To see the other types of publications on this topic, follow the link: ATP7B.
Dissertations / Theses on the topic 'ATP7B'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 41 dissertations / theses for your research on the topic 'ATP7B.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
Minghetti, Matteo. "Characterisation and expression of copper homeostasis genes in sea bream (Sparus aurata)." Thesis, University of Stirling, 2009. http://hdl.handle.net/1893/1113.
Full textAbstract:
The redox properties of Copper (Cu) make it both an ideal cofactor for many enzymes, and, in its free form, a highly toxic molecule capable of stimulating production of reactive oxygen species or binding to protein thiol groups. Therefore, living organisms have evolved homeostatic systems to “handle” Cu avoiding dangerous and wasteful aspecific interactions. These systems comprise uptake, carrier, storage and excretion proteins. The importance of Cu-homeostatic systems was initially discovered in humans where alterations of Cu-excretory proteins were shown to be responsible for two lethal genetic disorders; the Wilson and Menkes diseases. The levels of bioavailable Cu in the aquatic environment is important because concentrations in oceanic waters tend to be minute, whilst in some fresh and coastal waters, particularly around areas of mineral extraction, viniculture and farming operations, concentrations can be excessive. In contrast to terrestrial vertebrates, fish are not only exposed to dietary sources of copper but are also exposed to dissolved ionic copper that may enter via the skin and gills. Indeed, the latter route is important in fish and it has been demonstrated in physiological studies that under conditions of dietary deficiency, fish can satisfy their own body requirements by uptake from water. Therefore, fish must have systems relating to both gill and gut to enable maintenance of body homeostasis of this essential, yet toxic, metal. In an attempt to understand the mechanisms of Cu homeostasis in fish, whether under conditions of deficiency, adequacy or excess, it is essential to consider the expression of known Cu-homeostasis proteins. Thus, cDNAs for sea bream (Sparus aurata) homologues of copper transporter 1 (Ctr1), antioxidant protein 1 (Atox1), Menkes protein (ATP7A), Wilson protein (ATP7B), and metallothionein (MT), which are responsible for the uptake, delivery to the secretory pathway and scavenging of intracellular Cu, were cloned and their mRNA tissue expression levels measured. To investigate the molecular basis of the different homeostatic and toxic responses to waterborne or dietary Cu, sea bream were exposed to sub-toxic levels of Cu in the diet (130 mg/Kg of dry diet) or water (0.3 mg/L) and tissue mRNA and Cu levels were measured. Moreover, to discriminate between the effect of different metals on the transcriptional regulation of Cu homeostasis genes in fish, Sparus aurata fibroblast (SAF1) cells were exposed to sub-toxic levels of Cu (25 μM), Zn (100 μM) and Cd (10 μM). In addition, a microarray was used to gain a broader overview of the transcriptional response of SAF1 cells to Cu (25 μM). Waterborne or dietary Cu resulted in distinct expression profiles of Cu-homeostasis genes and markers of oxidative stress. After dietary exposure, Cu increased in intestine and liver, whilst after waterborne exposure Cu increased in gill and liver. Exposure to dietary Cu resulted in decreases in Ctr1 and ATP7A mRNA in both liver and intestine. Renal Ctr1 levels remained unchanged, whilst ATP7A mRNA decreased. In contrast, waterborne Cu exposure increased intestinal Ctr1 and ATP7A mRNA, and increased renal Ctr1 and decreased renal ATP7A mRNA. Both dietary and waterborne Cu increased ATP7B mRNA in liver. Metallothionein (MT) mRNA increased in liver and gill after waterborne Cu. Glutathione reductase (GR), a marker of oxidative stress, increased expression in liver and gill after waterborne Cu exposure, but decreased in intestine. Thus, exposure to Cu via water or diet has different, often opposite effects on Cu-homeostasis genes. The decrease in expression of both Cu-transport genes in intestine after dietary exposure may indicate a defensive mechanism to limit uptake of Cu. The opposite effects in intestine after waterborne exposure are more difficult to explain, but again may reflect a defence mechanism against excess bloodborne Cu coming from the gill. Since both dietary and waterborne Cu increased Cu levels in liver and increased hepatic ATP7B it is likely that well-characterised mammalian route of Cu excretion to bile is active in sea bream. However, only hepatic Cu derived from gill increased the expression of the stress markers MT and GR. This suggests that Cu is delivered to liver in a different form from gill as that from intestine, the intestinally derived pool being less toxic. Thus the increase in copper transport gene expression in intestine after gill exposure might be a mechanism to enable incorporation of excess bloodborne Cu into the intestinal pathway of Cu delivery to liver, thus minimizing toxicity. The in vitro exposure of SAF1 cells to Cu showed a similar response to liver of fish exposed to waterborne Cu indicating similar Cu availability and complexation. ATP7A mRNA levels were induced by Cu but not by Zn or Cd suggesting Cu-specific regulation. Conversely, MT and GR were induced by all metals tested. The transcriptomic analysis highlighted that the biological processes most significantly affected by Cu were secretion, protein trafficking and stress. Overall, these results show that in fish copper has distinct effects on tissue Cu transporter genes and oxidative stress depending on whether it is taken up via the gill or gut and that intestinal absorption may be required for normal uptake and metabolism of Cu, regardless of the route of uptake. Moreover, changes in mRNA levels indicate that Cu homeostasis genes, at least in fish, may be regulated at the transcriptional level. Although more work needs to be done to identify genes that are robust predictors of Cu toxicity, the microarray results presented here show a clear transcriptional fingerprint which may characterize Cu toxicity in fish.
2
Concilli, Mafalda. "HSP70 as a target for correction of Wilson disease causing ATP7B mutants." Thesis, Open University, 2017. http://oro.open.ac.uk/50813/.
Full textAbstract:
Copper (Cu) is an essential micronutrient, which operates as a cofactor of enzymes regulating a wide range of critical physiological processes. However, Cu overload compromises the redox balance in cells and tissues causing serious toxicity. Removal of excess Cu from the body is driven be Cu-transporting ATPase ATP7B, which sequesters the potentially toxic metal and mediates its excretion into the bile. Mutations in the ATP7B result in Wilson disease (WD) that is caused by the toxic accumulation of Cu in the liver due to the loss of ATP7B function. The most frequent ATP7B mutant, H1069Q, still preserves a significant Cu-transporting activity, but undergoes retention and degradation in the endoplasmic reticulum (ER). Thus, rescue of ATP7B-H1069Q from the ER is expected to recover mutant function and, hence, would be beneficial for a large group of WD patients. Unfortunately, specific targets as well as safe drugs for correction of ATP7B-H1069Q mutant remain to be uncovered. Comparing interactomes of WT and H1069Q variants of ATP7B, I found HSP70 as a specific mutant interactor that regulates ER retention and degradation of ATP7B-H1069Q. HSP70 suppression (with either RNAi or allosteric inhibitor) improved stability of the mutant and facilitated its export from the ER to the Golgi and post-Golgi copper excretion sites. These findings prompted me to look for a safe way to inhibit HSP70 and rescue the ATP7B mutant. To this end several bioinformatics tools were employed to search for FDA-approved drugs that modulate HSP70 expression or exhibit structural similarity to HSP70 inhibitors. As a result, Domperidone and glucocorticoid receptor agonists were identified and validated as effective correctors of ATP7B mutant. In summary, my findings suggest a key role for HSP70 in proteostasis of ATP7B-H1069Q and revealed FDA-approved compounds as safe drugs for ATP7B mutant correction and, thus, for the normalization of Cu homeostasis in Wilson disease patients.
3
Tsay, Mike J. "Expression, purification and characterization of the LEC-rat N-terminal metal binding domain from Atp7b, an orthologue to ATP7B, a copper transporting P-type ATPase implicated in Wilson disease." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2001. http://www.collectionscanada.ca/obj/s4/f2/dsk3/ftp04/MQ62903.pdf.
Full text
4
Kühne, Angelika. "Funktionelle Untersuchungen der Auswirkung von Mutationen auf das humane Kupfertransportprotein ATP7B (Wilson ATPase)." Doctoral thesis, Universitätsbibliothek Leipzig, 2013. http://nbn-resolving.de/urn:nbn:de:bsz:15-qucosa-102080.
Full textAbstract:
Das Schwermetall Kupfer ist von essentieller Bedeutung für zahlreiche zelluläre Funktionen. Aufgrund seines Redoxpotentials muss die Kupferhomöostase im Organismus eng reguliert werden. Die Schlüsselrolle spielt dabei das Kupfertransportprotein ATP7B (Wilson ATPase) in der Leber. Ein Funktionsverlust dieses Proteins wird in der autosomal-rezessiv vererbten Erkrankung Morbus Wilson deutlich. Der Kupfertransportdefekt der Hepatozyten führt zu einer Kupferüberladung in der Leber mit nachfolgender Schädigung. Ferner kommt es zu einer Kupferakkumulation im Zentralnervensystem mit neurologischen Störungen. Das bei der Erkrankung betroffene Gen ATP7B wurde 1993 kloniert. Bis heute sind über 500 krankheitsverursachende Genmutationen entdeckt worden. Eine Schlüsselfunktion dieser Enzymgruppe ist die katalytische Phosphorylierung. Die Auswirkungen von Mutationen auf die Funktion des Proteins sind jedoch nur unzureichend verstanden. ATP7B kann mit Hilfe des Baculovirusexpressionssystems hergestellt und anschließend proteinbiochemischen Untersuchungen unterzogen werden.
In dieser experimentellen Arbeit wurde untersucht, ob Punktmutationen diesen Phosphorylierungsmechanismus von ATP7B beeinflussen. Dafür wurden, neben dem Wildtyp-Protein, 25 patientenspezifische und eine noch nicht beim Menschen beobachtete Mutation der Phosphorylierungsstelle D1027A als Negativkontrolle generiert und die katalytische Aktivität in einem Phosphorylierungsassay untersucht. In der vorliegenden Arbeit wurde gezeigt, dass bestimmte Punktmutationen zum Funktionsverlust von ATP7B führen. Als weiterer Mechanismus der Mutationswirkung wurde, neben der Inaktivierung von ATP7B, die Hyperphosphorylierung entdeckt. Die biochemische Charakterisierung dieser Mutationen führt zu einem tieferen Verständnis in der Pathophysiologie des Morbus Wilson und ebnet den Weg für detaillierte Untersuchungen der Genotyp-Phänotyp-Korrelation sowie für innovative Diagnostik- und Therapiestrategien.
5
Forbes, John Richard. "Functional analysis of the copper-transporting P-type ATPase, ATP7B, defective in Wilson disease." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2000. http://www.collectionscanada.ca/obj/s4/f2/dsk1/tape2/PQDD_0008/NQ59959.pdf.
Full text
6
Schirrmeister, Wiebke [Verfasser]. "Kupfertoxizität, Regeneration und Lipidmetabolismus in der Atp7b-/- - Maus, einem Tiermodell des Morbus Wilson / Wiebke Schirrmeister." Magdeburg : Universitätsbibliothek, 2013. http://d-nb.info/1054421234/34.
Full text
7
Araújo, Thiago Ferreira de. "Importância da detecção de mutações do gene ATP7B para o diagnóstico da doença de Wilson." Universidade de São Paulo, 2014. http://www.teses.usp.br/teses/disponiveis/5/5168/tde-14082014-091501/.
Full textAbstract:
O diagnóstico da doença de Wilson (DW) é realizado por exames clínicos, laboratoriais, anatomopatológicos e de imagem. Mais de 500 mutações no gene ATP7B foram descritas como causadoras da DW. Para avaliar a importância da detecção de mutações no diagnóstico da DW em nosso meio, analisamos 35 pacientes com DW, 20 familiares de wilsonianos a partir de rastreamento familiar, 18 com hepatite crônica criptogênica e sete com insuficiência hepática aguda grave. Para o diagnóstico da DW foi utilizado o sistema de escore sugerido pela Sociedade Europeia para o Estudo do Fígado de 2012. Os dados demográficos, clínicos, laboratoriais e histológicos foram obtidos retrospectivamente. Obteve-se o DNA genômico de cada paciente a partir de sangue periférico e realizou-se o sequenciamento direto dos 21 éxons e suas bordas intrônicas do gene ATP7B. Todos os pacientes com DW apresentavam no mínimo quatro pontos. No grupo de rastreamento familiar o sequenciamento foi importante para o diagnóstico de DW em 14 familiares; no grupo de hepatite crônica criptogênica em oito pacientes e no grupo de insuficiência hepática aguda grave em três pacientes. Foi caracterizada uma família com cinco genótipos diferentes (dois homozigotos p.A1135Qfs/p.A1135Qfs e p.M645R/p.M645R), um heterozigoto composto (p.A1135Qfs/p.M645R) e dois heterozigotos simples (p.A1135Qfs/0 e p.M645R/0) com fenótipos variados. Foram detectadas duas mutações em heterozigose simples em pacientes com insuficiência hepática aguda grave. A mutação p.A1135Qfs e p.L708P foram as mais frequentes em todos os grupos. Foi identificada pela primeira vez a mutação p.M645R em homozigose. Concluímos que os resultados confirmaram que o sequenciamento do gene ATP7B foi útil: 1) para confirmar que as mutações p.A1135Qfs e p.L708P são as mais importantes na população brasileira; 2) para demonstrar que a mutação tida como a mais frequente na Europa, a p.H1069Q, tem bem menor importância em nosso meio, embora mais frequentemente do que o observado anteriormente; 3) para confirmar (ou excluir) precocemente o diagnóstico e evitar a realização de exames desnecessários e invasivos e iniciar (ou não realizar) o tratamento, com base mais sólida, em pacientes com hepatopatia crônica idiopática e em familiares de portadores de DW; 4) para definir o diagnóstico de DW em casos de insuficiência hepática aguda grave, diagnóstico ainda que tardio, mas de suma importância para realização de estudo familiar subsequente, 5) para identificação não esperada de heterozigotos simples e polimorfismos de significado ainda não esclarecido em pacientes com insuficiência hepática aguda grave; 6) para identificação de casos inusitados de três genótipos diferentes causadores da doença na mesma família (homozigose de duas mutações diferentes e heterozigose composta); 7) para melhor definir que a mutação p.M645R em homozigose tem potencial para desenvolver a DW, embora resultados de estudos em in vitro sugiram função normal da proteína defeituosa sintetizada; 8) para definir que há casos de doentes com a mutação p.M645R em heterozigose composta de evolução extremamente benigna, com diagnóstico após a quinta década de vida, com discretas alterações hepáticas. Porém há casos com evolução mais grave tanto do ponto de vista hepático quanto neurológico, possivelmente influenciados pelas mutações que a acompanham<br>Wilson\'s disease (WD) is an autosomal recessive disorder secondary to mutations in the ATP7B gene resulting in toxic accumulation of copper in various tissues. The diagnosis of WD is made by the analysis of clinical, laboratory, histological findings and imaging tests. More than 500 mutations have been described in the ATP7B gene as the cause of WD. In order to expand the knowledge of the importance of mutation detection in the diagnosis of WD, we analyzed 36 patients with WD, 20 individuals from family screening, 18 with cryptogenic chronic hepatitis and seven with severe acute liver failure. For the diagnosis of WD the International Scoring System suggested by the European Association for the Study of the Liver (EASL) in 2012 was used. Demographic, clinical, laboratory and histological data were obtained retrospectively. Direct sequencing of 21 exons and intron boundaries of ATP7B gene was performed in genomic DNA extracted from peripheral blood leucocytes of all subjects. All patients with WD have at least four points of the scoring system without considering the DPA challenge test. In the family screening group, sequencing was important for the diagnosis of DW in fourteen patients; eight patients in the group of cryptogenic chronic hepatitis, and three patients in the group of severe acute liver failure. Five different genotypes were identified in one family (two homozygous, p.A1135Qfs/p.A1135Qfs and p.M645R/p.M645R, one compound heterozygous p.A1135Qfs/p.M645R, and two simple heterozygous p.A1135Qfs/0 and p.M645R/0). Two patients with acute liver failure were detected as simple heterozygous. The p.A1135Qfs and p.L708P were the most frequent mutations in all groups. It is the first time p.M645R mutation was detected in homozygosity. The ATP7B gene sequencing was useful: 1) to confirm that p.A1135Qfs and p.L708P mutations are the most frequent in the Brazilian population; 2) to confirm that the most common mutation in Europe, p.H1069Q has lower frequency in our area; 3) to confirm (or exclude) an early diagnosis and to avoid unnecessary and invasive tests and to initiate (or not) the specific treatment with a stronger basis in patients with chronic liver disease and individuals from family screening of patients with Wilson disease; 4) to confirm the diagnosis, although late, of cases with severe acute liver failure, but very important to perform family screening; 5) to identify simple heterozygotes in patients with severe acute liver failure; 6) to describe unusual cases of three different genotypes of WD patients in a same family (two different homozygous mutations and one compound heterozygous); 7) to better define that p.M645R mutation in homozigosity develops WD, although the results from in vitro studies suggested a normal function for the defective synthesized protein; 8) to define that there are patients with p.M645R mutations in compound heretozigosity with a very benign clinical picture, with late diagnosis, after the fifth decade of life, with mild liver alterations. However, there are patients with a more severe clinical evaluation, hepatic or neurologic, probably secondary to the influence of the other mutation
8
Jeromson, Sarah Joy. "Development of a yeast model to distinguish missense mutations from polymorphisms in the Wilson's disease gene ATP7B." Thesis, University of Huddersfield, 2003. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.288501.
Full text
9
Hercend, Claude. "Contribution de la modélisation moléculaire à l'étude de pathologies humaines : Application au transporteur ATP7B et au récepteur 5HT2B." Phd thesis, Université René Descartes - Paris V, 2012. http://tel.archives-ouvertes.fr/tel-00708236.
Full text
10
Hercend, Claude. "Contribution de la modélisation moléculaire à l’étude de pathologies humaines : Application au transporteur ATP7B et au récepteur 5HT2B." Thesis, Paris 5, 2012. http://www.theses.fr/2012PA05T005/document.
Full text
11
Deguti, Marta Mitiko. ""Doença de Wilson: aspectos demográficos e fenotípicos relacionados ao genótipo ATP7B e estudo do haplótipo em portadores da mutação L708P"." Universidade de São Paulo, 2004. http://www.teses.usp.br/teses/disponiveis/5/5147/tde-02052006-093857/.
Full textAbstract:
A doença de Wilson é um distúrbio da excreção biliar de cobre devido a um defeito na proteína ATP7B. Em caráter pioneiro na América do Sul, seqüenciou-se o gene ATP7B em 60 pacientes brasileiros pertencentes a 46 famílias; os resultados foram relacionados com aspectos demográficos e fenotípicos. Detectaram-se 25 mutações, 12 das quais novas. A 3402delC (34,8%) e a L708P (14,1%) ocorreu em 58,3% das famílias de São Paulo e em 44,4% das de Minas Gerais, respectivamente. As substituições novas, pesquisadas por RFLP ou PCR alelo-específica, não ocorreram em 60 indivíduos controle; portanto, não são polimorfismos comuns. O estudo comparativo de haplótipos dos portadores da L708P da coorte atual e de Gran Canaria sugeriu um efeito-fundador comum para ambos os grupos. O fenótipo variou amplamente para genótipos idênticos<br>ATP7B protein. As the first study of its kind in South America, the ATP7B gene was sequenced and the results were related to demographic and phenotypic aspects of 60 Brazilian patients, from 46 distinct families. Twenty-five mutations were detected, 12 of which are novel. The 3402delC (34.8%) and the L708P (14.1%) occurred in 58.3% of the families from Sao Paulo and in 44.4% of those from Minas Gerais, respectively. The novel substitutions were shown not to be common polymorphisms by RFLP or allele-specific PCR studies performed in 60 control subjects. Haplotype analysis comparing carriers of the L708P from this cohort study with patients from Gran Canary suggests the same founder-effect for both groups. Phenotype varied widely for identic genotypes.
12
Sánchez, Monteagudo Ana. "Genética molecular y biomarcadores de la enfermedad de Wilson." Doctoral thesis, Universitat Politècnica de València, 2023. http://hdl.handle.net/10251/171454.
Full textAbstract:
[ES] La enfermedad de Wilson (EW) es un trastorno hereditario del metabolismo del cobre causado por mutaciones en ATP7B, que codifica una proteína transportadora de cobre en el hígado. Su mal funcionamiento provoca un fallo en la excreción biliar de cobre y una acumulación progresiva de este metal en el organismo, especialmente en hígado y cerebro. En este trabajo, se explora la posible utilidad de miRNAs circulantes en plasma para identificar biomarcadores que sirvan para controlar la progresión de la enfermedad en pacientes con EW bajo tratamiento. Los modelos desarrollados para cada miRNA mostraron un buen rendimiento al clasificar a los pacientes con factores de evolución desfavorable, por lo que estos tres miRNAs se proponen como candidatos para mejorar el seguimiento clínico o para respaldar la eficacia de nuevas terapias en la EW.<br>[CA] La malaltia de Wilson és un trastorn hereditari del metabolisme del coure causat per mutacions en ATP7B, que codifica per a una proteïna transportadora del coure al fetge. El seu mal funcionament produeix alteracions en l'excreció biliar i l'acumulació progressiva de coure, especialment en fetge i cervell. Es va explorar la possible utilitat del perfil de miRNAs circulants com biomarcadors de progressió de la patologia hepàtica. L'avaluació dels models obtinguts per a cadascun dels tres miRNAs va mostrar un bon rendiment per a classificar al grup de pacients amb factors d’evolució desfavorable, en conseqüència, es proposen com a candidats per tal de millorar el seguiment clínic o comprovar l’efectivitat de noves teràpies en la malaltia de Wilson.<br>[EN] Wilson disease (WD) is an inherited disorder of copper metabolism caused by mutations in ATP7B, which encodes for a liver copper-transporting protein. Its dysfunction causes a deficit in biliary copper excretion and a progressive accumulation of this metal in the organism, mainly in liver and brain. In this work, circulating miRNAs profiling in plasma has been accomplished to identify biomarkers that could serve to monitor disease progression in WD patients under chelation therapy. Developed models for each miRNA exhibited good performance classifying patients with poor outcome factors, consequently, these three miRNAs are proposed as candidates to improve clinical follow-up or to support efficacy of novel therapies in WD.<br>Esta Tesis Doctoral ha sido financiada por los siguientes proyectos de investigación: “Avanzar en el diagnóstico y la prognosis de la enfermedad de Wilson”
Duración: 2016-2019, Fundació Per Amor a l’Art (FPAA) IP: C. Espinós; “Bases genéticas y biomarcadores pronóstico de la enfermedad de Wilson y
Wilson-like” 2020-2022, Fundació Per Amor a l’Art (FPAA) IP: C. Espinós; “Estudios clínicos, bases genéticas y biomarcadores pronóstico en enfermedades raras neurodegenerativas” 2019-2021, Instituto de Salud Carlos III (Expediente: PI18/00147) IP: C. Espinós; “De genes a terapia en enfermedades neurodegenerativas y neuromusculares” 2018-2021, Generalitat Valenciana, Programa Prometeo para grupos de investigación de excelencia (Expediente: PROMETEO/2018/135)
Consorcio de investigadores formado por F. V. Pallardó (coordinador), J.M. Millán, I. Galindo, P. Sanz, T. Sevilla y C. Espinós.<br>Sánchez Monteagudo, A. (2021). Genética molecular y biomarcadores de la enfermedad de Wilson [Tesis doctoral]. Universitat Politècnica de València. https://doi.org/10.4995/Thesis/10251/171454<br>TESIS
13
Kühne, Angelika [Verfasser], Joachim [Akademischer Betreuer] Mössner, Dominik [Akademischer Betreuer] Huster, Rolf [Gutachter] Gebhardt, and Thomas [Gutachter] Berg. "Funktionelle Untersuchungen der Auswirkung von Mutationen auf das humane Kupfertransportprotein ATP7B (Wilson ATPase) / Angelika Kühne ; Gutachter: Rolf Gebhardt, Thomas Berg ; Joachim Mössner, Dominik Huster." Leipzig : Universitätsbibliothek Leipzig, 2013. http://d-nb.info/1238241875/34.
Full text
14
Schmid, Sebastian C. [Verfasser], Gregor [Akademischer Betreuer] Weirich, and T. A. [Akademischer Betreuer] Meitinger. "Untersuchung des Kupfertransporters ATP7B auf Chromosomen- und Genebene in Hinblick auf primäre Chemotherapieresistenz bei Therapie mit platinhaltiger Chemotherapie / Sebastian Christoph Schmid. Gutachter: T. A. Meitinger. Betreuer: Gregor Weirich." München : Universitätsbibliothek der TU München, 2012. http://d-nb.info/1025337689/34.
Full text
15
Niemiec, Moritz Sebastian. "Human copper ion transfer : from metal chaperone to target transporter domain." Doctoral thesis, Umeå universitet, Kemiska institutionen, 2015. http://urn.kb.se/resolve?urn=urn:nbn:se:umu:diva-100511.
Full textAbstract:
Many processes in living systems occur through transient interactions among proteins. Those interactions are often weak and are driven by small changes in free energy. Due to the short-living nature of these interactions, our knowledge about driving forces, dynamics and structures of these types of protein-protein heterocomplexes are though limited. This is especially important for cellular copper (Cu) trafficking: Copper ions are essential for all eukaryotes and most bacteria. As a cofactor in many enzymes, copper is especially vital in respiration or detoxification. Since the same features that make copper useful also make it toxic, it needs to be controlled tightly. Additionally, in the reducing environment of the cytosol, Cu is present as insoluble Cu(I). To circumvent both toxicity and solubility issues, a system has evolved where copper is comforted by certain copper binding proteins, so-called Cu-chaperones. They transiently interact with each other to distribute the Cu atoms in a cell. In humans, one of them is Atox1. It binds copper with a binding site containing two thiol residues and transfers it to other binding sites, mostly those of a copper pump, ATP7B (also known as Wilsons disease protein). My work was aimed at understanding copper-mediated protein-protein interactions on a molecular and mechanistic level. Which amino acids interact with the metal? Which forces drive the transfer from one protein to the other? Using biophysical and biochemical methods such as chromatography and calorimetry on wild type and point-mutated proteins in vitro, we found that the copper is transferred via a dynamic intermediate complex that keeps the system flexible while shielding the copper against other interactions. Although similar transfer interactions can be observed in other organisms, and many conclusions in the copper field are drawn from bacterial and yeast analogs, we believe that it is important to investigate human proteins, too. Not only is their regulation different, but also only in humans we find the diseases linked to the proteins: Copper level regulation diseases are to be named first, but atypical copper levels have also been linked to tumors and amyloid dispositions. In summary, my observations and conclusions are of basic research character and can be of importance for both general copper and human medicinal research.
16
BORGES, Christina Telles. "Estudo teórico da Interação da Proteína ATP7A com a Cisplatina." reponame:Repositório Institucional da UNIFEI, 2016. http://repositorio.unifei.edu.br:8080/xmlui/handle/123456789/522.
Full textAbstract:
Submitted by repositorio repositorio (repositorio@unifei.edu.br) on 2016-08-24T12:13:27Z
No. of bitstreams: 1
dissertacao_borges_2016.pdf: 3222821 bytes, checksum: 560a8ab8059916a0da25a738422e4856 (MD5)<br>Made available in DSpace on 2016-08-24T12:13:27Z (GMT). No. of bitstreams: 1
dissertacao_borges_2016.pdf: 3222821 bytes, checksum: 560a8ab8059916a0da25a738422e4856 (MD5)
Previous issue date: 2016-07<br>Um quimioterápico muito utilizado no tratamento de diversos tipos de câncer é o cis-diaminodicloroplatina (II), conhecido por cisplatina. Apesar do amplo espectro de atividades apresentado por esse fármaco, fazendo com que ele seja usado para tratar diversos tipos de tumores, a resistência limita drasticamente seu uso. Essa resistência está associada, entre outros fatores, à redução da acumulação intracelular da droga o que pode estar relacionada à interações com várias biomoléculas tioladas, como por exemplo a proteína ATP7A. A proteína ATP7A tem 40280 átomos e alguns domínios de ligação à metais, sendo responsável pelo controle de íons metálicos no organismo. Cálculos computacionais utilizando o programa Gaussian 09 e a metodologia híbrida QM/MM com o método ONIOM, foram feitos para a reação entre o sítio ativo do quinto domínio de ligação à metais da proteína ATP7A e a cisplatina, com o objetivo de analisar parâmetros termodinâmicos que possam ser um indicativo da possível participação da proteína ATP7A no mecanismo de resistência à cisplatina.
17
Samimi, Goli. "The cellular pharmacology and cytotoxic activity of cisplatin are modulated by the copper transporter ATP7A /." Diss., Connect to a 24 p. preview or request complete full text in PDF format. Access restricted to UC campuses, 2004. http://wwwlib.umi.com/cr/ucsd/fullcit?p3123664.
Full text
18
Singh, Prashant. "Regulation of the Menkes Protein in neuroendocrine Cells in Response to Copper." Bowling Green State University / OhioLINK, 2009. http://rave.ohiolink.edu/etdc/view?acc_num=bgsu1237841061.
Full text
19
Bouchard, Andréanne. "Incorporating Molecular Data in the Taxonomic Study of Diatoms: An Example Using Two Wellknown Genera, Frustulia and Navicula S.S. (Bacillariophyceae, Naviculales)." Thesis, Université d'Ottawa / University of Ottawa, 2021. http://hdl.handle.net/10393/42387.
Full textAbstract:
Diatoms are crucially important to the global ecosystem due to their role in regulating the world’s carbon and silicon cycles, and their production of large amounts of organic material in aquatic environments. They are thought to comprise ca. 100,000 species, although some estimates suggest that there could be over a million. Despite their importance and high species diversity, little is known about their phylogeny due to technical issues that hinder the reconstruction of their relationships. However, owing to a new technique that allows for DNA to be amplified from a single isolated cell, it is possible to explore diatom relationships with extensive taxonomic sampling. This thesis aims to demonstrate that the integration of molecular data and morphological characters can provide a new paradigm for future phylogenetic and taxonomic studies of diatoms, especially among closely related and taxonomically complex groups. To achieve this, I examined common species from two naviculoid diatom genera, Frustulia and Navicula using sequence data from three molecular markers (rbcL, atpB, 18S), traditional and fine-scale morphological characters, and frustule shape. The molecular markers rbcL and atpB evolved at a similar rate and performed well at reconstructing species-level phylogenies, whereas 18S was more conserved and best used for resolving relationships at higher taxonomic levels. Hidden diversity was uncovered in what have traditionally been thought as well-circumscribed taxa, and three new species were described. The methods used here show promise for the future of diatom systematics.
20
Miranda, Vitor Fernandes Oliveira de [UNESP]. "Filogenia e biogeografia de Droseraceae inferidas a partir de caracteres morfológicos e moleculares (18S, atpB, matK, rbcL e ITS)." Universidade Estadual Paulista (UNESP), 2006. http://hdl.handle.net/11449/100633.
Full textAbstract:
Made available in DSpace on 2014-06-11T19:30:58Z (GMT). No. of bitstreams: 0
Previous issue date: 2006-04-19Bitstream added on 2014-06-13T21:01:44Z : No. of bitstreams: 1
miranda_vfo_dr_rcla.pdf: 1021369 bytes, checksum: 2be3c5a3b761577a7fcabcf55b7efb6e (MD5)<br>Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)<br>A família Droseraceae está organizada taxonomicamente em quatro gêneros: Drosera L., Dionaea Ellis, Aldrovanda L. e Drosophyllum Link, sendo que estes três últimos são monotípicos. Entretanto, análises de caracteres morfológicos, anatômicos e moleculares levaram à inclusão de Drosophyllum numa nova família. O gênero Drosera está representado por aproximadamente 130 espécies, sendo a maior parte espécies perenes. As espécies podem ser encontradas em regiões temperadas e tropicais, apresentando elevado grau de endemismo, embora várias espécies sejam cosmopolitas. As relações filogenéticas de Droseraceae são pouco conhecidas, resultando em uma classificação sujeita a muitas controvérsias. As classificações propostas são conflitantes e estudos filogenéticos têm demonstrado que diversos táxons infragenéricos (subgêneros e seções) de Drosera não são monofiléticos. A obtenção de uma hipótese filogenética robusta para o grupo pode, potencialmente, resolver inúmeras questões sistemáticas para Droseraceae. O presente estudo se divide em duas partes (representadas pelos capítulos) nos quais o primeiro visa (1) verificar a posição filogenética de Droseraceae dentro de Caryophyllales s.l.; (2) verificar as relações de Aldrovanda, Dionaea e Drosera e (3) identificar a posição de Drosera (Freatulina) regia em Droseraceae. A segunda parte (segundo capítulo), por sua vez, visa elucidar as relações filogenéticas das diversas seções e subgêneros de Drosera, empregando-se dados moleculares do gene plastidial matK, dos espaçadores internos transcritos (ITS1 e ITS2) do DNA nuclear ribossomal (DNAnr), bem como o estudo de 61 caracteres morfológicos.<br>The family Droseraceae includes four genera: Drosera L., Dionaea Ellis, Aldrovanda L., and Drosophyllum Link, the last three of which are monotypic. However analyses of morphological, anatomical, and molecular data corroborate the exclusion of Drosophyllum to a new family. The genus Drosera includes nearly 130 species, mostly perennial. Species are found in temperate and tropical regions, with endemic and cosmopolitan distribution. There are few studies regarding phylogenetic relationships of Droseraceae, and the recent classifications are questionable. The classifications are controversial and phylogenetic studies have shown that many sections and even subgenera of Drosera are not monophyletic. The aim of this study is to obtain a robust phylogenetic hypothesis to Droseraceae. This study consists of two sections (chapters): the goals of the first chapter are (1) to analyze the relationship of Droseraceae considering Caryophyllales s.l., (2) to analyze the relationship of Aldrovanda, Dionaea, and Drosera and (3) to verify the position of Drosera (Freatulina) regia in Droseraceae; the goals of the second chapter are to analyze the phylogenetic relationships of sections and subgenera of Drosera, based on morphological (61 characters) and molecular (matK and ITS region) sequence data. Sensitivity analysis was performed using a range of analytical parameters in attempt to verify the parameter set which minimized the homoplasies in each data partition (morphological and molecular datasets). The final cladogram based on combined datasets was employed to produce an area cladogram trying to elucidate the historical events related to the distribution pattern of Droseraceae.
21
Miranda, Vitor Fernandes Oliveira de. "Filogenia e biogeografia de Droseraceae inferidas a partir de caracteres morfológicos e moleculares (18S, atpB, matK, rbcL e ITS) /." Rio Claro : [s.n.], 2006. http://hdl.handle.net/11449/100633.
Full textAbstract:
Resumo: A família Droseraceae está organizada taxonomicamente em quatro gêneros: Drosera L., Dionaea Ellis, Aldrovanda L. e Drosophyllum Link, sendo que estes três últimos são monotípicos. Entretanto, análises de caracteres morfológicos, anatômicos e moleculares levaram à inclusão de Drosophyllum numa nova família. O gênero Drosera está representado por aproximadamente 130 espécies, sendo a maior parte espécies perenes. As espécies podem ser encontradas em regiões temperadas e tropicais, apresentando elevado grau de endemismo, embora várias espécies sejam cosmopolitas. As relações filogenéticas de Droseraceae são pouco conhecidas, resultando em uma classificação sujeita a muitas controvérsias. As classificações propostas são conflitantes e estudos filogenéticos têm demonstrado que diversos táxons infragenéricos (subgêneros e seções) de Drosera não são monofiléticos. A obtenção de uma hipótese filogenética robusta para o grupo pode, potencialmente, resolver inúmeras questões sistemáticas para Droseraceae. O presente estudo se divide em duas partes (representadas pelos capítulos) nos quais o primeiro visa (1) verificar a posição filogenética de Droseraceae dentro de Caryophyllales s.l.; (2) verificar as relações de Aldrovanda, Dionaea e Drosera e (3) identificar a posição de Drosera (Freatulina) regia em Droseraceae. A segunda parte (segundo capítulo), por sua vez, visa elucidar as relações filogenéticas das diversas seções e subgêneros de Drosera, empregando-se dados moleculares do gene plastidial matK, dos espaçadores internos transcritos (ITS1 e ITS2) do DNA nuclear ribossomal (DNAnr), bem como o estudo de 61 caracteres morfológicos<br>Abstract: The family Droseraceae includes four genera: Drosera L., Dionaea Ellis, Aldrovanda L., and Drosophyllum Link, the last three of which are monotypic. However analyses of morphological, anatomical, and molecular data corroborate the exclusion of Drosophyllum to a new family. The genus Drosera includes nearly 130 species, mostly perennial. Species are found in temperate and tropical regions, with endemic and cosmopolitan distribution. There are few studies regarding phylogenetic relationships of Droseraceae, and the recent classifications are questionable. The classifications are controversial and phylogenetic studies have shown that many sections and even subgenera of Drosera are not monophyletic. The aim of this study is to obtain a robust phylogenetic hypothesis to Droseraceae. This study consists of two sections (chapters): the goals of the first chapter are (1) to analyze the relationship of Droseraceae considering Caryophyllales s.l., (2) to analyze the relationship of Aldrovanda, Dionaea, and Drosera and (3) to verify the position of Drosera (Freatulina) regia in Droseraceae; the goals of the second chapter are to analyze the phylogenetic relationships of sections and subgenera of Drosera, based on morphological (61 characters) and molecular (matK and ITS region) sequence data. Sensitivity analysis was performed using a range of analytical parameters in attempt to verify the parameter set which minimized the homoplasies in each data partition (morphological and molecular datasets). The final cladogram based on combined datasets was employed to produce an area cladogram trying to elucidate the historical events related to the distribution pattern of Droseraceae<br>Orientador: Antonio Furlan<br>Coorientador: Maurício Bacci Júnior<br>Banca: Marco Antonio de Assis<br>Banca: Reinaldo Monteiro<br>Banca: Fernando Portella de L. Marques<br>Banca: Vinícius A. de Oliveira Dittrich<br>Doutor
22
RIMBAULT, BLANDINE. "Etude de l'expression des genes chloroplastiques atpa et atpb, codant pour les sous unites et de l'atp synthetase, dans l'algue verte c. Reinhardtii." Paris 11, 2001. http://www.theses.fr/2001PA112043.
Full textAbstract:
L'origine endosymbiotique des chloroplastes se manifeste par le transfert de nombreux genes, a partir de l'ancetre procaryote, dans le genome nucleaire. L'existence, pour chaque complexe de l'appareil photosynthetique, de sous unites codees par le genome nucleaire et d'autres codees par le chloroplaste implique une regulation de l'expression des genes, afin que les sous unites soient produites dans les proportions requises pour leur assemblage. Les travaux presentes dans notre these concernent la regulation de l'expression de deux genes chloroplastiques de l'algue verte c. Reinhardtii, atpa et atpb, codant pour les sous unites et du complexe de l'atp synthetase. La majeure partie des genes chloroplastiques sont transcrits separement et de maniere independante. Le gene atpa fait cependant partie d'une des rares unites de transcription qui comprend trois autres genes : psbl cema et atph. Huit transcrits sont accumules. Le gene atpa occupe une position privilegiee, en tant que gene situe le plus en amont de l'unite de transcription. L'efficacite de sa traduction ne depend ni de la nature, mono ou polycistronique des transcrits contenant la phase codante de atpa, ni de leur accumulation. Le gene atpb est plus representatif de l'ensemble des genes demeures dans le chloroplaste. Un facteur nucleaire specifique, mdb1p, agit au niveau de la stabilite du transcrit. Ce facteur agit en stabilisant le transcrit, peut-etre en le rendant competent pour la traduction. Le transcrit subit de plus une maturation de la region 5 qui depend de la nature, chloroplastique ou bacterienne, de sa phase codante. Meme si le transcrit atpb possede trois codons d'initiation possibles, la traduction s'effectue a partir d'un seul aug : c'est uniquement la position du codon qui determine la traduction. Enfin nous avons mis en evidence que la traduction de atpa et atpb est coordonnee en fonction de l'assemblage de l'enzyme. L'absence d'une sous-unite du couple perturbe la synthese de l'autre sous unite: nous avons montre que des intermediaires dans la voie de biogenese de l'atp synthetase regulent negativement la synthese des deux sous unites.
23
Långström, Elisabeth. "Systematics of Echiochilon and Ogastemma (Boraginaceae), and the Phylogeny of Boraginoideae." Doctoral thesis, Uppsala universitet, Systematisk botanik, 2002. http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-1863.
Full textAbstract:
Echiochilon, Ogastemma and Sericostoma are revised resulting in the recognition of 15 species of Echiochilon and one Ogastemma species. Several species are placed in synonymy and three new species are described, E. baricum, E. callianthum and E. cyananthum. The single species of Sericostoma is shown to be nested within Echiochilon. The plastid atpB gene was sequenced for Echiochilon and Ogastemma from the Old World and Antiphytum from the New World, plus for a selection of 33 other Boraginaceae taxa. They were analysed together with selected outgroup taxa to give a framework of the tribes of Boraginoideae. The analysis gave support for establishing the new tribe Echiochileae for Antiphytum, Echiochilon and Ogastemma, and for merging the traditionally accepted tribe Eritrichieae with Cynoglosseae. The ITS region was sequenced for all but one species of Echiochilon and for representatives of Antiphytum and Ogastemma. Phylogenetic analysis of Echiochilon revealed that the strongly zygomorphic-flowered species form a paraphyletic group. The morphological data gave results fairly congruent with the ITS phylogeny. Biogeographic interpretations of the ITS and atpB phylogenies indicated a trans-Atlantic dispersal of Antiphytum as the most plausible explanation to the Old/New World disjunction. Analyses using DIVA (Dispersal Vicariance Analysis) of the distributions of the Echiochilon species indicated an ancestor to Echiochilon with a wide distribution over northern Africa and Arabia to India.
24
Liu, Li. "Roles of PMCA Isoforms in Ca2+-Homeostasis and Contractility of Bladder Smooth Muscle: Evidence from PMCA Gene-Ablated Mice." Cincinnati, Ohio : University of Cincinnati, 2007. http://rave.ohiolink.edu/etdc/view.cgi?acc_num=ucin1178307168.
Full textAbstract:
Thesis (Ph.D.)--University of Cincinnati, 2007.<br>Advisor: Richard J. Paul. Title from electronic thesis title page (viewed Apr. 4, 2009). Keywords: PMCA (human gene symbols; ATP2B); SERCA2 (human gene symbols; ATP2A2); NCX; bladder smooth muscle; Ca²⁺ homeostasis; gene-altered mice. Ca²⁺ waves; Ca²⁺ sparks; Fura-PE3; Fluo-4; Indo-1; multi-photon microscopy. Includes abstract. Includes bibliographical references.
25
Ogórek, Mateusz. "Rola białek ATP7A i ATP7B w utrzymaniu homeostazy miedzi w procesie spermatogenezy." Praca doktorska, 2019. https://ruj.uj.edu.pl/xmlui/handle/item/148805.
Full textAbstract:
Miedź jest pierwiastkiem potrzebnym do prawidłowego przebiegu procesów życiowych każdej żywej komórki oraz niezbędnym mikroelementem dla wzrostu i rozwoju wszystkich organizmów żywych. Dzięki swoim zdolnościom oksydo-redukcyjnym, miedź jest kofaktorem wielu reakcji enzymatycznych, które pełnią kluczową rolę w tak podstawowych procesach metabolicznych jak oddychanie komórkowe, detoksykacja wolnych rodników, synteza neurotransmiterów czy przyswajanie żelaza. Niedobór miedzi skutkuje obniżeniem lub brakiem aktywności miedzio-zależnych enzymów, co prowadzi do poważnych zmian patologicznych w organizmie. Natomiast nadmiar miedzi może powadzić do uszkodzeń oksydacyjnych organelli komórkowych i materiału genetycznego, gdyż ten aktywny pierwiastek może wchodzić w reakcje prowadzące do powstawania wolnych rodników w komórce. Od długiego czasu znany był bardzo toksyczny wpływ miedzi na funkcjonowanie męskiego układu rozrodczego, ale badania ostatnich lat pokazały także, że jony miedzi są niezbędne do prawidłowego przebiegu procesu spermatogenezy, dlatego konieczne jest utrzymanie homeostazy tego pierwiastka w gonadzie męskiej. Wyniki naszych badań pokazują, że w jądrze, podczas procesu gametogenezy, oraz w najądrzu, w czasie dojrzewania plemnika, homeostaza miedzi jest ściśle kontrolowana i regulowana przez trzy grupy białek: transportery jednowartościowych jonów metali CTR1 (znany także jako SLC31A1) i CTR2 (znany także jako SLC31A2), białka ATP7A i ATP7B - ATPazy typu P wiążące kationy miedziowe oraz metalochaperony (ATOX1 i CCS). Otrzymane przez nas wyniki pokazały, że w trakcie procesu spermatogenezy, na wczesnych etapach podziału mejotycznego, miedź pobierana jest przez spermatogonia przy udziale białka CTR1 gdyż odpowiednio wysokie stężenie kationów miedziowych jest niezbędne dla zainicjowania mejozy. Po rozpoczęciu podziału redukcyjnego nadmiar miedzi usuwany jest z leptotenowych i pachytenowych spermatocytów I-rzędowych, przy udziale białka ATP7A. Po zakończeniu mejozy miedź usuwana jest ze spermatyd wydłużonych przy udziale białka ATP7B. W kanaliku plemnikotwórczym jony miedzi usunięte z komórek germinalnych pobierane są przez komórki Sertoliego, na co wskazuje ekspresja białka CTR1 na błonie tych komórek. W komórkach Sertoliego, miedź może zostać ponownie wykorzystana do produkcji białek miedziozależnych lub też, w razie jej nadmiaru, usunięta z kanalika plemnikotwórczego przez zlokalizowany w błonie bazalnej komórek Sertoliego eksporter ATP7A. Po zakończeniu spermiacji, wydłużone spermatydy przemieszczają się do najądrza, gdzie przebiega proces dojrzewania gamety. Nasze badania wykazały, że we wszystkich odcinkach najądrza zachodzi ekspresja białek związanych z regulacją metabolizmu miedzi. W komórkach nabłonkowych ekspresja białka ATP7B umożliwia wydzielanie miedzi do płynu najądrzowego w dwóch postaciach: związanej z ceruloplazminą i w formie jonów Cu+. Stężenie miedzi w płynie najądrzowym regulowane jest przez białko CTR1 zlokalizowane w błonie apikalnej komórek nabłonkowych, co umożliwia transport jonów Cu+ z płynu nasiennego do cytoplazmy oraz białko ATP7A zlokalizowane w błonie bazalnej tych komórek, co umożliwia usunięcie nadmiaru jonów Cu+ do krwioobiegu. Miedź z płynu najądrzowego pobierana jest przez plemniki przy udziale białka CTR1, które zlokalizowane jest w główce plemnika. Odpowiednio wysoki poziom miedzi w plemniku jest niezbędny do syntezy miedzio-zależnych enzymów biorących udział w produkcji energii oraz w procesach ochrony antyoksydacyjnej gamety. Nadmiar miedzi z plemnika może zostać usunięty przy pomocy białka ATP7B, które znajduje się we wstawce plemnika.<br>Copper is a trace element essential for metabolic processes in every living cell and is necessary for growth and development of all the living organisms. Due to its oxido-reductive properties, copper is a cofactor in many enzymatic reactions, which play an essential role in metabolic processes as elementary as cellular respiration, free radicals detoxification, neurotransmitters synthesis or iron metabolism. Disturbances in copper homeostasis lead to highly destructive processes in the organism. Copper deficiency results in a decrease or lack of the activity of many copper-dependent enzymes. Copper overload on the other hand can lead to oxidative damage of the cell organella and the genetic material as this reactive element can undergo reactions leading to free radical formation inside the cell. For many decades copper has been known as highly toxic for male reproduction system but investigation of the last years showed that copper is also essential for the process of spermatogenesis and thus it is necessary to maintain the homeostasis of this element in the male gonad. Our results have shown that in the testis during the gametogenesis process and in epididymis during sperm maturation copper uptake, transport and excretion are precisely controlled by three groups of proteins involved in copper metabolism: importers of monovalent metal ions CTR1 (also known as SLC31A1), and CTR2 (also known as SLC31A2), exporters ATP7A, ATP7B - type P ATPases that bind copper cations, and metalochaperones (ATOX1 and CCS). The results we obtained show that in the early phases of meiotic division, spermatogonias import high amounts of copper ions via CTR1 in order to reach the proper copper cation concentration as it is essential to begin meiotic division. When the meiotic division begins, in primary spermatocytes (leptotene and pachytene), ATP7A protein exports the excess of copper to protect the cells from copper overload and toxicity. After terminating the meiotic division, copper is exported from the elongated spermatides by ATP7B. In the seminiferous tubules the exported copper ions are taken up by Sertoli cells via CTR1 importer, which is suggested by the CTR1 expression on the cell membrane of those cells. In Sertoli cells copper can be incorporated into cupric proteins or - in the case of copper excess - removed from the seminiferous tubule via ATP7A transporter located in basal membrane of Sertoli cells. Once spermiation is finished, elongated spermatides are transferred to epididymis where they mature. Copper transport proteins are present in all three parts of epididymis. The expression of ATP7B in the epithelial cells enables the release of copper into the epididymal fluid in two forms: bound with ceruloplasmin or Cu+ ions. Copper concentration in the epididymal fluid is regulated by CTR1 and ATP7A. CTR1 protein is located in the apical membrane of the epithelial cells and enables transport of the Cu+ ions from the seminal fluid into the cytoplasm. ATP7A is located in the basal membrane of the same cells and enables the removal of the excess of the Cu+ ions by the blood circulation system. Copper is also taken up by the sperm cells from the epididymal fluid via CTR1 located in the sperm cell's head. Appropriate copper concentration in the sperm cell is required for the synthesis of the copperdependent enzymes that take part in the energy production and in the antioxidant protection of the gamete. The copper excess can be removed from the sperm cell via ATP7B located in the midpiece of the cell.
26
Braun, Sebastian. "ATP7B-Polymorphismen bei Patienten mit Morbus Wilson /." 2007. http://bvbr.bib-bvb.de:8991/F?func=service&doc_library=BVB01&doc_number=015731078&line_number=0001&func_code=DB_RECORDS&service_type=MEDIA.
Full text
27
Kühne, Angelika. "Funktionelle Untersuchungen der Auswirkung von Mutationen auf das humane Kupfertransportprotein ATP7B (Wilson ATPase)." Doctoral thesis, 2012. https://ul.qucosa.de/id/qucosa%3A11810.
Full textAbstract:
Das Schwermetall Kupfer ist von essentieller Bedeutung für zahlreiche zelluläre Funktionen. Aufgrund seines Redoxpotentials muss die Kupferhomöostase im Organismus eng reguliert werden. Die Schlüsselrolle spielt dabei das Kupfertransportprotein ATP7B (Wilson ATPase) in der Leber. Ein Funktionsverlust dieses Proteins wird in der autosomal-rezessiv vererbten Erkrankung Morbus Wilson deutlich. Der Kupfertransportdefekt der Hepatozyten führt zu einer Kupferüberladung in der Leber mit nachfolgender Schädigung. Ferner kommt es zu einer Kupferakkumulation im Zentralnervensystem mit neurologischen Störungen. Das bei der Erkrankung betroffene Gen ATP7B wurde 1993 kloniert. Bis heute sind über 500 krankheitsverursachende Genmutationen entdeckt worden. Eine Schlüsselfunktion dieser Enzymgruppe ist die katalytische Phosphorylierung. Die Auswirkungen von Mutationen auf die Funktion des Proteins sind jedoch nur unzureichend verstanden. ATP7B kann mit Hilfe des Baculovirusexpressionssystems hergestellt und anschließend proteinbiochemischen Untersuchungen unterzogen werden.
In dieser experimentellen Arbeit wurde untersucht, ob Punktmutationen diesen Phosphorylierungsmechanismus von ATP7B beeinflussen. Dafür wurden, neben dem Wildtyp-Protein, 25 patientenspezifische und eine noch nicht beim Menschen beobachtete Mutation der Phosphorylierungsstelle D1027A als Negativkontrolle generiert und die katalytische Aktivität in einem Phosphorylierungsassay untersucht. In der vorliegenden Arbeit wurde gezeigt, dass bestimmte Punktmutationen zum Funktionsverlust von ATP7B führen. Als weiterer Mechanismus der Mutationswirkung wurde, neben der Inaktivierung von ATP7B, die Hyperphosphorylierung entdeckt. Die biochemische Charakterisierung dieser Mutationen führt zu einem tieferen Verständnis in der Pathophysiologie des Morbus Wilson und ebnet den Weg für detaillierte Untersuchungen der Genotyp-Phänotyp-Korrelation sowie für innovative Diagnostik- und Therapiestrategien.
28
Fatemi, Negah. "Structural and Functional Studies of ATP7B, the Copper(I)-transporting P-type ATPase Implicated in Wilson Disease." Thesis, 2011. http://hdl.handle.net/1807/31746.
Full textAbstract:
Copper is an integral component of key metabolic enzymes. Numerous physiological processes depend on a fine balance between the biosynthetic incorporation of copper into proteins and the export of excess copper from the cell. The homeostatic control of copper requires the activity of the copper transporting ATPases (Cu-ATPases). In Wilson disease the disruption in the function of the Cu-ATPase ATP7B results in the accumulation of excess copper and a marked deficiency of copper-dependent enzymes. In this work, the structure of ATP7B has been modeled by homology using the Ca-ATPase X-ray structure, enabling a mechanism of copper transport by ATP7B to be proposed. The fourth transmembrane helix (TM4) of Ca-ATPase contains conserved residues critical to cation binding and is predicted to correspond to TM6 of the ATP7B homology model, containing the highly conserved CXXCPC motif. The interaction with Cu(I) and the importance of the 3 cysteines in TM6 of ATP7B has been shown using model peptides. ATP7B has a large cytoplasmic N-terminus comprised of six copper-binding domains (WCBD1-6), each capable of binding one Cu(I). Protein-protein interactions between WCBDs and the copper chaperone Atox1 has been shown, contrary to previous reports, to occur even in the absence of copper. 15N relaxation measurements on the apo and Cu(I)-bound WCBD4-6 show that there is minimal change in the dynamic properties and the relative orientation of the domains in the two states. The domain 4-5 linker remains flexible, and domain 5-6 is not a rigid dimer, with flexibility between the domains. Copper transfer to and between WCBD1-6 likely occurs via protein interactions facilitated by the flexibility of the domains with respect to each other. The flexible linkers connecting the domains are important in giving the domains motional freedom to interact with Atox1, to transfer copper to other domains, and finally to transfer copper to the transmembrane site for transport across the membrane.
29
Singh, Nivedita. "Genetic Analysis of Wilson Disease in a South Indian Population and Molecular Characterization of 13 Novel ATP7B Mutations." Thesis, 2017. http://hdl.handle.net/2005/3273.
Full textAbstract:
Wilson disease (WD) is an autosomal recessive disorder characterized by deposition of copper in the body, mainly in the liver and brain. WD patients present with hepatic, neurological, and psychiatric problems. The diagnosis of WD is very challenging, and is performed by taking
into account both clinical and biochemical parameters. The treatment of WD exists, which aims at initial chelation therapy followed by maintenance therapy. WD is caused by mutations in the ATP7B gene. Till date, more than 600 mutations in ATP7B have already been described from many countries, including India. However, there are a very few large cohort studies which are
reported from Indian population. In this study, we have attempted to perform mutation analysis of ATP7B in a large cohort of WD families from Bangalore, south India, and further look into the molecular consequences of the novel mutations identified in the present study.
30
""Doença de Wilson: aspectos demográficos e fenotípicos relacionados ao genótipo ATP7B e estudo do haplótipo em portadores da mutação L708P"." Tese, Biblioteca Digital de Teses e Dissertações da USP, 2004. http://www.teses.usp.br/teses/disponiveis/5/5147/tde-02052006-093857/.
Full text
31
Arsénio, Sílvia Inês Sustelo. "Doença de Wilson: abordagem terapêutica." Master's thesis, 2020. http://hdl.handle.net/10451/52418.
Full textAbstract:
Trabalho Final de Mestrado Integrado, Ciências Farmacêuticas, 2020, Universidade de Lisboa, Faculdade de Farmácia.<br>O cobre é um oligoelemento essencial para o funcionamento do organismo humano. É um metal imprescindível para a atividade de várias enzimas envolvidas em diversos processos fisiológicos importantes, atuando como cofator catalítico.
A incorporação de cobre no organismo é feita maioritariamente por via oral, através da alimentação. No intestino, a absorção do cobre é realizada por uma ATPase, a ATP7A, localizada na membrana dos enterócitos. Após entrar na circulação portal, o cobre chega rapidamente ao fígado, que é o principal órgão responsável pela sua metabolização. Nos hepatócitos, a proteína ATP7B é responsável por incorporar o cobre na ceruloplasmina, e está envolvida no processo de excreção biliar de cobre. Assim, a inativação de ATP7B resulta num distúrbio grave da homeostase do cobre e na inativação de enzimas dependentes deste metal, manifestando-se clinicamente como a Doença de Wilson.
Esta doença caracteriza-se por uma mutação rara no cromossoma 13 que codifica para a proteína ATP7B, resultando numa acumulação de cobre em vários tecidos e órgãos, nomeadamente no fígado e no cérebro. Esta patologia apresenta uma ampla heterogeneidade de sintomas, pelo que as manifestações clínicas podem ser predominantemente hepáticas, neurológicas ou psiquiátricas. Uma das características, mais comuns, é o anel Kayser-Fleischer presente na maioria dos pacientes com sintomas neurológicos. O diagnóstico desta patologia é baseado numa ampla combinação de testes laboratoriais e características clínicas, como a análise da concentração hepática de cobre e da ceruloplasmina sérica. Antes do desenvolvimento de terapêuticas farmacológicas, a doença de Wilson era inevitavelmente uma doença fatal, contudo, atualmente o prognóstico dos pacientes é bastante favorável.
O tratamento farmacológico da Doença de Wilson fundamenta-se na remoção do excesso de cobre através da utilização de agentes quelantes, como a D-penicilamina e a trientina, e na diminuição da absorção de cobre com o auxílio de sais de zinco.
O tratamento farmacológico disponível geralmente é bastante eficaz, contudo as opções terapêuticas ainda são limitadas e possuem inúmeros efeitos secundários que não favorecem a sua adesão. Inúmeros avanços estão a ser feitos no sentido de desenvolver novos compostos e terapêuticas inovadoras. A terapia genética representa um futuro tratamento curativo para esta patologia.<br>Copper is an essential trace element for the functioning of the human organism. It is an indispensable metal for the activity of several enzymes involved in many important physiological processes, acting as a catalytic cofactor.
The incorporation of copper in the body is mostly done orally, through feeding. In the intestine, the absorption of copper is performed by an ATPase, the ATP7A, located in the enterocyte membrane. After entering the portal circulation, copper quickly reaches the liver, which is the main organ responsible for copper metabolization. In the hepatocytes, the ATP7B protein is responsible for incorporating copper into the ceruloplasmin, and is involved in the process of bile excretion of copper. Therefore, the inactivation of ATP7B results in a severe disturbance of the homeostasis of copper and in the inactivation of enzymes dependent on this metal, manifesting itself clinically as Wilson's disease.
This pathology presents a wide clinical heterogeneity, so the clinical manifestations can be predominantly hepatic, neurological or psychiatric. One of the most common features is the Kayser-Fleischer ring present in most patients with neurological symptoms. The diagnosis of this pathology is based on a wide combination of laboratory tests and clinical characteristics, such as the analysis of the hepatic concentration of copper and serum ceruloplasmin.Before the development of pharmacological therapies, Wilson's disease was inevitably a fatal disease, however, currently the patients' prognosis is very positive.
The pharmacological treatment of Wilson's disease is based on the removal of excess copper using chelating agents such as D-penicillamine and trientine, and on reducing the absorption of copper with the use of zinc salts.
The available pharmacological treatment is generally quite effective, however the therapeutic options are still limited and have numerous side effects that do not promote their compliance. Numerous advances are being made towards the development of new compounds and innovative therapies. Gene therapy represents a future curative treatment for this pathology.
32
Ferreira, Eduardo Rafael Calçada da Silva. "Doença de Wilson : estratégia terapêutica." Master's thesis, 2013. http://hdl.handle.net/10451/30589.
Full textAbstract:
Trabalho Final de Mestrado Integrado, Ciências Farmacêuticas, Universidade de Lisboa, Faculdade de Farmácia, 2013<br>Esta revisão bibliográfica tem como principal objectivo fazer uma síntese das estratégias terapêuticas actualmente usadas na Doença de Wilson e das suas perspectivas futuras. No momento em que foi descrita pela primeira vez, em 1912, a Doença de Wilson era uma doença com um prognóstico fatal, uma vez vez que não era conhecido qualquer tipo de tratamento.
A causa da doença é uma mutação genética que altera o funcionamento normal da proteína ATP7B. Esta alteração tem como consequência a acumulação do elemento metálico cobre no organismo, que afecta o funcionamento normal dos vários orgãos do organismo humano. Uma das consequências desta acumulação é a produção de espécies reactivas de oxigénio que, no decorrer do tempo, podem dar origem a mecanismos que conduzam a uma das manifestações mais frequentes da Doença de Wilson, a cirrose hepática.
No meio do século XX, foram descobertos os primeiros agentes terapêuticos para esta doença, destacando-se os agentes quelantes de cobre. A evolução no desenvolvimento destes fármacos permitiu definir os perfis de segurança de cada um dos fármacos e estabelecer as melhores estratégias terapêuticas para esta doença. Assim, actualmente, dependendo da sintomatologia apresentada, os doentes podem precisar da administração de agentes quelantes como a penicilamina ou trientina, caso se encontrem num episódio de manifestação aguda da doença, ou podem necessitar da administração de sais de zinco, caso sejam doentes pré-sintomáticos ou em fase de manutenção.
Presentemente, o desenvolvimento de novos fármacos, como o tetratiomolibdato e seus análogos representam uma possível alternativa farmacológica num futuro próximo, assim que existirem mais estudos sobre a sua segurança e eficácia. Outra possibilidade terapêutica em estudo é a terapia com base genética, seja através da introdução do gene que codifica a proteína ATP7B nas células afectadas ou através da indução de células estaminais pluripotentes com expressão correcta da proteína em questão, que possam contribuir para um correcto metabolismo do cobre no organismo.<br>This bibliographic review has as its main goals the synthesis of the therapeutic strategies used in Wilson’s Disease management and its future perspectives. When it was described for the first time, in 1912, Wilson’s Disease was a disease with a fatal prognosis, since it was not known any kind of treatment.
The cause of the disease is a genetic mutation that changes the ordinary function of the ATP7B protein. This change has as consequence the accumulation of the metallic element copper in the organism, affecting the normal function of several organs of the human body. One of the consequences of this accumulation is the production of reactive oxygen species which can origin mechanisms that lead to one of the most frequent Wilson’s Disease manifestations, hepatic cirrhosis.
In the middle of the XX century, the first therapeutic agents for this disease were discovered, with the copper chelating agents being the main therapeutic agents available. The evolution on the development of these drugs allowed to define the security profiles of each one and to establish the best therapeutic strategies for this disease. Currently, depending on the symptoms presented by the patients, they may need chelating agents administration, such as penicilamine or trientine, if they are in a acute phase of the disease, or they may need zinc salts administration if they are pre-symptomatic patients or if they are on a maintenance phase.
Presently, the development of new drugs such as tetratiomolibdate and analogs represent a possible pharmacologic alternative in the future, as long as more studies about security and effectiveness are performed. Other therapeutic possibility is the genetic-based therapy, by introducing the codifying gene of the ATP7B protein on the affected cells or by inducing pluripotent stem cells to have the correct expression of the protein, which might contribute to a normal copper metabolism on the organism.
33
Barbosa, Maria Teresa de Seabra Andrade Alvares. "O papel do cobre na doença de Wilson: estratégias terapêuticas." Master's thesis, 2019. http://hdl.handle.net/10451/43423.
Full textAbstract:
Trabalho Final de Mestrado Integrado, Ciências Farmacêuticas, Universidade de Lisboa, Faculdade de Farmácia, 2019<br>O Cobre é um elemento essencial para a sobrevivência do organismo humano. É imprescindível a determinadas enzimas cuja atividade é dependente do Cobre, atuando como cofator catalítico. Uma vez que estas enzimas apresentam um papel importante em diversos processos fisiológicos, a manutenção da homeostase do Cobre torna-se crucial. Diversas fontes naturais conseguem libertar quantidades significativas de cobre na atmosfera. As dietas incluem quantidades de Cobre adequadas, por isso, qualquer desequilíbrio na quantidade ingerida pode levar a efeitos prejudiciais no organismo. A absorção de Cobre no intestino vai ser realizada pela proteína ATP7A e pode ser influenciada por diversos fatores. Após entrar na circulação, o cobre tem capacidade para se ligar a variadas proteínas como a Albumina e a Transcupreína. A proteína ATP7B vai ser responsável pela excreção biliar de Cobre e pela sua incorporação na Ceruloplasmina para ser posteriormente libertado na circulação sanguínea. Mutações nos genes que codificam essas proteínas, levam a alterações nos níveis de Cobre no organismo. A Doença de Wilson caracteriza-se como uma doença onde ocorre uma mutação no gene ATP7B, originando uma acumulação de Cobre livre em vários órgãos, predominantemente o fígado e o cérebro. As principais manifestações clínicas da doença são as manifestações hepáticas, neurológicas e psiquiátricas. Os anéis de Kayser-Fleischer apesar de não serem exclusivos da Doença de Wilson, são a característica clínica mais evidente. A Doença de Wilson quando não tratada pode ser fatal, reforçando a ideia de que o diagnóstico precoce é uma ferramenta vital. O diagnóstico baseia-se essencialmente na determinação dos níveis de Ceruloplasmina e Cobre no sangue e, na presença dos anéis de Kayser-Fleischer. O tratamento fundamenta-se na remoção do excesso de cobre com base no uso de agentes quelantes como a D-Penicilamina, a Trietilenotetramina e o Tetratiomolibdato e na inibição da absorção de cobre com o auxílio dos Sais de Zinco. A combinação dos agentes quelantes com os Sais de Zinco apresenta-se atualmente como uma terapêutica promissora.<br>Copper is an essential element for the survival of the human organism. It is essential for certain enzymes whose activity is dependent on Copper, acting as a catalytic cofactor. Since these enzymes play an important role in many physiological processes, maintenance of Copper homeostasis becomes crucial. Several natural sources can release significant amounts of copper into the atmosphere. Diets include adequate amounts of copper, so any imbalance in intake can lead to detrimental effects on the body. Copper absorption in the gut will be performed by the ATP7A protein and may be influenced by several factors. After entering the circulation, copper is able to bind to various proteins such as Albumin and Transcuprein. The ATP7B protein will be responsible for the biliary excretion of Copper and its incorporation into Ceruloplasmin for later release into the bloodstream. Mutations in the genes that encode these proteins lead to changes in copper levels in the body. Wilson's disease is characterized as a disease where a mutation in the ATP7B gene occurs, leading to an accumulation of free copper in various organs, predominantly the liver and brain. The main clinical manifestations of the disease are hepatic, neurological and psychiatric manifestations. Kayser-Fleischer rings, although not unique to Wilson's disease, are the most obvious clinical feature. Untreated Wilson's disease can be fatal, reinforcing the idea that early diagnosis is a vital tool. The diagnosis is based essentially on the determination of ceruloplasmin and copper levels in the blood and the presence of the Kayser-Fleischer rings. The treatment is based on the removal of excess copper based on the use of chelating agents such as D-Penicillamine, Triethylenetetramine and Tetrathiomolybdate and inhibition of copper absorption with the aid of Zinc Salts. The combination of chelating agents with Zinc Salts is currently a promising therapy.
34
Vo, Kim. "La transplantation d’hépatocytes chez le rat Long Evans Cinnamon, modèle animal de la maladie de Wilson." Thèse, 2006. http://hdl.handle.net/1866/2670.
Full textAbstract:
La maladie de Wilson est une maladie héréditaire due à un déficit du transporteur du cuivre, l’ATP7B. Cette maladie se présente sous forme d’insuffisance hépatique aiguë ou chronique, pour lesquels le traitement médical actuel consiste en l’administration d’agents chélateurs, ce qui ne résulte cependant pas en une guérison complète de la maladie. La transplantation orthotopique du foie est le seul traitement définitif actuellement, avec tous les désavantages qu’elle comporte. Un traitement alternatif à cette option est donc souhaitable. Cette étude porte sur la faisabilité de la transplantation d’hépatocytes chez le modèle animal de la maladie de Wilson, le rat Long Evans Cinnamon (LEC), avec pour buts d’en déterminer la sécurité et l’efficacité tant sur le plan clinique (amélioration de la survie, prévention de l’hépatite) que pathologique. Douze rats LEC ont reçu une injection intrasplénique de 2,6 x 105 – 3,6 x 107 hépatocytes prélevés chez des rats donneurs de souche LE. Ils ont été suivis durant 6 mois puis sacrifiés. Ils ont ensuite été comparés à un groupe contrôle de douze autres rats LEC. Aucune différence significative n’a été notée au niveau du poids, du bilan hépatique et des concentrations de cuivre biliaire et hépatique. Cependant, une amélioration de l’activité oxydase de la céruloplasmine post-transplantation a été démontrée chez le groupe de rats transplantés (49,6 ± 31,5 versus 8,9 ± 11,7). Les rats transplantés ont aussi eu une amélioration sur tous les critères histologiques étudiés. Enfin, l’ARNm de l’atp7b a été retrouvé chez 58% des rats transplantés avec un taux d’expression de 11,9% ± 13,6 par rapport à un rat LE normal. L’immunohistochimie a quant à elle démontré la présence de l’atp7b chez tous les rats transplantés. Les résultats obtenus sont considérés favorables à ce traitement alternatif, et indiquent que la transplantation d’hépatocytes est une technique sécuritaire qui peut contribuer à renverser le processus pathologique en cours dans la maladie de Wilson.<br>Wilson’s disease (WD) is a hereditary metabolic disease caused by a deficiency of copper-transporting ATP7B, resulting in copper accumulating to toxic levels in the liver. Its manifestations range from acute or chronic hepatic insufficiency to fulminant liver failure. The mainstay of therapy is the use of chelating agents. However selected patients may also require orthotopic liver transplantation (OTL), an invasive and complex procedure with life-long implications. Hepatocyte transplantation is an appealing alternative to OLT. Its safety and efficacy were evaluated in the animal model of WD, the Long Evans Cinnamon (LEC) rat. Twelve LEC rats received an intrasplenic injection of 2,6 x 105 – 3,6 x 107 hepatocytes obtained from LE donor rats. They were followed for 6 months before sacrifice. They were then compared to a control group of twelve rats. No difference was found when comparing their weights, biochemical parameters such as liver function tests and bilirubin, as well as their biliary and hepatic copper concentrations. However, the ceruloplasmin oxydase activity was improved in the transplanted rats (49,6 ± 31,5 versus 8,9 ± 11,7). After sacrifice, histologic evaluation and demonstration of atp7b mRNA in the recipient liver were performed. There was evidence of histological improvement and atp7b mRNA was found in 58% of transplanted rats with an expression of 11,9% ± 13,6 when compared to a normal LE rat. Evidence of successful engraftment of the transplanted cells was found in every transplanted rat using the technique of immunohistochemistry. These encouraging results are in accordance with previous studies on hepatocyte transplantation in the LEC rat. Its application to the human clinical setting is the next step, as it has already been tried in other metabolic liver diseases.
35
Hong-Ru and 陳虹如. "The Effect of ATP7A Gene Knockdown andCopper Metabolism Disorders in Zebrafish." Thesis, 2009. http://ndltd.ncl.edu.tw/handle/56546859164074667097.
Full textAbstract:
碩士<br>中山醫學大學<br>醫學檢驗暨生物技術學系碩士班<br>97<br>The trace element copper plays important roles in a range of physiological functions. However, copper is also toxic to cell once when the cation built up. The dilemma is unraveled by two similar mechanisms to carefully control the uptake and rejection of the cation to maintain a copper homeostasis. In human, two genes are responsible for the homeostasis, ATP7A and ATP7B. In zebrafish (Danio rerio), the ortholog of the ATP7A, which is required for copper transport from its intracellular storage to trans-Golgi network (TGN) in order to be used by cuproenzyme or for cellular efflux. To evaluate the role of ATP7A in copper metabolism, an antisense morpholino oligonucleotide strategy was performed to knockdown the zebrafish ATP7A. Using microarray to analyze the ATP7A knockdown zebrafish mRNA, some genes are found up- or down-regulated by the treatment. A variety of cuproenzyme were affected including the superoxide dismutase (SOD1), a significant component of antioxidant system. Although it was known that cofactor copper is required for SOD1 enzyme activity, there is no evidence to reveal the possibility that ATP7A regulates the SOD1 gene expression. To evaluate the role of copper in SOD1 gene regulation, zebrafish embryos were knockdown their ATP7A gene or applied to a copper deficient (by copper chelator) or overdosed environments. Our results have shown that transcription factor SP1 is important for SOD1 expression. Based on these data, a mechanism that ATP7A down-regulates SOD1 gene expression is through SP1 mediated by copper ions is established.
36
Huster, Dominik. "Untersuchungen zur Funktion, Regulation und Pathophysiologie des Kupfertransportproteins ATP7V (Morbus Wilson Protein) /." 2007. http://bvbr.bib-bvb.de:8991/F?func=service&doc_library=BVB01&doc_number=015638810&line_number=0001&func_code=DB_RECORDS&service_type=MEDIA.
Full text
37
Saman, Sadik. "Identifizierung genetischer Biomarker für die Wirksamkeit von Oxaliplatin:Kandidatengen-bezogene und Genom-weite Analysen." Doctoral thesis, 2014. http://hdl.handle.net/11858/00-1735-0000-0023-9949-9.
Full text
38
Huang, Wei-Hsiang, and 黃偉翔. "Phylogeography of the atpB-rbcL noncoding spacer region of the chloroplast DNA in the endemic species Tetraena mongolica (Zygophyllaceae) in Inner Mongolia." Thesis, 2003. http://ndltd.ncl.edu.tw/handle/82712195406079246834.
Full textAbstract:
碩士<br>國立中山大學<br>生物科學系研究所<br>91<br>Abstract
Sequence variation of the atpB-rbcL noncoding spacer region of the chloroplast DNA was used to reconstruct the phylogeography of Tetraena mongolica.T. mongolica (Zogophylaceae) is a relict species of a monotypic genus of in Inner Mongolia of China. It has been listed as seriously endangered plants that only distributed on the Ordos plateau of Inner Mongolic. The area is a refuge of many relict Asian Plants. Reproduction of T. mongolica is mainly by seed but a reproduction is anther way under the stress. A total of 880 bp of the atpB-rbcL spacer of cpDNA was sequenced from 8 populations of T. Mongolic. According to the cpDNA data, the level of gene flow (Nm:0.04-2.01), and population differentiation (Fst:0.199-0.895) were indicated, and the “isolation by distance” model was not supported (R2 =0.0024). Based on minimum spanning network and nested clade analysis, the past fragmentation is the main phylogeographic factor affecting the population structure of T. mongolica .We suggested the deluges of Yellow River and isolation of Gianlishan Mountain cased the population fragmentation of T. mongolica.
Keywords: phylogeography, Tetraena mongolica, gene flow, population
differentiation, nested clade analysis, past fragmentation
39
陳婉玲. "Phylogenetic relationships of soybean accession by the nucleotide sequences variation of the chloroplast atpB-rbcL noncoding region and ITS1 of nuclear ribosomal DNA." Thesis, 2006. http://ndltd.ncl.edu.tw/handle/30193003253003650097.
Full textAbstract:
碩士<br>國立嘉義大學<br>園藝學系研究所<br>94<br>Soybean, Glycine max（L.） Merrill, is an annual crop and belongs to Leguminosae Glycine. The genus Glycine consists of the subgenera Soja and Glycine. The subgenus Soja consists of G. max, cultivated soybean, and its wild G. soja. In order to enhance the competition ability in the market of vegetable soybean, new cultivars developed by breeders are needed. It will be a great contribution to many breeders. The objective of this study was to utilize atpB-rbcL sequences and DGGE of rDNA ITS1 to evaluate the genetic diversity among 53 soybean accessions collected from Taiwan. 53 soybean accessions which included vegetable soybean, black soybean, Chia bean (brown vegetable soybean), manure soybean and wild soybean(G. soja) were collected from Tainan District Agricultural Improvement Stations (Tainan DAIS), KaoHsiung District Agricultural Improvement Stations (KaoHsiung DAIS), Asian Vegetable Research Development Center (AVRDC) and National Chiayi University (NCYU). From nucleotide sequences of the atpB-rbcL noncoding spacer of cpDNA, we detected an insertion A base at 541 sites in the Taisyoshiromo, #2808 and AGS292, out of 53 soybean accessions. In contrast to insertion, nucleotide sequences of the atpB-rbcL noncoding spacer have no differentiation among all accessions of G. soja and G. max. AGS292 was acclimated from the Taisyoshiromo at the KDAIS and AVRDC in 1987. It shown that AGS292 derived monophyletically from Taisyoshiromo according to the atpB-rbcL noncoding sequences. No difference of atpB-rbcL sequence found among other G. soja and G. max. Primer pair DNITS1 (5’- GAAGGATCATTGTCGATGCCT - 3’) and NITS2 (5’ - GCTTAAA CTCAGCGGGTAGC - 3’) was design from ITS1 - 5.8S - ITS2 of ribosomal in soybean, and 40 bases of GC clamp joint to the 5’-end of DNITS1 primer. PCR products were analysed using denaturing gradient gel electrophoresis (DGGE). All soybean accessions display the 625 bp fragment by PCR amplification. Following PCR with DNITS1/DNITS2 (5’ – CAGATTTCAACCAACCACGAG – 3’) primer pair, a product about 480 bp can be amplified from all soybean accessions. PCR products digested with ClaI and two fragments of 260 and 220 bp can be detected. Fifty-three accessions can be divided into tree groups based on gel display by their migration rate following DGGE.
40
Capela, Mariana Lopes da Cruz. "Doença de Menkes : um caso clínico e revisão teórica." Master's thesis, 2015. http://hdl.handle.net/10451/25861.
Full textAbstract:
Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2015<br>Doença de Menkes é uma doença do metabolismo do cobre rara e fatal, causada por diversas mutações numa proteína transportadora de cobre, a ATP7A. Tem hereditarie-dade ligada ao X, mas estima-se que um terço dos casos sejam de mutação de novo e um caso de mosaicismo gonadal já foi descrito. Este defeito genético causa uma deficiência sistémica de cobre devido a uma reduzida absorção deste elemento no intestino delgado, bem como uma má distribuição pelo restante organismo. A actividade reduzida de vari-adas cuproenzimas condicionam uma multiplicidade de sintomas. Indivíduos afectados apresentam-se sem sintomas na altura do nascimento, mas por volta dos 2-3 meses de idade desenvolvem sintomas neurodegenerativos e manifestações do tecido conjuntivo, com um quadro clínico caracterizado por regressão do desenvolvimento psicomotor, hipotonia, convulsões, má progressão estaturo-ponderal e alterações do cabelo. Adicio-nalmente, podem apresentar divertículos da bexiga, pólipos gastrointestinais e altera-ções ósseas.
Tratamento precoce com cobre parentérico tem demonstrado melhoria na sobrevivência, redução das crises epilépticas, e nalguns casos, normalização do neurodesenvolvimento, se iniciado uns dias após o nascimento. Contudo, a detecção pré-sintomática é difícil porque os recém-nascidos afectados não apresentam anormalidades clínicas, ou, se exis-tem, são muito subtis.
Este artigo procura expor e relatar um caso clínico de Doença de Menkes, adquirido por mosaicismo gonadal, acompanhado de uma pequena revisão teórica e descrição e diag-nósticos diferenciais a ponderar.<br>Menkes disease is a rare and fatal disease of copper metabolism caused by multiple mu-tations in a copper transporting protein, ATP7A. It is an X-linked genetic disease but it has been estimated that one-third of cases arise from de novo mutations and one case of germline mosaicism has been reported. This genetic defect causes a systemic copper deficiency due to poor absorption of this trace element in the small intestine and a de-fective distribution within the body. The reduced activity of a range of copper depend-ent enzymes leads to variable symptoms. Affected individuals appear normal at birth but at 2-3 months of age develop neurodegenerative symptoms and connective tissue manifestations, characterized by loss of previously obtained developmental milestones and the onset of hypotonia, seizures, failure to thrive and hair abnormalities. Additional features can include bladder diverticula, gastrointestinal polyps and bone abnormalities.
Early treatment with copper injections has shown to enhance survival, reduce seizures, and, in some cases, normalize neurodevelopment outcomes, if initiated within days after birth. However, presymptomatic detection is difficult because clinical abnormalities in affected newborns are absent or subtle.
This article aims to report a clinical case of germline mosaicism Menkes Disease with a short review of the literature.
41
Nandagopal, Neethi. "Identification of copper metabolism as a KRAS-specific vulnerability in colorectal cancer." Thesis, 2020. http://hdl.handle.net/1866/25272.
Full textAbstract:
KRAS est parmi les gènes les plus fréquemment mutés dans les cancers humains, tel que ~ 45% des cancers colorectaux (CCR). Malgré les efforts déployés pour réduire son potentiel oncogénique, KRAS muté est fréquemment associé à la résistance aux médicaments et est extrêmement difficile à cibler sur le plan thérapeutique. Les protéines à la surface cellulaire sont souvent dérégulées dans les cancers et sont des cibles thérapeutiques attrayantes en raison de leur accessibilité aux anticorps. Nous avons séquençé les ARNm de cellules épithéliales intestinales exprimant KRAS muté et observé que ces dernières présentaient des changements importants dans les gènes codant pour des protéines de surface cellulaire. Par conséquent, notre objectif était d'identifier de nouvelles cibles thérapeutiques exprimées à la surface de cellules transformées par l’oncogène KRAS. En utilisant une approche de pointe en protéomique de surface cellulaire, nous avons identifié plusieurs protéines différentiellement exprimées dans les cellules avec KRAS muté par rapport à leurs homologues de type sauvage. Nous avons ensuite effectué un crible CRISPR/Cas9 basé sur les protéines de surface cellulaire, qui a révélé que la perte de la protéine Atp7a affectait de manière différentielle les cellules épithéliales intestinales, en fonction de leur statut KRAS. De façon intéressante, nous avons constaté que ATP7A était régulé à la hausse dans les cellules avec KRAS muté par rapport à leurs homologues de type sauvage. ATP7A a un double rôle dans les cellules; alors qu'il est essentiel pour la maturation des enzymes dépendantes du cuivre (Cu), ATP7A protège les cellules d'une toxicité excessive induite par le Cu (cuproptose). Chez l'homme, les mutations dans ATP7A entraînent des troubles caractérisés par des déficiences systémiques dans le transport et les niveaux de Cu. Chez les animaux et dans les modèles de culture cellulaire, tel que les cellules épithéliales intestinales, les niveaux intracellulaires de Cu sont directement corrélés avec l'abondance post-transcriptionnelle d'ATP7A. Dans le même ordre d'idées, nous avons observé que les cellules de CCR avec KRAS muté avaient relativement plus de Cu intracellulaire, et la surexpression d'ATP7A protégeait les cellules KRAS muté de la cuproptose, par rapport à leurs homologues de type sauvage. Nous avons également observé que la croissance in vivo des xénogreffes KRAS mutées était réduite lorsque les souris étaient nourries avec un régime pauvre en Cu. Le Cu est utilisé par plusieurs enzymes qui régulent des fonctions cellulaires critiques, notamment la respiration mitochondriale, la motilité cellulaire et la prolifération. Nous montrons que les cellules mutantes KRAS étaient plus sensibles au chélateur de Cu, ammonium tetrathiomolybdate (TTM), par rapport aux cellules de type sauvage. De plus, les cellules avec KRAS muté traitées avec le TTM ont présenté des activités réduites de MEK1/2 dépendant du Cu et de l'enzyme de la chaîne de transport d'électrons mitochondriale, cytochrome c oxidase (CCO). Nous avons été surpris de constater que le transporteur de Cu de haute affinité, CTR1, est régulé à la baisse dans les cellules avec KRAS muté, et avons donc émis l'hypothèse que les cellules KRAS mutées doivent absorber le Cu par d'autres moyens. Ainsi, nous avons constaté que la macropinocytose agit comme une voie non canonique d'approvisionnement en Cu dans les cellules avec KRAS muté. Le traitement de cellules in vivo avec l'inhibiteur de la macropinocytose, EIPA, a inhibé l'expression d'ATP7A et diminué le Cu biodisponible dans les xénogreffes KRAS mutées. En conclusion, nos résultats montrent que les cellules avec KRAS muté augmentent les niveaux de Cu et d'ATP7A pour soutenir la tumorigenèse en augmentant l'activité cuproenzymatique et diminuant la cuproptose. Cette étude est pertinente pour le cancer, car les tissus tumoraux contiennent fréquemment des niveaux de Cu plus élevés que les tissus normaux. Des études récentes ont mis en évidence un potentiel de repositionnement du chélateur de Cu TTM, qui est disponible en clinique et utilisé pour traiter les troubles du Cu. Nos résultats démontrent que la biodisponibilité du Cu pourrait être exploitée pour traiter le CCR avec KRAS muté avec de tels inhibiteurs. Les travaux futurs comprennent l'identification de stratégies combinatoires qui peuvent être améliorer les effets anti-cancéreux de la chélation du Cu.<br>KRAS is amongst the most frequently mutated genes driving human cancers, including ~ 45% of colorectal cancers (CRC). Despite intense efforts to curb its oncogenic potential, mutant KRAS is frequently associated with drug resistance and is extremely challenging to target therapeutically. Cell-surface proteins are often spatially dysregulated in cancers and are attractive therapeutic targets due to their easy accessibility. We performed RNA sequencing of mutant KRAS-expressing intestinal epithelial cells and observed that cells undergoing transformation exhibited dramatic changes in cell surface-coding genes. Therefore, our goal was to identify novel druggable targets expressed at the cell surface of mutant KRAS-transformed cells. Using a cutting-edge cell surface proteomics approach, we identified several differentially expressed proteins at the surface of KRAS-mutant cells compared to wild-type counterparts. We then performed a cell surface based CRISPR/Cas9 screen, which revealed that loss of the copper exporter Atp7a differentially affected the fitness of intestinal epithelial cells, depending on their KRAS status. Interestingly, we found that ATP7A was upregulated in KRAS-mutant cells compared to wild-type counterparts. ATP7A has a dual role in cells; while it is essential for maturation of copper (Cu)-dependent enzymes, ATP7A protects cells from excess Cu-induced toxicity (cuproptosis). In humans, ATP7A mutations result in disorders characterized by systemic deficiencies in Cu transport and levels. In animals and in tissue culture models, including intestinal epithelial cells, intracellular Cu levels are directly correlated with the post-transcriptional abundance of ATP7A. In line with this, we observed that KRAS-mutant CRC cells and tissues had relatively more intracellular Cu, and ATP7A-overexpression protected KRAS-mutant cells from cuproptosis, compared to wild-type counterparts. We also observed that in vivo growth of KRAS-mutant xenografts was reduced when mice were fed a Cu-deficient diet. Cu is utilized by several enzymes that regulate critical cellular functions including mitochondrial respiration, cell motility and proliferation. We show that KRAS-mutant cells were more sensitive to the Cu chelating drug ammonium tetrathiomolybdate (TTM), compared to wild-type cells. Moreover, TTM-treated KRAS-mutant cells displayed reduced activities of Cu-dependent MEK1/2 and mitochondrial electron transport chain enzyme, cytochrome c oxidase (CCO). We were surprised to find that the high-affinity CTR1 importer is downregulated in KRAS-mutant cells, and so we hypothesized that KRAS cells must uptake Cu through alternate means. In accordance with this, we found that macropinocytosis acts as a non-canonical Cu-supply route in KRAS-mutant cells. In vivo, treating cells with the macropinocytosis inhibitor EIPA, inhibited the expression of ATP7A and decreased bioavailable Cu in KRAS xenografts. In conclusion, our results show that KRAS-mutant cells increase Cu and ATP7A levels, likely to support tumorigenesis by elevating cuproenzymatic activity and parallelly dealing with cuproptosis. This study is relevant to cancer as tumor tissues and patients contain higher Cu levels than normal controls. Recent studies have highlighted a potential for repurposing the clinically available copper chelator TTM, which is used to treat Cu disorders. Our results demonstrate that copper bioavailability could be exploited to treat KRAS-mutated CRC with such inhibitors. Future work includes identification of combinatorial strategies that may be synthetic lethal to copper chelation.