To see the other types of publications on this topic, follow the link: Arab Art.
Dissertations / Theses on the topic 'Arab Art'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 dissertations / theses for your research on the topic 'Arab Art.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
Amor, Mohamed C. "Arab Muslim immigrants in the U.S. : home environment between forces of change and continuity /." free to MU campus, to others for purchase, 2000. http://wwwlib.umi.com/cr/mo/fullcit?p9988642.
Full text
2
Joumaa, Jamal. "Australian artists of Arabic origin identity and hope /." View thesis, 2009. http://handle.uws.edu.au:8081/1959.7/41020.
Full textAbstract:
Thesis (D.C.A.)--University of Western Sydney, 2009.A thesis presented to the University of Western Sydney, College of Arts, School of Communication Arts, in fulfilment of the requirements for the degree of Doctor of Creative Arts. Includes bibliographies.
3
PUGLIESI, GIROLAMO GIUSEPPE MARIA. "Un canone per il teatro arabo. Una lettura de Qālabu-nā al-masraḥī di Tawfīq al-Ḥakīm." Doctoral thesis, Università Cattolica del Sacro Cuore, 2010. http://hdl.handle.net/10280/747.
Full textAbstract:
Un'analisi della teoria teatrale di Tawfīq al-Ḥakīm a partire dal suo Qālabu-nā l-masraḥī. Lo studio intende dimostrare come in tutta l’opera di Tawfīq al-Ḥakīm sia presente, seppure in modalità diverse, una teleologia performativa della scrittura teatrale.An analysis of Tawfiq al-Hakim's theatrical theory in the light of his Qālabu-nā al-masraḥī. The study aims at showing how in Tawfīq al-Ḥakīm's whole work is present, although in different ways, a performative teleology of playwriting.
4
PUGLIESI, GIROLAMO GIUSEPPE MARIA. "Un canone per il teatro arabo. Una lettura de Qālabu-nā al-masraḥī di Tawfīq al-Ḥakīm." Doctoral thesis, Università Cattolica del Sacro Cuore, 2010. http://hdl.handle.net/10280/747.
Full textAbstract:
Un'analisi della teoria teatrale di Tawfīq al-Ḥakīm a partire dal suo Qālabu-nā l-masraḥī. Lo studio intende dimostrare come in tutta l’opera di Tawfīq al-Ḥakīm sia presente, seppure in modalità diverse, una teleologia performativa della scrittura teatrale.An analysis of Tawfiq al-Hakim's theatrical theory in the light of his Qālabu-nā al-masraḥī. The study aims at showing how in Tawfīq al-Ḥakīm's whole work is present, although in different ways, a performative teleology of playwriting.
5
Guerrero-Rippberger, Sara Angel. "30° from the Northern Tropic : art, region and collective practices from urban Latin American and Arab worlds." Thesis, University of the Arts London, 2017. http://ualresearchonline.arts.ac.uk/12038/.
Full textAbstract:
This thesis investigates the socially imagined representation of two areas of the global South, through the lens of contemporary art. It traces the historicisation of urban Latin America and the Arab world along a timeline of critical lenses, questioning their construction as imagined sites. Re-occurring tropes from exhibition spaces acting as representations of the global South on a macro-level are contrasted with observations from a local level, in an ethnographic study of nineteen artist groups of four capital cities of Latin America and the Arab world. The research draws upon sociological methodologies of research, arts methodologies and historicisation to chart the scope and function of these groups against the backdrop of the global art-institution’s so-called geographic turn and it’s romanticisation of the precarious state as the new avant-garde. Moving away from the traditional cartography of art and social history, this thesis offers an expanded concept of collectivity and social engagement through art, and the artist group as unit of social analysis in urban space. Putting these ideas into dialogue, artist-led structures are presented as counter-point to collective exhibitions and to the collectivity of national identity and citizenship. An abundance of artist groups in the art scene of each city represents an informal infrastructure in which a mirror image of inner-workings of the city and art world become visible through this zone of discourses in conflict. This unorthodox exploration of art, region, and collective expression launches into the possibility of new constellations of meaning, tools to recapture the particulars of everyday experience in the unfolding of large narratives. Examining the place of collective art practices in the socio-political history of the city, this intervention into current theory around the role of art from the global South traces the currents and counter-currents of the art-institution and its structures of representation re-enacted in places of display and public discourse -- the museum, the news, the gallery, the biennial,the street and the independent art space.
6
Gabsi, Ouafa. "L'art contemporain du Sud de la Méditerranée : à la recherche d'une identité, d'une place et d'une reconnaissance à l'heure de la mondialisation." Thesis, Paris 1, 2015. http://www.theses.fr/2015PA010508.
Full textAbstract:
Comment l'art contemporain du sud de la Méditerranée est-il perçu et reconnu par les experts du monde de l'art occidental ? Telle la question à laquelle nous nous sommes intéressée. Pour y répondre, il nous a fallu comprendre les liens qu'entretiennent l'art et la mondialisation et discuter les apports des études culturelles et postcoloniales à ce sujet. A partir de ce questionnement initial nous avons rassemblé et étudié les discours hégémoniques intervenant dans le champ de la culture, des processus de négociations, des politiques de différences et des modes d'identification des artistes du Sud selon une vision ethnocentriste et identitaire. Pour mener à bien notre recherche, nous avons conduit deux études. La première porte sur une étude thématique des intitulés d'expositions internationales concernant l'art contemporain du sud de la Méditerranée (Europe et États-Unis de 1999 à 2014). Nous soutenons l'idée que les sujets d'expositions véhiculent un discours qui traduit des idées culturelles d'hégémonie occidentale et des orientations concernant le genre, l' ethnicité, la classe, confinant le statut de l'artiste sud-méditerranéen à un rôle «périphérique ». La seconde enquête qui est de nature compréhensive, traite des croyances des artistes du sud de la Méditerranée et de leurs positionnements par rapport aux marqueurs identitaires dans la construction de catégories ethniques. Quel regard portent-ils sur ces marqueurs, leur accordent-ils une certaine reconnaissance ? Cette étude a été conduite avant et après les mouvements révolutionnaires du printemps arabeHow is contemporary art of the southern Mediterranean perceived and cognized by experts in the world of Western art ? It is this very question which actually interested us. To answer this, we had to understand the links between art and globalization and discuss the contributions of cultural and postcolonial studies related to this subject. From that initial question, we have gathered and studied hegemonic discourses involved in the field of culture, negotiation processes, differences policies and modes of identification of the artists from the South in an ethnocentric vision. To carry out our research, we conducted two studies. The first concerns a thematic study of the headings of international exhibitions on contemporary art from the south of the Mediterranean (Europe and the United States from 1999 to 2014). We support the idea that the subjects of exhibitions convey a discourse that reflects the cultural ideas of Western hegemony and trends concerning genre, ethnicity, class, confining the status of the southern Mediterranean artist to a "peripheral" role. The second survey which is comprehensive in nature, deals with the beliefs of the southern Mediterranean artists and their positioning in comparison with identity markers in the construction of ethnic categories. How do they perceive these markers, do they give them some recognition ? This study was conducted before and after the revolutionary movements of the Arab Spring
7
Joumaa, Jamal. "Australian artists of Arabic origin : identity and hope." Thesis, View thesis, 2009. http://handle.uws.edu.au:8081/1959.7/41020.
Full textAbstract:
Despite the migration of some artists of Arabic origin to Australia since 1947, experimental Australian artists of Arabic origin only began to gain attention for their work from 1975 onwards. The works of those artists who have a migrant background, distinguished, on one hand, by the continuous link between themselves and their cultural heritage and the political and human conditions of their homelands, and on the other hand, being inspired by the social, cultural and political issues of Australian life, which reflect the type and nature of relationships between the artists and their host society. It is important to note the commonalities in efforts of artists to realize their arts with individual imprints, in an attempt to create an aesthetic contribution that confirms their own particularity. In their cultural trends, originating from the values and concerns of their social existence; exploring new artistic values and symbols, and working through different artistic trends and techniques, in ways that reflect their visions about art as a duty, and represent a cultural, aesthetic and moral responsibility, toward the societies of their homelands and their adopted country. At present, this art activity is recognized as having made a vital contribution to Australian cultural life, incorporating serious artistic and cultural concerns, represented by a group of exhibitions. Thus, this study is in the frame of these cultural and artistic efforts, dating to the beginning of this activity in Australia, studying the educational, political, social conditions, which help in the development of this art. It focuses on exposing the artistic elements and their aesthetic and cultural values, the symbols and their relegations, which appear in the works of the participant artists in the frame of the study.
8
Ensor, Lael J. "Decoration in early Qur'an manuscripts: A close look at the Walters Art Museum's W.554." Access to citation, abstract and download form provided by ProQuest Information and Learning Company; downloadable PDF file, 56 p, 2009. http://proquest.umi.com/pqdweb?did=1885754571&sid=3&Fmt=2&clientId=8331&RQT=309&VName=PQD.
Full text
9
Erskine-Loftus, Pamela F. "What is the relationship western museological practice and philosophy and display in the Sharjah art museum, United Arab Emirates?" Thesis, University of Newcastle Upon Tyne, 2010. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.531734.
Full text
10
Amanat, Shayda. "Iran and the Arab World Through A Female Lens: Deconstructing Western Phantasms and Terrors." Scholarship @ Claremont, 2014. http://scholarship.claremont.edu/scripps_theses/428.
Full textAbstract:
This thesis explores how today’s Sheherazades, in this case women photographers from the Middle East, create alternative representations that constitute new meanings and understandings of life, gender, and politics in Iran and the Arab world.
11
Cornet, Catherine. "In Search of an Arab Renaissance : artists, Patrons and Power in Egypt and the Middle East (2001-2013)." Paris, EHESS, 2016. http://www.theses.fr/2016EHES0091.
Full textAbstract:
Le paradigme de la Nahda, ou Renaissance arabe est un puissant zeitgeist qui revient cycliquement dans la pensée et le monde culturel du Moyen-Orient depuis la fin du 19eme siècle. Cette thèse questionne les raisons du retour du paradigme dans les années 2000 (et en particulier entre 2001 et 2005) en Egypte et dans les Emirats (Doha et Sharjah) en observant les rapports de force entre différentes sphères artistiques et les structures de mécénat. Elle interroge la raison d'être de cette quête pour une Renaissance culturelle, les enjeux liées au mécénat, l'exploitation politique du culturel et en particulier les questions d'authenticité, de culture nationale et globale, musulmane ou séculière, d'indépendance et enfin, de liberté artistique. L'étude du paradigme passe à travers la comparaison des discours et des oeuvres des 'artistes d'états' soutenus par le pouvoir de Moubarak, des artistes commerciaux, qui derrière Adel Imam, sont les fers de lance du pouvoir séculier contre les islamistes égyptiens; et des artistes arabes et internationaux qui à Doha ou Sharjah gravitent autour du riche mécénat des Emirats. En opposition à l'état, plusieurs sphères sont étudiées: celle des artistes 'indépendants' mais soutenus par les fondations privées ainsi que la sphère des artistes musulmans qui proposent un fan al hadif, ou 'art modeste'. La sphère des artistes digitaux enfin, autonomes par rapport aux réseaux de mécénat, permet de confirmer l'existence d'une réelle Renaissance culturelle digitale soutenue par l'explosion des réseaux sociaux, une décennie avant les révolutions arabes. En questionnant la position des artistes vis à vis de leurs mécènes et par rapport au pouvoir, cette thèse souligne l'importance du discours culturel et artistique pour la sphère publique et ses répercussions sur les enjeux de citoyennetéThe Nahda, or "Arab Renaissance" is a powerful returning paradigm in Egypt and the Middle East cultural field since the end of the 19th century. The aim of this dissertation is to assess, through the study of the new paradigm, the autonomy of the arts in Egypt and the Middle East and their relation to power and to interrogate the role of art in identity definition and in the "dialogue" with Islam after 9/11 - and especially after foreign actors have greatly re-shuffled the power relationship. The first case study focuses on "state artists" in Egypt and studies the passage from the Tahtqif, or "culturisation" of Egyptians in the name of Enlightenment and the gradually undermining of state monopoly over identity politics. The second chapter is dedicated to Arab artists and their Gulf patrons: the agency of the "invisible hand" of the global artistic market is discussed, through two case studies in Doha and Sharjah. The third chapter assesses the state narrative against Islamists in Egypt through the figure of comedy actor Adel Imam. The second part is dedicated to the artists in opposition to the state. Chapter I reviews the agency of the artistic sphere in total opposition with the state, with the study of a group of young Muslim filmmakers who intented to contribute to a fann al hadif or "purposeful art". The two following chapters review the works of the "independent scene" that saw the light after the arrival arrival en masse of foreign funding in 2001, while the last case studies centred on Digital artists venture into giving the first hints of a conclusion about a Digital Renaissance that took place after after 2004, and of the adoption of social networks in Egypt. The importance of the arts in the political discourse, its agency in the process of secularization, nationalist debates or international relations in the time of globalisation, is barely mentioned in political science. This dissertation is intended to corroborate the claim that there is much to learn from the art spectrum and from its agency on societal changes and power struggles
12
Chamsine, Rania. "Lashes to Ashes, Exploring the Hidden Dimensions of Human Hair." VCU Scholars Compass, 2013. http://scholarscompass.vcu.edu/etd/3144.
Full textAbstract:
Hair is power, beauty and seduction: a reflection of ethnicity and religion, and even a canvas for self-expression. A key feature in defining identity and social status, it holds the essence of our individuality. However, once removed from its original and natural setting—the epidermis—hair is seen as waste, and often evokes disgust. The objective of this thesis is to explore human hair, which particularly in the Arabic-Islamic region, carries great significance and raises many religious, cultural, and gender issues. Through design, and informed by critical design theory, I explore how this corporeal material can be reused and re-presented as a means of interrogating the references, symbolism, and connotations of hair both in, and out of, its natural setting.
13
Planel, Alice. "Artists of Algerian origin exhibiting in France 1989-2012 : an analysis of selected artists' work and its reception : the urban, the home and the Arab woman, and the 'global' art world." Thesis, Kingston University, 2013. http://eprints.kingston.ac.uk/28772/.
Full textAbstract:
This thesis investigates the work of a selected number of artists of Algerian origin who rose to prominence in France between 1989 and 2012 and analyses the reception of their work in French institutions of art. The artists are Adel Abdessemed (b.1971), Kader Attia (b. 1970), Faycal Baghriche (b. 1972), Samta Benhyahia (b.1950), Zoulikha Bouabdellah (b. 1977), Mohamed Bourouissa (b. 1978), Katia Kameli (b.1973) and Zineb Sedira (b.1963). This is the first in-depth study on these artists's work within a French exhibiting context and it also represents the first critical analysis of the impact that collective memory, French cultural policies and an emerging discourse ofa 'global' art world system has had on the reception of their work. Based upon extensive primary research on the exhibiting practices of French institutions and responses of the French press, alongside interviews with the artists, the thesis engages with art historical, sociological and cultural memory methods in order to examine the emergence and reception of these artist' work. The analysis also brings into focus the aesthetic preoccupations of the artists and their diverse contexts of production. Chapter one presents a critical overview through a historiography of major . exhibitions of artists of Algerian origin in French institutions of art between 1989- 2012. The following four chapters are structured through themes that are recurrent in the artists's work: the urban, the home and the Arab woman and the global world. Chapter two focuses on Abdessemed and Attia's engagement with urban themes, and questions the impact of collective narratives of the 'banlieue' on their work. Chapter three analyses the representations of the self and the domestic in the early work of Benyahia, Bouabdellah, Kameli and Sedira, and proposes that their critical diasporic narratives problematize the dominant discourses of collective memory in France. An analysis of the work of Abdessemed, Attia and Sedira in chapter four foregrounds the discontinuities and continuities within a 'global' world-order with specific reference to Franco/Algerian crossings. Overall, through a detailed analysis of the institutional contexts of France and the 'global' art world, the thesis offers an institutional critique arguing that diasporic experiences - evident in the work of artists of Algerian origin - are rarely acknowledged or debated in French institutions, while artistic nationality is over-determined. Informed by Isobel Armstrong's concept of a 'radical aesthetic' and Deleuze and Guattari's notion of the rhizome, the thesis also argues that aesthetics and contexts of production need to be acknowledged in the analyses of the artist's work.
14
Lawson, Daniel. ""Like Their Lives Depended On It": The Role of Comics in Subverting Anti-Arab and Islamophobic Discourse." Diss., Virginia Tech, 2011. http://hdl.handle.net/10919/77058.
Full textAbstract:
This dissertation examines the role the medium of comics plays in the construction and subversion of anti-Arab and Islamophobic discourse. It seeks to address the following questions in particular: how does the medium of comics interpellate subjects regarding the Western discursive formation that conflates Arab, Muslim, and terrorist? What does the medium of comics afford creators in subverting dominant discourses that dehumanize Arabs and Muslims?
I argue that as a hypermedium in which text and repeated images are in continual tension, comics challenge the sort of foundational notion of truth necessary for dominant discourse. I use a Foucauldian lens to examine several comics in relation to larger discursive formations.
In Chapter 1, I explain the problem, my methods, and my theory in more detail. In Chapter 2, I apply this theory as a lens to examine the rhetorical work the medium plays in subverting dominant discourse in Palestine, a nonfiction piece of comics journalism. I use Chapter 3 to problematize the assertions made in the first two chapters by looking at an instance where comics are used to reinscribe dominant discourse. Specifically, I analyze the graphic adaptation of The 9/11 Report. Chapter 4 acts as something of a retort to Chapter 3; it examines In the Shadow of No Towers to interrogate the ways in which Art Spiegelman explicitly addresses not only the issues he grappled with as a New Yorker during and after 9/11, but the complex relations of representation that arose from the event. Chapter 5 I examine how subversion works when a hypermedium is further remediated by analyzing Didier LeFevre's The Photographer: Into War-Torn Afghanistan with Doctors without Borders. The Conclusion is devoted to discussing the implications of this study, both in terms of pedagogy and in terms of theorizing the relationship and differences between image and text. I argue that comics demonstrate the productive ideological tensions that exist between modes of signification (such as verbal and visual). An understanding of this ideological tension is key for scholars of visual rhetoric and hegemonic discourse.Ph. D.
15
Hammond, Katherine E. "Historiography, the Global Contemporary, and Street Arts of the Egyptian Revolution." Ohio University / OhioLINK, 2018. http://rave.ohiolink.edu/etdc/view?acc_num=ohiou1534170611388269.
Full text
16
Chèvre, Mathilde. "Renaissance enfantine : La création arabe en littérature pour la jeunesse depuis 1967, reflet et projet des sociétés (Égypte, Liban, Syrie)." Thesis, Aix-Marseille, 2013. http://www.theses.fr/2013AIXM3091.
Full textAbstract:
Au lendemain de la défaite de 1967 appelée la naksa, une génération d’intellectuels syriens, égyptiens et libanais s’engagent dans l’écriture et l’illustration pour les enfants. Ce faisant ils se racontent et dessinent leur avenir idéalisé. La création arabe en littérature pour la jeunesse qui se développe dans les années 1970 est profondément animée par le souffle idéologique de son temps. Elle pose les jalons structurels, thématiques et graphiques qui inspirent la production contemporaine. Les auteurs, illustrateurs et éditeurs entendent parler à l’enfant arabe du monde dans lequel il grandit. Ils mènent une réflexion sur les thématiques, sur les niveaux de langue arabe, sur l’image figurative, ses héritages, sa structure et ses codes. Leur quête est littéraire, artistique et identitaire : ils sont les initiateurs d’une renaissance, une nahda pour les enfants. Ces questionnements sont les pierres d’angle de notre recherche. Celle-ci se concentre sur le mouvement avant-gardiste de création arabe en littérature pour la jeunesse des années 1970 à nos jours, elle ambitionne d’en étudier les rouages et les ouvrages, d’observer l’articulation entre l’œuvre, son intention, son mode de production et son message. Il s’agit d’une part d’archiver les mémoires et les histoires collectives et individuelles, d’élucider les héritages et les filiations de ces créateurs, de suivre l’évolution de leurs motivations idéologiques, artistiques, économiques. Il s’agit d’autre part de faire une lecture au plus prés de notre corpus, une étude de l’évolution des thématiques au fil du temps mais aussi une analyse des albums eux-mêmes, dans leur structure linguistique et graphiqueAfter the defeat of 1967, known as the naksa, a generation of Syrian, Egyptian and Lebanese intellectuals began writing and illustrating children's books. In doing so they gave form to an idealized future. Children's literature that developed in the Arab world during the 1970s was greatly influenced by the ideological climate of the time. It laid the structural, thematic and graphical foundations on which today's work is based. The goal of authors, illustrators and publishers was to produce works for Arab children which described the world in which they were growing up. Their work was centered on themes, on the different levels of Arabic, on the figurative image, its heritage, its structure and its codes and conventions. Their objective was literary, artistic, and a quest for cultural identity. They were the vanguard of a renaissance, a nahda for children.These questions form the basis of this research. It concentrates on the avant-guard movement in children's literature from the 1970s to the present day. It attempts to study the way it worked and what was published, to observe the connections between the work itself, its aims, the way it was produced and its message. The research involves, on the one hand, documenting recollections and stories, both collective and individual, tracing the heritage and interconnections among of those involved, to follow the development of their ideological, artistic and economic motivation. It will also involve a detailed study of illustrated books for children, an examination of the thematic evolution over time, as well as a semiological reading of the books themselves, with reference to their linguistic and graphic structure
17
Naïm, Denise Nicole. "Symbiotic Catastrophes: An Urge To Make a Recording." VCU Scholars Compass, 2007. http://scholarscompass.vcu.edu/etd_retro/179.
Full textAbstract:
Becoming a young woman amid the foothills and valleys of the Appalachian Mountains has fulfilled me with an awareness that I am not from "around these parts" that I now find myself in. As I navigated my way across the mountains, to the southern slopes of the east coast, I began to realize the life I was leaving behind through the process of photography, film, and the act of making a recording. This document speaks about the ideas and persistent energy that drive my process of creation while focusing on three important bodies of work that exhibit what I believe to be a method of engagement between the body and the camera. Out of my experiences, I want to make record of the blips and intonations, and of the in-between spaces where language is displaced and the visual speaks for itself.
18
Baladi, Sarya Sofia. "The Arabs are Coming!: Arab-American Political Participation from 9/11 to the Trump Era." Thesis, Boston College, 2019. http://hdl.handle.net/2345/bc-ir:108415.
Full textAbstract:
Thesis advisor: Jonathan LaurenceThesis advisor:
This thesis examines how the political participation of Arab-Americans has evolved from 9/11 to the Trump Era. In light of the events in American history in the past two decades that have had significant ramifications on this group, it is important to analyze whether, to what extent, and how the political participation of Arab-Americans was affected. During both the attacks of perpetuated by al-Qaeda on American soil in 2001 and the election of President Trump in 2016, Arab-Americans, particularly those of Muslim faith, saw their realities change as they found themselves in a very hostile socio-political reality: they were thrusted in the spotlight for the worse and were subject to an increasing amount of violent and non-violent animosity from both the American people and from American institutional structures. The events since 9/11 have therefore had an undeniable effect on this group as a whole. However, they have also elicited different reactions according to the national and international political context at the time which have even varied within the Arab-American community. The author analyses how this immigrant group reacted to the political shock of 9/11, as well as its efforts to further mobilize and/or assimilate politically and racially to cope with its heightened visibility. She also looks at the role Arab-American activists have played to advocate for their community and whether they are representative of Arab- Americans as a whole. Finally, she outlines how Arab-Americans are currently reacting to the Trump Administration, and how they are politically fairing at a time of heightened American partisanship
Thesis (BA) — Boston College, 2019-04-29
Submitted to: Boston College. College of Arts and Sciences
Discipline:
Discipline:
19
Hosseinioun, Mishana. "The globalisation of universal human rights and the Middle East." Thesis, University of Oxford, 2014. http://ora.ox.ac.uk/objects/uuid:8f6bdf79-2512-4f32-840a-3565a096ae8d.
Full textAbstract:
The goal of this study is to generate a more holistic picture of the diffusion and assimilation of universal human rights norms in diverse cultural and political settings such as the Middle East and North Africa (MENA). The overarching question to be investigated in this thesis is the relationship between the evolving international human rights regime and the emerging human rights normative and legal culture in the Middle East. This question will be investigated in detail with reference to regional human rights schemes such as the Arab Charter of Human Rights, as well as local human rights developments in three Middle Eastern states, Egypt, the United Arab Emirates, and the Islamic Republic of Iran. Having gauged the take-up of human rights norms on the ground at the local and regional levels, the thesis examines in full the extent of socialisation and internalisation of human rights norms across the Middle East region at large.
20
Alaybani, Rasmyah. "Words and Images:Women’s Artistic Representations in Novels and Fine Art in the Kingdom of Saudi Arabia 2005-2017." The Ohio State University, 2019. http://rave.ohiolink.edu/etdc/view?acc_num=osu1565009668743079.
Full text
21
Al-Hadid, Diana. "Magic Mountain." VCU Scholars Compass, 2005. http://scholarscompass.vcu.edu/etd/827.
Full textAbstract:
My installations are propositions for an imaginary world that relies on its own internal logic, a world of believability without recognition. While the work references landscape it also emphasizes its contrivance, as it is automatically estranged in an "unnatural" gallery setting. I subvert or de-familiarize the materials and processes that I use in the service of creating a fictitious environment. My places are impossible places. They are irregular, illogical, and unstable. Our imagination can be one of most dangerous things to psychological stability as it is an inventory of all things possible, no matter how irrational or improbable. The irrational is always an option, a lingering threat. The imagination seems to hate permissions and limitations, but is nevertheless lodged within them. I want to create a sense of nonsensical logic. If all things that can be imagined are logical possibilities, I want to find the place where fantasy seems to be just barely reality. If I can't have an inherent contradiction, I'll take an apparent one.
22
Clévenot, Dominique. "Une esthétique du voile : réflexion sur la figure du plan dans l'art arabo-islamique." Paris 1, 1988. http://www.theses.fr/1988PA010590.
Full textAbstract:
L'un des traits dominants de l'art arabo-islamique est sa propension a jouer de la bidimensionalité, a être un art de la surface. Comment comprendre cette caractéristique ? Pour répondre à cette question, trois domaines artistiques ont tour à tour été abordés : celui de l'architecture de la mosquée hypostyle arabe, celui de la représentation figurée, notamment la peinture d'illustration au XIIIe siècle, et enfin celui des arts de la ligne, qui regroupent l'arabesque végétale, l'entrelacs géométrique et la calligraphie. Dans ces trois domaines l'importance de la bidimensionalité peut se comprendre comme le produit d'un héritage artistique. Mais si l'histoire peut rendre compte de l'origine d'une forme, elle ne suffit pas pour en éclairer la fonction ou la signification. Pour ce faire il faut interroger le contexte culturel, à savoir en ce cas le système de pensée qu'est l'islam. Or, selon cette approche, la bidimensionalité apparait remplir dans l'art arabo-islamique une fonction esthétique majeure : ce que nous appelons la "figure du plan" se révéler être l'équivalent plastique du concept islamique de "voile" (hijab), écran tendu entre le visible et l'invisible, mais écran sur lequel s'inscrivent les tentations du regard (mystique)One of the main features of arabo-islamic art is its propensity to play on bidimensionality, to be a surface art. How can this caracteristic be understood ? To answer this question, three artistic domains have been evoqued : that of the hypostyle arab mosque architecture, that of figurative representation, particularly illustrative painting of the xiii cy. , and finally that of linear arts, which include vegetal arabesque, geometric interlace and calligraphy. In these three domains the importance of bidimensionality may be understood as the product of an artistic legacy. But if history may account for the origin of a given form, it is not sufficient to elucidate its fonction or signification. In order to do so, one must consider the cultural context, in this case the islamic system of thought. According to this approach, bidimensionality seems to fulfill in arabo-islamic art a major aesthetic fonction : what we call "the figure of the plain" shows itself to be the plastic equivalent of the islamic concept of "the veil" (hijab), a screen placed between the visible and the invisible, but a screen upon which are inscribed the (mystical) temptations to perceve
23
El-Soufi, Assaf Hind. "La calligraphie : naissance d'un art moderne ?" Paris 8, 1998. http://www.theses.fr/1998PA081471.
Full textAbstract:
La these traite les problematiques concernant l'art arabe moderne. Il s'agit de la calligraphie arabe et de son evolution selon les styles modernes. Elle se situe des annees 50 aux annees 90. Le corpus groupe des peintres de pays arabes mais considere specifiquement le cas libanais. Une partie historique decrit la genese de l'art. Une seconde partie etudie les paradoxes de la modernite arabe: conflit theorique, approches de l'art, confusion des concepts et des dualismes tradition/modernite, authenticite/contemporaneite, particularisme/localisme, identite/acculturation. Une troisieme partie etudie les styles et montre que l'art arabe cherche une specificite dans une conciliation de l'art calligraphique avec les styles modernes. Un art composite nait de cette interference, cet art se veut authentique, prend la tradition comme point de depart et aboutit a une imitaion des styles occidentaux. Il engendre des variantes. L'etude considere plus specifiquement les interrelations entre les deux abstractions: islamique et moderne, et remet en question la dimension terminologique de l'abstrait qualifiant deux modalites et deux styles d'epoque differentes et de logiques opposees. Une quatrieme partie cherche les caracteristiques d'une esthetique. Le proces de l'image est ouvert montrant les aspects de l'image arabe. Le triomphe actuel de la lettre denote un fait culturel qui explique l'expansion de la lettre dans tous les pays arabes et islamiques et sur tous les supports. Phenomene lie a un attachement culturel. Une methodologie prise du structuralisme et du post structuralisme nous a conduit a une mutation esthetique d'un paradigme revolu vers un nouveau paradigme moderne ou les oeuvres lettriques se placent entre deux tensions. Ce mouvement arabe ne constituant pas explicitement une ecole, va se repandre et se manifester comme par epidemie partout. Il s'agit de l'art hurufi, ou l'art de la modernite arabe, il n'est autre que de la calligraphie moderniseeThe thesis treats the problematics concerned with modem arab art. It is being talked about calligraphy and its evolution according to modern styles. It covers the 1950-1990 period. The corpus groups painters from the arab world but specifically considers the lebanese case. A first historical part describes the genesis of art. A second part studies the paradoxes of arab modernity: theoretical conflict, art approaches, and contusion of dualities tradition/modernity, authenticity/contemporarity particularism/universalism, autonomy/hegemony. A third part studies styles that are nothing than a conciliation of calligraphy with modern styles. From this interference, a composite art is born. This art wishes itself to be authentic, takes tradition as a starting point and ends as an mutation of occidental styles. It generates numerous variants. This study considers more specifically the interelations between both abstractions : the islamic one and the modern one, and challenges the terminological dimension of the abstract qualifying two modalities and two styles from different epochs and from opposite logics. A fourth part seeks to identify the characteristics of aesthetics. The case of the image is treated showing alt the aspects of the arab image. The actual triumph of the letter denotes a cultural fact that explains the expansion of the letter in all arab and islamic countries at all levels. A phenomenon related to a cultural attachement. A methodology taken from post structuralism has lead to an aesthetic mutation from a past gone paradigm into a new modern one where graphic lettered works stand between two tensions. This arab movement, even though not explicitly constituting a school, is going to spread and manifest itself everywhere as an epidemic. It is being talked about hurufi art, or the art of arab modernity. It is nothing else than a modernised calligraphy
24
Block, Katherine M. "Veils: Truth in Translation." Digital Commons @ East Tennessee State University, 2015. https://dc.etsu.edu/etd/2540.
Full textAbstract:
This supporting document for the thesis exhibition entitled “Veils: Truth in Translation” will discuss Block’s exploration of painting during her time at East Tennessee State University. The supporting document also provides the historical background and influences which have contributed to Block's overall process and techniques. These influences include the Abstract Expressionists, Carl Jung, Ferdinand de Saussure, John Dewey, Theodor Adorno, Joan Mitchell and Gerhard Richter. In the supporting document Block probes the idea that non-objective painting is more than a language confined by linguistic elements of sign, signifier, and signified, but is a process of thinking, which is communicated on a higher level of perception than verbal speech or visual symbolism. Block will discuss how she translates experiences from the metaphysical realm of feeling and thought to the physical reality of paint and surface which communicates the experience to the viewer.
25
Liberatti, Elisângela. "Ara, Chico." Florianópolis, 2012. http://repositorio.ufsc.br/xmlui/handle/123456789/100652.
Full textAbstract:
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Comunicação e Expressão. Programa de Pós-Graduação em Estudos da TraduçãoMade available in DSpace on 2013-06-25T21:17:18Z (GMT). No. of bitstreams: 1 309863.pdf: 6321954 bytes, checksum: afe6f76a500e5b7db68ec4fb19d30b1c (MD5)
Esta pesquisa situa-se na intersecção entre Estudos da Tradução, tradução de quadrinhos e funcionalismo nordiano (1991). Seu objetivo é propor uma tradução comentada com enfoque funcionalista de duas histórias em quadrinhos (HQs) do Chico Bento, no par linguístico português-inglês, sob a perspectiva teórico-metodológica do funcionalismo nordiano e do conceito de pseudodialeto caipira sugerido por Bagno (2011). A tradução da variação linguística presente nos quadrinhos do Chico Bento faz-se importante para a área de Estudos da Tradução pelo fato de que (pseudo)dialetos caracterizam e marcam o usuário da língua e, portanto, são elementos significativos em traduções cujo propósito seja a manutenção no texto alvo (TA) das características linguísticas presentes no texto fonte (TF). Com isso, é papel do tradutor identificar o propósito do (pseudo)dialeto presente no TF e assegurar que tal propósito mantenha-se consistente na tradução. Partindo-se do princípio de que as HQs do Chico Bento buscam retratar, ficcionalmente, a vida do caipira brasileiro e que a fala dos personagens seja uma tentativa de representação do cenário caipira dessas histórias, a tradução proposta busca manter o pseudodialeto caipira representado nas HQs, além de adaptar tais HQs ao público a quem o TA se destina, conceito da teoria funcionalista de Nord.
This research is situated at the intersection between Translation Studies, comics' translation, and Nord's functionalist approach (1991). Its objective is to propose a functionalist translation with commentary of two Chuck Billy's comics, in the linguistic-pair Portuguese-English, from the theoretical and methodological perspective of Nord's functionalist approach and the concept of hillbilly (pseudo)dialect suggested by Bagno (2011). The translation of the linguistic variation present in Chuck Billy's comics is important to the Translation Studies area because (pseudo)dialects characterize and mark the language user, being meaningful elements in translations in which the purpose is the maintenance in the target text (TT) of the linguistic characteristics present in the source text (ST). Therewith, it is the translator's role to identify the purpose of the (pseudo)dialect present in the ST and ensure that such purpose is still consistent in the translation. Assuming that Chuck Billy's comics try to fictionally portray the life of a Brazilian hillbilly and that the character's speech is an attempt to represent the hillbilly scenario of such comics, the proposed translations try to maintain the hillbilly (pseudo)dialect represented in the comics, as well as to adapt such comics to the public to whom the TT is destined, a concept from Nord's functionalist approach.
26
Alshaboul, Yousef Mohammad. "From inside the Arab family: What literacy practices occur when raising bilingual and biliterate children?" Thesis, University of North Texas, 2004. https://digital.library.unt.edu/ark:/67531/metadc4722/.
Full textAbstract:
Living in the United States creates unique challenges in biliteracy and bilingualism for the Arab family. While extant literature provides insight into the literacy interactions and experiences of families from many other cultures now living in the U.S. , there is next to nothing regarding the Arab family literacy experience. Thus, knowledge about the literacy activities Arab families engage in as they gain access to and knowledge of a new culture and language is important. The purpose of this study was to investigate and describe the literacy practices of the Arab families raising bilingual and biliterate children in the U.S. This study , using methodology based on ethnographic approaches, investigated the literacy events, behaviors and interactions which occurred within one Arab family over a 16-week period. A second group of participants were 5 other Arab families living in the U.S. Data sources included video and audio recordings, field notes, observations, journals, informal interviews, and artifacts of children's literacy. The researcher and the participants engaged as co-participants in the research. Findings showed that driving factors behind home literacy practices were religious beliefs and the imminence of return to the home country. Arab mothers were found to yield a heavy influence on the pursuit of literacy, as well as the consistency of literacy learning events in the home. Findings should contribute to helping parents of children with different cultural backgrounds and languages provide the most effective types of support in the home instruction to develop fluency in both the new and the primary language. Information gathered would also help teachers bring together these children with their peers and the subject matter to create a positive synergy wherein all learners can be successful.
27
Zwartjes, Otto. "The Andalusian "xarja-s" : poetry at the crossroads of two systems ? /." Nijmegen : [s.n.], 1995. http://catalogue.bnf.fr/ark:/12148/cb38921249k.
Full text
28
Liza, Rodríguez Jacqueline Susann. "Determinación del sexo en guacamayos de las especies Ara ararauna, Ara macao, Ara chloropthera, Ara militaris, Propyrrhura couloni mediante el uso del ADN." Bachelor's thesis, Universidad Nacional Mayor de San Marcos, 2006. https://hdl.handle.net/20.500.12672/685.
Full textAbstract:
Con la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas.
Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo.--- With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.
Tesis
29
Guermazi, Amal. "La musique dans le cinéma de Youssef Chahine : spécificités et fonctions." Thesis, Sorbonne université, 2020. http://www.theses.fr/2020SORUL009.
Full textAbstract:
Malgré l’omniprésence des genres musicaux divers dans le cinéma de Youssef Chahine (1926- 2008), son œuvre prolifique n’a encore fait l’objet d’aucune étude musicologique approfondie. Au croisement de l’Histoire, du cinéma et de la musicologie, cette thèse vise à relever les spécificités et les fonctions de la musique dans les films du cinéaste.L’étude fournit d’abord une contextualisation historique du fait musical dans le cinéma égyptien pendant la première moitié du xxe siècle mettant en évidence l’étroite relation entre film et chanson dès l’avènement du cinéma parlant. Une fois ce cadre global établi, le parcours spécifique de Youssef Chahine est ensuite revisité à travers une lecture musicale de ses films les plus marquants. Quatre périodes essentielles sont ainsi identifiées se résumant dans : le divertissement, l’engagement, la conciliation puis enfin le divertissement de combat. Pour la première fois, nous exposons la manière avec laquelle Chahine change progressivement les codes de la comédie musicale arabe pour aboutir à une musique qui incarne en soi la résistance.Grâce aux archives inédites conservées à la Cinémathèque française, il est désormais possible de plonger au cœur d’un processus de création filmique à caractère musical. Relever les influences du cinéaste, comprendre ses intentions et deviner ses aspirations sont autant d’éléments qui permettent de mieux cerner l’univers chahinienAlthough prominent, music in Chahine's cinema has still not been the focus of any in-depth musicological study. For the first time to the best of our knowledge, and at the crossroads of History, Cinema and Musicology, this thesis aims at revealing the very specificities and functions of music in the filmmaker’s work.First, the study provides a historical contextualization of music in Egyptian cinema during the first half of the 20th century. It shows the close relationship between film and song ever since the introduction of talking pictures to the country. Second, the director's own career-path is revisited in light of his most significant musical films. Four founding periods are identified and summarized in the following eras: pure entertainment, political engagement, conciliation and finally festive criticism. In this last stage, we unveil how Chahine redefines the codes of the Arab musical film with a music that embodies in itself a socio-political discourse.Thanks to the new archives kept at the Cinémathèque française, we can immerse ourselves at the heart of a music-driven film making process. Noting the influences of the director, understanding his intentions and aspirations will eventually allow us to better seize the Chahinian universe
30
Shuqair, Noura Abdulhameed H. "Living Between Two Worlds: Conflict, Investigation And The Change." Master's thesis, University of Central Florida, 2013. http://digital.library.ucf.edu/cdm/ref/collection/ETD/id/5702.
Full textAbstract:
Beginning with my exploration of art as an aesthetic object, this paper shows the growth of my work and concept. Through my practice, I have been able to understand the contradictions in my traditional society and western modernity. It has helped me grapple with my own beliefs, and begin to confront those I don't agree with.M.F.A.
Masters
Visual Arts and Design
Arts and Humanities
Emerging Media; Studio Art and the Computer
31
Abdelli-Pasquier, Fadhel. "La banque arabe pour le développement économique en Afrique, BADEA, et la coopération arabo-africaine /." Paris : Éd. l'Harmattan, 1991. http://catalogue.bnf.fr/ark:/12148/cb35492507w.
Full text
32
La, Follette Tavia. "Sites of Passage: Art as Action in Egypt and the US-- Creating an Autoethnography Through Performance Writing, Revolution, and Social Practice." Antioch University / OhioLINK, 2013. http://rave.ohiolink.edu/etdc/view?acc_num=antioch1365450771.
Full text
33
Jahan, Bakhsh Sefidi Zahra. "La valeur de l'art du Moyen-Orient : l'effet de l'arrivée du marché sur l'évolution du monde de l'art de l'Iran, du Liban et Émirats Arabes Unis et leur rayonnement international." Thesis, Sorbonne Paris Cité, 2017. http://www.theses.fr/2017USPCA041/document.
Full textAbstract:
Cette thèse a pour principal objectif d’étudier la nouvelle configuration de la valeur de l’art moderne et contemporain du Moyen-Orient, et plus précisément la perception qui s’est fait jour à partir du milieu des années 2000, où Dubaï serait devenu le lieu de fixation de la valeur économique et de diffusion de l’art à différents niveaux : national, régional et international. L’art visuel du Moyen-Orient, jusqu’alors limité aux scènes nationales et négligé sur la scène internationale, connaît une évolution locale ainsi qu’un rayonnement international inédit. La mutation innovante du monde de l’art de cette zone géographique repose, en général, sur l’implantation de maisons de vente et sur la formation d’un marché international pour l’art du Moyen-Orient à Dubaï. Ce nouveau dispositif a influencé non seulement l’écosystème du monde national de l’art, mais aussi le choix d’artistes, des commissaires d’exposition autant que des conservateurs des musées internationaux. L’accroissement de champ du marché est l’objet principal de cette étude, et l’ajustement du champ artistique un objet secondaire. En retraçant l’histoire des pays étudiés par une approche sociologique de l’art, il s’agira, d’abord, de cerner l’évolution quantitative et qualitative des galeries d’art visuel, après les avoir identifiées en tant qu’acteur multifonction du monde de l’art, en ce qui concerne trois pays emblématiques de l’art de la région : l’Iran, le Liban et les Émirats Arabes Unis ; ensuite, il s’agira d’analyser leurs activités internationales ainsi que leur rayonnement à la fois régional et international, avant la formation du marché de l’art de Dubaï en 2006 et jusqu’à 2015. La méthodologie employée pour ce travail sollicitera un certain nombre d’outils propres aux sciences sociales et humaines : l’entretien compréhensif, l’enquête quantitative, l’analyse typologique, l’étude documentaire et l’enquête de terrain : l’immersion et l’observation participanteThe main objective of the present doctoral thesis is to study the configuration of the value of Middle Eastern modern and contemporary art. More precisely, we look at how Dubai has emerged in international perceptions as the center for art appraisal and diffusion nationally, regionally and internationally. Middle Eastern visual arts, mainly limited to their national settings, have been overlooked on an international level. Today, we are witnessing their unprecedented emergence and appreciation on the international scene. The innovative mutation of the art world within this geographical zone is mainly due to the implantation of auction houses and the creation of an international market for Middle Eastern art in Dubai. These new measures have not only influenced the ecosystem of the art milieu on a national level, but have also impacted the choice of artists, exhibition commissioners and curators of international museums. The development of this market is the principal object of the present study and as a secondary object, we look at the adjustments made by the art world to adapt to this new art scene. Through the Sociology of Art approach, we retrace the history of three emblematic countries (Iran, Lebanon and the United Arab Emirates) with the aim of understanding the quantitative and qualitative evolution of their visual art galleries identified as multifunctional actors of the art world. We then analyze their international activities as well as their expansion, regionally and internationally, before the creation of the art market of Dubai between 2006 and 2015. Our methodology is based on the research methods of the social sciences: comprehensive interviews, quantitative investigations, typological analyses, documentation review and field work through immersion and participatory observation
34
Nakhli, Alia. "Le discours identitaire dans l’art contemporain en Tunisie : de la tunisianité à l’arabité (1956-1987)." Thesis, Paris 10, 2013. http://www.theses.fr/2013PA100032.
Full textAbstract:
Cette thèse porte sur la fabrique visuelle identitaire dans l’art contemporain, en Tunisie postcoloniale, de 1956 à 1987. Période coïncidant avec la construction d’un État-nation moderne, sur le modèle occidental. Dans une première partie, la recherche focalise sur la mise en place d’une iconographie académique figurative célébrant les us et coutumes ainsi que les scènes populaires. Ce qui a généré une esthétique officielle, véhiculant une image de la nouvelle nation tunisienne, conforme au discours politique exaltant le sentiment national de la tunisianité. Avec le constat d’échec de l’expérience socialiste, en 1969, le changement d’orientation idéologique imposait une recomposition identitaire qui visait la réhabilitation de la dimension arabe de l’identité nationale, et ce, afin de ressusciter l’enthousiasme populaire né avec l’Indépendance. La deuxième partie met en évidence la corrélation entre la crise politique et l’apparition d’une nouvelle esthétique de « l’authenticité » qui célèbre un nouveau principe fédérateur : celui de l’arabité. La thèse retrace la chronologie des manifestations artistiques panarabes, organisées sous la tutelle de l’Union nationale des artistes plasticiens arabes et auxquelles la Tunisie a pris part de façon active. La volonté d’« arabiser » l’art, s’est alors incarnée, outre dans les recherches picturales sur les signes et symboles populaires, dans un courant artistique panarabe baptisé hurûfiyya (lettrisme)This thesis focuses on identity visual factory of contemporary art, in post-colonial Tunisia, from 1956 to 1987. This period coincides with the building of modern nation-State, in compliance with western pattern. In the first part, the research focuses on the setting of a representational academic iconography, celebrating the traditions as well as the popular scenes. This has generated an official aesthetic, conveying a new image of the Tunisian nation, in accordance with the political discourse exalting the national feeling of tunisianity. With the admission of failure of the socialist experience in 1969, the ideological shift imposed a rethinking of identity the aim of which was to rehabilitate the Arabic dimension of the national identity, in order to resuscitate the popular enthusiasm of the early years of the independence. The second part shows the correlation between the political crisis and the appearance of a new aesthetic of “authenticity”, celebrating a new federative principle: the arabity. The thesis traces the chronology of the pan-arab artistic manifestations, organized under the supervision of the national union of plastic arab artists and to which Tunisia took an active part. The willingness to “arabize” the art was then embodied in a pan-arab artistic current, baptized hurûfiyya (lettrism) in addition to researchs on pictorial popular signs and symbols
35
Khlaifat, Abdelfattah S. (Abdelfattah Saleh). "Higher Education in the United Arab Emirates: University of United Arab Emirates and its Development." Thesis, University of North Texas, 1992. https://digital.library.unt.edu/ark:/67531/metadc332689/.
Full textAbstract:
The purpose of this study was to trace the development of education, including higher education, in the United Arab Emirates. In order to complete this study, a computer search of available literature in the English and Arabic languages was constructed. The findings of this study revealed that although education at all levels has been expanded and improved, enrollment in vocational education and science remains low at the secondary level. Students also seem to avoid science and education at the college level. Based on the results of this study, further research should be conducted to determine the perceptions of alumni educational experience, community involvement in education, the role of national and multi-national cooperations in education, and women's education in relation to their participation in the labor force.
36
Boldt, Andrea. "Charakterisierung der Erdnussallergene Ara h 1, Ara h 3/4 und ihrer Isoformen." [S.l.] : [s.n.], 2005. http://deposit.ddb.de/cgi-bin/dokserv?idn=976057409.
Full text
37
AIANI, MARINA. "LE NUOVE CITTADINE ED IL CONSUMO DI NOTIZIE: UN'INDAGINE SU PARTECIPAZIONE, APPARTENENZE E TRASMISSIONE CULTURALE DELLE GIOVANI DI ORIGINE ARABA A MILANO." Doctoral thesis, Università Cattolica del Sacro Cuore, 2015. http://hdl.handle.net/10280/6098.
Full textAbstract:
Sebbene la presenza dei figli degli migranti stia assumendo sempre maggior rilievo anche in Italia la ricerca ha posto poca attenzione alle loro scelte di consumo mediale e all’appropriazione dei media come risorse sociali ed ambientali. La tesi si focalizza sul caso delle giovani donne di origine araba per indagare il ruolo giocato dal consumo di notizie nella cornice più complessa dei processi di negoziazione di identità. Un focus è riservato alle tre dimensioni di appartenenze, partecipazione e trasmissione culturale tra generazioni – in relazione alle madri e ai coetanei. Un’indagine, a livello più “macro”, indaga le possibili implicazioni per il dialogo interculturale. Attraverso la raccolta di quarantotto storie di vita un primo livello di analisi diacronico indaga presenza e intensità del consumo di news nelle fasi della vita per comprendere se possa rappresentare un rito di passaggio all’età adulta, mentre una seconda pista cerca di comprendere come esso si leghi alla questione del sentirsi “cittadini”, in termini di riconoscimento, appartenenza e per scoprire se il consumo di news possa diventare una risorsa per essere soggetti attivi nella sfera pubblica. Tutte le giovani donne di origine araba vivono a Milano, hanno tra i diciotto e i trentadue anni e differiscono per le variabili di 1) nascita o arrivo in Italia dopo i 6 anni; 2) attivismo e 3) religiosità (musulmane, copte ortodosse, atee).Although the presence of migrants’ sons and daughters is gaining more and more importance also in Italy, the research have not given special attention to their choices concerning media consumption and to the appropriation of the media as social and environmental resources. This thesis is focused on the case of young women of Arab origin in order to investigate the intersections between news consumption and the negotiation of the social identity. A first focus is on three dimensions: participation, belonging and cultural transmission – in comparison with mothers and peers. A second “macro” level of the research investigates the implications as regard to intercultural dialogue. Through the collection of forty-eight life histories, a first level of diachronic analysis investigates the presence and the intensity of news consumption in different stages in order to understand if it could be a rite of passage to the adulthood, while a second track tries to understand how this is connected to the feeling of being “citizens”, in terms of identification, belonging and to investigate if news consumption may be a resource to be active citizens in the public sphere. All young women of Arab origin live in Milan, they are between eighteen and thirty-two years old, and differ in variables 1) they were born or arrived in Italy since they were 6 years old, 2) activism and 3) religion (Muslims, Coptic Orthodox or atheists).
38
AIANI, MARINA. "LE NUOVE CITTADINE ED IL CONSUMO DI NOTIZIE: UN'INDAGINE SU PARTECIPAZIONE, APPARTENENZE E TRASMISSIONE CULTURALE DELLE GIOVANI DI ORIGINE ARABA A MILANO." Doctoral thesis, Università Cattolica del Sacro Cuore, 2015. http://hdl.handle.net/10280/6098.
Full textAbstract:
Sebbene la presenza dei figli degli migranti stia assumendo sempre maggior rilievo anche in Italia la ricerca ha posto poca attenzione alle loro scelte di consumo mediale e all’appropriazione dei media come risorse sociali ed ambientali. La tesi si focalizza sul caso delle giovani donne di origine araba per indagare il ruolo giocato dal consumo di notizie nella cornice più complessa dei processi di negoziazione di identità. Un focus è riservato alle tre dimensioni di appartenenze, partecipazione e trasmissione culturale tra generazioni – in relazione alle madri e ai coetanei. Un’indagine, a livello più “macro”, indaga le possibili implicazioni per il dialogo interculturale. Attraverso la raccolta di quarantotto storie di vita un primo livello di analisi diacronico indaga presenza e intensità del consumo di news nelle fasi della vita per comprendere se possa rappresentare un rito di passaggio all’età adulta, mentre una seconda pista cerca di comprendere come esso si leghi alla questione del sentirsi “cittadini”, in termini di riconoscimento, appartenenza e per scoprire se il consumo di news possa diventare una risorsa per essere soggetti attivi nella sfera pubblica. Tutte le giovani donne di origine araba vivono a Milano, hanno tra i diciotto e i trentadue anni e differiscono per le variabili di 1) nascita o arrivo in Italia dopo i 6 anni; 2) attivismo e 3) religiosità (musulmane, copte ortodosse, atee).Although the presence of migrants’ sons and daughters is gaining more and more importance also in Italy, the research have not given special attention to their choices concerning media consumption and to the appropriation of the media as social and environmental resources. This thesis is focused on the case of young women of Arab origin in order to investigate the intersections between news consumption and the negotiation of the social identity. A first focus is on three dimensions: participation, belonging and cultural transmission – in comparison with mothers and peers. A second “macro” level of the research investigates the implications as regard to intercultural dialogue. Through the collection of forty-eight life histories, a first level of diachronic analysis investigates the presence and the intensity of news consumption in different stages in order to understand if it could be a rite of passage to the adulthood, while a second track tries to understand how this is connected to the feeling of being “citizens”, in terms of identification, belonging and to investigate if news consumption may be a resource to be active citizens in the public sphere. All young women of Arab origin live in Milan, they are between eighteen and thirty-two years old, and differ in variables 1) they were born or arrived in Italy since they were 6 years old, 2) activism and 3) religion (Muslims, Coptic Orthodox or atheists).
39
Keresztély, Kata. "Peinture de fiction : une tradition arabe médiévale." Thesis, Paris Sciences et Lettres (ComUE), 2018. http://www.theses.fr/2018PSLEH180/document.
Full textAbstract:
Dans les ouvrages contemporains traitant des arts visuels dans la tradition artistique 'chrétienne' ou 'occidentale' les analyses des œuvres d'art sont souvent effectuées à l'appui d'une approche interdisciplinaire intégrant les méthodes de recherche et les questionnements des sciences sociales ainsi que d'autres disciplines, comme la littérature. Sur se modèle, je tente d’élaborer une méthode de recherche complexe pour l’appliquer dans l’étude de l’iconographie arabe médiévale. Les sources principales de mon travail sont les manuscrits iconographiés de deux 'bestsellers' de la littérature arabe médiévale : les Maqâmât d'al-Harîrî et la traduction arabe de Kalîla wa Dimna de Bîdpây, copiés et peints, pour les premiers au XIIIe siècle, et, pour les seconds, au XIVe siècle, respectivement en Irak, en Syrie et en Egypte. Pour étudier les manuscrits, je propose une approche dont le leitmotiv est l'observation de la relation entre les textes et les images en les considérant comme un ensemble et comme éléments qui constituent des œuvres d'art complexes. Les manuscrits médiévaux contenant des images deviennent ainsi, en tant qu'objets matériels mais aussi comme des produits intellectuels et artistiques, des sources primaires de l’histoire intellectuelle arabe médiévaleIn contemporary studies dealing with visual art within the « Western » or « Christian » world, the artworks’ analysis are often proposed on the basis of an interdisciplinary approach integrating methods of different scientific fields such as social sciences, and literature. Following this model, I try to develop a complex method in order to study medieval Arabic iconography. My work’s principal sources are the illustrated manuscripts of the two « bestsellers » of medieval Arabic literature: al-Harîrî’s Maqâmât and the Arabic translation of Bîdpây’s tales, the Kalîla wa Dimna, copied and painted during the second half of the 13th and the first half of the 14th centuries in Irak, Syria and Egypt. In the analysis of the manuscripts, I concentrate on the relationship between text and images while I consider them as elements of a complex artwork, as a whole. While doing so, medieval manuscripts containing images become primary sources of Arabic intellectual history as material objects but also as intellectual products
40
Al-Kahtany, Abdulwahab Said. "Organizational Commitment: A Cross-National Comparison of Arab and Non-Arab Employees in Saudi Petrochemical Companies." Thesis, University of North Texas, 1998. https://digital.library.unt.edu/ark:/67531/metadc277912/.
Full textAbstract:
Individuals with different personal demographics and job-based factors have different attitudes and behaviors, which can influence their levels of commitment to their organizations. These differences in organizational commitment increase as their cultural backgrounds differ significantly. Personal demographics and job-related factors are reliable predictors of employees' commitment to their employing organizations. The purpose of this study was to empirically investigate if there is a difference in the level of employees' commitment to Saudi petrochemical companies on the basis of differences in their personal demographics and job-related factors.
41
Kerner, Jaclynne J. "Art in the name of science : illustrated manuscripts of the Kitāb al-diryāq /." Ann Arbor (Mich.) : Proquest, UMI dissertation services, 2004. http://catalogue.bnf.fr/ark:/12148/cb411716600.
Full text
42
Bida, Habib. "La notion d'imitation de la nature dans l'art arabo-islamique." Paris 1, 1993. http://www.theses.fr/1993PA010751.
Full textAbstract:
A partir de textes choisis dans le patrimoine culturel araboislamique, datant du 10e au 14e siecle ap jc, et de notions contenues dans les textes, nous avons essaye de decouvrir les fondements philosophiques et esthetiques de certains arts araboislamiques tels que la calligraphie, l'ornementation geometrique et l'art de la miniature. Apres des analyses textuelles operees autour des notions tels que art, perception, forme, matiere, ame, intellect, nature homme, homme parfait, dieu, nous avons decouvert que ces notions fonctionnent entre elles d'une maniere, nous amenant a considerer queles arts arabo-islamiques sont imitatifs de la nature, et que l'artiste arabo-musulman, dans sa demarche artistique, imite dieu a travers ses creations naturelles et ce pour s'affirmer en tant que son vicaire dans le monde d'ici-bas et symboliser sa quete et son desir de voyager vers lui a travers sa "divinite humaine".
43
Hazzouri, Ayman. "Une plasticité contemporaine de la calligraphie arabe (signe, symbole, arabesque dans la peinture arabe contemporaine)." Thesis, Strasbourg, 2013. http://www.theses.fr/2013STRAC022.
Full textAbstract:
Depuis les années 1940, l’art dans le monde arabe traverse des questionnements quant à son authenticité et son identité. Cette thèse souligne dans sa première partie l’importance et l’influence du patrimoine et de l’héritage culturel de la peinture arabe contemporaine. La deuxième partie détaille les éléments culturels provenant de l’héritage patrimonial, dont la complémentarité entre la calligraphie et l’arabesque. Dans la calligraphie contemporaine, des artistes explorent et ont développé de nouvelles formes dans la calligraphie arabe, un art riche qui met au jour la composition plastique de la lettre et sa valeur abstraite. La quête identitaire sera traitée sous la forme d'un mariage entre l’art du passé et l’art de la modernité, via l’étude de la lettre arabe. Elle s'illustre au moyen d'ornements traditionnels de l’art populaire (naïf ou non) comme l’une des sources d’inspiration dans la société arabe actuelle. De ces travaux émergent un questionnement sur l’esthétique et la plasticité de la calligraphie. La troisième partie porte sur la définition et l’apparition de l’orientation artistique nommée Al-Hurufiya et les deux manifestations ponctuelles et majeures qui ont accompagné son apparition, respectivement théorique et artistique : le rassemblement de « la dimension unique » et le Groupe de Casablanca. La quatrième partie expose les différentes caractéristiques de la peinture hurufie, en répertoriant les méthodes employées par les artistes arabes spécialisés dans ses pratiques. Enfin, dans la cinquième partie, nous exposons et expliquons la démarche plastique qui nous inspire à partir de l’usage de la lettre arabe, des signes, des symboles et des autres motifs d’arabesque. L’enjeu est de présenter la relation singulière que nous entretenons avec cet art et de nous inscrire dans le continuum hurufi, pour ensuite nous permettre de bifurquer sur d’autres modes plastiquesSince the 1940s, the art in the Arab world is going through questions about its authenticity and identity. This thesis emphasizes in its first part the importance and influence of the heritage and cultural legacy of contemporary Arab painting. The second part details the cultural elements from the historic heritage, whose complementarily between calligraphy and arabesque. In contemporary calligraphy artists to explore and have developed new forms in Arabic calligraphy, a wealthy art reveals the plastic composition of the letter and its abstract value. The quest for identity is treated as a marriage between the art of the past and the art of modernity, through the study of the Arabic letter. It is illustrated by means of traditional folk art ornaments (naive or not) as a source of inspiration in the current Arab society. From this work emerged a questioning of aesthetics and plasticity of calligraphy. The third part deals with the definition and development of artistic orientation named Al- Hurufiya and two point and major events that have accompanied its appearance, respectively theoretical and artistic: the gathering of the “single dimension” and the Group Casablanca. The fourth part describes the various features of the hurufie painting, identifying the methods used by Arab artists specialized practices. Finally, in the fifth section, we present and explain the artistic approach that inspires us from the use of the Arabic letter, signs, symbols and other Arabesque motifs. The challenge is to present the unique relationship we have with us this art and enroll in the hurufi continuum, then allow us to fork over other plastics modes
44
Marques, Adriana Ribeiro de Oliveira. "Caracterização da estrutura genética populacional das araras vermelhas Ara chloropterus e Ara macao (Psittaciformes, Aves)." Universidade de São Paulo, 2011. http://www.teses.usp.br/teses/disponiveis/41/41131/tde-12052011-152811/.
Full textAbstract:
O objetivo do presente estudo foi caracterizar a estrutura genética populacional de duas espécies de araras: Ara chloropterus e Ara macao. Foram analisadas amostras de sangue e penas de diferentes regiões no Brasil, de uma localidade na Bolívia e outra no Peru. Foram realizadas análises com DNA mitocondrial (região controladora e citocromo oxidase I) e nuclear (microssatélites) das duas espécies. Para A. chloropterus foram obtidos 2166 pares de base do DNA mitocondrial de 89 amostras e dados de seis locos de microssatélites de 95 amostras. A rede de haplótipos e a árvore de neighbor-joining construídas com dados mitocondriais e os índices de FST obtidos com os dois marcadores revelaram fraca estruturação genética. Isso pode ser devido a alto fluxo gênico apresentado ou retenção de polimorfismo ancestral. Portanto, a espécie parece se organizar em metapopulações (baixa estruturação genética e alto fluxo gênico). Nesse caso, seria interessante conservar indivíduos de diversas localidades e seus corredores. Para Muscular Dystrophy foram obtidos 2094 pares de base do DNA mitocondrial de 68 amostras e dados de sete locos de microssatélites de 64 amostras. A rede de haplótipos e a árvore de neighbor-joining construídas com dados mitocondriais e os índices de FST obtidos com os dois marcadores indicam ausência de diferenciação genética entre as localidades estudadas. A análise demográfica dessa espécie indica expansão populacional há pouco mais de 50.000 anos atrás e declínio populacional desde o último período máximo de glaciação. Estes resultados sugerem que essa espécie é constituída de uma única grande população que poderia ser considerada como uma única unidade de manejo caso outras diferenças (ex.: adaptações ecológicas locais) não sejam encontradas. Ambas as espécies estudadas apresentam alta diversidade genética, possivelmente devido a um intenso fluxo gênico dentro de cada uma.The present study aimed to characterize the population genetic structure of two macaw species: Ara chloropterus and Ara macao. Samples from various localities in Brazil, one in Bolivia and another in Peru were analyzed. Mitochondrial (control region and cytochrome oxidase I) and nuclear (microsatellites) DNA were analyzed. For A. chloropterus 89 individuals had 2166 bp of mitochondrial DNA sequenced and 95 individuals were genotyped for six polymorphic microsatellite loci. Network and the neighbor-joining tree constructed based on mitochondrial data and FST values obtained with both molecular markers revealed weak genetic structure. This can be due to high gene flow or retained ancestral polymorphism. Thus, A. chloropterus seems to be organized in metapopulations (low genetic structure and high gene flow). Under this scenario, it would be desirable to preserve individuals from various locations and there corridors. For Muscular Dystrophy we obtained 2094 bp of mitochondrial DNA for 68 individuals and data on seven microsatellites for 64 individuals. The haplotype network and the neighbor-joining tree constructed based on mitochondrial data and FST values obtained with both molecular markers revealed no genetic differentiation among localities. The demographic analysis of this species indicated a population expansion 50,000 years ago and a population decline since the last glaciation maximum. These results suggest that this species is organized as a large population that could be considered as a single management unit for conservation purposes if other differences are not found (eg. local ecological adaptations). Both species have high genetic diversity, possibly due to extensive gene flow within each one.
45
Oostrum, Anne Heleen van. "The art of Nāy playing in modern Egypt /." [Leiden] : [A. H. van Oostrum], 2004. http://catalogue.bnf.fr/ark:/12148/cb40026536q.
Full text
46
Al-Olimat, Muhamad S. (Muhamad Salim). "The State of Democracy in the Arab World." Thesis, University of North Texas, 1995. https://digital.library.unt.edu/ark:/67531/metadc279024/.
Full textAbstract:
This comparative study assesses the state of democracy and examines the process of democratization in the Arab World between the years 1980-1993. It addresses shortcomings in the mainstream democracy literature that excluded the Arab World from the global democratic revolution on political cultural grounds. To fulfil the objectives of this study, I employ both the qualitative and quantitative research approaches to test a number of hypothesized relationships. I hypothesize that transition to democracy is negatively associated with economic development, militarism, U.S. foreign policy, the political economy of oil, and dependency. I contend that emerging civil society institutions so far have had no significant effect on democratization in the Arab World. Finally, I hypothesize that the level of democracy in the Arab World is influenced greatly by the issue of civil rights. In order to investigate the hypothesized relationships, the following data sets have been used: Gastil's Freedom House Data set, "Repression and Freedom in the 1980s" data set, and Vanhanen's 1990 data set. The findings of this study support the aforementioned hypothesized relationships. I find that Arab countries, in general have made modest progress toward democracy, making the Arab World part of the global revolution.
47
Vieira, Carlos Jorge Canto. "Capitéis de ara do Municipium Olisiponense." Master's thesis, Instituições portuguesas -- UNL-Universidade Nova de Lisboa -- FCSH-Faculdade de Ciências Sociais e Humanas -- -Departamento de História da Arte, 1998. http://dited.bn.pt:80/30318.
Full text
48
Doutabaa-Charif, Najia. "Art et altérité : l'intérêt en France pour les faits culturels et artistiques du monde arabe." Paris 10, 2005. http://www.theses.fr/2005PA100093.
Full textAbstract:
En cherchant à comprendre la signification de l'intérêt en France pour les faits culturels et artistiques du monde arabe, l'auteur met en rapport l'art et l'altérité ou son traitement en tant que faits sociaux et historiques. La problématique retenue s'intéresse à l'un des aspects symboliques de la vie sociale : le traitement de l'altérité par le support de l'art. Le travail empirique est composé de deux enquêtes : l'une qualitative auprès des artistes arabes vivant à Paris et la deuxième quantitative puis qualitative donnant la parole aux visiteurs de l'Institut du monde arabe. Les résultats obtenus après analyses et interprétations des entretiens et des questionnaires mettent en évidence du côté des artistes une certaine "lutte pour la reconnaissance". Les résultats de l'enquête auprès des visiteurs révèlent une relation entre le processus symbolique, le traitement de l'altérité, et la pratique culturelle et sociale, la visite à l'Institut du monde arabe. Ils ont mis en évidence des motivations et des intérêts en rapport avec une " demande de connaissance " de l'autre et de sa cultureWhile seeking to understand the significance of the interest taken the cultural and artistic facts of the Arab world in France, the author relates art and otherness or its unveiling of treatment social and historical facts. The problems selected relate to one of the symbolic aspects of social life: the expression of otherness through art. The postulates of knowledge sociology, those of art sociology of and especially the cultural and artistic reception make up the theoretical frames of this study. The empirical work is composed of two investigations : the first one is qualitative amongst the Arab artists living in Paris and the second one quantitative and then qualitative by allowing the visitors of the Institute of the Arab world to give their opinion. The results res highlightobtained alter the analysis and interpretations of the interviews and the questionnai a certain "struggle for recognition" on the artists' side. The results of the investigation amongst the visitors reveal a relationship between the symbolic process, the treatment of otherness, and the cultural and social practice during the visit at the Institute of the Arab world
49
Al-adah, Laila Mohammad Salem. "The experience of Arab university medical students whose main subjects are taught in English." Thesis, University of Huddersfield, 2008. http://eprints.hud.ac.uk/id/eprint/5012/.
Full textAbstract:
The study is about the experience of Arab University students whose main subjects are taught in English. It investigates and discusses many English language problems in the Kingdom of Saudi Arabia in teaching, learning and studying medicine, pure science and technical English. In general, Arab learners of the English language encounter problems in the four skills of the English language, in speaking, writing, reading and listening. They also show weaknesses in many aspects of the English language such as vocabulary, grammar, pronunciation, spelling, morphology and syntax. The question is how these language difficulties affect their studies in medicine. The initial hypothesis was that all depended on the students’ facility in English, but this turned out not to be the case. The research started with the analysis of students’ written replies to questions. This was followed by the development of a questionnaire distributed to 736 medical students. This explored various factors in relation to their success in exams to find out which factors might be significant. There were few correlations between success in medical exams and previous encounters with the English language. The one correlation between the test results and the questionnaire findings was not the uses of and familiarity with English but the parents’ background. The research therefore went on to explore, through interviews, and analysis of written statements, the students’ attitudes towards the teaching of medicine in relation to the use of the English language. It was found that the hypothesis of the importance of English as a prerequisite for success was not borne out. What was discovered was the students’ pragmatic attitude towards their study and that what they thought they needed as medical practitioners depended on a kind of secondary technical vocabulary. The research discusses some of the effects of learning and teaching theories and their relationship to the process of the education system. Whilst social constructivism is held to be the ideal one to apply to the learning process, this research demonstrated that behaviorism and rote learning still dominated the experience of the students in their learning of medicine. Despite their continued commitment to the ideals of learning English, the students took a pragmatic approach to their studies, which consisted of a mixture of Arabic and English medical vocabulary.
50
Frydendahl, Jan Gaute. "ARB-valsede laminatkompositter av AA3103 og Cu." Thesis, Norges teknisk-naturvitenskapelige universitet, Institutt for materialteknologi, 2012. http://urn.kb.se/resolve?urn=urn:nbn:no:ntnu:diva-18885.
Full textAbstract:
Laminatkompositter av plater av AA3103 aluminium + copper, samt AA3103 + C24000 messing, har blitt laget ved å anvende en prosess for akkumulert valsesveising (ARB). To forskjellige kobber/aluminium-stabler ble utsatt for 6 sykluser ARB ved en valsetemperatur på 350°C, og beholdt en kontinuerlig lagstruktur gjennom hele prosessen. Den relativt lave graden av kaldbearbeiding gjorde imidlertid at styrken økte lite eller ingenting med økende antall passeringer. 3 andre paralleller med originalstabler ble lagd av kobber, ikke-anløpt messing, og anløpt messing, der hver plate ble stablet mellom to aluminiumsplater som var betraktelig kaldvalset. Den første passeringen ARB foregikk ved 350°C, mens de påfølgende passeringene skjedde ved romtemperatur (CARB). Hver prøve som ble laget i løpet av denne prosessen ble kritisk oppsprukket, langs midten av plata, langsmed valseretningen, i løpet av den 5. passeringen ARB. I tilleg så hadde store, akkumulerte tøyninger forårsaket betydelig sprekkvekst langs kantene av laminatplatene.Etter passeringene før kritisk sprekkvekst oppstod, viste de kaldvalsede prøvene økende styrke med økende antall passeringer gjennom valsen, helt til det punktet hvor kobber/messing-lagene hadde sprukket opp og ble diskontinuerlige. De oppsprukne lagene bidro lite til styrke i både strekk- og bøyetester, samt at disse materialene gav prøver med innbyrdes større avvik mellom prøver tatt fra forskjellige steder på samme plate. Tidligere forskningsarbeid har funnet at forskjeller i plastisk flyt kan forårsake instabiliteter ved grenseflatene, og at dette fører til necking av lagene til det hardeste materialet. I løpet av arbeidet utført i denne rapporten, ble forholdet mellom lagtykkelsen til de ulike materialene balansert for å motarbeide denne effekten. I tillegg så viste de fremstilte prøvene en hittil oversett instabilitetsmekanisme: skjærdeformasjon. Skjærbånd ble observert i kobberlagene under EBSD-undersøkelser, og antatt korresponderende bølgelignende deformasjonsmønstre, som forplantet seg på tvers av lag, ble observert i lysmikroskop.Videre ARB-passeringer med de utforskede materialene vil ikke være mulig uten noen form for varmebehandling eller anløping mellom enkelte passeringer, siden det vil bli nødvendig å løse opp spenninger i de svært arbeidsherdede materialene.