Academic literature on the topic 'Associated Spring Corporation'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Associated Spring Corporation.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Associated Spring Corporation"

1

Carew, R., T. Meng, W. J. Florkowski, R. Smith, and D. Blair. "Climate change impacts on hard red spring wheat yield and production risk: evidence from Manitoba, Canada." Canadian Journal of Plant Science 98, no. 3 (June 1, 2018): 782–95. http://dx.doi.org/10.1139/cjps-2017-0135.

Full text
Abstract:
A Just–Pope production function is employed to investigate the effects of historic weather changes on hard red spring wheat yield variability in Manitoba. Field-level data on wheat yield, proportion of wheat seeded area, and fertilizer inputs from the Manitoba Agricultural Services Corporation were employed to determine how temperature and precipitation affect mean wheat yield and production risk, and how projected climate scenarios impact yield variability in heterogeneous risk areas of Manitoba. Variety richness increases average yield and reduces yield variance while varieties protected by plant breeders’ rights increase yield variance. Phosphorus fertilizer is positively associated with average wheat yield while total precipitation is shown to negatively affect mean yield and positively impact yield variability. June precipitation matters while June and July temperatures negatively affect yield. Projected climate change is expected to increase yield variability in both the medium (2034–2050) and long term (2079–2095), both under low- and high-carbon scenarios with production variance effects differing across crop districts. Adaptation strategies may be required to mitigate yield risk effects of climate change resulting in late seeding decisions from increased spring precipitation.
APA, Harvard, Vancouver, ISO, and other styles
2

Jan, F. J., S. K. Green, S. L. Shih, L. M. Lee, H. Ito, J. Kimbara, K. Hosoi, and W. S. Tsai. "First Report of Tomato yellow leaf curl Thailand virus in Taiwan." Plant Disease 91, no. 10 (October 2007): 1363. http://dx.doi.org/10.1094/pdis-91-10-1363a.

Full text
Abstract:
During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5′ATCGTGTTGGGAAGAGGTTT3′) and KD-PAC1 (5′GGAGAAAGCTCCCAAAGATT3′). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.
APA, Harvard, Vancouver, ISO, and other styles
3

Lobben, Stian E., Lena Malnes, Sveinung Berntsen, Leif Inge Tjelta, Elling Bere, Morten Kristoffersen, and Thomas Mildestvedt. "Bicycle usage among inactive adults provided with electrically assisted bicycles." Acta Kinesiologiae Universitatis Tartuensis 24 (January 2, 2019): 60–73. http://dx.doi.org/10.12697/akut.2018.24.05.

Full text
Abstract:
In the present study we aimed primarily to examine cycling time and distance when inactive subjects were provided with electrically assisted bicycles. Secondly to evaluate changes in maximal oxygen uptake. Inactive employees in a selection of public and private corporations in three Norwegian cities were invited to participate. Inclusion criteria were: a desire to cycle to work, residence more than 3 km from the workplace, and not physically active according to guidelines. There were 25 participants in the study and we provided them all with electrically assisted bicycles fitted with GPS bike computers to record usage. The participants were followed for three to eight months, 226 days on average. Measures of maximal oxygen uptake were performed before and after the intervention. Demographic characteristics and prior transportation habits were reported in a questionnaire at baseline. Participants cycled for 107.1± 62 min per week covering 37.6 ± 24 km per week. The distances cycled were significantly greater in the autumn (47.4 km/week, p=0.035) than in the spring (32.1 km/week). Participants cycled more on weekdays (7.1 km/day, p < 0.001) compared to weekends (0.9 km/day, p<0.001). Maximal oxygen uptake improved significantly, 2.4 ml/min/kg (7.7 %), p<0.001 and this was associated with cycling distance (r=0.49, p=0.042) and self-reported commuting distance (r=0.51, p=0.018). Offering electrically assisted bicycles to inactive employees may initiate transport-related physical activity and may give positive health effects.
APA, Harvard, Vancouver, ISO, and other styles
4

Elangovan, Harikrishnan, and Rajesh Kumar. "Factors affecting prevalence of overweight and obesity in urban adolescents: a study from North Chennai, India." International Journal of Contemporary Pediatrics 5, no. 5 (August 24, 2018): 1990. http://dx.doi.org/10.18203/2349-3291.ijcp20183545.

Full text
Abstract:
Background: Obesity is escalating at an alarming rate especially among the urban population. Obesity in childhood is an important risk factor for obesity in adulthood. Overweight and obesity are related to physically inactivity, high social economic back ground and dietary transition. This study was done to estimate the overall prevalence of overweight and obesity among urban adolescents and to examine its associated factors.Methods: This is a cross sectional community-based study conducted in North Chennai Corporation Zone II over a period of 2 years. A predesigned proforma was used to collect the demographic profile, socioeconomic status and level of physical activity. Trained Investigators were used to measure anthropometric measures. Data were analyzed with SPSS 16.0 and P value of <0.05 is taken as statistically significant.Results: A total of 4900 children (M: 2317, F: 2583) were included in the study. The prevalence of overweight and obesity were found as 22.1 % and 4.1%. The proportion of overweight was highest at 14 years for boys and 15 years for girls. There is a statistical significance for overweight in relation to sex (P = 0.001), socioeconomic status (P = 0.00001), parent’s occupation (P = 0.00001) and literacy status (P = 0.00001), junk food preference (P = 0.00001), mode of conveyance (P = 0.00001) and level of physical activity (P=0.00001).Conclusions: As obesity in childhood has high risk of comorbidities, intervention studies have to be planned to educate the adolescents as they are the future society and the role models for their off springs.
APA, Harvard, Vancouver, ISO, and other styles
5

Soled, Derek, and Cray Noah. "Leveraging Machine Perfusion to Ameliorate Geographic Disparities in Organ Allocation." Voices in Bioethics 7 (May 9, 2021). http://dx.doi.org/10.52214/vib.v7i.8219.

Full text
Abstract:
Photo by Robina Weermeijer on Unsplash INTRODUCTION Geographic inequities in access to donor lungs have persisted since the first successful lung transplant in 1983.[1] With unanswered questions regarding organ preservation and transport in the early days of transplantation, the United Network of Organ Sharing (UNOS) understandably incorporated geography in the allocation algorithm. Today, geography is still the most influential criterion in the lung allocation algorithm.[2] As a result, patients in urban centers often receive transplants before patients in less-resourced rural areas. Ex vivo machine perfusion can significantly improve lung procurement and transport, offering longer preservation times before, after, or during transportation. Out-of-hospital perfusion centers, a recent addition to the healthcare field, may increase both the number of lungs available and potentially the distance they can travel. Before the adoption of machine perfusion becomes commonplace, UNOS should direct how to integrate machine perfusion into procurement networks best and shed the antiquated geographical confines that govern allocation today and compromise the ethical standards on which the field was founded. ANALYSIS l. The Past: A History of Geographic Disparities in Lung Transplantation Since the founding of UNOS in 1986, patient geography has been the first filter for all lung procurements. In the early days of the field, implementing these so-called donor service areas, while arbitrarily formed, made sense given the unknowns pertaining to lung preservation and transportation. For almost two decades, donor service areas and time on the waitlist governed lung allocation. In 1998, after physician protest and advocacy, the U.S. Department of Health and Human Services (HHS) delivered the Final Rule on Organ Transplantation to create a more equitable organ allocation system. Even then, it was not until 2005 that UNOS developed the lung allocation score, a quantitative metric that considered predicted waitlist survival and transplant benefit. The implementation of the lung allocation score in the U.S. and abroad by Eurotransplant was a success by multiple standards, most importantly reducing waitlist mortality to record lows.[3] However, a glaring problem remained: the donor service area criterion remained, and arbitrary geographical boundaries continued to govern the distribution of all procured lungs. Despite the improvements in waitlist mortality, regions with low rates of lung donation, primarily rural areas, have suffered disproportionately. Areas in the lowest quartile of lung availability had an 84 percent increased risk of waitlist death and a 57 percent lower transplantation rate than the top quartile.[4] In fact, simply moving to an adjacent donor service area a few miles away might double a patient’s chances of receiving a lung transplant, significantly more than that patient being bumped into a higher lung allocation score bracket.[5] That is, driving across an arbitrary border might increase one’s chances of receiving a new set of lungs. Unsurprisingly, analysis of data over the last decade shows that donor service areas are independently associated with disparities in access to lung transplants significantly more than any other factor, including gender, ethnicity, diagnosis group, or age. ll. The Future: Machine Perfusion and Equity in Organ Allocation Farther allocation distances are associated with sharper drops in waitlist mortality. A model from Stanford University demonstrates that expanding the existing 250-mile threshold to a 500-mile threshold would decrease waitlist mortality by 21.3 percent; an expansion of 1000 miles would lower it by 31.8 percent.[6] Since lungs are already more delicate than other solid organs,[7] an expansion would require better and longer preservation. The answer is already here: machine perfusion. Ex vivo machine perfusion of organs prior to transplantation has grown remarkably over the past two decades, with recent clinical trial results demonstrating the ability of machine perfusion to resuscitate and assess “marginal” organs prior to transplantation.[8] Many centers around the U.S. already apply machine perfusion to expand the donor pool, and the adoption of machine perfusion as common practice is burgeoning. While the availability of more organs will decrease waiting list mortality, it alone will not address the longstanding geographical disparities. In fact, unless there is deliberate preparation by UNOS, this new biotechnology could very easily exacerbate geographic disparities. It is currently an expensive technology that is exclusive to urban centers with an already high organ availability. Proper foresight before widespread adoption is critical. As machine perfusion will extend the preservation of all solid organs, discussions must start taking place now regarding larger allocation boundaries or even a boundless system altogether. One concern is that organs resuscitated in this manner will have lower efficacy than organs preserved on ice and rapidly transplanted. Yet, a recent retrospective study from the Toronto group showed that longer perfusion times over 12 hours do not impact patient outcomes,[9] and some groups have had success with preservation times over 20 hours.[10] In addition to longer preservation times, machine perfusion can easily be made portable. Data from a recent international pivotal trial using the Organ Care System (OCS) from the Massachusetts-based company TransMedics showed the promising ability of portable machine perfusion to preserve and resuscitate marginal lungs. Indeed, while much of the attention around machine perfusion has been about its capability to resuscitate marginal organs, its secondary ability, allowing farther transport of lungs, could end geographic disparities in organ allocation. Before it is universally adopted into clinical practice, it is imperative that UNOS acts now to direct hospitals on how to integrate machine perfusion into procurement networks. There also must be preemptive policies regarding out-of-hospital perfusion centers. The first and only example thus far is the private corporation Lung Bioengineering, located in Silver Spring, Maryland. This standalone center aims to resuscitate and analyze declined lungs via machine perfusion, shipping viable ones to nearby U.S. transplant centers. The company is currently finishing a phase 2 clinical trial assessing the safety of extending lung preservation times with it. Unless decisive action is taken now, these centers will continue to open exclusively in urban areas surrounded by high-volume centers. To engage in the UNOS organ allocation system, private corporations should be required to distribute to rural and previously under-resourced areas. This could be accomplished by setting up satellite campuses or investing in the necessary infrastructure to preserve and deliver organs far distances portably. CONCLUSION We finally have the tools to extinguish the perennial problem of geographic disparities in organ allocation. Within the next five to ten years, there will be widespread adoption of machine perfusion, both in hospitals and in out-of-hospital perfusion centers. In an already convoluted organ allocation system, it will further complicate organ allocation and will potentially worsen disparities if action is not taken upfront. Establishing regulations to ensure machine perfusion is leveraged in a way that is equitable to all who need solid organ transplants, not only those who live within 250 miles of transplant centers, is crucial. It is necessary for UNOS to be ahead of the curve, mitigate these potential consequences, and reprioritize the ethical principles on which the field was founded. This example should serve as a model for how biotechnology can ameliorate disparities – geographic or otherwise – in scarce resource allocation in healthcare. [1] Lynch, R. J., and R. E. Patzer. 2019. "Geographic inequity in transplant access." Curr Opin Organ Transplant 24 (3): 337-342. https://doi.org/10.1097/MOT.0000000000000643. [2] Goff, R. R., E. D. Lease, S. Sweet, A. Robinson, and D. Stewart. 2020. “Measuring and Monitoring Equity in Access to Deceased Donor Lung Transplants among Waitlisted Candidates.” J Hear Lung Transplant 39 (4): S216. https://doi.org/10.1016/j.healun.2020.01.847. [3] Egan, T. M. 2018. "From 6 years to 5 days for organ allocation policy change." J Heart Lung Transplant 37 (5): 675-677. https://doi.org/10.1016/j.healun.2017.12.010. [4] Benvenuto, L. J., D. R. Anderson, H. P. Kim, J. L. Hook, L. Shah, H. Y. Robbins, F. D'Ovidio, M. Bacchetta, J. R. Sonett, S. M. Arcasoy, and Program From the Columbia University Lung Transplant. 2018. "Geographic disparities in donor lung supply and lung transplant waitlist outcomes: A cohort study." Am J Transplant 18 (6): 1471-1480. https://doi.org/10.1111/ajt.14630. [5] Kosztowski, M., S. Zhou, E. Bush, R. S. Higgins, D. L. Segev, and S. E. Gentry. 2019. "Geographic disparities in lung transplant rates." Am J Transplant 19 (5): 1491-1497. https://doi.org/10.1111/ajt.15182. [6] Mooney, J. J., J. Bhattacharya, and G. S. Dhillon. 2019. "Effect of broader geographic sharing of donor lungs on lung transplant waitlist outcomes." J Heart Lung Transplant 38 (2): 136-144. https://doi.org/10.1016/j.healun.2018.09.007. [7] Possoz, J., A. Neyrinck, and D. Van Raemdonck. 2019. "Ex vivo lung perfusion prior to transplantation: an overview of current clinical practice worldwide." J Thorac Dis 11 (4): 1635-1650. https://doi.org/10.21037/jtd.2019.04.33. [8] Noah, C. V., P. Tratnig-frankl, S. Raigani, C. Cetrulo, K. Uygun, and H. Yeh. 2020. “Moving the Margins: Updates on the Renaissance in Machine Perfusion for Organ Transplantation.” Curr Transplant Reports 7 (2): 1-10. https://doi.org/10.1007/s40472-020-00277-z. [9] Yeung, J. C., T. Krueger, K. Yasufuku, M. de Perrot, A. F. Pierre, T. K. Waddell, L. G. Singer, S. Keshavjee, and M. Cypel. 2017. "Outcomes after transplantation of lungs preserved for more than 12 h: a retrospective study." Lancet Respir Med 5 (2): 119-124. https://doi.org/10.1016/S2213-2600(16)30323-X. [10] Cypel, M., A. Neyrinck, and T. N. Machuca. 2019. "Ex vivo perfusion techniques: state of the art and potential applications." Intensive Care Med 45 (3): 354-356. https://doi.org/10.1007/s00134-019-05568-3.
APA, Harvard, Vancouver, ISO, and other styles
6

Deck, Andy. "Treadmill Culture." M/C Journal 6, no. 2 (April 1, 2003). http://dx.doi.org/10.5204/mcj.2157.

Full text
Abstract:
Since the first days of the World Wide Web, artists like myself have been exploring the new possibilities of network interactivity. Some good tools and languages have been developed and made available free for the public to use. This has empowered individuals to participate in the media in ways that are quite remarkable. Nonetheless, the future of independent media is clouded by legal, regulatory, and organisational challenges that need to be addressed. It is not clear to what extent independent content producers will be able to build upon the successes of the 90s – it is yet to be seen whether their efforts will be largely nullified by the anticyclones of a hostile media market. Not so long ago, American news magazines were covering the Browser War. Several real wars later, the terms of surrender are becoming clearer. Now both of the major Internet browsers are owned by huge media corporations, and most of the states (and Reagan-appointed judges) that were demanding the break-up of Microsoft have given up. A curious about-face occurred in U.S. Justice Department policy when John Ashcroft decided to drop the federal case. Maybe Microsoft's value as a partner in covert activity appealed to Ashcroft more than free competition. Regardless, Microsoft is now turning its wrath on new competitors, people who are doing something very, very bad: sharing the products of their own labour. This practice of sharing source code and building free software infrastructure is epitomised by the continuing development of Linux. Everything in the Linux kernel is free, publicly accessible information. As a rule, the people building this "open source" operating system software believe that maintaining transparency is important. But U.S. courts are not doing much to help. In a case brought by the Motion Picture Association of America against Eric Corley, a federal district court blocked the distribution of source code that enables these systems to play DVDs. In addition to censoring Corley's journal, the court ruled that any programmer who writes a program that plays a DVD must comply with a host of license restrictions. In short, an established and popular media format (the DVD) cannot be used under open source operating systems without sacrificing the principle that software source code should remain in the public domain. Should the contents of operating systems be tightly guarded secrets, or subject to public review? If there are capable programmers willing to create good, free operating systems, should the law stand in their way? The question concerning what type of software infrastructure will dominate personal computers in the future is being answered as much by disappointing legal decisions as it is by consumer choice. Rather than ensuring the necessary conditions for innovation and cooperation, the courts permit a monopoly to continue. Rather than endorsing transparency, secrecy prevails. Rather than aiming to preserve a balance between the commercial economy and the gift-economy, sharing is being undermined by the law. Part of the mystery of the Internet for a lot of newcomers must be that it seems to disprove the old adage that you can't get something for nothing. Free games, free music, free pornography, free art. Media corporations are doing their best to change this situation. The FBI and trade groups have blitzed the American news media with alarmist reports about how children don't understand that sharing digital information is a crime. Teacher Gail Chmura, the star of one such media campaign, says of her students, "It's always been interesting that they don't see a connection between the two. They just don't get it" (Hopper). Perhaps the confusion arises because the kids do understand that digital duplication lets two people have the same thing. Theft is at best a metaphor for the copying of data, because the original is not stolen in the same sense as a material object. In the effort to liken all copying to theft, legal provisions for the fair use of intellectual property are neglected. Teachers could just as easily emphasise the importance of sharing and the development of an electronic commons that is free for all to use. The values advanced by the trade groups are not beyond question and are not historical constants. According to Donald Krueckeberg, Rutgers University Professor of Urban Planning, native Americans tied the concept of property not to ownership but to use. "One used it, one moved on, and use was shared with others" (qtd. in Batt). Perhaps it is necessary for individuals to have dominion over some private data. But who owns the land, wind, sun, and sky of the Internet – the infrastructure? Given that publicly-funded research and free software have been as important to the development of the Internet as have business and commercial software, it is not surprising that some ambiguity remains about the property status of the dataverse. For many the Internet is as much a medium for expression and the interplay of languages as it is a framework for monetary transaction. In the case involving DVD software mentioned previously, there emerged a grass-roots campaign in opposition to censorship. Dozens of philosophical programmers and computer scientists asserted the expressive and linguistic bases of software by creating variations on the algorithm needed to play DVDs. The forbidden lines of symbols were printed on T-shirts, translated into different computer languages, translated into legal rhetoric, and even embedded into DNA and pictures of MPAA president Jack Valenti (see e.g. Touretzky). These efforts were inspired by a shared conviction that important liberties were at stake. Supporting the MPAA's position would do more than protect movies from piracy. The use of the algorithm was not clearly linked to an intent to pirate movies. Many felt that outlawing the DVD algorithm, which had been experimentally developed by a Norwegian teenager, represented a suppression of gumption and ingenuity. The court's decision rejected established principles of fair use, denied the established legality of reverse engineering software to achieve compatibility, and asserted that journalists and scientists had no right to publish a bit of code if it might be misused. In a similar case in April 2000, a U.S. court of appeals found that First Amendment protections did apply to software (Junger). Noting that source code has both an expressive feature and a functional feature, this court held that First Amendment protection is not reserved only for purely expressive communication. Yet in the DVD case, the court opposed this view and enforced the inflexible demands of the Digital Millennium Copyright Act. Notwithstanding Ted Nelson's characterisation of computers as literary machines, the decision meant that the linguistic and expressive aspects of software would be subordinated to other concerns. A simple series of symbols were thereby cast under a veil of legal secrecy. Although they were easy to discover, and capable of being committed to memory or translated to other languages, fair use and other intuitive freedoms were deemed expendable. These sorts of legal obstacles are serious challenges to the continued viability of free software like Linux. The central value proposition of Linux-based operating systems – free, open source code – is threatening to commercial competitors. Some corporations are intent on stifling further development of free alternatives. Patents offer another vulnerability. The writing of free software has become a minefield of potential patent lawsuits. Corporations have repeatedly chosen to pursue patent litigation years after the alleged infringements have been incorporated into widely used free software. For example, although it was designed to avoid patent problems by an array of international experts, the image file format known as JPEG (Joint Photographic Experts Group) has recently been dogged by patent infringement charges. Despite good intentions, low-budget initiatives and ad hoc organisations are ill equipped to fight profiteering patent lawsuits. One wonders whether software innovation is directed more by lawyers or computer scientists. The present copyright and patent regimes may serve the needs of the larger corporations, but it is doubtful that they are the best means of fostering software innovation and quality. Orwell wrote in his Homage to Catalonia, There was a new rule that censored portions of the newspaper must not be left blank but filled up with other matter; as a result it was often impossible to tell when something had been cut out. The development of the Internet has a similar character: new diversions spring up to replace what might have been so that the lost potential is hardly felt. The process of retrofitting Internet software to suit ideological and commercial agendas is already well underway. For example, Microsoft has announced recently that it will discontinue support for the Java language in 2004. The problem with Java, from Microsoft's perspective, is that it provides portable programming tools that work under all operating systems, not just Windows. With Java, programmers can develop software for the large number of Windows users, while simultaneously offering software to users of other operating systems. Java is an important piece of the software infrastructure for Internet content developers. Yet, in the interest of coercing people to use only their operating systems, Microsoft is willing to undermine thousands of existing Java-language projects. Their marketing hype calls this progress. The software industry relies on sales to survive, so if it means laying waste to good products and millions of hours of work in order to sell something new, well, that's business. The consequent infrastructure instability keeps software developers, and other creative people, on a treadmill. From Progressive Load by Andy Deck, artcontext.org/progload As an Internet content producer, one does not appeal directly to the hearts and minds of the public; one appeals through the medium of software and hardware. Since most people are understandably reluctant to modify the software running on their computers, the software installed initially is a critical determinant of what is possible. Unconventional, independent, and artistic uses of the Internet are diminished when the media infrastructure is effectively established by decree. Unaccountable corporate control over infrastructure software tilts the playing field against smaller content producers who have neither the advance warning of industrial machinations, nor the employees and resources necessary to keep up with a regime of strategic, cyclical obsolescence. It seems that independent content producers must conform to the distribution technologies and content formats favoured by the entertainment and marketing sectors, or else resign themselves to occupying the margins of media activity. It is no secret that highly diversified media corporations can leverage their assets to favour their own media offerings and confound their competitors. Yet when media giants AOL and Time-Warner announced their plans to merge in 2000, the claim of CEOs Steve Case and Gerald Levin that the merged companies would "operate in the public interest" was hardly challenged by American journalists. Time-Warner has since fought to end all ownership limits in the cable industry; and Case, who formerly championed third-party access to cable broadband markets, changed his tune abruptly after the merger. Now that Case has been ousted, it is unclear whether he still favours oligopoly. According to Levin, global media will be and is fast becoming the predominant business of the 21st century ... more important than government. It's more important than educational institutions and non-profits. We're going to need to have these corporations redefined as instruments of public service, and that may be a more efficient way to deal with society's problems than bureaucratic governments. Corporate dominance is going to be forced anyhow because when you have a system that is instantly available everywhere in the world immediately, then the old-fashioned regulatory system has to give way (Levin). It doesn't require a lot of insight to understand that this "redefinition," this slight of hand, does not protect the public from abuses of power: the dissolution of the "old-fashioned regulatory system" does not serve the public interest. From Lexicon by Andy Deck, artcontext.org/lexicon) As an artist who has adopted telecommunications networks and software as his medium, it disappoints me that a mercenary vision of electronic media's future seems to be the prevailing blueprint. The giantism of media corporations, and the ongoing deregulation of media consolidation (Ahrens), underscore the critical need for independent media sources. If it were just a matter of which cola to drink, it would not be of much concern, but media corporations control content. In this hyper-mediated age, content – whether produced by artists or journalists – crucially affects what people think about and how they understand the world. Content is not impervious to the software, protocols, and chicanery that surround its delivery. It is about time that people interested in independent voices stop believing that laissez faire capitalism is building a better media infrastructure. The German writer Hans Magnus Enzensberger reminds us that the media tyrannies that affect us are social products. The media industry relies on thousands of people to make the compromises necessary to maintain its course. The rapid development of the mind industry, its rise to a key position in modern society, has profoundly changed the role of the intellectual. He finds himself confronted with new threats and new opportunities. Whether he knows it or not, whether he likes it or not, he has become the accomplice of a huge industrial complex which depends for its survival on him, as he depends on it for his own. He must try, at any cost, to use it for his own purposes, which are incompatible with the purposes of the mind machine. What it upholds he must subvert. He may play it crooked or straight, he may win or lose the game; but he would do well to remember that there is more at stake than his own fortune (Enzensberger 18). Some cultural leaders have recognised the important role that free software already plays in the infrastructure of the Internet. Among intellectuals there is undoubtedly a genuine concern about the emerging contours of corporate, global media. But more effective solidarity is needed. Interest in open source has tended to remain superficial, leading to trendy, cosmetic, and symbolic uses of terms like "open source" rather than to a deeper commitment to an open, public information infrastructure. Too much attention is focussed on what's "cool" and not enough on the road ahead. Various media specialists – designers, programmers, artists, and technical directors – make important decisions that affect the continuing development of electronic media. Many developers have failed to recognise (or care) that their decisions regarding media formats can have long reaching consequences. Web sites that use media formats which are unworkable for open source operating systems should be actively discouraged. Comparable technologies are usually available to solve compatibility problems. Going with the market flow is not really giving people what they want: it often opposes the work of thousands of activists who are trying to develop open source alternatives (see e.g. Greene). Average Internet users can contribute to a more innovative, free, open, and independent media – and being conscientious is not always difficult or unpleasant. One project worthy of support is the Internet browser Mozilla. Currently, many content developers create their Websites so that they will look good only in Microsoft's Internet Explorer. While somewhat understandable given the market dominance of Internet Explorer, this disregard for interoperability undercuts attempts to popularise standards-compliant alternatives. Mozilla, written by a loose-knit group of activists and programmers (some of whom are paid by AOL/Time-Warner), can be used as an alternative to Microsoft's browser. If more people use Mozilla, it will be harder for content providers to ignore the way their Web pages appear in standards-compliant browsers. The Mozilla browser, which is an open source initiative, can be downloaded from http://www.mozilla.org/. While there are many people working to create real and lasting alternatives to the monopolistic and technocratic dynamics that are emerging, it takes a great deal of cooperation to resist the media titans, the FCC, and the courts. Oddly enough, corporate interests sometimes overlap with those of the public. Some industrial players, such as IBM, now support open source software. For them it is mostly a business decision. Frustrated by the coercive control of Microsoft, they support efforts to develop another operating system platform. For others, including this writer, the open source movement is interesting for the potential it holds to foster a more heterogeneous and less authoritarian communications infrastructure. Many people can find common cause in this resistance to globalised uniformity and consolidated media ownership. The biggest challenge may be to get people to believe that their choices really matter, that by endorsing certain products and operating systems and not others, they can actually make a difference. But it's unlikely that this idea will flourish if artists and intellectuals don't view their own actions as consequential. There is a troubling tendency for people to see themselves as powerless in the face of the market. This paralysing habit of mind must be abandoned before the media will be free. Works Cited Ahrens, Frank. "Policy Watch." Washington Post (23 June 2002): H03. 30 March 2003 <http://www.washingtonpost.com/ac2/wp-dyn/A27015-2002Jun22?la... ...nguage=printer>. Batt, William. "How Our Towns Got That Way." 7 Oct. 1996. 31 March 2003 <http://www.esb.utexas.edu/drnrm/WhatIs/LandValue.htm>. Chester, Jeff. "Gerald Levin's Negative Legacy." Alternet.org 6 Dec. 2001. 5 March 2003 <http://www.democraticmedia.org/resources/editorials/levin.php>. Enzensberger, Hans Magnus. "The Industrialisation of the Mind." Raids and Reconstructions. London: Pluto Press, 1975. 18. Greene, Thomas C. "MS to Eradicate GPL, Hence Linux." 25 June 2002. 5 March 2003 <http://www.theregus.com/content/4/25378.php>. Hopper, D. Ian. "FBI Pushes for Cyber Ethics Education." Associated Press 10 Oct. 2000. 29 March 2003 <http://www.billingsgazette.com/computing/20001010_cethics.php>. Junger v. Daley. U.S. Court of Appeals for 6th Circuit. 00a0117p.06. 2000. 31 March 2003 <http://pacer.ca6.uscourts.gov/cgi-bin/getopn.pl?OPINION=00a0... ...117p.06>. Levin, Gerald. "Millennium 2000 Special." CNN 2 Jan. 2000. Touretzky, D. S. "Gallery of CSS Descramblers." 2000. 29 March 2003 <http://www.cs.cmu.edu/~dst/DeCSS/Gallery>. Links http://artcontext.org/lexicon/ http://artcontext.org/progload http://pacer.ca6.uscourts.gov/cgi-bin/getopn.pl?OPINION=00a0117p.06 http://www.billingsgazette.com/computing/20001010_cethics.html http://www.cs.cmu.edu/~dst/DeCSS/Gallery http://www.democraticmedia.org/resources/editorials/levin.html http://www.esb.utexas.edu/drnrm/WhatIs/LandValue.htm http://www.mozilla.org/ http://www.theregus.com/content/4/25378.html http://www.washingtonpost.com/ac2/wp-dyn/A27015-2002Jun22?language=printer Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Deck, Andy. "Treadmill Culture " M/C: A Journal of Media and Culture< http://www.media-culture.org.au/0304/04-treadmillculture.php>. APA Style Deck, A. (2003, Apr 23). Treadmill Culture . M/C: A Journal of Media and Culture, 6,< http://www.media-culture.org.au/0304/04-treadmillculture.php>
APA, Harvard, Vancouver, ISO, and other styles
7

Mocatta, Gabi, and Erin Hawley. "Uncovering a Climate Catastrophe? Media Coverage of Australia’s Black Summer Bushfires and the Revelatory Extent of the Climate Blame Frame." M/C Journal 23, no. 4 (August 12, 2020). http://dx.doi.org/10.5204/mcj.1666.

Full text
Abstract:
The Black Summer of 2019/2020 saw the forests of southeast Australia go up in flames. The fire season started early, in September 2019, and by March 2020 fires had burned over 12.6 million hectares (Werner and Lyons). The scale and severity of the fires was quickly confirmed by scientists to be “unprecedented globally” (Boer et al.) and attributable to climate change (Nolan et al.).The fires were also a media spectacle, generating months of apocalyptic front-page images and harrowing broadcast footage. Media coverage was particularly preoccupied by the cause of the fires. Media framing of disasters often seeks to attribute blame (Anderson et al.; Ewart and McLean) and, over the course of the fire period, blame for the fires was attributed to climate change in much media coverage. However, as the disaster unfolded, denialist discourses in some media outlets sought to veil this revelation by providing alternative explanations for the fires. Misinformation originating from social media also contributed to this obscuration.In this article, we investigate the extent to which media coverage of the 2019/2020 bushfires functioned both to precipitate a climate change epiphany and also to support refutation of the connection between catastrophic fires and the climate crisis.Environmental Communication and RevelationIn its biblical sense, revelation is both an ending and an opening: it is the apocalyptic end-time and also the “revealing” of this time through stories and images. Environmental communication has always been revelatory, in these dual senses of the word – it is a mode of communication that is tightly bound to crisis; that has long grappled with obfuscation and misinformation; and that disrupts power structures and notions of the status quo as it seeks to reveal what is hidden. Climate change in particular is associated in the popular imagination with apocalypse, and is also a reality that is constantly being “revealed”. Indeed, the narrative of climate change has been “animated by the revelations of science” (McNeish 1045) and presented to the public through “key moments of disclosure and revelation”, or “signal moments”, such as scientist James Hansen’s 1988 US Senate testimony on global warming (Hamblyn 224).Journalism is “at the frontline of environmental communication” (Parham 96) and environmental news, too, is often revelatory in nature – it exposes the problems inherent in the human relationship with the natural world, and it reveals the scientific evidence behind contentious issues such as climate change. Like other environmental communicators, environmental journalists seek to “break through the perceptual paralysis” (Nisbet 44) surrounding climate change, with the dual aim of better informing the public and instigating policy change. Yet leading environmental commentators continually call for “better media coverage” of the planetary crisis (Suzuki), as climate change is repeatedly bumped off the news agenda by stories and events deemed more newsworthy.News coverage of climate-related disasters is often revelatory both in tone and in cultural function. The disasters themselves and the news narratives which communicate them become processes that make visible what is hidden. Because environmental news is “event driven” (Hansen 95), disasters receive far more news coverage than ongoing problems and trends such as climate change itself, or more quietly devastating issues such as species extinction or climate migration. Disasters are also highly visual in nature. Trumbo (269) describes climate change as an issue that is urgent, global in scale, and yet “practically invisible”; in this sense, climate-related disasters become a means of visualising and realising what is otherwise a complex, difficult, abstract, and un-seeable concept.Unsurprisingly, natural disasters are often presented to the public through a film of apocalyptic rhetoric and imagery. Yet natural disasters can be also “revelatory” moments: instances of awakening in which suppressed truths come spectacularly and devastatingly to the surface. Matthewman (9–10) argues that “disasters afford us insights into social reality that ordinarily pass unnoticed. As such, they can be read as modes of disclosure, forms of communication”. Disasters, he continues, can reveal both “our new normal” and “our general existential condition”, bringing “the underbelly of progress into sharp relief”. Similarly, Lukes (1) states that disasters “lift veils”, revealing “what is hidden from view in normal times”. Yet for Lukes, “the revelation tells us nothing new, nothing that we did not already know”, and is instead a forced confronting of that which is known yet difficult to engage with. Lukes’ concern is the “revealing” of poverty and inequality in New Orleans following the impact of Hurricane Katrina, yet climate-related disasters can also make visible what McNeish terms “the dark side effects of industrial civilisation” (1047). The Australian bushfires of 2019/2020 can be read in these terms, primarily because they unveiled the connection between climate change and extreme events. Scorching millions of hectares, with a devastating impact on human and non-human communities, the fires revealed climate change as a physical reality, and—for Australians—as a local issue as well as a global one. As media coverage of the fires unfolded and smoke settled on half the country, the impact of climate change on individual lives, communities, landscapes, native animal and plant species, and well-established cultural practices (such as the summer camping holiday) could be fully and dramatically realised. Even for those Australians not immediately impacted, the effects were lived and felt: in our lungs, and on our skin, a physical revelation that the impacts of climate change are not limited to geographically distant people or as-yet-unborn future generations. For many of us, the summer of fire was a realisation that climate change can no longer be held at arm’s length.“Revelation” also involves a temporal collapse whereby the future is dragged into the present. A revelatory streak of this nature has always existed at the heart of environmental communication and can be traced back at least as far as the environmentalist Rachel Carson, whose 1962 book Silent Spring revealed a bleak, apocalyptic future devoid of wildlife and birdsong. In other words, environmental communication can inspire action for change by exposing the ways in which the comforts and securities of the present are built upon a refusal to engage with the future. This temporal rupture where the future meets the present is particularly characteristic of climate change narratives. It is not surprising, then, that media coverage of the 2019/2020 bushfires addressed not just the immediate loss and devastation but also dread of the future, and the understanding that summer will increasingly hold such threats. Bushfires, Climate Change and the MediaThe link between bushfire risk and climate change generated a flurry of coverage in the Australian media well before the fires started in the spring of 2019. In April that year, a coalition of 23 former fire and emergency services leaders warned that Australia was “unprepared for an escalating climate threat” (Cox). They requested a meeting with the new government, to be elected in May, and better funding for firefighting to face the coming bushfire season. When that meeting was granted, at the end of Australia’s hottest and driest year on record (Doyle) in November 2019, bushfires had already been burning for two months. As the fires burned, the emergency leaders expressed frustration that their warnings had been ignored, claiming they had been “gagged” because “you are not allowed to talk about climate change”. They cited climate change as the key reason why the fire season was lengthening and fires were harder to fight. "If it's not time now to speak about climate and what's driving these events”, they asked, “– when?" (McCubbing).The mediatised uncovering of a bushfire/climate change connection was not strictly a revelation. Recent fires in California, Russia, the Amazon, Greece, and Sweden have all been reported in the media as having been exacerbated by climate change. Australia, however, has long regarded itself as a “fire continent”: a place adapted to fire, whose landscapes invite fire and can recover from it. Bushfires had therefore been considered part of the Australian “normal”. But in the Australian spring of 2019, with fires having started earlier than ever and charring rainforests that did not usually burn, the fire chiefs’ warning of a climate change-induced catastrophic bushfire season seemed prescient. As the fires spread and merged, taking homes, lives, landscapes, and driving people towards the water, revelatory images emerged in the media. Pictures of fire refugees fleeing under dystopian crimson skies, masked against the smoke, were accompanied by headlines like “Apocalypse Now” (Fife-Yeomans) and “Escaping Hell” (The Independent). Reports used words like “terror”, “nightmare” (Smee), “mayhem”, and “Armageddon” (Davidson).In the Australian media, the fire/climate change connection quickly became politicised. The Deputy Prime Minister Michael McCormack interviewed by the ABC, responding to a comment by Greens leader Adam Bandt, said connecting bushfire and climate while the fires raged was “disgraceful” and “disgusting”. People needed help, he said, not “the ravings of some pure enlightened and woke capital city greenies” (Goloubeva and Haydar). Gladys Berejiklian the NSW Premier also described it as “inappropriate” (Baker) and “disappointing” (Fox and Higgins) to talk about climate change at this time. However Carol Sparks, Mayor of bushfire-ravaged Glen Innes in rural NSW, contradicted this stance, telling the ABC (Australian Broadcasting Corporation) “Michael McCormack needs to read the science”. Climate change, she said, was “not a political thing” but “scientific fact” (Goloubeva and Haydar).As the fires merged and intensified, so did the media firestorm. Key Australian media became a sparring ground for issue definition, with media predictably split down ideological lines. Public broadcasters the ABC and SBS (Special Broadcasting Service), along with The Age, The Sydney Morning Herald and The Guardian Australia, predominantly framed the catastrophe as wrought by climate change. The Guardian, in an in-depth investigation of climate science and bushfire risk, stated that “despite the political smokescreen” the connection between the fires and global warming was “unequivocal” (Redfearn). The ABC characterised the fires as “a glimpse of the horrors of climate change’s crescendoing impact” (Rose). News outlets owned by Rupert Murdoch’s News Corp Australia, however, actively sought to play down the fires’ seriousness. On 2 January, as front pages of newspapers across the world revealed horrifying fiery images, Murdoch’s Australian ran an upbeat shot of New Year’s Day picnic races as its lead, relegating discussion of the fires to page 4 (Meade). More than simply obscuring the fires’ significance, News Corp media actively sought to convince readers that the fires were not out of the ordinary. For example, as the fires’ magnitude was becoming clear on the last day of 2019, The Australian ran a piece comparing the fires with previous conflagrations, claiming such conditions were “not unprecedented” and the fires were “nothing new” (Johnstone). News Corp’s Sky News also used this frame: “climate alarmists”, “catastrophise”, and “don’t want to look at history”, it stated in a segment comparing the event to past major bushfires (Kenny).As the fires continued into January and February 2020, the refutation of the climate change frame solidified around several themes. Conservative media continued to insist the fires were “normal” for Australia and attributed their severity to a lack of hazard reduction burning, which they blamed on “Greens policies” (Brown and Caisley). They also promoted the argument, espoused by Energy Minister Angus Taylor, that with only “1.3% of global emissions” Australia “could not have meaningful impact” on global warming through emissions reductions, and that top-down climate mitigation pressure from the UN was “doomed to fail” (Lloyd). Foreign media saw the fires in quite different terms. From the outside looking in, the Australian fires were clearly revealed as fuelled by global heating and exacerbated by the Australian government’s climate denialism. Australia was framed as a “notorious climate offender” (Shield) that was—as The New York Times put it—“committing climate suicide” (Flanagan) with its lack of coherent climate policy and its predilection for mining coal. Ouest-France ran a headline reading “High on carbon, rich Australia denies global warming” in which it called Scott Morrison’s position on climate change “incomprehensible” (Guibert). The LA Times called the Australian fires “a climate change warning to its leaders—and ours”, noting how “fossil fuel friendly Morrison” had “gleefully wielded a fist-sized chunk of coal on the floor of parliament in 2017” (Karlik). In the UK, the Independent online ran a front page spread of the fires’ vast smoke plume, with the headline “This is what a climate crisis looks like” (Independent Online), while Australian MP Craig Kelly was called “disgraceful” by an interviewer on Good Morning Britain for denying the fires’ link to climate change (Good Morning Britain).Both in Australia and internationally, deliberate misinformation spread by social media additionally shaped media discourse on the fires. The false revelation that the fires had predominantly been started by arson spread on Twitter under the hashtag #ArsonEmergency. While research has been quick to show that this hashtag was artificially promoted by bots (Weber et al.), this and misinformation like it was also shared and amplified by real Twitter users, and quickly spread into mainstream media in Australia—including Murdoch’s Australian (Ross and Reid)—and internationally. Such misinformation was used to shore up denialist discourses about the fires, and to obscure revelation of the fire/climate change connection. Blame Framing, Public Opinion and the Extent of the Climate Change RevelationAs studies of media coverage of environmental disasters show us, media seek to apportion blame. This blame framing is “accountability work”, undertaken to explain how and why a disaster occurred, with the aim of “scrutinizing the actions of crisis actors, and holding responsible authorities to account” (Anderson et al. 930). In moments of disaster and in their aftermath, “framing contests” (Benford and Snow) can emerge in which some actors, regarding the crisis as an opportunity for change, highlight the systemic issues that have led to the crisis. Other actors, experiencing the crisis as a threat to the status quo, try to attribute the blame to others, and deny the need for policy change. As the Black Summer unfolded, just such a contest took place in Australian media discourse. While Murdoch’s dominant News Corp media sought to protect the status quo, promote conservative politicians’ views, and divert attention from the climate crisis, other Australian and overseas media outlets revealed the fires’ link to climate change and intransigent emissions policy. However, cracks did begin to show in the News Corp stance on climate change during the fires: an internal whistleblower publicly resigned over the media company’s fires coverage, calling it a “misinformation campaign”, and James Murdoch also spoke out about being “disappointed with the ongoing denial of the role of climate change” in reporting the fires (ABC/Reuters).Although media reporting on the environment has long been at the forefront of shaping social understanding of environmental issues, and news maintains a central role in both revealing environmental threats and shaping environmental politics (Lester), during Australia’s Black Summer people were also learning about the fires from lived experience. Polls show that the fires affected 57% of Australians. Even those distant from the catastrophe were, for some time, breathing the most toxic air in the world. This personal experience of disaster revealed a bushfire season that was far outside the normal, and public opinion reflected this. A YouGov Australia Institute poll in January 2020 found that 79% of Australians were concerned about climate change—an increase of 5% from July 2019—and 67% believed climate change was making the bushfires worse (Australia Institute). However, a January 2020 Ipsos poll also found that polarisation along political lines on whether climate change was indeed occurring had increased since 2018, and was at its highest levels since 2014 (Crowe). This may reflect the kind of polarised media landscape that was evident during the fires. A thorough dissection in public discourse of Australia’s unprecedented fire season has been largely eclipsed by the vast coverage of the coronavirus pandemic that so quickly followed it. In May 2020, however, the fires were back in the media, when the Bushfires Royal Commission found that the Black Summer “played out exactly as scientists predicted it would” and that more seasons like it were now “locked in” because of carbon emissions (Hitch). It now remains to be seen whether the revelatory extent of the climate change blame frame that played out in media discourse on the fires will be sufficient to garner meaningful action and policy change—or whether denialist discourses will again obscure climate change revelation and seek to maintain the status quo. References Anderson, Deb, et al. "Fanning the Blame: Media Accountability, Climate and Crisis on the Australian ‘Fire Continent’." Environmental Communication 12.7 (2018): 928-41.Australia Institute. “Climate Change Concern.” Jan. 2020. <https://www.tai.org.au/sites/default/files/Polling%20-%20January%202020%20-%20Climate%20change%20concern%20and%20attitude%20%5BWeb%5D.pdf>.Baker, Nick. “NSW Mayor Alams Deputy PM’s 'Insulting' Climate Change Attack during Bushfires.” SBS News 11 Nov. 2019. <https://www.sbs.com.au/news/nsw-mayor-slams-deputy-pm-s-insulting-climate-change-attack-during-bushfires>.Benford, Robert D., and David A. Snow. "Framing Processes and Social Movements: An Overview and Assessment." Annual Review of Sociology 26.1 (2000): 611-39.Boer, Matthias M., Víctor Resco de Dios, and Ross A. Bradstock. "Unprecedented Burn Area of Australian Mega Forest Fires." Nature Climate Change 10.3 (2020): 171-72.Brown, Greg, and Olivia Caisley. “Greens Policies Increasing Bushfire Threat, Barnaby Joyce Says.” The Australian 11 Nov. 2019. <https://www.theaustralian.com.au/nation/politics/deputy-pm-michael-mccormack-slams-raving-innercity-lunatics-for-linking-climate-change-to-fires/news-story/5c3ba8d3e72bc5f10fcf49a94fc9be85>.Carson, Rachel. Silent Spring. Boston and New York: Houghton Mifflin, 2002 [1962].Cox, Lisa. “Former Fire Chiefs Warn Australia Is Unprepared for Escalating Fire Threat.” The Guardian 10 Apr. 2019. <https://www.theguardian.com/australia-news/2019/apr/09/former-fire-chiefs-warn-australia-unprepared-for-escalating-climate-threat>.Crowe, David. “Ipsos Poll Offers Only a Rough Guide to the Liberal Party’s Uncertain Fate.” Sydney Morning Herald 7 Apr. 2019.Davidson, Helen. “Mallacoota Fire: Images of 'Mayhem' and 'Armageddon' as Bushfires Rage.” The Guardian 31 Dec. 2019. <https://www.theguardian.com/australia-news/2019/dec/31/mallacoota-fire-mayhem-armageddon-bushfires-rage-victoria-east-gippsland>.Doyle, Kate. “2019 Was Australia’s Hottest and Driest Year on Record.” ABC News 2 Jan. 2020. <https://www.abc.net.au/news/2020-01-02/2019-was-australias-hottest-and-driest-year-on-record/11837312>.“Escaping Hell.” The Independent 2 Jan. 2020.Ewart, Jacqui, and Hamish McLean. "Ducking for Cover in the ‘Blame Game’: News Framing of the Findings of Two Reports into the 2010–11 Queensland floods." Disasters 39.1 (2015): 166-84.Fife-Yeomans, Janet. “Apocalypse Now.” Herald Sun 1 Jan. 2020. Flanagan, Richard. “Australia Is Committing Climate Suicide.” The New York Times 3 Jan. 2020. <https://www.nytimes.com/2020/01/03/opinion/australia-fires-climate-change.html>.Fox, Aine, and Hannah Higgins. “Climate Talks for Another Day: NSW Premier.” 7 News 11 Nov. 2019. <https://7news.com.au/news/disaster-and-emergency/climate-change-talk-inappropriate-premier-c-55045>.Goloubeva, Jenya, and Nour Haydar. “Regional Mayors Criticise Politicians for Failing to Link Climate Change and Deadly Bushfires.” ABC News 11 Nov. 2019. <https://www.abc.net.au/news/2019-11-11/carol-sparks-climate-change-federal-government-claire-pontin/11691444>.Good Morning Britain. “Interview with Craig Kelly MP.” ITV 6 Jan. 2020.Guibert, Christelle. “Dopée au Charbon, la Riche Australie Nie le Réchauffement Climatique.” Ouest France 20 Dec. 2019. <https://www.ouest-france.fr/monde/australie/dopee-au-charbon-la-riche-australie-nie-le-rechauffement-climatique-6664289>.Hamblyn, Richard. “The Whistleblower and the Canary: Rhetorical Constructions of Climate Change.” Journal of Historical Geography 35 (2009): 223–36.Hansen, Anders. Environment, Media, and Communication. New York: Routledge, 2010.Happer, Catherine, and Greg Philo. “New Approaches to Understanding the Role of the News Media in the Formation of Public Attitudes and Behaviours on Climate Change.” European Journal of Communication 31.2 (2016): 136–51.Hitch, Georgia. “Bushfire Royal Commission: 'Black Summer' Played Out Exactly as Scientists Predicted It Would.” ABC News 25 May 2020. <https://www.abc.net.au/news/2020-05-25/bushfire-royal-commission-hearing-updates/12282808>.Johnstone, Craig. “History of Disasters Shows There Is Nothing New about Nation’s Destructive Blazes.” The Australian 31 Dec. 2019. <https://www.theaustralian.com.au/nation/history-of-disasters-shows-there-is-nothing-new-about-nations-destructive-blazes/news-story/f43c2a6037a8b0e422a69880bce10139>.Karlik, Evan. “Opinion: In Australia’s Raging Bushfires, a Climate-Change Warning to Its Leaders — and Ours.” The Los Angeles Times 10 Jan. 2020. <https://www.latimes.com/opinion/story/2020-01-10/australia-fires-prime-minister-politics-united-states>.Kenny, Chris. “Climate Alarmists Don't Want to Look at History.” Sky News 21 Nov. 2019. <https://www.skynews.com.au/details/_6106878027001>.Lester, Libby. Media & Environment: Conflict, Politics and the News. Polity: Cambridge, 2010. Lloyd, Graham. “Climate Pressure ‘Doomed to Fail’, Says Angus Taylor.” The Australian 30 Dec. 2019. <https://www.theaustralian.com.au/nation/politics/climate-pressure-doomed-to-fail-says-angus-taylor/news-story/f2441a20c70b944dd1d54ae15f304791>.Lukes, Stephen. “Questions about Power: Lessons from the Louisiana Hurricane.” Social Science Research Council (2006). 12 May. 2020 <https://items.ssrc.org/understanding-katrina/questions-about-power-lessons-from-the-louisiana-hurricane/>.Matthewman, Steve. Disasters, Risks and Revelation: Making Sense of Our Times. London and New York: Palgrave Macmillan, 2015.McCubbing, Gus. “Declare Climate Emergency: Ex-Fire Chiefs.” The Canberra Times 14 Nov. 2019. <https://www.canberratimes.com.au/story/6491540/declare-climate-emergency-ex-fire-chiefs/>.McNeish, Wallace. “From Revelation to Revolution: Apocalypticism in Green Politics.” Environmental Politics 26.6 (2017): 1035–54.Meade, Amanda. “The Australian: Murdoch-Owned Newspaper Accused of Downplaying Bushfires in Favour of Picnic Races.” The Guardian 4 Jan. 2020. <https://www.theguardian.com/media/2020/jan/04/the-australian-murdoch-owned-newspaper-accused-of-downplaying-bushfires-in-favour-of-picnic-races>.Nisbet Matthew C. “Knowledge into Action: Framing the Debates over Climate Change and Poverty.” Doing News Framing Analysis: Empirical and Theoretical Perspectives. Eds. Paul D’Angelo and Jim A. Kuypers. London and New York: Routledge, 2010. 59–99.Nolan, Rachael H., et al. "Causes and Consequences of Eastern Australia’s 2019‐20 Season of Mega‐Fires." Global Change Biology (2020): 1039-41.Parham, John. Green Media and Popular Culture: An Introduction. New York and London: Palgrave, 2016.Redfearn, Graham. “Explainer: What Are the Underlying Causes of Australia's Shocking Bushfire Season?” The Guardian 13 Jan. 2020. <https://www.theguardian.com/environment/2020/jan/13/explainer-what-are-the-underlying-causes-of-australias-shocking-bushfire-season>.Rose, Anna. “The Battle against the Bushfires Should Focus Our Attention on the War against Climate Inaction”. ABC News 2 Feb. 2020. <https://www.abc.net.au/news/2020-02-02/battle-against-bushfires-war-against-climate-inaction/11909806>.Ross, David, and Imogen Reid. “Bushfires: Firebugs Fuelling Crisis as National Arson Toll Hits 183.” The Australian 15 Jan. 2020. <https://www.theaustralian.com.au/nation/bushfires-firebugs-fuelling-crisis-asarson-arresttollhits183/news-story/52536dc9ca9bb87b7c76d36ed1acf53f>. “Rupert Murdoch's Son James Criticises News Corp, Fox for Climate Change and Bushfire Coverage.” ABC/Reuters 15 Jan. 2020. <https://www.abc.net.au/news/2020-01-15/james-murdoch-criticises-news-corp-fox-climate-change-coverage/11868544>.Shield, Charli. “Australian Bushfires: The Canary Building the Coal Mine.” Deutsche Welle 1 Jan. 2020. <https://www.dw.com/en/australian-bushfires-the-canary-building-the-coal-mine/a-51955677>.Smee, Ben. “Darkness at Noon: Australia’s Bushfire Day of Terror.” The Guardian 31 Dec. 2019. <https://www.theguardian.com/australia-news/2019/dec/31/darkness-at-noon-australia-bushfire-day-of-terror>.“This Is What a Climate Crisis Looks Like.” Independent Online. 2 Jan. 2020. Suzuki, David. “Ecological Crises Deserve Better Media Coverage.” The David Suzuki Foundation, 2020. 18 Mar. 2020. <https://davidsuzuki.org/story/ecological-crises-deserve-better-media-coverage/>.Trumbo, Craig. “Constructing Climate Change: Claims and Frames in US News Coverage of an Environmental Issue.” Public Understanding of Science 5.3 (1996): 269–84.Weber, Derek, et al. "#ArsonEmergency and Australia's ‘Black Summer’: Polarisation and Misinformation on Social Media." arXiv preprint arXiv:2004.00742 (2020).Werner, Joel, and Suzannah Lyons. “The Size of Australia's Bushfire Crisis Captured in Five Big Numbers.” ABC News 5 Mar. 2020. <https://www.abc.net.au/news/science/2020-03-05/bushfire-crisis-five-big-numbers/12007716>.
APA, Harvard, Vancouver, ISO, and other styles
8

West, Patrick Leslie, and Cher Coad. "The CCTV Headquarters—Horizontal Skyscraper or Vertical Courtyard? Anomalies of Beijing Architecture, Urbanism, and Globalisation." M/C Journal 23, no. 5 (October 7, 2020). http://dx.doi.org/10.5204/mcj.1680.

Full text
Abstract:
I have decided to launch a campaign against the skyscraper, that hideous, mediocre form of architecture…. Today we only have an empty version of it, only competing in height.— Rem Koolhaas, “Kool Enough for Beijing?”Figure 1: The CCTV Headquarters—A Courtyard in the Air. Cher Coad, 2020.Introduction: An Anomaly within an Anomaly Construction of Beijing’s China Central Television Headquarters (henceforth CCTV Headquarters) began in 2004 and the building was officially completed in 2012. It is a project by the Office for Metropolitan Architecture (OMA) headed by Rem Koolhaas (1944-), who has been called “the coolest, hippest, and most cutting-edge architect on the planet”(“Rem Koolhaas Biography”). The CCTV Headquarters is a distinctive feature of downtown Beijing and is heavily associated in the Western world with 21st-century China. It is often used as the backdrop for reports from the China correspondent for the Australian Broadcasting Corporation (ABC), Bill Birtles. The construction of the CCTV Headquarters, however, was very much an international enterprise. Koolhaas himself is Dutch, and the building was one of the first projects the OMA did outside of America after 9/11. As Koolhaas describes it: we had incredible emphasis on New York for five years, and America for five years, and what we decided to do after September 11 when we realized that, you know, things were going to be different in America: [was] to also orient ourselves eastwards [Koolhaas goes on to describe two projects: the Hermitage Museum, St. Petersburg, Russia and the CCTV Headquarters]. (Rem Koolhaas Interview) Problematically, Koolhaas claims that the building we created for CCTV could never have been conceived by the Chinese and could never have been built by Europeans. It is a hybrid by definition. It was also a partnership, not a foreign imposition…. There was a huge Chinese component from the very beginning. We tried to do a building that conveys that it has emerged from the local situation. (Fraioli 117) Our article reinterprets this reading. We suggest that the OMA’s “incredible emphasis” on America—home of the world’s first skyscraper: the Home Insurance Building built in 1885 in Chicago, Illinois—pivotally spills over into its engagement with China. The emergence of the CCTV Headquarters “from the local situation”, such as it is, is more in spite of Koolhaas’s stated “hybrid” approach than because of it, for what’s missing from his analysis of the CCTV Headquarters’ provenance is the siheyuan or classical Chinese courtyard house. We will argue that the CCTV Headquarters is an anomaly within an anomaly in contemporary Beijing’s urban landscape, to the extent that it turns the typologies of both the (vertical, American) skyscraper and the (horizontal, Chinese) siheyuan on a 90 degree angle. The important point to make here, however, is that these two anomalous elements of the building are not of the same order. While the anomalous re-configuration of the skyscraper typology is clearly part of Koolhaas’s architectural manifesto, it is against his architectural intentionality that the CCTV Headquarters sustains the typology of the siheyuan. This bespeaks the persistent and perhaps functional presence of traditional Chinese architecture and urbanism in the building. Koolhaas’s building contains both starkly evident and more secretive anomalies. Ironically then, there is a certain truth in Koolhaas’s words, beneath the critique we made of it above as an example of American-dominated, homogenising globalisation. And the significance of the CCTV Headquarters’ hybridity as both skyscraper and siheyuan can be elaborated through Daniel M. Abramson’s thesis that a consideration of unbuilt architecture has the potential to re-open architecture to its historical conditions. Roberto Schwarz argues that “forms are the abstract of specific social relationships” (53). Drawing on Schwarz’s work and Abramson’s, we conclude that the historical presence—as secretive anomaly—of the siheyuan in the CCTV Headquarters suggests that the building’s formal debt to the siheyuan (more so than to the American skyscraper) may continue to unsettle the “specific social relationship” of Chinese to Western society (Schwarz 53). The site of this unsettlement, we suggest, is data. The CCTV Headquarters might well be the most data-rich site in all of China—it is, after all, a monumental television station. Suggestively, this wealth of airborne data is literally enclosed within the aerial “courtyard”, with its classical Chinese form, of the CCTV Headquarters. This could hardly be irrelevant in the context of the geo-politics of globalised data. The “form of data”, to coin a phrase, radiates through all the social consequences of data flow and usage, and here the form of data is entwined with a form always already saturated with social consequence. The secretive architectural anomaly of Koolhaas’s building is thus a heterotopic space within the broader Western engagement with China, so much of which relates to flows and captures of data. The Ubiquitous Siheyuan or Classical Chinese Courtyard House According to Ying Liu and Adenrele Awotona, “the courtyard house, a residential compound with buildings surrounding a courtyard on four (or sometimes three) sides, has been representative of housing patterns for over one thousand years in China” (248). Liu and Awotona state that “courtyard house patterns could be found in many parts of China, but the most typical forms are those located in the Old City in Beijing, the capital of China for over eight hundred years” (252). In their reading, the siheyuan is a peculiarly elastic architectural typology, whose influence is present as much in the Forbidden City as in the humble family home (252). Prima facie then, it is not surprising that it has also secreted itself within the architectural form of Koolhaas’s creation. It is important to note, however, that while the “most typical forms” of the siheyuan are indeed still to be found in Beijing, the courtyard house is an increasingly uncommon sight in the Chinese capital. An article in the China Daily from 2004 refers to the “few remaining siheyuan” (“Kool Enough for Beijing?”). That said, all is not lost for the siheyuan. Liu and Awotona discuss how the classical form of the courtyard house has been modified to more effectively house current residents in the older parts of Beijing while protecting “the horizontal planning feature of traditional Beijing” (254). “Basic design principles” (255) of the siheyuan have supported “a transition from the traditional single-household courtyard housing form to a contemporary multi-household courtyard housing form” (254). In this process, approaches of “urban renewal [involving] demolition” and “preservation, renovation and rebuilding” have been taken (255). Donia Zhang extends the work of Liu and Awotona in the elaboration of her thesis that “Chinese-Americans interested in building Chinese-style courtyard houses in America are keen to learn about their architectural heritage” (47). Zhang’s article concludes with an illustration that shows how the siheyuan may be merged with the typical American suburban dwelling (66). The final thing to emphasise about the siheyuan is what Liu and Awotona describe as its “special introverted quality” (249). The form is saturated with social consequence by virtue of its philosophical undergirding. The coincidence of philosophies of Daoism (including feng-shui) and Confucianism in the architecture and spatiality of the classical Chinese courtyard house makes it an exceedingly odd anomaly of passivity and power (250-51). The courtyard itself has a highly charged role in the management of family, social and cultural life, which, we suggest, survives its transposition into novel architectural environments. Figure 2: The CCTV Headquarters—Looking Up at “The Overhang”. Cher Coad, 2020. The CCTV Headquarters: A New Type of Skyscraper? Rem Koolhaas is not the only architect to interrogate the standard skyscraper typology. In his essay from 1999, “The Architecture of the Future”, Norman Foster argues that “the world’s increasing ecological crisis” (278) is in part a function of “unchecked urban sprawl” (279). A new type of skyscraper, he suggests, might at least ameliorate the sprawl of our cities: the Millennium Tower that we have proposed in Tokyo takes a traditional horizontal city quarter—housing, shops, restaurants, cinemas, museums, sporting facilities, green spaces and public transport networks—and turns it on its side to create a super-tall building with a multiplicity of uses … . It would create a virtually self-sufficient, fully self-sustaining community in the sky. (279) Koolhaas follows suit, arguing that “the actual point of the skyscraper—to increase worker density—has been lost. Skyscrapers are now only momentary points of high density spaced so far apart that they don’t actually increase density at all” (“Kool Enough for Beijing?”). Foster’s solution to urban sprawl is to make the horizontal (an urban segment) vertical; Koolhaas’s is to make the vertical horizontal: “we’ve [OMA] come up with two types: a very low-rise series of buildings, or a single, condensed hyperbuilding. What we’re doing with CCTV is a prototype of the hyperbuilding” (“Kool Enough for Beijing?”). Interestingly, the “low-rise” type mentioned here brings to mind the siheyuan—textual evidence, perhaps, that the siheyuan is always already a silent fellow traveller of the CCTV Headquarters project. The CCTV Headquarters is, even at over 200 metres tall itself, an anomaly of horizontalism amidst Beijing’s pervasive skyscraper verticality. As Paul Goldberger reports, “some Beijingers have taken to calling it Big Shorts”, which again evokes horizontality. This is its most obvious anomaly, and a somewhat melancholy reminder of “the horizontal planning feature of traditional Beijing” now mutilated by skyscrapers (Liu and Awotona 254). In the same gesture, however, with which it lays the skyscraper on its side, Koolhaas’s creation raises into the air the shape of the courtyard of a classical Chinese house. To our knowledge, no one has noticed this before, let alone written about it. It is, to be sure, a genuine courtyard shape—not merely an archway or a bridge with unoccupied space between. Pure building entirely surrounds the vertical courtyard shape formed in the air. Most images of the building provide an orientation that maximises the size of its vertical courtyard. To this extent, the (secret) courtyard shape of the building is hidden in plain sight. It is possible, however, to make the courtyard narrow to a mere slit of space, and finally to nothing, by circumnavigating the building. Certain perspectives on the building can even make it look like a more-or-less ordinary skyscraper. But, as a quick google-image search reveals, such views are rare. What seems to make the building special to people is precisely that part of it that is not building. Furthermore, anyone approaching the CCTV Headquarters with the intention of locating a courtyard typology within its form will be disappointed unless they look to its vertical plane. There is no hint of a courtyard at the base of the building. Figure 3: The CCTV Headquarters—View from “The Overhang”. Cher Coad, 2020.Figure 4: The CCTV Headquarters—Looking through the Floor of “The Overhang”. Cher Coad, 2020.Visiting the CCTV Headquarters: A “Special Introverted Quality?” In January 2020, we visited the CCTV Headquarters, ostensibly as audience members for a recording of a science spectacular show. Towards the end of the recording, we were granted a quick tour of the building. It is rare for foreigners to gain access to the sections of the building we visited. Taking the lift about 40 floors up, we arrived at the cantilever level—known informally as “the overhang”. Glass discs in the floor allow one to walk out over nothingness, looking down on ant-like pedestrians. Looking down like this was also to peer into the vacant “courtyard” of the building—into a structure “turned or pushed inward on itself”, which is the anatomical definition of “introverted” (Oxford Languages Dictionary). Workers in the building evinced no great affection for it, and certainly nothing of our wide-eyed wonder. Somebody said, “it’s just a place to work”. One of this article’s authors, Patrick West, seemed to feel the overhang almost imperceptibly vibrating beneath him. (Still, he has also experienced this sensation in conventional skyscrapers.) We were told the rumour that the building has started to tilt over dangerously. Being high in the air, but also high on the air, with nothing but air beneath us, felt edgy—somehow special—our own little world. Koolhaas promotes the CCTV Headquarters as (in paraphrase) “its own city, its own community” (“Kool Enough for Beijing?”). This resonated with us on our visit. Conventional skyscrapers fracture any sense of community through their segregated floor-upon-floor verticality; there is never enough room for a little patch of horizontal urbanism to unroll. Within “the overhang”, the CCTV Headquarters felt unlike a standard skyscraper, as if we were in an urban space magically levitated from the streets below. Sure, we had been told by one of the building’s inhabitants that it was “just a place to work”—but compared to the bleak sterility of most skyscraper work places, it wasn’t that sterile. The phrase Liu and Awotona use of the siheyuan comes to mind here, as we recall our experience; somehow, we had been inside a different type of building, one with its own “special introverted quality” (249). Special, that is, in the sense of containing just so much of horizontal urbanism as allows the building to retain its introverted quality as “its own city” (“Kool Enough for Beijing?”). Figure 5: The CCTV Headquarters—View from “The Overhang”. Cher Coad, 2020.Figure 6: The CCTV Headquarters—Inside “The Overhang”. Cher Coad, 2020. Unbuilt Architecture: The Visionary and the Contingent Within the present that it constitutes, built architecture is surrounded by unbuilt architecture at two interfaces: where the past ends; where the future begins. The soupy mix of urbanism continually spawns myriad architectural possibilities, and any given skyscraper is haunted by all the skyscrapers it might have been. History and the past hang heavily from them. Meanwhile, architectural programme or ambition—such as it is—pulls in the other direction: towards an idealised (if not impossible to practically realise) future. Along these lines, Koolhaas and the OMA are plainly a future-directed, as well as self-aware, architectural unit: at OMA we try to build in the greatest possible tolerance and the least amount of rigidity in terms of embodying one particular moment. We want our buildings to evolve. A building has at least two lives—the one imagined by its maker and the life it lives afterward—and they are never the same. (Fraioli 115) Koolhaas makes the same point even more starkly with regard to the CCTV Headquarters project through his use of the word “prototype”: “what we’re doing with CCTV is a prototype of the hyperbuilding” (“Kool Enough for Beijing?”). At the same time, however, as the presence of the siheyuan within the architecture of the CCTV Headquarters shows, the work of the OMA cannot escape from the superabundance of history, within which, as Roberto Schwarz claims, “forms are the abstract of specific social relationships” (53). Supporting our contentions here, Daniel M. Abramson notes that unbuilt architecture implies two sub-categories … the visionary unbuilt, and the contingent … . Visionary schemes invite a forward glance, down one true, vanguard path to a reformed society and discipline. The contingent unbuilts, conversely, invite a backward glance, along multiple routes history might have gone, each with its own likelihood and validity; no privileged truths. (Abramson)Introducing Abramson’s theory to the example of the CCTV Headquarters, the “visionary unbuilt” lines up with Koolhaas’ thesis that the building is a future-directed “prototype”. while the clearest candidate for the “contingent unbuilt”, we suggest, is the siheyuan. Why? Firstly, the siheyuan is hidden in plain sight, within the framing architecture of the CCTV Headquarters; secondly, it is ubiquitous in Beijing urbanism—little wonder then that it turns up, unannounced, in this Beijing building; thirdly, and related to the second point, the two buildings share a “special introverted quality” (Liu and Awotona 249). “The contingent”, in this case, is the anomaly nestled within the much more blatant “visionary” (or futuristic) anomaly—the hyperbuilding to come—of the Beijing-embedded CCTV Headquarters. Koolhaas’s building’s most fascinating anomaly relates, not to any forecast of the future, but to the subtle persistence of the past—its muted quotation of the ancient siheyuan form. Our article is, in part, a response to Abramson’s invitation to “pursue … the consequences of the unbuilt … [and thus] to open architectural history more fully to history”. We have supplemented Abramson’s idea with Schwarz’s suggestion that “forms are the abstract of specific social relationships” (53). The anomaly of the siheyuan—alongside that of the hyperbuilding—within the CCTV headquarters, opens the building up (paraphrasing Abramson) to a fuller analysis of its historical positioning within Western and Eastern flows of globalisation (or better, as we are about to suggest, of glocalisation). In parallel, its form (paraphrasing Schwarz) abstracts and re-presents this history’s specific social relationships. Figure 7: The CCTV Headquarters—A Courtyard of Data. Cher Coad, 2020.Conclusion: A Courtyard of Data and Tensions of Glocalisation Koolhaas proposes that the CCTV Headquarters was “a partnership, not a foreign imposition” and that the building “emerged from the local situation” (Fraioli 117). To us, this smacks of Pollyanna globalisation. The CCTV Headquarters is, we suggest, more accurately read as an imposition of the American skyscraper typology, albeit in anomalous form. (One might even argue that the building’s horizontal deviation from the vertical norm reinforces that norm.) Still, amidst a thicket of conventionally vertical skyscrapers, the building’s horizontalism does have the anomalous effect of recalling “the horizontal planning feature of traditional Beijing” (Liu and Awotona 254). Buried within its horizontalism, however, lies a more secretive anomaly in the form of a vertical siheyuan. This anomaly, we contend, motivates a terminological shift from “globalisation” to “glocalisation”, for the latter term better captures the notion of a lack of reconciliation between the “global” and the “local” in the building. Koolhaas’s visionary architectural programme explicitly advances anomaly. The CCTV Headquarters radically reworks the skyscraper typology as the prototype of a hyperbuilding defined by horizontalism. Certainly, such horizontalism recalls the horizontal plane of pre-skyscraper Beijing and, if faintly, that plane’s ubiquitous feature: the classical courtyard house. Simultaneously, however, the siheyuan has a direct if secretive presence within the morphology of the CCTV Headquarters, even as any suggestion of a vertical courtyard is strikingly absent from Koolhaas’s vanguard manifesto. To this extent, the hyperbuilding fits within Abramson’s category of “the visionary unbuilt”, while the siheyuan aligns with Abramson’s “contingent unbuilt” descriptor. The latter is the “might have been” that, largely under the pressure of its ubiquity as Beijing vernacular architecture, “very nearly is”. Drawing on Schwarz’s idea that “forms are the abstract of specific social relationships”, we propose that the siheyuan, as anomalous form of the CCTV Headquarters, is a heterotopic space within the hybrid global harmony (to paraphrase Koolhaas) purportedly represented by the building (53). In this space thus formed collides the built-up historical and philosophical social intensity of the classical Chinese courtyard house and the intensities of data flows and captures that help constitute the predominantly capitalist and neo-liberalist “social relationship” of China and the Western world—the world of the skyscraper (Schwarz). Within the siheyuan of the CCTV Headquarters, globalised data is literally enveloped by Daoism and Confucianism; it is saturated with the social consequence of local place. The term “glocalisation” is, we suggest, to be preferred here to “globalisation”, because of how it better reflects such vernacular interruptions to the hegemony of globalised space. Forms delineate social relationships, and data, which both forms and is formed by social relationships, may be formed by architecture as much as anything else within social space. Attention to the unbuilt architectural forms (vanguard and contingent) contained within the CCTV Headquarters reveals layers of anomaly that might, ultimately, point to another form of architecture entirely, in which glocal tensions are not only recognised, but resolved. Here, Abramson’s historical project intersects, in the final analysis, with a worldwide politics. Figure 8: The CCTV Headquarters—A Sound Stage in Action. Cher Coad, 2020. References Abramson, Daniel M. “Stakes of the Unbuilt.” Aggregate Architectural History Collaborative. 20 July 2020. <http://we-aggregate.org/piece/stakes-of-the-unbuilt>.Foster, N. “The Architecture of the Future.” The Architecture Reader: Essential Writings from Vitruvius to the Present. Ed. A. Krista Sykes. New York: George Braziller, 2007: 276-79. Fraioli, Paul. “The Invention and Reinvention of the City: An Interview with Rem Koolhaas.” Journal of International Affairs 65.2 (Spring/Summer 2012): 113-19. Goldberger, Paul. “Forbidden Cities: Beijing’s Great New Architecture Is a Mixed Blessing for the City.” The New Yorker—The Sky Line. 23 June 2008. <https://www.newyorker.com/magazine/2008/06/30/forbidden-cities>.“Kool Enough for Beijing?” China Daily. 2 March 2004. <https://www.chinadaily.com.cn/english/doc/2004-03/02/content_310800.htm>. Liu, Ying, and Adenrele Awotona. “The Traditional Courtyard House in China: Its Formation and Transition.” Evolving Environmental Ideals—Changing Way of Life, Values and Design Practices: IAPS 14 Conference Proceedings. IAPS. Stockholm, Sweden: Royal Institute of Technology, 1996: 248-60. <https://iaps.architexturez.net/system/files/pdf/1202bm1029.content.pdf>.Oxford Languages Dictionary. “Rem Koolhaas Biography.” Encyclopedia of World Biography. 20 July 2020. <https://www.notablebiographies.com/news/Ge-La/Koolhaas-Rem.html>. “Rem Koolhaas Interview.” Manufacturing Intellect. Canadian Broadcasting Corporation. 2003. <https://www.youtube.com/watch?v=oW187PwSjY0>.Schwarz, Roberto. Misplaced Ideas: Essays on Brazilian Culture. New York: Verso, 1992. Zhang, Donia. “Classical Courtyard Houses of Beijing: Architecture as Cultural Artifact.” Space and Communication 1.1 (Dec. 2015): 47-68.
APA, Harvard, Vancouver, ISO, and other styles
9

Sofoulis, Zoé. "Machinic Musings with Mumford." M/C Journal 2, no. 6 (September 1, 1999). http://dx.doi.org/10.5204/mcj.1781.

Full text
Abstract:
What is a machine? As part of his answer to this, historian and philosopher of technology Lewis Mumford cites a classic definition: "a machine is a combination of resistant bodies so arranged that by their means the mechanical forces of nature can be compelled to do work accompanied by certain determinant motions" (Reuleaux [1876], qtd. in Mumford, Technics and Civilisation 9). Mumford's own definition is focussed on machines as part of a technological continuum between human body and automaton: Machines have developed out of a complex of non-organic agents for converting energy, for performing work, for enlarging the mechanical or sensory capacities of the human body, or for reducing to a mensurable order and regularity the processes of life. The automaton is the last step in a process that began with the use of one part or another of the human body as a tool. (9-10) The tool and the machine can be distinguished along this technological continuum, with the tool more dependent on "the skill and motive power of the operator", subject to "manipulation", and potentially more flexible in its uses, whereas the machine lends itself more to "automatic action" of a specialised kind. However, it is difficult to ultimately separate them, since the embodied skill of the tool-user becomes more mechanical and reflexive with practice (Technics and Civilisation 10), while the machine also evolves along increasingly organic lines (367), and there are common examples of hybrid machine-tools like the lathe or drill, which combine "the accuracy of the finest machine ... with the skilled attendance of the workman" (10). A powerfully attractive feature of the computer is that it is an effective hybrid of machine and tool: like a machine it performs many specialised functions at super-human speed and accuracy on command, but like a tool it is flexible and adaptable (through add-on software and plug-in peripherals) to a seemingly endless variety of users and uses. Fascinating Assemblages The automatic machine ... involves the notion of an external source of power, a more or less complicated inter-relation of parts, and a limited kind of activity. From the beginning the machine was a sort of minor organism, designed to perform a single set of functions. (Mumford, Technics and Civilisation 11) The autonomy of the machine is perhaps its most fascinating aspect. That the machine is an assemblage of parts and restricted functions -- a "minor organism" as Mumford puts it -- suggests to us a body. There is something ineluctably erotic about scenes of lubricated pistons moving in and out of cylinders, or greased gear wheels moving around each other, and a masturbatory energy seems to be involved in the machine that repetitively and by itself performs the same limited actions over and over and over. While there are parallels between masculine masturbation and machinic repetition, there are also associations with femininity. As Andreas Huyssen pointed out, the modern machine became associated with a dangerous female sexuality and took the place of the early moderns' untamed Mother Nature as the principal representative of non-human forces with autonomy and agency that could evade human control. But arguably, expressed fears of machinic autonomy are the flip side of a wish for it, arising from masculine reproductive fantasies that have been played out in technoscience by generations of fictional and real-life Frankensteins fanatically seeking to create artificial life in the form of technoscientific brainchildren (who are nevertheless often neglected and left to run wild at birth). At a conscious level, machines express what may be interpreted as anal-sadistic desires for order, regularity and control, but unconsciously there is an element of masochistic pleasure in being passive, in yielding up control to the machine, in letting it set the scene and determine the actions and roles for the humans as well as non-humans (Sofia, "Contested Zones", and "Mythic Machine" 44-8). Machinic Zeal What is the use of conquering nature if we fall a prey to nature in the form of unbridled men? What is the use of equipping mankind with mighty powers to move and build and communicate, if the final result of this secure food supply and this excellent organisation is to enthrone the morbid impulses of a thwarted humanity? (Mumford, Technics and Civilisation 366) With his emphasis on the social context and drives towards technology, Mumford (Technics and Civilisation 364-5) suggests that while some kinds of machines have existed for thousands of years, what we have come to think of as the mechanical age only arose with the widespread adoption of the machine as a way of securing order, regularity and calculability of physical and human resources, coupled with the ideological shift which made the machine into "a goal of desire" and an object of almost obsessive veneration from the mid-18th century to the early 20th century. Now, he said (writing first in the early 1930s) faith in the machine has been somewhat shaken, and it is no longer seen as "the paragon of progress" but as "merely a series of instruments" to be used when useful; yet despite this loss of faith the machine in capitalist contexts continues to be "over-worked, over-enlarged, over-exploited because of the possibility of making money out of it" (Technics and Civilisation 367). Almost seventy years after Mumford was writing, the obsessive zeal for the machine still has not completely disappeared, but has been displaced from giant smoke-puffing steel assemblages, whirling cogs and gearwheels, or the motors driving trains, cars and planes, and onto the silicon, plastic and light of computers (whose machineries of production and assembly are largely hidden off-shore to the bulk of users, thereby producing the illusion of "post-industrial" societies). The computer is now the paragon of progress and has become the "defining technology" of our age (Bolter), its place reinforced by an actively boosterist popular press (e.g. popular computing magazines; regular computer supplements in newspapers). Sociotechnical Not Posthuman Mumford continually makes the point that questions posed by/in technology are never answerable only technologically. It always comes down to human choices, and even when the results of these "are uncontrollable they are not external" to human culture: Choice manifests itself in society in small increments and moment-to-moment decisions as well as in loud dramatic struggles; and he who does not see choice in the development of the machine merely betrays his incapacity to observe cumulative effects until they are bunched together so closely that they seem completely external and impersonal. (Mumford, Technics and Civilisation 6) In a certain way Mumford's perspective anticipates actor-network theory, which looks at artefacts -- including machines -- as parts of sociotechnical networks that involve human decisions, including about the distribution of agency to non-humans. Even in the most automated machine, Mumford argues "there must intervene somewhere, at the beginning and end of the process ... the conscious participation of a human agent" (10). Actor-network studies of the development of scientific and technological artefacts aim in part to critique the sense of the external, impersonal or inevitable in scientific and technical 'progress' by insisting that "things might have been otherwise" (Bijker & Law 3), not just at the beginning and end, but all the way through the process of an artefact's development and use. The artefact is studied as a particular outcome of a set of decisions and performances made in the midst of contingencies affecting human and non-human actors with conflicting goals and contested powers within a dynamic sociotechnical network. Although actor-network theory is very interested in non-human agents, it does not, as do some recent participants in and theorists of cyberculture, celebrate the so-called post-human. There can be no agentic machines without there having been human competencies downloaded into them; there can be no technical order that is not also social and cultural. As Latour argues, the modernist work of purification has tried vainly to impose a separation between the social and technical, denying their mutual inextricability. From this Latourian perspective, the notion of the "post-human" is not, as it appears to be, post modern, but thoroughly modern. It carries through the quintessentially modernist project of denying after the fact the human agency and capacities that have been invested in producing hybrid artefacts which are then proclaimed as extra-human; it denies the cumulative effects of sociotechnical choices and instead represents the machinic imperative as somehow impersonal and external to human affairs. The notion of the posthuman can readily reinforce the pervasive popular cultural myths of technological inevitability and dominance, conveniently for those humans and corporations who actually do profit from decisions they make about developing and marketing machines of increasing autonomy, intelligence and subtlety. Machines and Provision The role of the machine has been overemphasised in histories of technology, according to Mumford. For aside from tools and machines which perform dynamic actions, there are technologies of containment and supply, which he categorizes as utensils (like baskets or pots), apparatus (such as dye vats, brick kilns), utilities (reservoirs, aqueducts, roads, buildings) and the modern power utility (railroad tracks, electric transmission lines). Some of the most effective adaptations of the environment came, not from the invention of machines, but from the equally admirable invention of utensils, apparatus, and utilities. ... But since people's attention is directed most easily to the noisier and more active parts of the environment, the role of the utility and the apparatus has been neglected ... both [tool and utensil] have played an enormous part in the development of the modern environment and at no stage in history can the two means of adaptation be split apart. Every technological complex includes both: not least our modern one. (Technics and Civilisation, 11-2). The development of various utensils and apparatus for storage (urns, granaries) and flow (irrigation, aqueducts) was essential for the emergence of settled agricultural communities in the neolithic period (Mumford, Technics and Human Development 140-1). As I explore in a related article (Sofia, "Container"), Mumford finds a prudish sexism in the relative neglect of technologies evocative of the female organs of storage, nutrition and transformation, compared with the overemphasis on technologies that are extensions of the muscular masculine body (Technics and Human Development, 140). However, the contrast between dynamic, noisy, active and autonomous machines, and passive, quiet, backgrounded containers cannot be sustained. For one the utensil even in its most basic form, has something machinic about it: a container can perform its function autonomously, without needing manipulation like a tool. Further, it is arguable that holding or containing is not simply a property of a shaped space, but a form of action in itself. Moreover in practice there are many hybrids of machine and utensil or utility, for example in domestic technologies like the food processor, a container with a machine-driven blade, or the washing machine, featuring a tub with mechanical agitation and rotary motion. Although Mumford is primarily interested in the machine, he observes that as modern "neotechnics" proceeds to develop ever more sophisticated machinery, so does it evolve more complex technologies of containment, as described in this passage which depicts both machines and utilities as active agents: Behind the façade [of the crisp lines of steel and glass that define the modern built environment] are rows and rows of machines, weaving cotton, transporting coal ... [etc.], machines with steel fingers and lean muscular arms, with perfect reflexes, sometimes even with electric eyes. Alongside them are the new utilities -- the coke oven, the transformer, the dye vats -- chemically cooperating with these mechanical processes, assembling new qualities in chemical compounds and materials. Every effective part in this whole environment represents an effort of the collective mind to widen the province of order and control and provision. (Technics and Civilisation, 356) Another way of getting the over-emphasised machine back into proportion is to look more closely at what it is used for, what purposes it serves. Mumford writes of the machine as part of the effort to produce "order and regularity" into the processes of life (10); to "widen the province of order and control and provision" (356) or to produce a "secure food supply and ... excellent organisation" (366). In other words, the machine is serving the goals typically associated with utensils, utilities and apparatus: smoothing out fluctuations in supply and distributing resources more evenly. Likewise Mumford suggests that in the back of developments of machine and tool is the effort to adapt by extending the body's powers and/or by altering the environment, so that, for example, instead of a physiological adaptation to cold through hair growth or hibernation, "there is an environmental adaptation, such as that made possible by the use of clothes and the erection of shelters" (10). These technologies are not machines, but container technologies, in the province of what philosopher of technology Don Ihde would call "background technics". We can think of the shift in emphasis here in relation to the example of road works. The large machines for bulldozing a path and laying down layers of road surface are very impressive in their size, power and technical capacity. But the road surface could not be laid down without there being technologies (including hybrids of machine and container, like the pick-up truck) for transporting, storing and mixing the materials used. And when it is done, the big machines lumber off elsewhere, and what we have before us is a road, a utility which facilitates orderly communication, transport and the supply of people and materials. In other words, these machines have served the goal of provisioning. The machine can enthral us with its autonomy, its alterity, its thingness, but as Heidegger has claimed, even such a powerful and seemingly stand-alone machine as a plane on a runway ready for take-off is ultimately just a "completely unautonomous" element when considered as part of a global system ordered "to ensure the possibility of transportation" (17). Like other modern machines, its own objectness and machinic resistance is dissolved as it becomes part of the "standing reserve", which can be understood as a macro-technology of provisioning through a matrix of mobilisable human and non-human resources. In the broader project of which this piece is a fragment, I want to investigate more closely the role and relative importance of machines compared to other kinds of equipment, especially for containment, supply or provisioning in contemporary technoculture, on the suspicion that it is apparatus and utilities rather than machines that define our contemporary lifeworld. References Bijker, Wiebe E., and John Law. General Introduction. Shaping Technology/Building Society: Studies in Sociotechnical Change. Eds. Bijker and Law. Cambridge, Mass.: MIT P, 1992. Bolter, Jay David. "The Computer as a Defining Technology." Computers in the Human Context: Information Technology, Production, and People. Ed. Tom Forester. Oxford: Basil Blackwell, 1989. Heidegger, Martin. "The Question Concerning Technology." The Question Concerning Technology and Other Essays. Trans. William Lovitt. New York: Harper & Row, 1977. Andreas Huyssen. "The Vamp and the Machine: Technology and Sexuality in Fritz Lang's Metropolis." New German Critique 24-25 (1982), 221-37. Also in Huyssen. After the Great Divide. Bloomington: Indiana UP, 1986. Ihde, Don. Technology and the Lifeworld: From Garden to Earth. Bloomington: Indiana UP, 1990. Latour, Bruno. We Have Never Been Modern. Trans. Catherine Porter. Cambridge, Mass.: Harvard UP, 1993. Mumford, Lewis. Technics and Civilisation. New York: Harcourt Brace Jovanovich, 1962 [1934]. ---. Technics and Human Development. New York: Harcourt Brace & World, 1966. Sofia, Zoë. "Container Technologies." Hypatia, Spring 2000 (forthcoming). ---. "Contested Zones: Futurity and Technological Art." Leonardo: Journal of the International Society for the Arts, Sciences, and Technology 29.1 (1996): 59-66. ---. "The Mythic Machine: Gendered Irrationalities and Computer Culture." Education/Technology/Power: Educational Computing as a Social Practice. Eds. Hank Bromley and Michael W. Apple. Albany NY: SUNY, 1998. Citation reference for this article MLA style: Zoë Sofoulis. "Machinic Musings with Mumford." M/C: A Journal of Media and Culture 2.6 (1999). [your date of access] <http://www.uq.edu.au/mc/9909/mumford.php>. Chicago style: Zoë Sofoulis, "Machinic Musings with Mumford," M/C: A Journal of Media and Culture 2, no. 6 (1999), <http://www.uq.edu.au/mc/9909/mumford.php> ([your date of access]). APA style: Zoë Sofoulis. (1999) Machinic musings with Mumford. M/C: A Journal of Media and Culture 2(6). <http://www.uq.edu.au/mc/9909/mumford.php> ([your date of access]).
APA, Harvard, Vancouver, ISO, and other styles
10

Leder, Kerstin, Angelina Karpovich, Maria Burke, Chris Speed, Andrew Hudson-Smith, Simone O'Callaghan, Morna Simpson, et al. "Tagging is Connecting: Shared Object Memories as Channels for Sociocultural Cohesion." M/C Journal 13, no. 1 (March 22, 2010). http://dx.doi.org/10.5204/mcj.209.

Full text
Abstract:
Connections In Small Pieces Loosely Joined, David Weinberger identifies some of the obvious changes which the Web has brought to human relations. Social connections, he argues, used to be exclusively defined and constrained by the physics and physicality of the “real” world, or by geographical and material facts: it’s … true that we generally have to travel longer to get to places that are farther away; that to be heard at the back of the theater, you have to speak louder; that when a couple moves apart, their relationship changes; that if I give you something, I no longer have it. (xi) The Web, however, is a place (or many places) where the boundaries of space, time, and presence are being reworked. Further, since we built this virtual world ourselves and are constantly involved in its evolution, the Web can tell us much about who we are and how we relate to others. In Weinberger’s view, it demonstrates that “we are creatures who care about ourselves and the world we share with others”, and that “we live within a context of meaning” beyond what we had previously cared to imagine (xi-xii). Before the establishment of computer-mediated communication (CMC), we already had multiple means of connecting people commonly separated by space (Gitelman and Pingree). Yet the Web has allowed us to see each other whilst separated by great distances, to share stories, images and other media online, to co-construct or “produse” (Bruns) content and, importantly, to do so within groups, rather than merely between individuals (Weinberger 108). This optimistic evaluation of the Web and social relations is a response to some of the more cautious public voices that have accompanied recent technological developments. In the 1990s, Jan van Dijk raised concerns about what he anticipated as wide-reaching social consequences in the new “age of networks” (2). The network society, as van Dijk described it, was defined by new interconnections (chiefly via the World Wide Web), increased media convergence and narrowcasting, a spread of both social and media networks and the decline of traditional communities and forms of communication. Modern-day communities now consisted both of “organic” (physical) and “virtual” communities, with mediated communication seemingly beginning to replace, or at least supplement, face-to-face interaction (24). Recently, we have found ourselves on the verge of even more “interconnectedness” as the future seems determined by ubiquitous computing (ubicomp) and a new technological and cultural development known as the “Internet of Things” (Greenfield). Ubicomp refers to the integration of information technology into everyday objects and processes, to such an extent that the end-users are often unaware of the technology. According to Greenfield, ubicomp has significant potential to alter not only our relationship with technology, but the very fabric of our existence: A mobile phone … can be switched off or left at home. A computer … can be shut down, unplugged, walked away from. But the technology we're discussing here–ambient, ubiquitous, capable of insinuating itself into all the apertures everyday life affords it–will form our environment in a way neither of those technologies can. (6) Greenfield's ideas are neither hypothesis, nor hyperbole. Ubicomp is already a reality. Dodson notes, Ubicomp isn't just part of our ... future. Its devices and services are already here. Think of the use of prepaid smart cards for use of public transport or the tags displayed in our cars to help regulate congestion charge pricing or the way in which corporations track and move goods around the world. (7) The Internet of Things advances the ubicomp notion of objects embedded with the capacity to receive and transmit data and anticipates a move towards a society in which every device is “on” and in some way connected to the Internet; in other words, objects become networked. Information contained within and transmitted among networked objects becomes a “digital overlay” (Valhouli 2) over the physical world. Valhouli explains that objects, as well as geographical sites, become part of the Internet of Things in two ways. Information may become associated with a specific location using GPS coordinates or a street address. Alternatively, embedding sensors and transmitters into objects enables them to be addressed by Internet protocols, and to sense and react to their environments, as well as communicate with users or with other objects. (2) The Internet of Things is not a theoretical paradigm. It is a framework for describing contemporary technological processes, in which communication moves beyond the established realm of human interaction, to enable a whole range of potential communications: “person-to-device (e.g. scheduling, remote control, or status update), device-to-device, or device-to-grid” (Valhouli 2). Are these newer forms of communication in any sense meaningful? Currently, ubicomp's applications are largely functional, used in transport, security, and stock control. Yet, the possibilities afforded by the technology can be employed to enhance “connectedness” and “togetherness” in the broadest social sense. Most forms of technology have at least some social impact; this is particularly true of communication technology. How can that impact be made explicit? Here, we discuss one such potential application of ubicomp with reference to a new UK research project: TOTeM–Tales of Things and Electronic Memory. TOTeM aims to draw on personal narratives, digital media, and tagging to create an “Internet” of people, things, and object memories via Web 2.0 and mobile technologies. Communicating through Objects The TOTeM project, began in August 2009 and funded by Research Councils UK's Digital Economy Programme, is concerned with eliciting the memory and value of “old” artefacts, which are generally excluded from the discourse of the Internet of Things, which focuses on new and future objects produced with embedded sensors and transmitters. We focus instead on existing artefacts that hold significant personal resonance, not because they are particularly expensive or useful, but because they contain or “evoke” (Turkle) memories of people, places, times, events, or ideas. Objects across a mantelpiece can become conduits between events that happened in the past and people who will occupy the future (Miller 30). TOTeM will draw on user-generated content and innovative tagging technology to study the personal relationships between people and objects, and between people through objects. Our hypothesis is that the stories that are connected to particular objects can become binding ties between individuals, as they provide insights into personal histories and values that are usually not shared, not because they are somehow too personal or uninteresting, but because there is currently little systematic context for sharing them. Even in families, where objects routinely pass down through generations, the stories associated with these objects are generally either reduced to a vague anecdote or lost entirely. Beyond families, there are some objects whose stories are deemed culturally-significant: monuments, the possessions of historical figures, religious artefacts, and archaeological finds. The current value system which defines an object’s cultural significance appears to replicate Bourdieu's assessment of the hierarchies which define aesthetic concepts such as taste. In both cases, the popular, everyday, or otherwise mundane is deemed to possess less cultural capital than that which is less accessible or otherwise associated with the social elites. As a result, objects whose histories are well-known are mostly found in museums, untouchable and unused, whereas objects which are within reach, all around us, tend to travel from owner to owner without anyone considering what histories they might contain. TOTeM’s aim is to provide both a context and a mechanism for enabling individuals and community groups to share object-related stories and memories through digital media, via a custom-built platform of “tales of things”. Participants will be able to use real-life objects as conduits for memory, by producing “tales” about the object's personal significance, told through digital video, photographs, audio, or a mixture of media. These tales will be hosted on the TOTeM project's website. Through specifically-developed TOTeM technology, each object tale will generate a unique physical tag, initially in the form of RFID (Radio Frequency Identification) and QR (Quick Response) codes. TOTeM participants will be able to attach these tags/codes to their objects. When scanned with a mobile phone equipped with free TOTeM software or an RFID tag reader, each tag will access the individual object's tale online, playing the media files telling that object’s story on the mobile phone or computer. The object's user-created tale will be persistently accessible via both the Internet and 3G (third generation) mobile phones. The market share of 3G and 4G mobile networks is expanding, with some analysts predicting that they will account for 30% of the global mobile phone market by 2014 (Kawamoto). As the market for mobile phones with fast data transfer rates keeps growing, TOTeM will become accessible to an ever-growing number of mobile, as well as Internet, users. The TOTeM platform will serve two primary functions. It will become an archive for object memories and thus grow to become an “archaeology for the future”. We hope that future generations will be able to return to this repository and learn about the things that are meaningful to groups and individuals right now. The platform will also serve as an arena for contemporary communication. As the project develops, object memories will be directly accessible through tagged artefacts, as well as through browsing and keyword searches on the project website. Participants will be able to communicate via the TOTeM platform. On a practical level, the platform can bring together people who already share an interest in certain objects, times, or places (e.g. collectors, amateur historians, genealogists, as well as academics). In addition, we hope that the novelty of TOTeM’s approach to objects may encourage some of those individuals for whom non-participation in the digital world is not a question of access but one of apathy and perceived irrelevance (Ofcom 3). Tales of Things: Pilots Since the beginning of this research project, we have begun to construct the TOTeM platform and develop the associated tagging technology. While the TOTeM platform is being built, we have also used this time to conduct a pilot “tale-telling” phase, with the aim of exploring how people might choose to communicate object stories and how this might make them feel. In this initial phase, we focus on eliciting and constructing object tales, without the use of the TOTeM platform or the tagging technology, which will be tested in a future trial. Following Thomson and Holland’s autoethnographic approach, in the first instance, the TOTeM team and advisors shared their own tales with each other (some of these can be viewed on the TOTeM Website). Each of us chose an object that was personally significant to us, digitally recorded our object memories, and uploaded videos to a YouTube channel for discussion amongst the group. Team members in Edinburgh subsequently involved a group of undergraduate students in the pilot. Here, we offer some initial reflections on what we have learned from recording and sharing these early TOTeM tales. The objects the TOTeM team and advisors chose independently from each other included a birth tag, a box of slides, a tile, a block of surf wax, a sweet jar from Japan, a mobile phone, a concert ticket, a wrist band, a cricket bat, a watch, an iPhone, a piece of the Berlin Wall, an antique pocket sundial, and a daughter’s childhood toy. The sheer variety of the objects we selected as being personally significant was intriguing, as were the varying reasons for choosing the objects. Even there was some overlap in object choice, for instance between the mobile and the iPhone, the two items (one (relatively) old, one new) told conspicuously different stories. The mobile held the memory of a lost friend via an old text message; the iPhone was valued not only for its practical uses, but because it symbolised the incarnation of two childhood sci-fi fantasies: a James Bond-inspired tracking device (GPS) and the “Hitchhiker’s Guide to the Galaxy”. While the memories and stories linked to these objects were in many ways idiosyncratic, some patterns have emerged even at this early stage. Stories broadly differed in terms of whether they related to an individual’s personal experience (e.g. memorable moments or times in one’s life) or to their connection with other people. They could also relate to the memory of particular events, from football matches, concerts and festivals on a relatively local basis, to globally significant milestones, such as the fall of the Berlin Wall. In many cases, objects had been kept as tokens and reminders of particularly “colourful” and happy times. One student presented a wooden stick which he had picked up from a beach on his first parent-free “lads’ holiday”. Engraved on the stick were the names of the friends who had accompanied him on this memorable trip. Objects could also mark the beginning or end of a personal life stretch: for one student, his Dub Child vinyl record symbolised the moment he discovered and began to understand experimental music; it also constituted a reminder of the influence his brother had had on his musical taste. At other times, objects were significant because they served as mementos for people who had been “lost” in one way or another, either because they had moved to different places, or because they had gone missing or passed away. With some, there was a sense that the very nature of the object enabled the act of holding on to a memory in a particular way. The aforementioned mobile phone, though usually out of use, was actively recharged for the purposes of remembering. Similarly, an unused wind-up watch was kept going to simultaneously keep alive the memory of its former owner. It is commonly understood that the sharing of insights into one’s personal life provides one way of building and maintaining social relationships (Greene et al.). Self-disclosure, as it is known in psychological terms, carries some negative connotations, such as making oneself vulnerable to the judgement of others or giving away “too much too soon”. Often its achievement is dependent on timing and context. We were surprised by the extent to which some of us chose to disclose quite sensitive information with full knowledge of eventually making these stories public online. At the same time, as both researchers and, in a sense, as an audience, we found it a humbling experience to be allowed into people’s and objects’ meaningful pasts and presents. It is obvious that the invitation to talk about meaningful objects also results in stories about things and people we deeply care about. We have yet to see what shape the TOTeM platform will take as more people share their stories and learn about those of others. We don’t know whether it will be taken up as a fully-fledged communication platform or merely as an archive for object memories, whether people will continue to share what seem like deep insights into personal life stories, or if they choose to make more subversive (no less meaningful) contributions. Likewise, it is yet to be seen how the linking of objects with personal stories through tagging could impact people’s relationships with both the objects and the stories they contain. To us, this initial trial phase, while small in scale, has re-emphasised the potential of sharing object memories in the emerging network of symbolic meaning (Weinberger’s “context of meaning”). Seemingly everyday objects did turn out to contain stories behind them, personal stories which people were willing to share. Returning to Weinberger’s quote with which we began this article, TOTeM will enable the traces of material experiences and relationships to become persistently accessible: giving something away would no longer mean entirely not having it, as the narrative of the object’s significance would persist, and can be added to by future participants. Indeed, TOTeM would enable participants to “give away” more than just the object, while retaining access to the tale which would augment the object. Greenfield ends his discussion of the potential of ubicomp by listing multiple experiences which he does not believe would benefit from any technological augmentation: Going for a long run in the warm gentle rain, gratefully and carefully easing my body into the swelter of a hot springs, listening to the first snowfall of winter, savouring the texture of my wife’s lips … these are all things that require little or no added value by virtue of being networked, relational, correlated to my other activities. They’re already perfect, just as they stand. (258) It is a resonant set of images, and most people would be able to produce a similar list of meaningful personal experiences. Yet, as we have already suggested, technology and meaning need not be mutually exclusive. Indeed, as the discussion of TOTeM begins to illustrate, the use of new technologies in new contexts can augment the commercial applications of ubiquoutous computing with meaningful human communication. At the time of writing, the TOTeM platform is in the later stages of development. We envisage the website taking shape and its content becoming more and more meaningful over time. However, some initial object memories should be available from April 2010, and the TOTeM platform and mobile tagging applications will be fully operational in the summer of 2010. Our progress can be followed on www.youtotem.com and http://twitter.com/talesofthings. TOTeM looks forward to receiving “tales of things” from across the world. References Bourdieu, Pierre. Distinction: A Social Critique of the Judgement of Taste. London: Routledge, 1984.Bruns, Axel. “The Future is User-Led: The Path towards Widespread Produsage.” fibreculture 11 (2008). 20 Mar. 2010 ‹http://www.journal.fibreculture.org/issue11/issue11_bruns_print.html›. Dodson, Sean. “Forward: A Tale of Two Cities.” Rob van Kranenburg. The Internet of Things: A Critique of Ambient Technology and the All-Seeing Network of RFID. Amsterdam: Institute of Network Cultures, Network Notebooks 02, 2008. 5-9. 20 Mar. 2010 ‹http://www.networkcultures.org/_uploads/notebook2_theinternetofthings.pdf›. Gitelman, Lisa, and Geoffrey B. Pingree. Eds. New Media: 1740-1915. Cambridge, MA: MIT Press, 2003. Greene, Kathryn, Valerian Derlega, and Alicia Mathews. “Self-Disclosure in Personal Relationships.” Ed. Anita L. Vangelisti and Daniel Perlman. Cambridge Handbook of Personal Relationships. Cambridge: Cambridge UP, 2006. 409-28. Greenfield, Adam. Everyware: The Dawning Age of Ubiquitous Computing. Berkeley, CA: New Riders, 2006. Kawamoto, Dawn. “Report: 3G and 4G Market Share on the Rise.” CNET News 2009. 20 Mar. 2010 ‹http://news.cnet.com/8301-1035_3-10199185-94.html›. Kwint, Marius, Christopher Breward, and Jeremy Aynsley. Material Memories: Design and Evocation. Oxford: Berg, 1999. Miller, Daniel. The Comfort of Things. Cambridge: Polity Press, 2008. Ofcom. ”Accessing the Internet at Home”. 2009. 20 Mar. 2010 ‹http://www.ofcom.org.uk/research/telecoms/reports/bbresearch/bbathome.pdf›. Thomson, Rachel, and Janet Holland. “‘Thanks for the Memory’: Memory Books as a Methodological Resource in Biographical Research.” Qualitative Research 5.2 (2005): 201-19. Turkle, Sherry. Evocative Objects: Things We Think With. Cambridge, MA: MIT Press, 2007. Valhouli, Constantine A. The Internet of Things: Networked Objects and Smart Devices. The Hammersmith Group Research Report, 2010. 20 Mar. 2010 ‹http://thehammersmithgroup.com/images/reports/networked_objects.pdf›. Van Dijk, Jan. The Network Society: Social Aspects of New Media. London: SAGE, 1999. Weinberger, David. Small Pieces Loosely Joined: How the Web Shows Us Who We Really Are. Oxford: Perseus Press, 2002.
APA, Harvard, Vancouver, ISO, and other styles

Book chapters on the topic "Associated Spring Corporation"

1

Ferdinand, Peter, Robert Garner, and Stephanie Lawson. "16. Civil Society, Interest Groups, and Populism." In Politics. Oxford University Press, 2018. http://dx.doi.org/10.1093/hepl/9780198787983.003.0016.

Full text
Abstract:
This chapter explores the role of civil society, interest groups, and populism in politics. It first considers the concept of ‘civil society’ and how it came to be associated with the protests that brought down communist regimes in Eastern Europe, along with its role in the Arab Spring. It then looks at interest groups as a major component of civil society, the rise of corporatism, and the notion of ‘infrapolitics’ or politics from below. It also discusses the growing phenomenon of populism as a way of enhancing the status and position of previously neglected groups in democracies as well as a challenge to liberal democracies. A case study on populism online involving Beppe Grillo and the Five star Movement is presented. The chapter suggests that populist politicians make use of the media to forge a direct relationship with their supporters.
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Associated Spring Corporation"

1

Brickner, Robert H. "Behind the Scenes: Historic Agreement to Develop U.S. Virgin Islands’ First Alternative Energy Facilities." In 18th Annual North American Waste-to-Energy Conference. ASMEDC, 2010. http://dx.doi.org/10.1115/nawtec18-3516.

Full text
Abstract:
In the summer of 2009, Governor John P. DeJongh, Jr. announced that the Virgin Islands Water and Power Authority (WAPA) had just signed two 20-year Power Purchase Agreements, and the Virgin Islands Waste Management Authority (VIWMA) had signed two 20-year Solid Waste Management Services Agreements with affiliates of Denver-based Alpine Energy Group, LLC (AEG) to build, own, and operate two alternative energy facilities that will serve the residents of St. Croix, St. John, and St. Thomas. The alternative energy facilities, to be built on St. Croix and St. Thomas, have a projected cost of $440 million and will convert an estimated 146,000 tons per year of municipal solid waste into refuse-derived fuel (RDF) using WastAway Services® technology, which will be combined with petroleum coke as fuel in fluidized bed combustion facilities to generate steam and electric power. These sustainable projects will provide 33 MW of electric power to St. Thomas and St. John and 16 MW of electric power to St. Croix, and will help to provide long-term cost stability for electric power and solid waste management in the Territory. Construction is expected to start in spring 2010 with an anticipated completion date during the fourth quarter of 2012. This procurement is a significant achievement for the U.S. Virgin Islands. When the projects are fully implemented, they will allow the Territory to reduce its dependence on oil, recover the energy value and certain recyclable materials from its municipal solid waste, and divert this waste from landfill. Since VIWMA has the responsibility to collect and/or dispose of solid waste year-round, having a system incorporating multiple solid waste processing lines and an adequate supply of spare parts on hand at all times is crucial to meeting the daily demands of waste receiving and processing, and RDF production. Also, with the location of the US Virgin Islands in a hurricane zone, and with only one or two combustion units available in each Project, the ability to both stockpile waste pre-RDF processing and store the produced RDF is very important. Gershman, Brickner & Bratton, Inc. (GBB)’s work has included a due diligence review of the Projects and providing professional support in VIWMA’s negotiations with AEG. GBB’s initial primary assignment centered on reviewing the design and operations of the RDF processing systems that will be built and operated under the respective Service Contracts. VIWMA needed to undertake a detailed technical review of the proposed RDF processing system, since this was the integration point of the waste collection system and waste processing/disposal services. GBB, in association with Maguire, was requested to provide this review and present the findings and opinions to VIWMA. In the completion of this effort, which included both a technical review and participation in negotiations to advance the Service Contracts for the Projects, GBB made direct contact with the key equipment suppliers for the Projects proposed by AEG. This included Bouldin Corporation, the primary RDF processing system supplier, with its patented WastAway technology, and Energy Products of Idaho, the main thermal processing equipment supplier, with its fluidized bed combustion technology and air pollution control equipment. Additionally, since the combustion systems for both Projects will generate an ash product that will require marketing for use and/or disposal over the term of the Service Contracts, GBB made contact with LA Ash, one of the potential subcontractors identified by AEG for these ash management services. Due to the nature of the contract guarantees of VIWMA to provide 73,000 tons per year of Acceptable Waste to each Project for processing, VIWMA authorized GBB to perform a current waste stream characterization study. Part of this effort included waste sorts for one week each in February 2009 on St. Croix and March 2009 on St. Thomas, with the results shared with VIWMA and AEG, as compiled. The 2009 GBB waste stream characterization study incorporated historical monthly waste weigh data from both the Bovoni and Anguilla Landfills that were received from VIWMA staff. The study has formed a basis for continuing to augment the waste quantity information from the two landfills with the additional current monthly results compiled by VIWMA staff going forward following the waste sorts. The final GBB report was published in December 2009 and includes actual USVI landfill receipt data through August 31, 2009. The information contained in this document provides the underpinnings to allow for better tracking and analysis of daily, weekly and monthly waste quantities received for recycling, processing and disposal, which are important to the overall waste processing system operations, guarantees and cost projections. GBB’s annual projections are that the total waste on St. Croix is currently over 104,000 tons per year and over 76,000 tons per year on St. Thomas. The thermal processing technology selected for both Projects is a fluidized bed process, employing a heated bed of sand material “fluidized” in a column of air to burn the fuel — RDF and/or Pet Coke. As such, the solid waste to be used in these combustion units must be size-reduced from the myriad of sizes of waste set out at the curb or discharged into the large roll-off boxes or bins at the many drop-off sites in the US Virgin Islands. While traditional RDF would typically have several days of storage life, the characteristics of the pelletized RDF should allow several weeks of storage. This will be important to having a sound and realistic operating plan, given the unique circumstances associated with the climate, waste moisture content, island location, lack of back-up disposal options and downtime associated with the Power Generation Facility. During the negotiations between AEG and VIWMA, in which GBB staff participated, in addition to RDF and pelletized RDF as the waste fuel sources, other potential fuels have been discussed for use in the Projects and are included as “Opportunity Fuels” in the Service Contracts. These Opportunity Fuels include ground woody waste, dried sludges, and shredded tires, for example. Therefore, the flexibility of the EPI fluidized bed combustion boilers to handle multi-fuels is viewed as an asset over the long term, especially for an island location where disposal options are limited and shipping materials onto and off of each island is expensive. This presentation will provide a unique behind-the-scenes review of the process that led to this historic agreement, from the due diligence of the proposed technologies, to implementation planning, to the negotiations with the contractor. Also discussed will be the waste characterization and quantity analysis performed in 2009 and the fast-track procurement planning and procurement of construction and operating services for a new transfer station to be sited on St. Croix.
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography