Majidae) are utilized in reef aquaria to control nuisance algae, particularly bubble algae. Although Mithraculus have modified, spooned-shaped chelae to feed on both fleshy and filamentous algae, they may consume alternative foods offered in a reef aquarium. The objective of this study was to determine the efficiency of using Mithraculus sculptus to control the bubble alga Ventricaria ventricosa (Siphonocladales–Cladophorales complex, Chlorophyta) in the presence of alternative foods (commercial pellets and frozen mysids) commonly utilized in reef aquaria. Results indicated that medium and large sized crabs consumed more bubble algae than smaller conspecifics. Although, M. sculptus first chose alternative foods to bubble alga (77% and 69% of the time chose pellets and frozen mysids, respectively), algal consumption only decreased significantly if, besides algae, pellets were provided; when only algae were provided, algal consumption was similar to when they were provided with mysids. The prey choice model was used as a conceptual framework to study the mechanisms underlying active selection; food energy content and handling time were measured and food profitability was calculated. Handling time decreased with increasing crab size. Pellets presented a higher profitability than algae but mysids and algae presented similar profitability; this seems to be in agreement with the observed reduced algal consumption when pellets made part of the diet. Mithraculus sculptus feeding behaviour on V. ventricosa recorded with digital high-speed video (DHSV) suggests that as the crab tears the algal cell apart, the cell liquid that contains juvenile cytoplasmatic spheres is released into the water; this behaviour might contribute to algal dispersal and consequently algal infestation. These results seem to indicate that M. sculptus might not be such an efficient bio-controller of the pest V. ventricosa as previously thought, particularly when pellets are used as food; however, its bio-control efficiency might be improved if, mysids are used as food.
18
Ji, Shi-Qi, Bing Wang, Ming Lu, and Fu-Li Li. "Defluviitalea phaphyphila sp. nov., a Novel Thermophilic Bacterium That Degrades Brown Algae." Applied and Environmental Microbiology 82, no. 3 (November 20, 2015): 868–77. http://dx.doi.org/10.1128/aem.03297-15.
Full textAbstract:
ABSTRACTBrown algae are one of the largest groups of oceanic primary producers for CO2removal and carbon sinks for coastal regions. However, the mechanism for brown alga assimilation remains largely unknown in thermophilic microorganisms. In this work, a thermophilic alginolytic community was enriched from coastal sediment, from which an obligate anaerobic and thermophilic bacterial strain, designated Alg1, was isolated. Alg1 shared a 16S rRNA gene identity of 94.6% withDefluviitalea saccharophilaLIND6LT2T. Phenotypic, chemotaxonomic, and phylogenetic studies suggested strain Alg1 represented a novel species of the genusDefluviitalea, for which the nameDefluviitalea phaphyphilasp. nov. is proposed. Alg1 exhibited an intriguing ability to convert carbohydrates of brown algae, including alginate, laminarin, and mannitol, to ethanol and acetic acid. Three gene clusters participating in this process were predicted to be in the genome, and candidate enzymes were successfully expressed, purified, and characterized. Six alginate lyases were demonstrated to synergistically deconstruct alginate into unsaturated monosaccharide, followed by one uronic acid reductase and two 2-keto-3-deoxy-d-gluconate (KDG) kinases to produce pyruvate. A nonclassical mannitol 1-phosphate dehydrogenase, catalyzingd-mannitol 1-phosphate to fructose 1-phosphate in the presence of NAD+, and one laminarase also were disclosed. This work revealed that a thermophilic brown alga-decomposing system containing numerous novel thermophilic alginate lyases and a unique mannitol 1-phosphate dehydrogenase was adopted by the natural ethanologenic strain Alg1 during the process of evolution in hostile habitats.
19
Grotti, Marco, Francesco Soggia, Cristina Lagomarsino, Walter Goessler, and Kevin A. Francesconi. "Arsenobetaine is a significant arsenical constituent of the red Antarctic alga Phyllophora antarctica." Environmental Chemistry 5, no. 3 (2008): 171. http://dx.doi.org/10.1071/en08025.
Full textAbstract:
Environmental context. Although arsenic occurs in marine animals at high concentrations, the pathways by which it is biotransformed and accumulated remain largely unknown. The observation that some species of algae can contain significant concentrations of arsenobetaine, a major marine arsenic species, is relevant to explanations of the source of this compound to marine animals and its transport through the marine food web. Abstract. Significant amounts of arsenobetaine (up to 0.80 μg As g–1 dry mass, representing 17% of the extractable arsenic) were found in the extracts of all four samples of the red alga Phyllophora antarctica collected from two sites in Antarctica (Terra Nova Bay and Cape Evans). The assignment was made with high performance liquid chromatography–inductively coupled plasma mass spectrometry (HPLC-ICPMS) based on exact cochromatography with a standard compound with two chromatographic systems (cation-exchange and ion-pairing reversed-phase), each run under two sets of mobile phase conditions. Particular care was taken during sample preparation to ensure that the arsenobetaine was of algal origin and did not result from epiphytes associated with the alga. Another red alga, Iridaea cordata, collected from Terra Nova Bay, did not contain detectable concentrations of arsenobetaine. For both algal species, the majority of the extractable arsenic was present as arsenosugars. Confirmation that marine algae can contain significant amounts of arsenobetaine allows a simpler explanation for the widespread occurrence of this arsenical in marine animals.
20
Bocanegra, Aránzazu, Adrián Macho-González, Alba Garcimartín, Juana Benedí, and Francisco José Sánchez-Muniz. "Whole Alga, Algal Extracts, and Compounds as Ingredients of Functional Foods: Composition and Action Mechanism Relationships in the Prevention and Treatment of Type-2 Diabetes Mellitus." International Journal of Molecular Sciences 22, no. 8 (April 7, 2021): 3816. http://dx.doi.org/10.3390/ijms22083816.
Full textAbstract:
Type-2 diabetes mellitus (T2DM) is a major systemic disease which involves impaired pancreatic function and currently affects half a billion people worldwide. Diet is considered the cornerstone to reduce incidence and prevalence of this disease. Algae contains fiber, polyphenols, ω-3 PUFAs, and bioactive molecules with potential antidiabetic activity. This review delves into the applications of algae and their components in T2DM, as well as to ascertain the mechanism involved (e.g., glucose absorption, lipids metabolism, antioxidant properties, etc.). PubMed, and Google Scholar databases were used. Papers in which whole alga, algal extracts, or their isolated compounds were studied in in vitro conditions, T2DM experimental models, and humans were selected and discussed. This review also focuses on meat matrices or protein concentrate-based products in which different types of alga were included, aimed to modulate carbohydrate digestion and absorption, blood glucose, gastrointestinal neurohormones secretion, glycosylation products, and insulin resistance. As microbiota dysbiosis in T2DM and metabolic alterations in different organs are related, the review also delves on the effects of several bioactive algal compounds on the colon/microbiota-liver-pancreas-brain axis. As the responses to therapeutic diets vary dramatically among individuals due to genetic components, it seems a priority to identify major gene polymorphisms affecting potential positive effects of algal compounds on T2DM treatment.
21
Keintjem, Brigieta, Defny S. Wewengkang, and Fatimawali Fatimawali. "AKTIVITAS PENGHAMBATAN PERTUMBUHAN MIKROORGANISME DARI EKSTRAK DAN FRAKSI ALGA Ulva lactuca TERHADAP Escherichia coli, Staphylococcus aureus, DAN Candida albicans." PHARMACON 8, no. 2 (May 28, 2019): 397. http://dx.doi.org/10.35799/pha.8.2019.29306.
Full textAbstract:
ABSTRACT Algae have long been used for the treatment of various types of diseases. Ulva lactuca is one of the algae, which contains bioactive substances as antimicrobial, antifungal, and antioxidant. This study aims to determine the microorganisms growth inhibitory activity from Ulva lactuca algae obtained from the of Lembeh Strait waters in City of Bitung against microorganisms Escherichia coli, Staphylococcus aureus and Candida albicans. Ulva lactuca algae was extracted using maceration method with ethanol solvent and fractionated with methanol, n-hexan and chloroform solvents. Testing of antimicrobial activity using agar diffusion method. The result showed that extracts and fractions of Ulva lactuca algae did not have antimicrobial activity against the microorganisms Escherichia coli, Staphylococcus aureus and Candida albicans. The chemical composition of algae is influenced by season, geographical distribution, as well as environmental factors such as temperature, water, salinity, light, nutrition, and mineral availability.Keywords: Ulva lactuca, Antimicrobials, Maseration, Fractions, Agar DiffusionABSTRAK Alga telah lama digunakan untuk keperluan pengobatan berbagai jenis penyakit. Ulva lactuca merupakan salah satu alga yang memiliki kandungan zat bioaktif sebagai antimikroba. Penelitian ini bertujuan untuk mengetahui adanya aktivitas penghambat pertumbuhan mikroorganisme dari alga Ulva lactuca yang diperoleh dari perairan Selat Lembeh kota Bitung terhadap mikroba Escherichia coli, Staphylococcus aureus, dan Candida albicans. Alga Ulva lactuca diekstraksi menggunakan metode maserasi dengan pelarut etanol dan difraksinasi dengan pelarut methanol, n-hexan, dan kloroform. Pengujian aktivitas antimikroba menggunakan metode difusi agar. Hasil penelitian menunjukkan ekstrak dan fraksi dari alga Ulva lactuca tidak memiliki aktivitas antimikroba terhadap Escherichia coli, Staphylococcus aureus, dan Candida albicans. Komposisi kimia alga dipengaruhi oleh musim, distribusi geografis, serta faktor lingkungan seperti suhu, air, salinitasi, cahaya, nutrisi, dan ketersediaan mineral.Kata kunci : Alga Ulva lactuca, Antimikroba, Maserasi, Fraksi, Difusi Agar
22
Gerrath, J. F., J. A. Gerrath, and D. W. Larson. "A preliminary account of endolithic algae of limestone cliffs of the Niagara Escarpment." Canadian Journal of Botany 73, no. 5 (May 1, 1995): 788–93. http://dx.doi.org/10.1139/b95-086.
Full textAbstract:
This paper reports the discovery of endolithic algae from vertical limestone cliffs associated with the Niagara Escarpment, southern Ontario, Canada. The endolithic habitat forms a distinctive dark green layer 1–3 mm below the surface of the porous dolomitic limestone. Samples of the algal layer were isolated from freshly cleaved rock samples using sterile probes and grown on a solid (agarized) standard algal mineral medium supplemented with soil extract. A diverse assemblage of organisms grew on the agar plates, including bacteria, fungi, blue-green algae (cyanobacteria), green algae, yellow-green algae, and occasionally the protonemata of mosses. Isolated algae belong to unicellular, colonial, and filamentous morphological types. Algal genera that have been identified include seven blue-green algae (Cyanophyta or Cyanobacteria), six green algae (Chlorophyta), and one yellow-green alga (Xanthophyceae). Six of the algal genera found in Ontario rocks also occur inside rocks of the Colorado plateau in northern Arizona, and one genus also occurs inside Antarctic rocks. Key words: terrestrial algae, endolithic organisms, limestone cliffs, Niagara Escarpment, southern Ontario.
23
Alfaro, Andrea C., W. Lindsey Zemke-White, and Winifereti Nainoca. "Faunal composition within algal mats and adjacent habitats on Likuri Island, Fiji Islands." Journal of the Marine Biological Association of the United Kingdom 89, no. 2 (November 17, 2008): 295–302. http://dx.doi.org/10.1017/s0025315408002774.
Full textAbstract:
The faunal composition within three mono-specific algal habitats was investigated at Likuri Island, southern Viti Levu, Fiji Islands. Gracilaria maramae was the dominant alga within algal drift mat, seagrass bed, and rocky substrate habitats at the study site. This algal species exhibits two distinctive morphologies depending on whether it is attached or loose-lying. When attached to seagrass blades or rocky substrates, this alga has long straight branches stemming from a single holdfast, while detached individuals develop curled tendrils that re-attach to adjacent substrates. Re-attachment behaviour and high growth rates result in a dense mat of drift algae, which provides a suitable micro-habitat for macro-invertebrates. The sources of algal fragments that contribute to the algal mat appear to be nearby seagrass beds and rocky substrates, where this species may settle directly from spores. Storm events may detach these algae, although pulling experiments showed that the attachment to rocky substrates is 5 times stronger than the attachment to seagrass blades. Results from the macro-faunal samples indicate that the loose-lying algal mat habitat had the highest abundance and biodiversity of organisms, followed by the seagrass bed, and then the rocky substrate habitat. The ability of loose G. maramae fragments to re-attach, along with their high growth rate, may provide a unique micro-habitat for highly abundant and diverse faunal assemblages, which in turn may sustain adjacent near-shore communities. This study highlights the ecological importance of floating algal mats to coastal ecosystems, which should be considered in future management strategies throughout the Fiji Islands.
24
Hutchison, Leonard J., and G. L. Barron. "Parasitism of algae by lignicolous Basidiomycota and other fungi." Canadian Journal of Botany 75, no. 6 (June 1, 1997): 1006–11. http://dx.doi.org/10.1139/b97-111.
Full textAbstract:
On water agar, 30 out of 81 species of fungi tested showed positive directional hyphal growth towards microcolonies of the green alga Protococcus sp. and produced coralloid masses of branched assimilative hyphae within the invaded algal colonies. Of 77 species of fungi tested against the blue-green alga Synechococcus elongatus, 33 exhibited this same phenomenon. Cell walls of S. elongatus were subsequently lysed while only cell death occurred in Protococcus sp., resulting in the release of the contents that were presumably absorbed by the coralloid hyphae. Branched hyphae from some invading fungi occasionally attached to larger individual cells of Protococcus sp., penetrated the walls, and absorbed the contents. Key words: algae, Chlorophyta, Cyanophyta, cyanobacteria, Basidiomycota, wood decay, nitrogen requirements, Protococcus, Synechococcus.
25
Williamson, Bo, Paul W. Gabrielson, and Margarita Brandt. "First report of any species of the red algal order Nemaliales from mainland Ecuador: Neoizziella asiatica (Liagoraceae, Rhodophyta)." Botanica Marina 65, no. 2 (February 28, 2022): 135–39. http://dx.doi.org/10.1515/bot-2021-0092.
Full textAbstract:
Abstract The benthic marine algae of the mainland coast of Ecuador are poorly known mainly due to a lack of collections. Currently, DNA barcoding is the preferred method to identify species of benthic marine algae worldwide, as morpho-anatomical characters are inadequate to distinguish many species of macroalgae. We used the red algal barcode rbcL-3P to identify specimens collected in January 2020 from Manabí, Ecuador as Neoizziella asiatica. This is the first member of the red algal order Nemaliales to be reported from the mainland coast of Ecuador and extends the distribution of this alga by 1,100 km to the south from Panama.
26
Hengkengbala, Irvan R., Grevo S. Gerung, and Stenly Wullur. "DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency." AQUATIC SCIENCE & MANAGEMENT 6, no. 2 (August 10, 2019): 33. http://dx.doi.org/10.35800/jasm.6.2.2018.24836.
Full textAbstract:
Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae. The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya. Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E). Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne). Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.
27
Tampanguma, Biondi, Grevo S. Gerung, Veibe Warouw, Billy Th Wagey, Stenly Wulllur, Deiske A. Sumilat, and Hens Onibala. "DNA Isolation And Amplification of the rbcL (ribulose-1,5- bisphosphate carboxylase/oxygenase large subunit) gene of Caulerpa sp., Gracilaria sp., And Sargassum sp." Jurnal Ilmiah PLATAX 8, no. 2 (August 14, 2020): 214. http://dx.doi.org/10.35800/jip.8.2.2020.30003.
Full textAbstract:
DNA isolation and gene amplification of algae are significantly influenced by various factors such as characteristics and components of the algae cell wall. Therefore techniques and methods of DNA isolation in certain algae, sometimes only succeed in one particular species and can not be applied to another algae species. Based on that issue, this study was conducted with the aims to determine the succeed of DNA isolation and amplify the rbcL gene as a target gene for identification. Algae DNA was isolated by using innuPrep Plant DNA commercial kit, and the second one with a modified conventional Cetyl Trimetyl Ammonium Bromide (CTAB) method, for the amplification process was using rbcL gene (ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit) with two pairs of primers : rbcL 7F-753R and rbcL 577F-rbcSR. The results showed that the DNA of Gracilaria sp was succeed isolated by using CTAB method and it was denoted by the presence of DNA bands in agarose gel. Meanwhile DNA amplification for Gracilaria sp., and Sargassum sp., were succeed amplified with the appearance of DNA bands. But in algae Caulerpa sp., was only succeed on 1 pair of primary rbcL 7F and 7.Keywords : DNA, gene rbcL, algae Caulerpa sp., Sargassum sp., Gracilaria sp;AbstrakIsolasi DNA dan amplifikasi gen pada alga sangat dipengaruhi oleh beberapa faktor seperti karakter dan komponen pada dinding sel alga. Oleh karena itu proses isolasi DNA terkadang bisa berhasil pada satu jenis alga, namun tidak berhasil pada jenis alga lainnya. Oleh karena alasan tersebut, maka penelitian ini dilakukan untuk menentukan keberhasilan Isolasi DNA dan mengamplifikasi gen rbcL sebagai gen target identifikasi. Penelitian ini dilakukan dengan tahapan awal Isolasi DNA yang menggunakan kit komersil innuPrep Plant DNA Kit, dan metode konvensional Cetyl Trimetyl Ammonium Bromide (CTAB) yang telah dimodifikasi. Sedangkan untuk proses amplifikasi, menggunakan gen rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) digunakan dua pasang primer yaitu rbcL 7F-753R dan rbcL 577F-rbcSR. Hasil isolasi DNA dari alga Gracilaria sp berhasil diisolasi menggunakan metode CTAB yang ditandai dengan adanya pita DNA pada gel agarose. Amplifikasi DNA pada alga Gracilaria sp., dan Sargassum sp., berhasil diamplifikasi dengan munculnya pita DNA. Namun pada alga Caulerpa sp. hanya berhasil pada 1 pasang primer rbcL 7F dan753R.Kata kunci : DNA, gen rbcL, alga Caulerpa sp., Sargassum sp., Gracilaria sp.
28
Ulaan, Gia Aprilia Kartini, Adithya Yudistira, and Henki Rotinsulu. "UJI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL ALGA Ulva lactuca MENGGUNAKAN METODE DPPH (1,1 diphenyl-2-picrylhydrazyl)." PHARMACON 8, no. 3 (August 28, 2019): 535. http://dx.doi.org/10.35799/pha.8.2019.29327.
Full textAbstract:
Ulva lactuca Algae habitat was found in shallow marine waters and its morphology is thin and flat thallus. Ulva lactuca Algae, known as sea lettuce, contains a lot of chlorophyll in its cells. Chlorophyll has the ability as a free radical scavenger and also has antioxidant activity. Antioxidants are compounds that could inhibit oxidation reactions by binding to free radicals and highly reactive molecules. This study was conducted to determine the antioxidant activity of ethanol extract of Algae Ulva lactuca obtained from the Lembeh Strait, Bitung City. Ulva lactuca Algae was extracted by maceration method using ethanol solvent. Testing of antioxidant activity was carried out using the DPPH method, which was measured using a UV-VIS spectrophotometer. The results showed that the ethanol extracts of Ulva lactuca Algae had antioxidant activity with a percentage value of 51.63% at a concentration of 100 mg/L. Keywords : Ulva lactuca Algae, Antioxidants, Ethanol, DPPHABSTRAKHabitat tumbuhan Alga Ulva lactuca terdapat di air laut dan morfologinya berupa thallus tipis dan gepeng. Alga Ulva lactuca yang dikenal dengan selada laut, banyak mengandung klorofil dalam sel-selnya. Klorofil memiliki kemampuan sebagai penangkap radikal bebas dan juga memiliki aktivitas antioksidan. Antioksidan merupakan senyawa yang dapat menghambat reaksi oksidasi dengan cara mengikat radikal bebas dan molekul yang sangat reaktif. Penelitian ini dilakukan untuk mengetahui aktivitas antioksidan dari ekstrak etanol Alga Ulva lactuca yang diperoleh dari Peraian Selat Lembeh, Kota Bitung. Alga Ulva lactuca diekstrak dengan metode maserasi menggunakan pelarut etanol. Pengujian aktivitas antioksidan dilakukan dengan metode DPPH yang di ukur menggunakan Spektrofotometer UV-VIS. Hasil penelitian menunjukkan bahwa ekstrak etanol Alga Ulva lactuca memiliki aktivitas antioksidan dengan nilai presentase sebesar 51,63% pada konsentrasi 100 mg/L. Kata kunci : Alga Ulva lactuca, Antioksidan, Etanol, DPPH
29
Eich, Andreas, Amanda K. Ford, Maggy M. Nugues, Ryan S. McAndrews, Christian Wild, and Sebastian C. A. Ferse. "Positive association between epiphytes and competitiveness of the brown algal genus Lobophora against corals." PeerJ 7 (February 8, 2019): e6380. http://dx.doi.org/10.7717/peerj.6380.
Full textAbstract:
Observations of coral–algal competition can provide valuable information about the state of coral reef ecosystems. Here, we report contact rates and apparent competition states for six shallow lagoonal reefs in Fiji. A total of 81.4% of examined coral perimeters were found to be in contact with algae, with turf algae (54.7%) and macroalgae of the genus Lobophora (16.8%) representing the most frequently observed contacts. Turf algae competitiveness was low, with 21.8% of coral–turf contacts being won by the algae (i.e. overgrowth or bleaching of coral tissue). In contrast, Lobophora competitiveness against corals was high, with 62.5% of contacts being won by the alga. The presence of epiphytic algae on Lobophora was associated with significantly greater algal competitiveness against corals, with 75.8% and 21.1% of interactions recorded as algal wins in the presence and absence of epiphytes, respectively. Sedimentation rate, herbivorous fish biomass, and coral colony size did not have a significant effect on Lobophora–coral interactions. This research indicates a novel and important role of epiphytes in driving the outcome of coral–algal contacts.
30
Kemenangan, Franklin R., Gaspar D. Manu, and Fransine B. Manginsela. "Growth Of Brown Algae, Padina australis, In The Coastal waters of Serei Village, West Likupang District, North Minahasa Regency." JURNAL ILMIAH PLATAX 5, no. 2 (April 17, 2017): 243. http://dx.doi.org/10.35800/jip.5.2.2017.17003.
Full textAbstract:
Marine algae is one resource that has important economic value because it has cagar, carrageen and alginate ontent (Indriani and Sumiarsih, 1999). In the world of science, the word algae comes from the Greek , algor which means cold (Nontji, 2002). Padina australis is a species of marine algae belong to Phaeophyta Division (brown algae) which is commonly found in marine waters, from shallow to deep waters. This algae has a wide transparent brown sheet or filament shape. This study was aimed to observe the growth of algae P. australis by using case study method where samples of Padina algae taken from nature were placed into basket as container for culturing. While the technique used is cultivation using basket; in order to determine the growth, algae was analyzed further by measuring the maximum weight of P. australis living without substrate. Some environmental factors such as temperature, salinity, depth and tides were recorded to see their impact on the growth of P. australis. Serei village is the location of the research on the growth of this P. australis. The result also records that P. australis can only live about three weeks and after that die. The growth of P. australis was greatest in the 8th container weighing 23 gr.Keywords: Growth, Padina australis, Desa Serei ABSTRAKAlga laut adalah salah satu sumberdaya yang mempunyai nilai ekonomis penting karena memiliki kandungan agar, karaginan dan alginat (Indriani dan Sumiarsih, 1999). Dalam dunia ilmu pengetahuan, alga berasal dari bahasa Yunani yaitu Algor yang berarti dingin (Nontji, 2002). Padina australis merupakan spesies alga laut dari Divisi Phaeophyta (alga cokelat) yang pada umumnya tersebar di perairan laut, mulai perairan laut dangkal hingga perairan dalam. Alga ini memiliki bentuk lembaran atau filamen yang lebar yang berwarna cokelat transparan. Penelitian ini bertujuan untuk mengamati pertumbuhan alga Padina australis lewat metode studi kasus dimana sampel alga Padina yang diambil dari alam kemudian ditempatkan ke dalam keranjang sebagai wadah budidaya alga Padina australis. Sedangkan teknik yang digunakan adalah teknik budidaya dengan menggunakan keranjang. Pertumbuhan dianalisis berdasrakan pertambahan berat malsimum P. australis yang hidup tanpa substrat. Beberapa factor lingkungan antara lain suhu, salinitas, kedalaman dan pasang surut diukur untuk melihat dampaknya terhadap pertumbuhan P. australis. Desa Serei merupakan lokasi dilakukannya penelitian pertumbuhan alga P. australis ini. Setelah dilakukan pengamatan P. australis hanya bisa hidup sekitar tiga minggu dan setelah itu mati dan hancur. Pertumbuhan P. australis paling besar terjadi pada wadah ke-8 dengan berat 23 gr. Kata kunci : Pertumbuhan, Padina australis, Desa Serei
31
K., Santhoshkumar, Prasanthkumar S., and J. G. Ray. "Chlorococcum humicola (Nageli) Rabenhorst as a Renewable Source of Bioproducts and Biofuel." Journal of Plant Studies 5, no. 1 (February 29, 2016): 48. http://dx.doi.org/10.5539/jps.v5n1p48.
Full textAbstract:
Among the diverse new generation biomass yielding species, green algae are the most promising organisms. Compared to biomass production of other organisms, production of algae is less laborious, quite fast, and more economical. Moreover, eutrophicated waters get naturally purified in the cultivation process of algae. Algal biomass from monoculture of specific species, which are rich in carbohydrates, proteins and lipids, is considered a good source of diverse bio-products and feed-stock for food, feeds and bio-fuels. Quantity and quality of algal biomass for specific products depend on the species and strains as well as environmental conditions of cultivation. In this connection, biomass productivity and oil-yield of a local strain of <em>Chlorococcum humicola </em>(Nageli) Rabenhorst was assessed in Bold’s Basal Medium. Long-term storage capacity of the alga was tried by entrapping the algal cells in sodium alginate beads, which showed viability up to 14 months. Estimation of total carbohydrate, protein, lipid and chemical characterization of oil as well as the feasibility of its conversion to biodiesel revealed the industrial potential of this local strain as a source of food and biofuel. Fatty acid profiling of the extracted oil showed that 70% are mono-saturated and 12.2 % are nutritionally important polyunsaturated fatty acids. The oil could be effectively trans-esterified to methyl esters and the conversion was confirmed by FTIR spectroscopy. Further standardization of the mass production of the alga in natural environmental conditions for biomass and oil is progressing to optimize its value as globally competent food, nutraceutical and biofuel resource.
32
Moniung, Prisilia, Marina Singkoh, and Regina Butarbutar. "Potensi Alga Halymenia durvillei Sebagai Sumber Antioksidan Alami." JURNAL BIOS LOGOS 12, no. 1 (April 11, 2022): 39. http://dx.doi.org/10.35799/jbl.v12i1.36721.
Full textAbstract:
Red algae have the ability to produce secondary metabolites which are bioactive compounds. The content of secondary metabolites from red algae can be determined by an approach method that can provide information on the presence of secondary metabolites. The purpose of this study was to identify bioactive compounds, as well as to analyze the natural antioxidant activity of H. durvillei algae. Extracts were made by maceration method using 96% ethanol. Antioxidant activity test using DPPH method. Algae extract H. durvillei contains compounds of alkaloids, tannins, saponins and phenols which have antioxidant activity that can counteract the formation of free radicals. The results of antioxidant tests conducted using UV-Vis spectrophotometry on the ethanolic extract of H. durvillei algae showed an IC50 value of 101.22 ppm. Keywords: Red Algae (H. durvillei); Bioactive Compounds; Natural Antioxidants ABSTRAKAlga merah memiliki kemampuan untuk memproduksi metabolit sekunder yang bersifat sebagai senyawa bioaktif. Kandungan senyawa metabolit sekunder dari alga merah dapat diketahui dengan suatu metode pendekatan yang dapat memberikan informasi adanya senyawa metabolit sekunder. Tujuan penelitian ini untuk mengidentifikasi senyawa bioaktif, serta menganalisis aktivitas antioksidan alami yang terdapat pada alga H. durvillei. Pembuatan ekstrak dilakukan dengan metode maserasi menggunakan etanol 96%. Uji aktivitas antioksidan menggunakan metode DPPH. Ekstrak Alga H. durvillei memiliki kandungan senyawa alkaloid, tanin, saponin dan fenol yang memiliki aktivitas antioksidan yang dapat menangkal terbentuknya radikal bebas.Hasil uji antioksidan yang dilakukan menggunakan spektrofotometri UV-Vis pada ekstrak etanol alga H. durvillei menunjukkan nilai IC50 sebesar 101.22 ppm. Kata Kunci: Alga Merah (H. durvillei); Senyawa Bioaktif; Antioksidan Alami
33
Wang, J., and AE Douglas. "Nitrogen recycling or nitrogen conservation in an alga-invertebrate symbiosis?" Journal of Experimental Biology 201, no. 16 (August 15, 1998): 2445–53. http://dx.doi.org/10.1242/jeb.201.16.2445.
Full textAbstract:
When corals and allied animals are deprived of their symbiotic algae, the ammonium content in their tissues rises. This is commonly interpreted as evidence for nitrogen recycling (i.e. algal assimilation of animal waste ammonium into amino acids that are released back to the animal), but it can also be explained as nitrogen conservation by the animal (i.e. reduced net ammonium production in response to the receipt of algal photosynthetic carbon). This study discriminated between these interpretations in two ways. First, the increased ammonium concentration in the sea anemone Aiptasia pulchella, caused by darkness or depletion of the alga Symbiodinium, was partially or completely reversed by supplementing the medium with organic carbon compounds (e.g. <IMG src="/images/symbols/&agr ;.gif" WIDTH="9" HEIGHT="12" ALIGN= "BOTTOM" NATURALSIZEFLAG="3">-ketoglutarate). Second, the activity of the ammonium-assimilating enzyme glutamine synthetase and the concentration of protein amino acids in the free amino acid pool of the animal, which were depressed by darkness and algal depletion, were restored by exogenous carbon compounds. It is concluded that organic carbon, whether derived from algal photosynthate or exogenously, promotes the animal's capacity for ammonium assimilation and reduces ammonium production from amino acid degradation. These processes contribute to nitrogen conservation in the animal, but they confound the interpretation of various studies on nitrogen recycling by symbiotic algae.
34
Kepel, Rene Ch, and Desy M. H. Mantiri. "The biodiversity of macroalgae in the coastal waters of Kora-Kora, East Lembean Sub-District, Minahasa Regency." JURNAL ILMIAH PLATAX 7, no. 2 (July 5, 2019): 383. http://dx.doi.org/10.35800/jip.7.2.2019.23727.
Full textAbstract:
This study was carried out in coastal waters of Kora-Kora, East Lembean Sub-District, Minahasa Regency with an objective of knowing the taxa composition of macroalgae through morphological studies. Data collection used exploring survey. Results found 10 species that consisted 1 species of red algae (Rhodophyta), 6 species of brown algae (Phaeophyta), and 3 species of green algae (Chlorophyta).Keyword: Macroalgae, Kora-Kora. ABSTRAKPenelitian ini dilakukan di perairan pesisir Kora-Kora, Kecamatan Lembean Timur, Kabupaten Minahasa dengan tujuan untuk mengetahui komposisi taksa makroalga melalui pendekatan morfologi. Pengambilan data dilakukan dengan menggunakan metode survei jelajah. Hasil penelitian menemukan 10 spesies, yang terdiri dari 1 spesies alga merah (Rhodophyta), 6 spesies alga cokelat (Phaeophyta)) dan 3 spesies alga hijau (Chlorophyta).Kata Kunci: makroalga, Kora-Kora.
35
Baars, D. L. "Kansaphyllum, a new Late Pennsylvanian phylloid algal genus." Journal of Paleontology 66, no. 4 (July 1992): 697–701. http://dx.doi.org/10.1017/s0022336000024628.
Full textAbstract:
Phylloid (leaf-shaped) fossil algae are common constituents in sedimentary rocks of Late Pennsylvanian through Early Permian age in the Midcontinent, U.S.A., commonly producing porous algal-rich bioherms that may be prolific petroleum reservoir rocks. During the course of re-evaluating the paleontological character of these fossil algae in Kansas, remarkably well-preserved codiacean algae were found in an oncolitic nodule in the Wakarusa Limestone Member of the Bern Limestone (Virgilian) in Lyon County, Kansas. Although this is the locality and stratigraphic bed from which the genotype Anchicodium funile Johnson, 1946, was collected, the new alga is not of that genus, but occurs with specimens of Anchicodium.
36
Kepel, Rene Charles, Desy M. H. Mantiri, and Nasprianto. "The biodiversity of macroalgae in the coastal waters of Tongkaina, Manado City." JURNAL ILMIAH PLATAX 6, no. 1 (May 11, 2018): 160. http://dx.doi.org/10.35800/jip.6.1.2018.19558.
Full textAbstract:
This study was carried out in coastal waters of Tongkaina, Manado City with an objective of knowing the taxa composition of macroalgae through morphological studies. Data collection used exploring survey. Results found 15 species that consisted 7 species of green algae, 4 species of brown algae, and 4 species of red algae.Keyword: Macroalgae, Tongkaina. AbstrakPenelitian ini dilakukan di perairan pesisir Tongkaina, Kota Manado dengan tujuan untuk mengetahui komposisi taksa makroalga melalui pendekatan morfologi. Pengambilan data dilakukan dengan menggunakan metode Survei Jelajah. Hasil penelitian menemukan 15 spesies, yang terdiri dari 7 spesies alga hijau, 4 spesies alga cokelat dan 4 spesies alga merah.Kata Kunci: makroalga, Tongkaina.
37
Djabayan-Djibeyan, Pablo, Roslyn Gibbs, and Brian Carpenter. "In vivo Release of Lectins from the Green Alga Ulva fasciata." Natural Product Communications 5, no. 4 (April 2010): 1934578X1000500. http://dx.doi.org/10.1177/1934578x1000500422.
Full textAbstract:
The green alga Ulva fasciata Delile (Ulvaceae), after thawing from storage at −20oC, has been used to study the in vivo biosynthesis and release of lectins. The alga was made to resume viable growth by immersion in a PBS buffer, pH 7.4, containing 0.01% w/v sodium azide and irradiating with a halophosphate lamp. The growing alga readily took up 14C leucine, when this was added to the buffer, as seen by a decrease in a sample count rate of ~ 8000 cpm over a period of twenty minutes. The transfer of the radioactivity fed algae into fresh PBS buffer resulted in 14C labeled proteins being subsequently released into solution. As well as observing changes in levels of radioactivity, the release of proteins was also monitored by UV absorption at 280 nm. Both techniques indicated an initial steady release over the first twelve hours, followed by a slower approach to a plateau value. Transfer of the algae that had undergone an initial period of protein release into a subsequent second and third volume of fresh PBS buffer produced similar UV absorption profiles, but the total quantities of material released were reduced. Identification of the released proteins was obtained from their ability to agglutinate red blood cells, which was inhibited by L-fucose, and their electrophoretic mobilities when compared with earlier isolated samples of the U. fasciata lectin. The reference lectin was obtained by affinity chromatography, following the selective precipitation of the water soluble algal proteins with ammonium sulfate. We postulate that the observed release profiles support the previously suggested concept that lectins have the ability to function as protection agents for living marine algae.
38
Trowbridge, Cynthia D., Colin Little, Penny Stirling, and William F. Farnham. "Sacoglossan gastropods on native and introduced hosts in Lough Hyne, Ireland: larval retention and population asynchrony?" Journal of the Marine Biological Association of the United Kingdom 88, no. 4 (June 25, 2008): 771–82. http://dx.doi.org/10.1017/s0025315408001690.
Full textAbstract:
The north-eastern Atlantic sacoglossan gastropod Elysia viridis was studied on littoral and sublittoral shores of the British Isles from 2001 to 2007 to evaluate its potential role in the known decline of the invasive green alga Codium fragile ssp. fragile. Across its European range, this sacoglossan associates with eight genera of algal hosts within three algal orders and two divisions; these hosts include native and introduced macroalgae. The ‘specialist’ herbivore was investigated primarily within the rocky shore community at Lough Hyne Marine Reserve, County Cork, south-west Ireland, with comparative information from surveys of 95 other sites in the British Isles. In Lough Hyne, E. viridis associated with the green algae Codium, Cladophora and Chaetomorpha as well as the red alga Griffithsia. The sacoglossan associated with Codium, Cladophora and Chaetomorpha as well as the red alga Halurus in Devon, Isle of Wight and the Channel Islands. Recruitment of E. viridis to Codium spp. in the lough was substantially higher than in most areas of the British Isles with 100% of the Codium hosts attacked during annual September surveys. The strong autumn pulse of sacoglossan recruitment, coupled with the asynchronous population dynamics compared to other shores, indicates retention of planktotrophic larvae within the lough. The previously reported decline in sacoglossan density with tidal level was hypothesized to be caused by sublittoral predators. Although our experiments failed to demonstrate an effect by large predators, the foraging of the abundant fingerling fish and small crabs could not be tested conclusively. Field experiments were consistent with the interpretation of intense sacoglossan herbivory in certain areas of the lough. However, even if the sacoglossans contribute to the local decline of C. fragile in the lough, they cannot account for the regional decline of the alga on the north-eastern Atlantic shores.
39
Jerković, Igor, Sanja Radman, and Stela Jokić. "Distribution and Role of Oct-1-en-3-ol in Marine Algae." Compounds 1, no. 3 (October 8, 2021): 125–33. http://dx.doi.org/10.3390/compounds1030011.
Full textAbstract:
Oct-1-en-3-ol has been studied among oxylipins as a global metabolome that induce the defense of marine algae. The present short review summarized the research of oct-1-en-3-ol as the stress response molecule in marine algae including different aspects: (i) its biosynthesis from fatty acids; (ii) its distribution in marine algae; (iii) a direct effect of oct-1-en-3-ol on microorganisms infecting the thalli; (iv) an indirect communication molecule for alga-alga signaling; and (v) as an inducer that initiates the defense response of algae.
40
Le Faucheur, Séverine, Yvan Tremblay, Claude Fortin, and Peter G. C. Campbell. "Acidification increases mercury uptake by a freshwater alga, Chlamydomonas reinhardtii." Environmental Chemistry 8, no. 6 (2011): 612. http://dx.doi.org/10.1071/en11006.
Full textAbstract:
Environmental contextMercury is classified as a priority pollutant owing to the biomagnification of its methylated species along food chains and the consequent effects on top consumers. The pH of natural waters affects many of the biogeochemical processes that control mercury accumulation in aquatic organisms. Here, evidence is presented that pH affects mercury uptake by unicellular algae, primary producers in aquatic food chains, thereby providing a new example of the pervasive influence of pH on the mercury biogeochemical cycle. AbstractWe have examined the influence of pH on HgII uptake (mainly in the form of the lipophilic complex HgCl2) by a green, unicellular alga, Chlamydomonas reinhardtii. Uptake of the dichloro complex increased by a factor of 1.6 to 2 when the pH was lowered from 6.5 to 5.5, an unexpected result given that the intracellular hydrolysis rate of fluorescein diacetate (FDA), used as a probe for the passive diffusion of lipophilic solutes through algal membranes, decreased in the studied alga under similar conditions. Several mechanisms were explored to explain the enhanced uptake at pH 5.5, including pH-induced changes in cell surface binding of Hg or in Hg loss rates from cells, but none of them gave completely satisfactory explanations. The present findings imply that inorganic HgII in aqueous solution behaves, in terms of uptake, neither as a lipophilic complex (the uptake of which would be expected to decrease with acidification because of algal membrane packing), nor as a cationic metal (the transport of which by facilitated transport would be expected to diminish with increasing proton concentration because of metal–proton competition at the transporter binding sites). Mercury uptake by algae seems rather to be stimulated by proton addition.
41
Roberts, Alison W., Eric M. Roberts, and Deborah P. Delmer. "Cellulose Synthase (CesA) Genes in the Green Alga Mesotaenium caldariorum." Eukaryotic Cell 1, no. 6 (December 2002): 847–55. http://dx.doi.org/10.1128/ec.1.6.847-855.2002.
Full textAbstract:
ABSTRACT Cellulose, a microfibrillar polysaccharide consisting of bundles of β-1,4-glucan chains, is a major component of plant and most algal cell walls and is also synthesized by some prokaryotes. Seed plants and bacteria differ in the structures of their membrane terminal complexes that make cellulose and, in turn, control the dimensions of the microfibrils produced. They also differ in the domain structures of their CesA gene products (the catalytic subunit of cellulose synthase), which have been localized to terminal complexes and appear to help maintain terminal complex structure. Terminal complex structures in algae range from rosettes (plant-like) to linear forms (bacterium-like). Thus, algal CesA genes may reveal domains that control terminal complex assembly and microfibril structure. The CesA genes from the alga Mesotaenium caldariorum, a member of the order Zygnematales, which have rosette terminal complexes, are remarkably similar to seed plant CesAs, with deduced amino acid sequence identities of up to 59%. In addition to the putative transmembrane helices and the D-D-D-QXXRW motif shared by all known CesA gene products, M. caldariorum and seed plant CesAs share a region conserved among plants, an N-terminal zinc-binding domain, and a variable or class-specific region. This indicates that the domains that characterize seed plant CesAs arose prior to the evolution of land plants and may play a role in maintaining the structures of rosette terminal complexes. The CesA genes identified in M. caldariorum are the first reported for any eukaryotic alga and will provide a basis for analyzing the CesA genes of algae with different types of terminal complexes.
42
Czerwik-Marcinkowska, Joanna, Katarzyna Gałczyńska, Jerzy Oszczudłowski, Andrzej Massalski, Jacek Semaniak, and Michał Arabski. "Fatty Acid Methyl Esters of the Aerophytic Cave Alga Coccomyxa subglobosa as a Source for Biodiesel Production." Energies 13, no. 24 (December 9, 2020): 6494. http://dx.doi.org/10.3390/en13246494.
Full textAbstract:
The microscopic alga Coccomyxa subglobosa, collected from the Głowoniowa Nyża Cave (Tatra Mountains, Poland), is a source of fatty acids (FAs) that could be used for biodiesel production. FAs from subaerial algae have unlimited availability because of the ubiquity of algae in nature. Algal culture was carried out under laboratory conditions and algal biomass was measured during growth phase, resulting in 5 g of dry weight (32% oil). The fatty acid methyl ester (FAME) profile was analyzed by means of gas chromatography–mass spectrometry (GC–MS). The presence of lipids and chloroplasts in C. subglobosa was demonstrated using GC–MS and confocal laser microscopy. Naturally occurring FAMEs contained C12–C24 compounds, and methyl palmitate (28.5%) and methyl stearate (45%) were the predominant lipid species. Aerophytic algae could be an important component of biodiesel production, as they are omnipresent and environmentally friendly, contain more methyl esters than seaweed, and can be easily produced on a large scale.
43
Kepel, Rene Charles, Desy M. H. Mantiri, Anton Rumengan, and Nasprianto. "The biodiversity of macroalgae in the coastal waters of Blongko Village, Sub-District of Sinonsayang, District of South Minahasa." JURNAL ILMIAH PLATAX 6, no. 1 (May 18, 2018): 174. http://dx.doi.org/10.35800/jip.6.1.2018.19583.
Full textAbstract:
This study was carried out in coastal waters of Blongko Vilage, Sub-District of Sinonsayang, District of South Minahasa with an objective of knowing the taxa composition of macroalgae through morphological studies. Data collection used exploring survey. Results found 14 species that consisted 8 species of green algae, 2 species of brown algae, and 4 species of red algae.Keyword: Macroalgae, Blongko. Abstrak Penelitian ini dilakukan di perairan pesisir Blongko, Kecamatan Sinonsayang, Kabupaten Minahasa Selatan dengan tujuan untuk mengetahui komposisi taksa makroalga melalui pendekatan morfologi. Pengambilan data dilakukan dengan menggunakan metode Survei Jelajah. Hasil penelitian menemukan 14 spesies, yang terdiri dari 8 spesies alga hijau, 2 spesies alga cokelat dan 4 spesies alga merah.Kata Kunci: makroalga, Blongko.
44
Djakatara, Paratiti Dewi, Grevo S. Gerung, Elvy L. Ginting, Calvyn F. A. Sondak, Natalie D. C. Rumampuk, and Desy M. H. Mantiri. "AMPLIFIKASI DNA ALGA MERAH (RHODOPHYTA) Eucheuma sp." JURNAL PESISIR DAN LAUT TROPIS 6, no. 2 (October 31, 2018): 26. http://dx.doi.org/10.35800/jplt.6.2.2018.21516.
Full textAbstract:
Indonesia is a rich source of biodiversity and having a richness species of marine organisms. Indonesia has around 17,000 islands, a suitable place for seaweed growth because of its long coastline. There are around 782 species of seaweed in Indonesia with 196 species of green algae, 134 species of brown algae, and 452 red algae. Any of various seaweeds that potential sources of revenue and mostly can be found around Indonesian waters is Eucheuma sp. including in red algae and can produce carrageenan. Algae Morphological characteristics can be influenced by environmental factors among others: water movement, sunlight, temperature, salinity, and degree of acidity (pH). Beside environmental factors, genetic factors can influence differences in production quality and morphological characteristics of algae. To distinguish morphological characteristics can be analyzed molecularly. In molecular analysis, important steps that must be taken are DNA isolation and genomic DNA amplification. Isolation of red algae DNA in this study using the CTAB method which was modified from Doyle and Doyle (1987), Allen (2006) and Nugroho et al. (2015). Amplification of red algae genomic DNA (Eucheuma sp.) Using COX2 and rbcL genes on PCR. The success of the genomic DNA isolation process and the amplification of COX2 and rbcL genes from Eucheuma sp. detected through UV transilluminator after going through a gel electrophoresis process. Based on this study, several modifications need to be carried out in the DNA isolation stage Eucheuma sp. by using the method of Doyle and Doyle (1987) modifications that need to be carried out include adding vitamin C and liquid nitrogen. Furthermore DNA of Eucheuma sp. successfully amplified by using F-577 and R-753 primers. Indonesia merupakan negara yang kaya akan sumber keanekaragaman hayati dan memiliki kekayaan spesies laut tertinggi. Indonesia memiliki sekitar 17.000 pulau, menjadi tempat yang cocok untuk pertumbuhan rumput laut karena garis pantainya yang panjang. Terdapat sekitar 782 spesies rumput laut di Indonesia dengan 196 spesies alga hijau, 134 spesies alga cokelat, dan 452 alga merah. Salah satu jenis rumput laut yang potensial dan banyak dijumpai di perairan Indonesia adalah Eucheuma sp. yang termasuk dalam alga merah dan dapat menghasilkan karaginan. Karakteristik morfologi alga dapat dipengaruhi oleh faktor lingkungan antara lain : gerakan air, cahaya matahari, suhu, salinitas dan derajat keasaman (pH). Selain faktor lingkungan, faktor genetik dapat mempengaruhi perbedaan kualitas produksi dan karakteristik morfologi pada alga. Untuk membedakan karakteristik morfologi dapat dianalisis secara molekuler. Dalam analisis molekuler, langkah penting yang harus dilakukan adalah isolasi DNA dan amplifikasi DNA genomik. Isolasi DNA alga merah dalam penelitian ini menggunakan metode CTAB yang di modifikasi dari Doyle dan Doyle, (1987), Allen, (2006) dan Nugroho dkk, (2015). Amplifikasi DNA genomik alga merah (Eucheuma sp.) menggunakan gen COX2 dan rbcL pada PCR. Keberhasilan proses isolasi DNA genomik dan amplifikasi gen COX2 dan rbcL dari Eucheuma sp. dideteksi melalui UV transilluminator setelah melalui proses elektroforesis gel. Berdasarkan penelitian ini, beberapa modifikasi perlu dilaksanakan dalam tahap isolasi DNA Eucheuma sp. dengan menggunakan metode Doyle dan Doyle, (1987) modifikasi yang perlu dilaksanakan meliputi penambahan vitamin C dan nitrogen cair. Selanjutnya DNA Eucheuma sp. berhasil diamplifikasi dengan menggunakan primer F-577 dan R-753.
45
Albini, Dania, Mike S. Fowler, Carole Llewellyn, and Kam W. Tang. "Turning defence into offence? Intrusion of cladoceran brood chambers by a green alga leads to reproductive failure." Royal Society Open Science 7, no. 9 (September 2020): 200249. http://dx.doi.org/10.1098/rsos.200249.
Full textAbstract:
Microalgae are the foundation of aquatic food webs. Their ability to defend against grazers is paramount to their survival, and modulates their ecological functions. Here, we report a novel anti-grazer strategy in the common green alga Chlorella vulgaris against two grazers, Daphnia magna and Simocephalus sp. The algal cells entered the brood chamber of both grazers, presumably using the brood current generated by the grazer's abdominal appendages. Once inside, the alga densely colonized the eggs, significantly reducing reproductive success. The effect was apparent under continuous light or higher light intensity. The algal cells remained viable following removal from the brood chamber, continuing to grow when inoculated in fresh medium. No brood chamber colonization was found when the grazers were fed the reference diet Raphidocelis subcapitata under the same experimental conditions, despite the fact that both algal species were readily ingested by the grazers and were small enough to enter their brood chambers. These observations suggest that C. vulgaris can directly inflict harm on the grazers' reproductive structure. There is no known prior example of brood chamber colonization by a microalgal prey; our results point to a new type of grazer–algae interaction in the plankton that fundamentally differs from other antagonistic ecological interactions.
46
Levy, Jacqueline L., Jenny L. Stauber, Steven A. Wakelin, and Dianne F. Jolley. "The effect of field-collected biofilms on the toxicity of copper to a marine microalga (Tetraselmis sp.) in laboratory bioassays." Marine and Freshwater Research 62, no. 12 (2011): 1362. http://dx.doi.org/10.1071/mf10313.
Full textAbstract:
Standard algal growth rate inhibition bioassays can lack environmental realism and may over- or underestimate metal bioavailability in natural systems. In aquatic environments, algal species interact with other biota, including other algae, bacteria and biofilms. In this work, the feasibility of incorporating marine biofilms into 72 h algal growth inhibition toxicity tests was explored. The effects of copper on Tetraselmis sp. were tested in the absence and presence of characterised field-collected biofilms. We hypothesised that the addition of biofilm would prevent copper toxicity to the alga primarily through interactions of the metal with other cells and biofilm exudates. The sensitivity of Tetraselmis sp. to copper (based on 72 h IC50 values; the copper concentration to inhibit population growth by 50%) in the presence of a blended biofilm inoculum varied 2-fold and was independent of the amount of biofilm added. However, increases in IC10 and IC20 values indicated some amelioration of copper toxicity. When intact biofilms were added to the bioassays, amelioration of toxicity was more consistent, probably due to increased binding of copper to cell surfaces or exudates. Difficulties in characterising biofilms and distinguishing that material from the test alga need to be overcome before biofilms can be routinely incorporated into laboratory bioassays.
47
Tattersall, Glenn J., and Nicole Spiegelaar. "Embryonic motility and hatching success of Ambystoma maculatum are influenced by a symbiotic alga." Canadian Journal of Zoology 86, no. 11 (November 2008): 1289–98. http://dx.doi.org/10.1139/z08-115.
Full textAbstract:
To augment O2 supply through the jelly mass and egg capsule, embryonic yellow-spotted salamanders ( Ambystoma maculatum (Shaw, 1802)) take advantage of a unicellular alga, Oophila ambystomatis . Convective currents from surface cilia, however, may also enhance O2 transport, whereas muscular contractions could either enhance delivery or contribute to O2 consumption. Embryonic motion is, therefore, potentially vital to salamander development. We examined embryonic motility across multiple developmental stages, survivorship, and hatching timing in response to different algal levels by rearing salamander egg masses under three different diel light cycles: 24 h dark, 12 h light, and 24 h light per day. Embryos raised in continuous light hatched synchronously and at slightly earlier developmental stages than embryos raised in the dark or in 12 h light per day. We removed eggs at multiple stages to examine embryonic rotation and muscular contraction rates under 180 min periods of both light and dark. Rotational movements occurred more frequently in alga-free than in algae-inhabited eggs, and more frequently in algae-inhabited eggs in the dark than in light. At later developmental stages, muscular contractions were more frequent in embryos from algae-inhabited egg masses in light than those in the dark; thus embryos with less O2 reduced muscular activity, thereby reducing energy consumption when O2 availability was compromised.
48
Liu, Chenlin, and Xiuliang Wang. "Superoxide dismutase and ascorbate peroxidase genes in Antarctic endemic brown alga Ascoseira mirabilis (Ascoseirales, Phaeophyceae): data mining of a de novo transcriptome." Botanica Marina 63, no. 6 (December 16, 2020): 541–49. http://dx.doi.org/10.1515/bot-2020-0025.
Full textAbstract:
AbstractThe Antarctic endemic brown alga Ascoseira mirabilis is physically and physiologically well adapted to the extreme polar environment. To better understand the molecular strategies associated with stress adaptation, the transcriptome of A. mirabilis was sequenced, and its antioxidant enzyme genes were identified and compared with other algae. A total of 126,576 unigenes with a mean length of 734 bp and N50 of 1174 bp was assembled from the transcriptome data. Phylogenetic analysis revealed that dramatic evolutionary changes had occurred in the brown algal superoxide dismutases (SODs) and class I peroxidases that were not consistent with the phylogeny of the species. Fe/Mn SODs are more prevalent in brown algae than in red and green algae. Two additional Fe-SODs in A. mirabilis were phylogenetically closely related to those of green algae, but not to those in other brown algae. We also identified three A. mirabilis ascorbate peroxidase (APx) genes that had a different origin from other brown algal APxs. The SOD and APx genes specifically identified in A. mirabilis will be crucial for understanding the evolution of the algal antioxidant enzymes that contribute to ecological success under extreme environmental conditions in the Antarctic region.
49
Tang, Kam, Claudia Dziallas, Kristine Hutalle-Schmelzer, and Hans-Peter Grossart. "Effects of food on bacterial community composition associated with the copepod Acartia tonsa Dana." Biology Letters 5, no. 4 (April 8, 2009): 549–53. http://dx.doi.org/10.1098/rsbl.2009.0076.
Full textAbstract:
The estuarine copepod Acartia tonsa naturally carried diverse strains of bacteria on its body. The bacterial community composition (BCC) remained very conservative even when the copepod was fed different axenic algal species, indicating that the food per se did not much affect BCC associated with the copepod. In xenic algal treatments, however, copepod-associated BCC differed with each alga fed, even though the same bacterial source was used to inoculate the algae. In addition, starved copepods taken at the same location but at different times significantly differed in their BCC. Algal species composition and copepod life history therefore serve to regulate BCC associated with copepods, and spatial and temporal variations in algal species composition and copepod origin would alter bacteria–copepod interactions.
50
Gregory, James A., Aaron B. Topol, David Z. Doerner, and Stephen Mayfield. "Alga-Produced Cholera Toxin-Pfs25 Fusion Proteins as Oral Vaccines." Applied and Environmental Microbiology 79, no. 13 (April 19, 2013): 3917–25. http://dx.doi.org/10.1128/aem.00714-13.
Full textAbstract:
ABSTRACTInfectious diseases disproportionately affect indigent regions and are the greatest cause of childhood mortality in developing countries. Practical, low-cost vaccines for use in these countries are paramount to reducing disease burdens and concomitant poverty. Algae are a promising low-cost system for producing vaccines that can be orally delivered, thereby avoiding expensive purification and injectable delivery. We engineered the chloroplast of the eukaryotic algaChlamydomonas reinhardtiito produce a chimeric protein consisting of the 25-kDaPlasmodium falciparumsurface protein (Pfs25) fused to the β subunit of the cholera toxin (CtxB) to investigate an alga-based whole-cell oral vaccine. Pfs25 is a promising malaria transmission-blocking vaccine candidate that has been difficult to produce in traditional recombinant systems due to its structurally complex tandem repeats of epidermal growth factor-like domains. The noncatalytic CtxB domain of the cholera holotoxin assembles into a pentameric structure and acts as a mucosal adjuvant by binding GM1 ganglioside receptors on gut epithelial cells. We demonstrate that CtxB-Pfs25 accumulates as a soluble, properly folded and functional protein within algal chloroplasts, and it is stable in freeze-dried alga cells at ambient temperatures. In mice, oral vaccination using freeze-dried algae that produce CtxB-Pfs25 elicited CtxB-specific serum IgG antibodies and both CtxB- and Pfs25-specific secretory IgA antibodies. These data suggest that algae are a promising system for production and oral delivery of vaccine antigens, but as an orally delivered adjuvant, CtxB is best suited for eliciting secretory IgA antibodies for vaccine antigens against pathogens that invade mucosal surfaces using this strategy.