Journal articles on the topic 'Amarium 153'

<p>ABSTRAK<br />Penggunaan varietas jahe yang responsif terhadap pemupukan dosis<br />rendah, diharapkan mampu meningkatkan efisiensi pemupukan dan<br />menekan pencemaran lingkungan. Penelitian dengan tujuan untuk<br />mengetahui respon lima aksesi jahe putih kecil terhadap pemupukan dosis<br />rendah telah dilaksanakan di Kebun Percobaan Cimanggu pada bulan<br />Agustus 2009 sampai Mei 2010. Lima aksesi jahe putih kecil dari daerah<br />marginal ditanam dalam polibag dan disusun menggunakan rancangan<br />acak kelompok yang diulang 3 kali. Setiap perlakuan terdiri atas 20<br />tanaman. Dua perlakuan yang diuji secara faktorial adalah, faktor I adalah<br />5 aksesi jahe putih kecil, yaitu (1) Ziof 0004, (2) Ziof 0007, (3) Ziof 0008,<br />(4) Ziof 0013, dan (5) Ziof 0014, dan faktor II adalah dosis pupuk, yaitu<br />(a) 50% dosis anjuran (200 kg/ha urea + 150 kg/ha SP-36 + 150 kg/ha<br />KCl), (b) 75% dosis anjuran (300 kg/ha urea + 225 kg/ha SP-36 + 225<br />kg/ha KCl), dan (c) dosis anjuran (400 kg/ha urea + 300 kg/ha SP-36 +<br />300 kg/ha KCl). Masing-masing perlakuan diberi pupuk kandang sebagai<br />pupuk dasar dengan dosis 20 t/ha. Pengamatan dilakukan terhadap<br />parameter pertumbuhan (tinggi tanaman, jumlah anakan, diameter batang,<br />dan jumlah daun), hasil dan serapan unsur hara N, P, dan K pada umur 4<br />BST dan 9 BST. Hasil penelitian menunjukkan bahwa masing-masing<br />aksesi memberikan respon yang berbeda terhadap penurunan dosis pupuk,<br />baik pada fase pertumbuhan maupun produksi tanaman jahe. Pengurangan<br />dosis pupuk sampai 25% tidak mengurangi produksi jahe, tetapi penurunan<br />dosis pupuk sampai 50% dari dosis rekomendasi menyebabkan penurunan<br />produksi jahe secara nyata. Komposisi unsur hara N, P, dan K yang<br />diserap berbeda pada setiap fase pertumbuhan tanaman.<br />Kata kunci : Aksesi, Zingiber officinale, pemupukan, pertumbuhan,<br />produksi</p><p>ABSTRACT<br />Response of five accessions of small white ginger to<br />fertilizers<br />The use of ginger varieties responsive to low fertilization dosages,<br />is expected to increase fertilizer use efficiency and reduce environmental<br />pollution. Research aimed at observing response of five small white ginger<br />accessions of low-dosage fertilization has been conducted in the Cimanggu<br />Experimental Station in from August 2009 through May 2010. Five small<br />white ginger accessions from marginal areas were planted in polybags.<br />The experiment was and arranged using a randomized block design was<br />repeated with 3 times replications. Each treatment consisted of 20 plants.<br />Two treatments were tested factorially, where factor I : 5 small white<br />ginger accessions, namely (1) Ziof 0004, (2) Ziof 0007, (3) Ziof 0008, (4)<br />Ziof 0013, and (5) Ziof 0014, and factor II : 3 fertilization dosages is<br />dosage of fertilizer, namely (a) 50% recommendation dosage (200 kg urea<br />+ 150 kg SP-36 + 150 kg KCl per hectare), (b) 75% recommendation<br />dosage (300 kg urea + 225 kg SP-36 + 225 kg KCl per hectare), and (c)<br />recommendation dosage (400 kg Urea + 300 kg SP-36 + 300 kg KCl per<br />hectare). Each treatment was given 20 t/ha of manure as basal fertilizer.<br />The parameters observed were growth parameters (plant height, number of<br />tillers, stem diameter, and number of leaves), yield and nutrient uptake of<br />N, P, and K at 4 and 9 months after planting (MAP). The results showed<br />that each of the accessions responded differently to the reduction of<br />fertilizer dosages, either in vegetative or generative growth phase of ginger<br />plants. Reduction of fertilizer dosages to 25% did not significantly reduce<br />the yield of ginger, however, fertilizer dosages reduction up to 50% of the<br />recommended dosages led to significant decrease of ginger yield.<br />Compositions of N, P, and K nutrients absorbed by plants were different in<br />every phase of plant growth.<br />Keywords : Accessions, Zingiber officinale, fertilizer, growth, yield</p>

The phytocomponents of the leaf and root extracts of Phyllanthus amarus (Euphorbiaceae) were studied. The constituents of the leaves and roots were identified and quantified by using GC-MS. Result from the phytochemical analyses showed the presence of saponins, tannins, phenolics, anthocyanins, and glycosides in both leaves and root of the plant. Alkaloids and triterpenoids were, however only absent in the root of P. amarus but present in the leaves of the plant. Flavonoids, coumarins and steroids were absent in the leaves but present in the root part. The mean concentration of the phytochemicals investigated in leaves are 0.73±0.01%, 1.85±0.03%, 1.12±0.01%, 1.80±0.01%, 1.59±0.50%, 0.13±0.10%, and 0.86±0.01%, for saponins, tannins, phenolics, anthocyanins, alkaloids, triterpenoids, and glycosides respectively, while the mean concentration of the phytochemicals investigated in roots are 0.91±0.01%, 1.53±0.03%, 0.70±0.01%, 2.97±0.10%, 2.47±0.03%, 0.62±0.01%, 0.90±0.01% and 2.02±0.10% for saponins, tannins, phenolics, steroids, flavonoids, anthocyanins, glycosides and coumarins respectively. Furthermore, the GC-MS analysis of methanol extracts of the leaves and root of P. amarus revealed the presence of three medicinally important bioactive compounds, which are: 9-Octadecenoic acid which has percentage of abundance of 92.23% and 82.46% in leaves and roots of the plant respectively, followed by n-Hexadecanoic acid and Tetradecanoic acid with their corresponding percentage of abundance of 7.7% and 17.54% for leaves and root. These analytical results suggest the plantto possess a significant role in phyto-medicine. The importance of this plant was discussed in line with the role they play in ethnomedicinal life of the people. Keywords: Phyllanthus amarus; Phytochemicals; GC-MS; methanolic extract; Phytocomponents

ABSTRACT Objective The aim of this study was to evaluate the effect of chemical degradation media associated with brushing on surface roughness (Ra) and Knoop microhardness (KHN) analyses of different composites. Materials and methods Eighty specimens were prepared for each composite: GrandioSO (Voco), Amaris (Voco), Filtek Supreme (3M ESPE), Filtek LS (3M ESPE). The specimens were divided into four groups according to the immersion in chemical degradation media for 7 days: artificial saliva (control), heptane, 0.02 M citric acid, 70% ethanol. The surface of specimens was submitted to 10950 brushing cycles (200 gm load) in an automatic toothbrushing machine with abrasive slurry. Surface roughness and microhardness measurements were obtained at baseline, after immersion in chemical degradation media and after brushing. Data were submitted to three-way repeated measures ANOVA and Tukey's test (p < 0.05). Results The KHN means for composites were: Grandio (153.5 ± 35.9)a, Filtek Supreme (87.0 ± 24.9)b, Amaris (64.5 ± 24.5)c, LS (69.0 ± 15.3)c; for storage media: artificial saliva (97.3 ± 46.7)a, ethanol (93.3 ± 49.9)a, citric acid (95.8 ± 42.1)a, heptane (87.6 ± 36.7)b; and after treatments: after chemical degradation (104.8 ± 49.7)a, baseline (93.8 ± 42.5)b, after brushing (81.9 ± 36.5)c. The Ra results for composites were: LS (0.15 ± 0.25)a, GrandioSO (0.19 ± 0.24)ab, Filtek Supreme (0.20 ± 0.22)ab, Amaris (0.23 ± 0.37)b; for storage media: artificial saliva (0.18 ± 0.31)a, heptane (0.18 ± 0.25)a, ethanol (0.20 ± 0.26)a, citric acid (0.21 ± 0.28)a, and after treatments: brushing (0.11 ± 0.14)a, after chemical degradation (0.23 ± 0.32)b, baseline (0.24 ± 0.32)b. Conclusion Brushing after chemical degradation reduced surface roughness values. In general, chemical degradation did not affect composites roughness, but microhardness was significantly reduced. Heptane produced the biggest reduction in composites microhardness. Clinical relevance The food-simulating solutions and brushing simulating alter the composites properties, and these alterations are material-dependent. How to cite this article Torres CRG, Da Silva TM, Sales ALLS, Pucci CR, Borges AB. Influence of Chemical Degradation and Toothbrushing on Surface of Composites. World J Dent 2015;6(2):65-70.

La ciudad de Lima, desde su fundación (18 de enero de 1535) hasta la actualidad, ha experimentado una gradual transformación tanto en su estructura urbana como en su población. Este proceso, sin embargo, se hizo más rápido y hasta violento a partir de la década del 80 del siglo pasado por surgimiento y acción del Movimiento Revolucionario Túpac Amaru y de Sendero Luminoso. La década de la guerra de 1980 a 1990 desplazó poblaciones íntegras del campo a la ciudad, de modo tal que Lima terminó siendo la ciudad serrana más grande del país. Nosotros queremos, en esta oportunidad, referirnos a la composición social de Lima que aparece en las Tradiciones Peruanas de Ricardo Palma.

Watermelon belongs to the genus Citrullus. There have been continuing interests in breeding of watermelon for economic benefits, but information on the scope and utilization of genetic variations in Citrullus is still limited. The present study was conducted in 2012–13, to evaluate the genetic diversity and population structure of the 1197 line watermelon collection maintained by the Beijing Vegetable Research Center (BVRC), which belongs to seven Citrullus species including Citrullus naudinianus, Citrullus colocynthis, Citrullus rehmii, Citrullus ecirrhosus, Citrullus amarus, Citrullus mucosospermus, and Cirullus lanatus subsp. vulgaris. Twenty-three highly informative microsatellite markers evenly distributed in the watermelon genome were used to assess genetic diversity in this collection. The markers detected on an average of 6.05 alleles per locus with the average value of polymorphism information content (PIC) at 0.49. A high level of gene diversity [Nei’s gene diversity index (Nei) = 0.56] and a low observed heterozygosity (Ho = 0.10) were revealed within the collection. Structure analysis grouped the 1197 accessions into two main populations (Pop I and Pop II) and an admixture group. Pop I contained 450 accessions from C. lanatus subsp. vulgaris (446) and C. mucosospermus (4). Pop II comprised 465 accessions, 379 of which belonged to C. lanatus subsp. vulgaris and 86 to C. naudinianus (3), C. ecirrhosus (2), C. rehmii (2), C. colocynthis (11), C. amarus (58), and C. mucosospermus (10). The remaining 282 accessions were classified as an admixture group. The two main populations were further subdivided into four subgroups. The groupings were consistent with the estimation of F statistics (Fst) and Nei’s genetic distances in collections. We confirmed the distinct genetic backgrounds between American and East Asian ecotypes. Subsequently, we defined a core set consisting of 130 accessions including 47 from Pop I, 68 from Pop II, and 15 from the Admixture group. This core set was able to capture all 133 alleles detected by 23 simple sequence repeats (SSRs) in 1197 accessions. These results will facilitate efficient use of genetic variations in Citrullus in watermelon breeding and help optimization of accessions in genomewide association studies.

El presente trabajo se realizó en la SAIS Túpac Amaru, localizada en -11.76° latitud sur y longitud -75.73°, sierra central del Perú. La altitud fluctúa entre 3600 a 4800 msnm, con temperaturas que oscilan entre -5°C a 18°C. El objetivo del estudio, fue analizar la prevalencia de la adenomatosis pulmonar ovina, para lo cual se consideró como población a 74,179 ovinos de la raza Junín. El método utilizado fue el análisis de los registros de mortalidad de ovinos en los últimos cuatro años, considerando, clases de ganado, edad y sexo. Se concluye que la enfermedad ha ocasionado una mortalidad de 4,670 ovinos durante el período de cuatro años, es decir el 1.45% de la población en promedio.Los animales adultos, son la mayoría de los casos muertos, existiendo también mortalidad en animales jóvenes, en machos con mayor frecuencia que en hembras. En cuanto a la media de la tasa de prevalencia puntual, se determinó un 1.5 % anual a nivel de la SAIS Túpac Amaru. Habiéndose encontrado la mayor tasa en capones 9.6%, seguido por carneros 4.5 % y borregas 2.2 %; aunque se observó también en animales jóvenes como: corderos 0.1%, borreguillas 0.4 %, carnerillos 1.3 % y caponcillos 1.6 %; lo cual indica que la enfermedad es prevalente en todas las edades y clases.La tasa de prevalencia acumulada va en incremento: 5.8 % (IC 0.05 a 0.06) a nivel de SAIS en cuatro años considerados en el presente estudio. Siendo más preocupante el caso de corderos que también va en incremento 0.6 %. Este hecho constituye un gran problema sanitario muy grave en la explotación ganadera por cuanto merma la producción y afecta directamente la rentabilidad de la empresa, y requiere ser abordada muy seriamente a nivel de política ganadera por parte del estado y todas las universidades.

The development of resistance to some synthetic antimalarial drugs and the spread of counterfeit antimalarial drugs, has become a global problem. It has affected effective malaria treatment, making the development of new drugs exigent. Certain medicinal plants contain potent ingredients such as alkalloids, flavonoids, glycoside and volatile oils, which suppress the spread of plasmodial infections, and are widely used within the tropics for treatment of malaria. This study was designed to investigate the antiplasmodial activities of the combined aqueous extract of Morinda lucida, Phyllantus amarus, Vernonia amygdalina and Newbouldia laevis at variable doses in Swiss albino mice infected with Plasmodium berghei (NK65). Fifty mice were randomized into ten groups which were divided equally for suppressive and curative test. Four days suppressive and 5 days curative test were used to assess the antiplasmodial activities of the extract in mice infected with chloroquine sensitive P. berghei at concentration of 200mg/kg, 400mg/kg and 800mg/kg body weight. Furthermore the levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and alkaline phosphate (ALP), urea and creatinin were determined by standard procedural methods to evaluate impact of extracts on hepatic and kidney function. The results of the 4 days suppressive test revealed that the test extract achieved percentage suppression of 9.8%, 58.3% and 60.2% for 200mg/kg, 400mg/kg and 800mg/kg concentration respectively. The curative test achieved the highest parasitaemia reduction with 800mg/kg (29.5±29.1 x 103) which was comparable to the standard antimalarial drug, chloroquine. There were significant elevation in the values of AST and ALT at 400mg/kg and 800mg/kg respectively suggesting hepatic dysfunction. However, ALP and urea showed no significant different (P>0.05), but creatinin showed significant difference (P<0.05) only at 200mg/kg. This study shows that the combined leaves extract demonstrated antimalarial activities.

Icosapent ethyl (Vascepa) is a purified preparation of the omega-3 fatty acid eicosapentaenoic acid, which is marketed by Amarin Pharma based in Ireland. The product was initially approved by the US Food and Drug Administration for the use of a high dose (4 g/day) in the treatment of hypertriglyceridaemia. On the basis of the results of the REDUCE-IT (Reduction of Cardiovascular Events with Icosapent Ethyl Intervention Trial), the agency later granted a label extension to include the additional indication of a reduction in risk of cardiovascular events in persons with serum triglyceride levels of 150 mg/dL or greater and established cardiovascular disease or diabetes. Data supporting the efficacy of omega-3 fatty acids in the prevention of cardiovascular disease have been inconsistent and controversial. The story of the development of icosapent ethyl has been fraught with challenges, including the invalidation of six core patents on the product, and recently, the completion of a new clinical trial, STRENGTH (Long-Term Outcomes Study to Assess STatin Residual Risk Reduction With EpaNova in HiGh CV Risk PatienTs With Hypertriglyceridemia), that directly contradicts REDUCE-IT and calls into question whether icosapent ethyl is actually effective in the secondary prevention of cardiovascular events. This article traces the course of the development of this fascinating product and discusses its complex medical, regulatory and legal history, which is still continuing to unfold.

<p><span lang="EN-US">Herein, we report the successful surgical treatment of the case of a 13-year-old patient with combined pulmonary artery stenosis, critical stenosis of the xenopericardial conduit and aortic valve insufficiency after two </span><span lang="EN-GB">previous </span><span lang="EN-US">operations </span><span lang="EN-GB">(</span><span lang="EN-US">radical correction of the common arterial trunk during the neonatal period and replacement of the right ventricular excretory tract conduit with branch plasty </span><span lang="EN-GB">at three years of age). </span><span lang="EN-US">According to echocardiography, the peak pressure gradient across the conduit was 110 mmHg, along with aortic valve regurgitation of the third degree. According to </span><span lang="EN-GB">computerised tomography </span><span lang="EN-US">angiography, there was narrowing of the right pulmonary artery up to 3 mm distally along with total calcification of the conduit and branches of the pulmonary artery with an intimate fit to the chest wall. </span><span lang="EN-US">The </span><span lang="EN-US">trunk of </span><span lang="EN-US">the </span><span lang="EN-US">pulmonary artery </span><span lang="EN-US">was replaced </span><span lang="EN-US">with a </span><span lang="EN-US">valve-</span><span lang="EN-US">containing </span><span lang="EN-US">conduit <span lang="EN-US">CARBOMEDICS СARBO-SEAL</span></span><span lang="EN-US"> No.25 (LivaNova PLC, London, United Kingdom); </span><span lang="EN-US">right </span><span lang="EN-US">pulmonary artery plasty was performed with a </span><span lang="EN-US">xenopericardial</span><span lang="EN-US"> patch</span><span lang="EN-US">;</span><span lang="EN-US"> aortic valve was </span><span lang="EN-US">replaced </span><span lang="EN-US">with <span lang="EN-US">CARBOMEDICS СARBO-SEAL</span> No.23 (LivaNova PLC, London, United Kingdom), a mechanical prosthesis, and </span><span lang="EN-US">supracoronary prosthetics were used for</span><span lang="EN-US"> the ascending aorta. </span><span lang="EN-GB">The duration of </span><span lang="EN-US">cardiopulmonary bypass</span><span lang="EN-GB">was </span><span lang="EN-US">309 minutes, </span><span lang="EN-US">cross-clamp</span><span lang="EN-GB">was </span><span lang="EN-US">142 minutes and circulatory arrest </span><span lang="EN-GB">was </span><span lang="EN-US">49 minutes, with </span><span lang="EN-US">26°C hypothermia</span><span lang="EN-US">. Extubation </span><span lang="EN-GB">was performed </span><span lang="EN-US">10 hours after </span><span lang="EN-GB">surgery, and he spent 3 days </span><span lang="EN-US">in intensive care. The duration of </span><span lang="EN-GB">hospitalisation was </span><span lang="EN-US">26 days. </span><span lang="EN-GB">He was examined </span><span lang="EN-US">after </span><span lang="EN-GB">6 months, and there were no </span><span lang="EN-US">complaints. </span><span lang="EN-GB">The presented clinical case shows that implantation of a mechanical prosthesis is justified with repeated reoperations on the outflow tract of the right ventricle and the pulmonary trunk, and it may be the surgery of choice.</span></p><p>Received 3 September 2020. Revised 1 October 2020. Accepted 5 October 2020.</p><p><strong>Funding:</strong> The study did not have sponsorship.</p><p><strong>Conflict of interest:</strong> Authors declare no conflict of interest.</p><p><strong>Author contributions</strong><br />Drafting the article: S.A. Belash, M.M. Amari<br />Literature review: S.A. Belash, M.M. Amari<br />Illustrations: S.S. Shevchenko, A.K. Shadrin<br />Critical revision of the article: K.O. Barbukhatti, S.A. Belash, N.B. Karakhalis, V.A. Porkhanov<br />Final approval of the version to be published: K.O. Barbukhatti, S.A. Belash, S.S. Shevchenko, M.M. Amari, N.B. Karakhalis, A.K. Shadrin, V.A. Porkhanov</p>

Berdasarkan data yang diperoleh dari rekam medik RS Jala Amari Makassar, pada tahun 2016 jumlah ibu hamil sebanyak 274 dengan kejadian Hyperemesis gravidarum sebanyak 51, pada tahun 2017 sebanyak 280 dengan kejadian Hyperemesis gravidarum sebanyak 67, pada tahun 2018 sebanyak 296 dengan kejadian Hyperemesis gravidarum sebanyak 79, dan pada bulan Januari sampai Mei tahun 2019 sebanyak 143 ibu hamil dengan kejadian Hyperemesis gravidarum sebanyak 22 kejadian. Tujuan dilakukannya penelitian ini adalah untuk mengetahui hubungan antara pekerjaan, gestasi, usia ibu dan paritas ibu terhadap kejadian hyperemesis gravidarum di RS AL Jala Ammari Makassar Tahun 2019. Penelitian ini menggunakan metode penelitian dengan menggunakan pendekatan Cross Sectional Study untuk mengetahui factor berhubungan terhadap kejadian hyperemesis gravidarum Populasi dan sampel dalam penelitian ini adalah semua ibu hamil pada bulan Januari sampai Mei 2019 di RS AL Jala Ammari Makassar sebanyak 143 orang, Dari hasil uji statistic dengan menggunakan uji Chi-Square (Fisher’s Exact Test) diperoleh untuk variabel pekerjaan ibu diperoleh nilai p (0,90) < ɑ (0,05), artinya tidak ada hubungan antara pekerjaan ibu dengan kejadian hyperemesis gravidarum , variabel gestasi diperoleh nilaip p (0,65) <ɑ (0,05), artinya tidak ada hubungan antara gestasi dengan hyperemesis gravidarum , variabel usia ibu diperoleh nilai p (0,004) <ɑ (0,05), artinya ada hubungan antara usia ibu dengan kejadian hyperemesis gravidarum , dan untuk variabel paritas diperoleh nilai p (0,982) >ɑ (0,05),artinya tidak ada hubungan paritas dengan kejadian hyperemesis gravidarum. Kesimpulan dari variabel pekerjaan, gestasi dan paritas yaitu tidak ada hubungan dengan kejadian hyperemesis gravidarum di RS AL Jala Ammari Makassar dan variabel usia ibu ada hubungan dengan kejadian hyperemesis gravidarum sehingga diharapkan kepada ibu hamil rutin untuk memeriksakan kehamilannya demi mencegah secara dini terjadinya hyperemesis gravidarum serta bagi peneliti berikutnya mmencari variable lain yang diduga menjadi penyebab terjadinya hyperemesis gravidarum.

Abstract Background: Lenalidomide and low-dose dexamethasone (Rd)-based therapies are widely used in the USA, while both Rd and bortezomib, melphalan, and prednisone (VMP) are used in Europe as first-line treatments (Txs) for patients (pts) ineligible to receive ASCT (Moreau P, et al. Ann Oncol. 2017;28:52-61). Of these, only Rd has the advantage of being an oral therapy which stimulates the immune system, is non-stem cell toxic, and has demonstrated both progression-free survival (PFS) and overall survival (OS) advantages compared with melphalan, prednisone and thalidomide (MPT). Rd is generally well tolerated, enabling pts to benefit from continuous therapy in contrast to the fixed duration employed for VMP. Newer regimens, such as the quadruplet daratumumab (Dara) in combination with VMP, have shown improved PFS vs VMP in the ALCYONE study, however, are yet to demonstrate an OS benefit (Mateos MV, et al. N Engl J Med. 2018;378:518-28). No study has compared VMP + Dara with Rd. Although clinical considerations are important in Tx decisions, combination regimens involving newer agents tend to add costs and require demonstration of significant added value to be considered cost-effective, especially given their potential impact on health system budgets. This analysis assessed the cost-effectiveness of Rd vs VMP, and compared these regimens with VMP + Dara, as first-line therapy for NDMM pts ineligible for ASCT from the perspective of the national health services (NHSs) of EU5 countries. Methods: A partitioned survival model was developed to model PFS and OS over a lifetime horizon. PFS and OS parametric functions for Rd were derived using published real-world Kaplan-Meier curves. A network meta-analysis was conducted to derive hazard ratios (HRs) for Rd vs VMP + Dara and vs VMP. In the absence of OS data for VMP + Dara, any advantages in survival are unknown. For the purposes of this analysis, a conservative estimate of OS equivalency compared with Rd was used, yet a range of values are possible. Drug acquisition costs were sourced from national drug price databases. Resource utilization costs were sourced from UK NHS reference costs and converted to EU5 country costs using producer price indices published by OECD; an average of all EU5 country costs was used. EQ-5D utilities for pre- and post-progression disease states were taken from Ramsenthaler C, et al. BMC Cancer. 2016;16:427. Disutilities for regimens requiring subcutaneous injections and intravenous infusions were applied (Stopeck A, et al. J Med Econ. 2012;15:712-23). Results: The base case analysis produced a total number of 3.17, 2.23, and 3.12 quality-adjusted life years (QALYs) for Rd, VMP, and VMP + Dara, respectively. The incremental cost-effectiveness ratio (ICER) for Rd vs VMP was EUR 43,030/QALY, indicating that Rd is cost-effective vs VMP at a willingness-to-pay threshold of EUR 50,000/QALY. Rd dominates VMP + Dara, having a greater gain in QALYs at lower cost. The ICER for VMP + Dara vs VMP was EUR 202,903, well above any acceptable cost-effectiveness threshold in Europe. Discussion: Achieving durable remission while minimizing toxicities in first-line Tx is an important Tx goal, as it has a bearing on the subsequent Tx journey both from an outcome and cost perspective. Individual country pharmacoeconomic assessments have shown Rd is cost-effective vs VMP (SMC No 1096/15, 2015; AWMSG advice 2116, July 2016; Usmani SZ, et al. J Med Econ. 2016;19:243-58), and a recent cost impact analysis suggested substantial cost savings with Rd use relative to VMP + Dara at first-line Tx (Jackson G, et al. HemaSphere 2018;2:PS1429). Limited clinical data and experience with VMP + Dara mean that estimates of long-term clinical outcomes (e.g. OS) associated with this regimen and costs of managing adverse events are not fully known and may not accurately reflect outcomes in clinical practice. In contrast, PFS and OS benefits for Rd vs MPT have been demonstrated (Facon T, et. al Blood. 2018;131:301-10), and an indirect Tx comparison reported statistically significant PFS and OS benefits for Rd vs VMP (Weisel K, et al. Leuk Lymphoma. 2017;58:153-61). As additional regimens are evaluated to assess clinical benefits over current standards of care, cost-effectiveness analyses are warranted to help define their place in the management of NDMM. For example, it may be interesting to compare Rd and Rd-based triplet regimens with VMP + Dara once relevant clinical data become available. Disclosures Ashcroft: Janssen: Consultancy, Honoraria, Speakers Bureau; Amgen: Consultancy, Honoraria, Speakers Bureau; Takeda: Consultancy, Honoraria; Celgene Corporation: Consultancy, Honoraria; Amaris Medical: Consultancy, Honoraria. Shephard:Celgene: Consultancy; Amaris Consulting: Employment. Elnoursi:Celgene: Consultancy; Amaris Consulting: Employment. Pelligra:Evidera: Employment. Dhanasiri:Celgene International: Employment, Equity Ownership.

This paper concerns the study of Otoliths coming from the sediments of the L. Pliocene of the region Kefales of the community Prassies at the northern part of Rethymnon (NW- Central Crete), 10 km from it and the places of sampling are along the road Rethymnon- Amari to the village Prassies. These sediments are yellowish with a visible inclination and sedimentary structures overlying in unconformity on the alpic substrate. The sediments of the studied area consist of Miocene, Plio-Pleistocene and Holocene formations. Holocene appears with littoral deposits (sand, gravels and alluvian deposits) 20 m. The Plio - Pleistocene formations –marine deposits- consisting of brawn marls without fossils (upper members), of marls with macrofossils (intermediate members) and white marls and clays with Algae and Pectinidae, Ostreidae, some Gastropods and Echinoids (lower members). Total height 150 m. The Miocene has a total thickness of 200 m. The studied Otoliths belong to the orders: 1. Iniomi (Myctophiformes): Diaphus splendidus (PROCHAZKA 1893), Diaphus sp., Diaphus holti TANING, 1918, Diaphus kokeni (PROCHAZKA 1893), Ceratoskopelus madarensis (LOWE 1839), Myctophidarum edwardsi (SAUVAGE 1873), 2. Anacanthini (Gadiformes): Bregmaceros albyi (SAUVAGE 1880), Macrurus novus BASSOLI, 3. Percomorphi (Perciformes): Gobius vicinalis KOKEN., Gobius sp. The studied Otoliths, mentioned for the first time in Greece, give important results on the biogeography and paleogeography and contribute to our knowledge about this fossilized group.

Aim: We analysed one-year refractive results and the incidence of complications in patients with correction of low-to-high myopia or myopic astigmatism by femtosecond laser in situ keratomileusis (FS-LASIK) using femtosecond laser LenSx® (Alcon, Fort Worth, Texas, USA) a excimer laser Excimer Amaris 500 (Schwind eye-tech-solutions GmbH and Co KG, Kleinostheim, Germany). Methods: To the retrospective study were included 171 eyes of 87 patients (38 men, 49 women) who underwent correction of myopia and myopic astigmatism by FS-LASIK in the outpatient Department of Ophthalmology, University Hospital in Hradec Králové between 2013-2017. We assessed uncorrected visual acuity (UCVA) and best corrected visual acuity (BCVA), subjective refraction, central corneal thickness (CCT) in the thinnest point, patient’s satisfaction and the incidence of complications in the one-year follow-up period. Results: At the time of laser procedure the mean patient‘s age was 29,26 ± 6,47 years (range 18 to 46 years). In 21 eyes was corrected myopia (range -6,5 to -2,5 D sph) and in 150 eyes myopic astigmatism (range -8,75 to -0,25 D sph and -3,0 to -0,25 D cyl). The mean preoperative UCVA 0,06 ± 0,08 (range 0,02 to 0,8) got better to 1,12 ± 0,17 (range 0,8 to 1,5) at the end of follow-up period. There wasn’t statistically significant change in BCVA between preoperative and postoperative values. Preoperative mean value of subjective refraction was -4,14 ± 1,43 D sph (range -8,5 to -1 D sph) and -0,57 ± 0,58 D cyl (range -3 to 0 D cyl) and after 12 months -0,02 ± 0,16 D sph (range -0,1 to 0,75 D sph) and -0,01 ± 0,1 D cyl (range -0,5 to 0,5 D cyl). The initial mean CCT was 554,76 ± 30,07 μm (range 485 to 660 μm), after 6 months 494,06 ± 34,99 μm (range 421 to 594 μm) and after 12 months 492,92 ± 34,55 μm (range 411 to 592 μm). We observed peroperative complications in 3 eyes. The suction loss of femtosecond laser occurred during flap creation due to sudden eye movement. Postoperatively in one case we enrolled flap pucker first postoperative day. In other case flap dislocation occurred after abdonimal surgery under general anesthesia which was performed 3 months after refractive procedure and we had to indicate flap reposition. The mean grade of patient’s satisfaction was at the end of follow-up period 1,04. The most often complaints were the sensation of dry eye (10 patients) and blurry vision during computer working, inadequate lighting and fatique (6 pacients). Conclusions: According to our experience correction of low-to-high myopia or myopic astigmatism by using FS-LASIK is an effective, relatively safe and predictable method. The basic assumption of good postoperative results and patient’s satisfaction is thorough and comprehensive preoperative examination with respect to indication criteria.

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

In June 2008, tomato (Solanum lycopersicum L.) plants cv. Fer De Lance (De Ruiter Seeds, Bergschenhoek, the Netherlands) grown in greenhouses near Perpignan (southern France) showed growth reduction and necrotic lesions on fruits, stems, and basal parts of the leaves. Tomato torrado virus (ToTV) was suspected on the basis of symptoms and its recent description in Spain (4). Primer set A (3), designed to ToTV RNA-2, was used for reverse transcription (RT)-PCR experiments on RNA extracted from four infected plants and allowed the amplification of a 493-bp fragment. No amplification was observed from healthy plant extracts. The RT-PCR product was directly sequenced (GQ303330) and a BLAST search in GenBank revealed 99.8- and 99.5%-nt identity with Polish (EU563947) and Spanish type strain (DQ388880) isolates of ToTV, respectively. Double-antibody sandwich-ELISA tests were conducted on these four samples to check for the presence of other viruses commonly found in tomato crops in France. Tomato spotted wilt virus, Parietaria mottle virus, Cucumber mosaic virus, Tomato mosaic virus, and Potato virus Y were not detected but Pepino mosaic virus (PepMV) was detected in all samples. ToTV was mechanically transmitted to Physalis floridana but PepMV was not. This plant was used to inoculate healthy tomatoes that served as a ToTV source for further experiments. Mechanical inoculation to test plants showed that Nicotiana benthamiana, N. clevelandii, N. debneyi, N. glutinosa, Capsicum annuum, Solanum melongena, and some tomato cultivars (including Fer De Lance), in which typical necrotic symptoms were observed, were systemically infected by the virus. Isometric particles ~28 nm in diameter were observed by electron microscopy in crude extracts of infected plants negatively stained with 1% ammonium molybdate, pH 7. To confirm ToTV identification, whitefly transmission experiments were performed with Trialeurodes vaporariorum and Bemisia tabaci. Adult whiteflies were placed in cages with infected tomato plants for 1-, 24-, or 48-h acquisition access periods (AAP) before transferring them by groups of ~50 on susceptible tomato plantlets placed under small containers (six plants per AAP). Forty-eight hours later, plants were treated with an insecticide and transferred to an insect-proof containment growth room. Ten days later, RNA preparation from all plants was tested by RT-PCR for the presence of ToTV. No transmission was observed with a 1-h AAP. With a 24-h AAP, transmission to four of six test plants was observed with both whitefly species, while at 48 h, AAP transmission to three and four plants of six was observed with T. vaporariorum and B. tabaci, respectively. Noninoculated control plants were all negative by RT-PCR. These experiments confirm T. vaporariorum and B. tabaci as natural vectors of ToTV as previously described (1,2). ToTV has been already reported in Spain, Poland, Hungary, and Australia, but to our knowledge, this is the first report of ToTV in France. Our detection of ToTV in April 2009 from the same area revealed 7 positive tomato plants of 17 tested. This observation suggests the persistence of the disease in the Perpignan Region. References: (1) K. Amari et al. Plant Dis. 92:1139, 2008. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007 (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

Background:Cocaine use disorder is a frequent cause of drug use disorders in the U.S. Although hallucinogen use disorder is less common, both are potentially preventable public health issues. To our knowledge, epidemiological studies estimating burden of cocaine or hallucinogen use disorders in common Musculoskeletal diseases (MSDs) are lacking.Objectives:To assess national time-trends in cocaine use and hallucinogen use disorders in people with MSDsMethods:This study used the U.S. National Inpatient Sample (NIS), a de-identified national all-payer inpatient health care database (https://www.hcup-us.ahrq.gov/nisoverview.jsp) from 1998-2014. The NIS is a 20% stratified sample of hospital discharges in the U.S. It is commonly used to derive national estimates of hospitalization and outcomes. Cocaine or hallucinogen use disorder hospitalization was defined in a validated approach as the presence of the following International Classification of Diseases, Ninth Revision, Clinical Modification (ICD-9-CM) diagnostic codes: cocaine use disorder, 304.2x, or 305.6x; and hallucinogen use disorder, 304.5x or 305.3x; hospitalizations for drug use in remission, drug counseling, rehabilitation or detoxification were excluded, as in previous studies. MSDs were identified based on the respective ICD-9 codes, a validated approach (5-9), in non-primary position: Gout: 274.xx; rheumatoid arthritis (RA): 714.xx; Fibromyalgia: 729.1; osteoarthritis (OA): 715.xx; or low back pain (LBP): 724.Results:In 1998-2000, the highest frequency of cocaine use hospitalizations was in people with LBP: LBP (n=5,914), followed by OA (n=4,931), gout (n=2,093), RA (n=2,026), and fibromyalgia (n=1,620). In 2013-2014, the order changed slightly with OA (n=22,185), followed by LBP (n=16,810), gout (n=10,570), RA (n=8,975), and fibromyalgia (n=5,680). Respective rates per 1 million U.S. NIS hospitalizations in 2013-2014 and the relative increase from 1998-2000 to 2013-2014 were: Gout, 10.2 (increase, 4.1-fold); OA, 21.4 (3.5-fold); fibromyalgia, 5.48 (2.5-fold); RA, 8.66 (3.4-fold); and LBP, 16.22 (1.8-fold; Figure 1).In 1998-2000, hallucinogen use disorder hospitalizations were as follows: LBP (n=176), followed by OA (n=63), RA (n=42), fibromyalgia (n=41) and gout (n<10; cells with frequency of 10 of fewer are reported as <10 per NIS guidance). In 2013-2014, the frequency order was the similar, with the highest numbers for LBP (n=525) followed by OA (n=400), RA (n=395), gout (n=135) and fibromyalgia (n=125). Respective rates per 1 million US NIS hospitalizations in 2013-2014 and the relative increase from 1998-2000 to 2013-2014 were: Gout, 0.13 (increase, 25-fold); OA, 0.39 (5.5-fold); fibromyalgia, 0.12 (2-fold); RA, 0.38 (8.5-fold); and LBP, 0.51 (2-fold; Figure 1).Conclusion:This study confirmed an increasing rate of both, cocaine use and hallucinogen use disorder hospitalizations in people with 5 MSDs over a 17-year period from 1998-2014 in the U.S.Figure 1.Time-trends in the rates of hospitalization with cocaine use and hallucinogen use disorder (A), non-home discharge (B), and in-hospital mortality (C) per 100,000 NIS hospitalization claims. The x-axis shows rate per 100,000 NIS hospitalization claims and the y-axis the study periodsAcknowledgements:I thank John D. Cleveland, MS of the University of Alabama at Birmingham for performing data analyses according to the protocol.Disclosure of Interests:Jasvinder Singh Shareholder of: JAS owns stock options in TPT Global Tech, Vaxart pharmaceuticals and Charlotte’s Web Holdings, Inc. JAS previously owned stock options in Amarin, Viking and Moderna pharmaceuticals., Consultant of: JAS has received consultant fees from Crealta/Horizon, Medisys, Fidia, UBM LLC, Trio Health, Medscape, WebMD, Adept Field Solutions, Clinical Care options, Clearview healthcare partners, Putnam associates, Focus forward, Navigant consulting, Spherix, Practice Point communications, the National Institutes of Health and the American College of Rheumatology. JAS is on the speaker’s bureau of Simply Speaking. JAS is a member of the executive of Outcomes Measures in Rheumatology (OMERACT), an organization that develops outcome measures in rheumatology and receives arms-length funding from 12 companies.

Purpose: To report a case of management of a post-LASIK superficial corneal scar using a novel single-step topography-based customized phototherapeutic keratectomy (PTK). Methods: Surgical technique description. Results: Ablation was planned using Schwind Amaris® 1050RS excimer laser as decentered trans-epithelial PTK of 5 mm × 3.5 mm of 75 µm depth exactly over the area of the scar. UDVA, CDVA improved from 20/60 and 20/40 pre-operatively to 20/30 and 20/20p post-operatively. Refractive error improved from −2.5 DC @135 to +0.25 DS/−0.25 DC @75. Regularization of topography and stromal surface on ASOCT was noted with minimal hyperopic shift. Another step of ablation to address induced hyperopia was not required. Conclusion: Topography-based customized PTK appears to be an effective novel technique for the management of superficial corneal scars with minimal induced refractive change. This technique holds promise as an alternative in the targeted management of superficial corneal scars, traditionally treated by conventional PTK, without significant ablation of normal tissue.

Abstract. Prastiyanto ME, Rohmah N, Efendi L, Arifin R, Wardoyo FA, Wilson W, Mukaromah AH, Dewi SS, Darmawati S. 2021. Antifungal activities of the rhizome extract of five member Zingiberaceae against Candida albicans and Trichophyton rubrum. Biodiversitas 22: 1509-1513. Fungal infections have now become serious health issues. One of the strategies to avoid the problems of fungal infections is by using natural product from plants that are effective against many human pathogenic fungi. The study portrayed the use of the extracts of plant rhizomes as the alternatives to fight against number of human pathogenic fungi. This research aimed to investigate the antifungal activities of crude ethanol extract of five member of the family Zingiberaceae (Curcuma longa, Alpinia galanga Zingiber officinale. var. rubrum, Zingiber officinale var. officinarum and Zingiber officinale var. amarum), which are widely used as folk medicines against Candida albicans and Trichophyton rubrum. Crude ethanol extracts of five members of Zingiberaceae were evaluated for their antifungal activities and the results were calculated based on the zones of inhibition using the diffusion method. The extract showed antifungal activity against Candida. albicans in the agar well diffusion assay (10.2-27.1 mm inhibition diameter) and against T. rubrum (27.3-44.3 mm inhibition diameter). The data have revealed that all rhizomes have the potential to be developed as antifungal agents, particularly against C. albicans and T. rubrum. Studies on the antifungal activity against yeast-like (C. albicans) and filamentous (T. rubrum) can provide new information about the benefits of members Zingiberaceae as a source of natural antifungal. Researchers can select the type of rhizome that has more potential for further extraction to obtain pure compounds that can be used as antifungals.

Pentingnya membangun OCB tidak lepas dari komitmen karyawan dalam organisasi. Komitmen karyawan akan mendorong terciptanya OCB dan tanpa adanya kontrol yang baik dalam pemberian kompensasi yang sesuai dengan hasil kerja tentunya memperlambat kerja pegawai. Penelitian ini bertujuan untuk menguji dan menganalisis pengaruh kompensasi dan komitmen organisasi terhadap kepuasan kerja dan OCB. Jumlah responden dalam penelitian ini berjumlah 86 orang. Pengumpulan data diperoleh dengan kuesioner menggunakan skala likert. Metode analisis data menggunakan Path Analysis. Hasil penelitian diperoleh bahwa kompensasi berpengaruh positif dan signifikan terhadap kepuasan kerja dan Kepuasan kerja berpengaruh positif dan signifikan terhadap OCB. Kata Kunci : Komitmen Organisasi, Kompensasi, Kepuasan kerja dan OCBDAFTAR PUSTAKA Bangun, Wilson. (2012). Manajemen Sumber Daya Manusia. Erlangga. Jakarta. Bernardin, H. John, & Joyce E.A Russel. (2003). Human resource management(An Experimental Approach International Edition). Mc. Graw-Hill Inc. Singapore. Baedhowi. (2007). Manajemen Sumber Daya Manusia. Pelita Insani. Semarang Bigliardi, Barbara & Albert, Ivo Dormio. (2012). The Impact of Organizational Culture on The Job Satisfaction of Knowledge Workers. Emerald Group. Vol.2 No.1, 36-51.Blau, P.M. (1964). Exchange and Power in Social Life. Transaction Publishers. Wiley, New York, NY.Bohlander, George, & Snell, Scott. (2010). Principles of Human Resource. Management, 15th ed. Mason, OH: South Western – Cengage Learning Boon, C. & Hartog, D.D. (2014). Human Resource Management and Organizational Citizenship Behavior The Mediating Role of Job Satisfaction. Netherland: Scriptiesonline.uba.uva.nl Cassio, Wayne F. (1997). Managing Human Resources, Productivity, Quality of Work Life Product Fourth Edition, New York: McGraw Hill International. Chinyere N. I. (2013). Job Satisfaction and Organizational Citizenship Behavior of Library Personnel in Selected Nigerian Universities. International Journal of Science and Research (IJSR) ISSN (Online): 2319-7064 Colquitt, Jason A., Jeffery A. LePine., Michael J. Wesson. (2011). Organizational Behaviour. New York: McGraw-Hill International Companies. Delery, E. J. & Doty, H. D. (1996). Modes of Theorizing in Strategic Human ResourcecManagement: Tests of Universalistic, Contingency, and Configurationally PerformancecPredictions, Academy of Management Journal, 39(4), 802–35. Dewi, S., Suwandana, Made. (2016). Pengaruh Kepuasan Kerja Terhadap Organizational Citizenship Behavior (OCB) Dengan Komitmen Organisasional Sebagai Variabel Mediasi. E-Jurnal Manajemen Unud, Vol. 5 No.9 : 5643-5670. Darma, P.S & Supryanto, Achmad.S. (2017). The effect of compensation on satisfaction and employe performance. Management and Economics Journal. E-ISSN: 2598-9537 P-ISSN: 2599-3402. Journal Home Page: http://ejournal.uin-malang.ac.id/index.php/mec. De Saa-Perez, P. & JM. Garcia-Falcon. (2002). A Resource-based View of Human Resource Management & Organizational Capabilities Development. International Journal of Human Resource Management. Vol. 13. 123–40. Dewanggana, B.D., Paramita, P.D. & Haryono, A.T. (2016). Pengaruh Komitmen Organisasi, Kepuasan Kerja, Budaya Organisasi Terhadap Organizational Citizenship Behavior (OCB) Yang Berdampak Pada Prestasi Kerja Karyawan (Studi Pada PT. PLN App Semarang). Journal Of Management, Vol. 2 No. 2 Edy Sutrisno, (2014). Manajemen Sumber Daya Manusia. Cetak Ke Enam. Pranada Media Group. Jakarta. Fahmi, Irham. (2014). Analisa kinerja keuangan. Alfabeta. Bandung. Fitrianasari,D.,Nimran,U.,&Utami,H.,N. (2013).Pengaruh Kompensasi DanKepuasanKerja Terhadap OrganizationalCitizenship Behavior(OCB)dan Kinerja Karyawan. (Studi pada Perawat Rumah SakitUmum “Darmayu”di KabupatenPonorogo”). Jurnal ProfitVol.7 No.1Flippo, Edwin B (1997). Manajemen Personalia, Edisi Indonesia. ErlangaJakarta. Guest, D. (1997). Human Resource Management and Performance: A Review and Research Agenda. The International Journal of Human Resource Management. Vol. 8 (3). 263-76. Hartono, B & Setiawan, R. (2013). Judul penelitian Pengaruh Komitmen Organisasional Terhadap Kepuasan Kerja Karyawan Paparon’s Pizza City Of Tomorrow. AGORAVol.1, No.1, 1-8. Hasibuan, Malayu. (2012). Manajemen Sumber Daya Manusia dan Kunci Keberhasilan. Haji Mas Agung. Jakarta. Handoko,THani.(2014).Manajemen Personalia &SumberdayaManusia.Edisi Kedua.Cetakan Ke-21. BPFE-Yogyakarta. Yogyakarta. Indrawati, Endang Sri. dan Nafi’, C. (2017). Hubungan Antara Kepuasan Kerja Dengan Organizational Citizenship Behavior Pada Karyawan CV. Elfa’s Kudus. Jurnal Empati. Vol. 7 No. 3, 134 – 145. Joarder, M. H. R., Sharif, M. Y., & Ahmmed, K. (2011). Mediating role of affectivecommitment in hrm practices and turnover intention. relationship: a study in adeveloping context. Business and Economics Research Journal, Vol 2 (4), 135–158. Kamel B., El Amine M.B., and Abdeljalil M., (2015). Relationship between Job Satisfaction and Organizational Citizenship Behavior in the National Company for Distribution of Electricity and Gas.European Journal of Business and Management Vol.7, No.30 1-6 Khan, A.H.,Muhammad M.N., Muhammad A &Wasim, H. (2012). Impact ofJob Satisfaction onEmployee Performance:An Empirical Study of Autonomous MedicalInstitutions of Pakistan.African Journalof Business Management,Vol. 6, 2697-2705 Kreitner, R &Kinicki, A. (2014). Perilaku Organisasi. Salemba Empat. Jakarta. Kurniawan, A. (2015). Pengaruh Komitmen Organisasi Terhadap Organizational Citizenship Behavior (OCB) PT X Bandung. Jurnal Manajemen, Vol.15 No.1, 95-118. Kwantes, Karam, Kuo, & Towson. (2009). Culture's influence on the perception of OCB as in-role or extra-role. Kanada. International Journal of Intercultural Relations Luthans, Fred. (2006). Perilaku Organisasi edisi 10. Penerbit ANDI. Yogyakarta. Mangkunegara, A.A. Anwar Prabu. 2013.Manajemen Sumber Daya ManusiaPerusahaan.RemajaRosdakarya. Bandung. Mathis, R.L. & J.H. Jackson. (2006). Human Resource Management: Manajemen Sumber Daya Manusia. Terjemahan Dian Angelia. Salemba Empat. Jakarta. ----------------------------------. (2011). Human Resource Management: Manajemen Sumber Daya Manusia. Terjemahan Dian Angelia. Salemba Empat. Jakarta. Mehboob & Bhutto. (2012). Job Satisfaction as a Predictor of Organizational Citizenship Behavior A Study of Faculty Members at Business Institutes. Jurnal Ilmu Pendidikan, (Online) Vol. 3, No 9(http://www.journal-archieves14.webs.com/1447-1455.pdf) Mondy,R Wayne. (2008).ManajemenSumberDaya Manusia. Jilid 2Edisi 10. PenerbitErlangga. Jakarta. Muguongo, Muguna,, Muriithi. (2015). Effects of Compensation on Job Satisfaction Among Secondary School Teachers in Maara Sub - County o Tharaka Nithi County, Kenya”, Published online October 10, 2015 (http://www.sciencepublishinggroup.com/j/jhrm) ISSN: 2331-0707 (Print); ISSN: 2331-0715 (Online) Nazar, Omer Abdallah Ahmed. (2016). Impact of Human Resource Management Practices on Organizational Citizenship Behavior: An Empirical Investigation from Banking Sector of Sudan. International Review of Management and Marketing. Vol. 6(4), 964-973. Nursyamsi. (2013). Organizational Citizenship Behavior dan Pemberdayaan terhadap Komitmen Organisasi serta Dampaknya terhadap Kinerja Karyawan. Jurnal Keuangan dan Perbankan Vol. 17 No 3, 488-498. Nurandini, A & Lataruva, E. (2014). Judul penelitian Analisis Pengaruh Komitmen Organisasi Terhadap Kinerja Karyawan (Studi Pada Pegawai Perum PERUMNAS Jakarta). JurnalStudiManajemen& Organisasi Vol 11, 78–91. Omer, N. & Ahmed, A. (2017). Impact of Human Resource Management Practices on Organizational Citizenship Behavior: An Empirical Investigation from Banking Sector of Sudan. International Review of Management and Marketing. Vol. 6(4), 964-973. Oyeniyi, K.O, Afolabi, M.A, Olayanju, Mufutau (2014). Effect of Human Resource Management Practices on Job Satisfaction: An Empirical Investigation of Nigeria Banks. International Journal of Academic Research in Business and Social Sciences, Vol. 4, No. 8, 243-251. Organ, D. W. (1990). The motivational basis of organizational citizen ship behavior. In B. M. Staw, & L. L. Cummings (Eds.), Research in organizational behavior (pp. 43-72). Greenwich, CT: JAI Press. Organ, D. W., Podsakoff, P. M., & MacKenzie, S. B. (2006). Organizational citizenship behavior: Its nature, antecedents, and consequences. Thousand Oaks, CA: SAGE. Pala, Fikri. Eker, Semith dkk.2008. The effect of demographic characteristic on organizational commitment and job satisfaction : An Empirical study on Turkish health care staff. The journal of industrial relations and human resources Vol. 10 No. 2 Purwanto, A.H. (2011). Pengaruh Kualitas Layanan Internal dan Orientasi Pemberi Layanan Terhadap Kinerja Pegawai di Kantor Perijinan Kabupaten Lamongan. Jurnal Psikosains. Vol. 3(1) : 55-72. Priyatno, Duwi. (2011). Buku Saku Analisis Statistik Data. Penerbit Media Kom. Yogyakarta. Prowse, Peter & Prowse, Julie. (2009). The dilemma of performance appraisal. Measuring Business Excellence, 13 (4) : 69 – 77. Podsakoff P.M, Michae Ahearne, MacKenzie S.B (1997). Organizational Citizenship Behavior and the Quantity of Work Group Perpormance. American Psychological Association. Vol. 82 No. 2, 262-270. Rahayu, N.M.N & Riana, I.G. (2017). Pengaruh Kompensasi Terhadap Kepuasan Kerja dan Keinginan Keluar Pada Hotel Amaris Legian. E-JurnalManajemen Unud, Vol. 6,No. 11, 5804-5833 Ramadhani, A.A (2013). Pengaruh Kompensasi Terhadap Motivasi Kerja Di PT. Pos Indonesia (Persero) Bandung. Skripsi: Program Studi Manajemen, Universitas Pendidikan Indonesia. (http://repository.upi.edu/1299/ [16 November 2013]Rahmayanti, Febriana, dan Dewi. (2014). Faktor-Faktor yang MempengaruhiOrganizationalCitizenshipBehavior(OCB).JurnalEcopsyVol.1No.3 Retnoningsih, T., Sunuharjo, B.S & Ruhana, I. 2015. Pengaruh Kompensasi Terhadap Kepuasan Kerja Dan Kinerja Karyawan (Studi Pada Karyawan PT PLN (Persero) Distribusi Jawa Timur Area Malang). Richard L. Hughes, Robert C. Ginnett, and Gordon J. Curphy. (2012). Leadership, Enhancing the Lessons of Experience, Alih Bahasa: Putri Izzati. Salemba Humanika. Jakarta. Robbins, S.P., & Judge, T.A. (2008). Perilaku organisasi. organizational behavior. buku 1. edisi 12. Penerjemah: Angelica, D., Cahyani, R., dan Rosyid, A. Salemba Empat. Jakarta. Robbins, S. P. & Coulter, M. (2012). Management (11th ed.). Prentice Hall: River, N.J. Robbins, S.P dan Judge T.A. (2015).Perilaku Organisasi.SalembaEmpat. Jakarta. Rozzaid, Y., Toni Herlambang, T & dan Devi, A.M. (2015). Pengaruh Kompensasi Dan Motivasi Terhadap Kepuasan Kerja Karyawan (Studi Kasus Pada PT. Nusapro Telemedia Persada Cabang Banyuwangi). Jurnal ManajemenDanBisnis IndonesiaVol. 1No. 2, 201-220. Saleem, Sharjeel & Saba, Amin. (2013). The Impact of Organizational Support for Career Development and Supervisory Suppoert on Employee Performance : An Emperical Study From Pakistani Academic Sector. Europen Journal of Business and Management. 5 (5) : 194-207. Samsudin, Sadili. (2010). Manajemen Sumber Daya Manusia. Pustaka Setia. Bandung. Sasilu, J.B, Chinyio & Sures, S. (2015). The impact of compensation on the job satisfaction of public sector construction workers of jigawa state of Nigeria. The Business and Management Review. Vol. 6 No. 4.Schneider, B., dan Bowen, D.E. (1985). Employee and customer perceptions of service in bank: Replication and extension. Journal of Applied Psychology. Vol 70, 423-433. Sekaran, Uma. (2014). Metodologi Penelitian untuk Bisnis (Research Methods for Business). Salemba Empat. Jakarta. Siagian, Sondang., P. (2013). Manajemen Sumber Daya Manusia. Binapura Aksara. Jakarta. --------------------------, (2008). Manajemen Sumber Daya Manusia (EdisiPertama). Binapura Aksara. Jakarta. Siregar, S & Prasetio, A.P. (2015). Pengaruh Kepuasan Kerja dan Komikmen Organisasi Terhadap Organizational Citizenship Behavior (Prilaku OCB) Karyawan Kantor Distribusi PT. PLN (Persero) Distribusi Jawa Barat Dan Banten. E-Proceeding ofManagement.Vol.2 no.3Society for Human Resource Management. (2012). EmployeeJob Satisfaction and Engagement. A research report by SHRM. Retrieved from www.shrmstore. shrm.org. Solihin, Dadang. (2013). Optimalisasi Otonomi Daerah Kebijakan, Strategi dan Upaya. Yayasan Empat Sembilan. Jakarta. Srimulyani, V. A. (2009). Tipilogi dan Anteseden Komitmen Organisasi. Jurnal Ilmiah Widya Wana. Vol. 33 (1), 1-20. Steven, H Appelbaum, Michel Roy & Terry Gilliland. (2011). Globalization of performance appraisals: theory and applications. Management Decision, Vol. 49 (4) : 570-585. Subekhi, A. (2012). Pengantar Manajemen Sumber DayaManusia.PrestasiPustakaJakarta. Jakarta. Sugiyono. (2013). Metode Penelitian Kuantitatif Kualitatif dan R&D. Alfabeta. Bandung. Sutrisno,E. (2011).ManajemenSumberDayaManusia. PrenadaMediaGroup.Jakarta. Tan, R&Tarigan, Z.J.H. (2017). PengaruhKompensasiDanKepuasanKerjaTerhadap OrganizationalCitizenshipBehavior(OCB)MelaluiMotivasi KerjaSebagaiVariabelInterveningPada3HMotosport. AGORAVol. 5,No. 1 Titisari, Purnamie. (2014). Peranan Organizational Citizenship Behaviour (OCB) dalam Meningkatkan Kinerja Karyawan. Mitra Wacana Media. Jakarta. Uma Sankar Mishra, Aurolipy, Madhusmita Dash. (2017). Impact of HRM Practices on Job Satisfaction and Performance: An Empirical Study in Health Care Sector. International journal of economic research. Vol. 14, No. 1 Umar, Husein. (2003). Riset Sumber Daya Manusia Dalam Organisasi. Penerbit Gramedia Pustaka Utama. Jakarta. Wexley, Kenneth. & Gary Yukl. (2003). Perilaku organisasi dan psikologi personalia. Rineka Cipta. Jakarta. Wibowo. (2016). Manajemen Kinerja. PT. Rajagrafindo Persada. Jakarta. Widodo, SE. (2015). Manajemen Pengembangan Sumber Daya Manusia. Pustaka Pelajar. Yogyakarta. Yani. (2012). Manajemen Sumber Daya Manusia. Mitra Wacana Media. Jakarta.Zaenabadi, H. (2010). Job satisfaction and organizational commitment as antecedents of Organizational Citizenship Behavior (OCB) of teachers. Procedia Social and Behavioral Sciences Vol. 5 : 998–1003.