To see the other types of publications on this topic, follow the link: Austin Post.
Journal articles on the topic 'Austin Post'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Austin Post.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Anonymous. "Austin Post receives Hubley Award." Eos, Transactions American Geophysical Union 72, no. 33 (1991): 348. http://dx.doi.org/10.1029/90eo10272.
Full text
2
Amith, Naragund, and Mudhol RS. "Autologous incus versus titanium partial ossicular replacement prosthesis in reconstruction of Austin type A ossicular defects: a prospective randomised clinical trial." Journal of Laryngology & Otology 131, no. 5 (2017): 391–98. http://dx.doi.org/10.1017/s0022215117000251.
Full textAbstract:
AbstractObjective:This study aimed to compare the functional and anatomical outcomes of ossiculoplasty using an autograft incus or a titanium partial ossicular replacement prosthesis for reconstructing Austin type A ossicular defects.Methods:Patients with Austin A ossicular defects were randomly divided into two groups: one group underwent ossiculoplasty with an autologous incus (the autologous incus group) and the other underwent ossiculoplasty with a titanium partial ossicular replacement prosthesis (the titanium prosthesis group). Otoscopic examination and audiological assessment was done pre-operatively and at 3, 6 and 12 months post-operatively.Results:A post-operative average air–bone gap closure of less than 20 dB was seen in 13 patients (65 per cent) in the autologous incus group and 7 (35 per cent) in the titanium prosthesis group. There were fewer post-operative complications in the autologous incus group (20 per cent) than in the titanium prosthesis group (45 per cent).Conclusion:Hearing outcomes and graft take up after ossiculoplasty were significantly better when an autologous incus rather than a titanium partial ossicular replacement prosthesis was used to reconstruct Austin type A ossicular defects. The major disadvantages of the titanium prosthesis were unpredictable results and more post-operative complications.
3
Dawadi, Tej P., TR Bhatta, B. Gyawali, BR Adhikari, and SK Giri. "Functional outcome of Austin Moore Hemire Placement Arthroplasty in Fracture Neck of Femur in elderly." Journal of Manmohan Memorial Institute of Health Sciences 3, no. 1 (2018): 6–15. http://dx.doi.org/10.3126/jmmihs.v3i1.19174.
Full textAbstract:
Objective: To study the outcome of Austin Moore Hemireplacement Arthroplasty in terms of Harris Hip Score and Mobility and Aid Score in fracture neck of femur in elderly.Design: A prospective randomized study carried out between September 2011 to August 2012 AD.Methods: We performed 30 Austin Moore hemiarthroplasties in patients aged 65 and above that sustained a displaced femoral neck fracture and evaluated the outcome in terms of Harris Hip Score and Mobility and Aid Score.Results: Mean HHS at 2 week was 63.93 which increased to 73.83, 80.53 and 86.48 at 6 weeks, 12 weeks and 6 months respectively with overall excellent to good result of 60%. The mean MASM at 6 months was 4.0 whereas the pre-injury MASM was 4.53.Conclusion: Hemiarthroplasty with Austin Moore Prosthesis is safe and effective method of treatment for displaced fracture neck of femur in elderly. There was early post-operative full weight bearing mobilization with reduction in major complications. The operative duration, post-operative complicationsare comparable to other similar studies done elsewhere. The end functional results also depend on the associated comorbidities and optimum post op rehabilitation.Journal of Manmohan Memorial Institute of Health SciencesVol. 3, No. 1, 2017, page: 6-15
4
Calabria, Lalita M., and Tom J. Mabry. "Tom J. Mabry's Natural Products Chemistry Program: 1960–2007." Natural Product Communications 2, no. 10 (2007): 1934578X0700201. http://dx.doi.org/10.1177/1934578x0700201001.
Full textAbstract:
This paper presents an overview of Dr. Mabry's accomplishments in his career as a natural product chemist, first at the University of Zürich as a post-doctoral fellow, and from 1962, as a faculty member at the University of Texas at Austin in the Department of Botany until the late 1990s, when the Biological Sciences programs at UT-Austin were completely reorganized. From then until his retirement in 2006, he was a member of the Molecular Cell and Developmental Biology faculty.
5
Bucknor, Michael A. "Austin Clarke’s “Saga Boys”: Black Aesthetics as Epistemology?" TOPIA: Canadian Journal of Cultural Studies 42 (May 2021): 76–95. http://dx.doi.org/10.3138/topia-42-007.
Full textAbstract:
Austin Clarke in Nine Men Who Laughed and Ebony Patterson in her Gangstas for Life series both inspire an investigation of the way in which the “Black dandy” is an index of Black aesthetics as epistemology. Via a dialogue between Clarke’s Black male dandies of the post 1960s Toronto in his short stories and Patterson’s visualizations of the post 1980s dancehall dandies in Kingston, this article argues that Afro-Caribbean invocations of the Black dandy is more than fashion statement; it is epistemological stance. I am deliberately tracing a connection between dancehall dandies and Clarke’s saga boys in order to first show the legacy and consonance of Clarke’s work in Black epistemological thought as well as to indicate the trans-historical reach of the unfinished re-humanization project for Black subjects.
6
Bowyer, Andrew D. "Moral Philosophy after Austin and Wittgenstein: Stanley Cavell and Donald MacKinnon." Studies in Christian Ethics 31, no. 1 (2017): 49–64. http://dx.doi.org/10.1177/0953946817737927.
Full textAbstract:
There are broad commonalities between the projects of Donald MacKinnon (1913–1994) and Stanley Cavell (1926–) sufficient to make the claim that they struck an analogous pose in their respective contexts. This is not to discount their manifest differences. In the milieu of 1960s and 1970s Cambridge, MacKinnon argued in support of a qualified language of metaphysics in the service of a renewed catholic humanism and Christian socialism. At Harvard, Cavell articulated commitments that made him more at home in the world of North American secular political liberalism. Where Nietzsche, Hume, Freud, Heidegger, Emerson and Thoreau were Cavell’s inspirations, Butler, Kant, G. E. Moore, Collingwood and the New Testament were MacKinnon’s. For all the stark differences, commonalities abound and the reason for this can be traced to a shared appreciation of Austin’s contribution to the ‘lingusitic turn’ together with Wittgenstein’s later work. They both developed projects obsessed with the problem of scepticism together with a commitment to a creative re-animation of moral discourse in light of it, with MacKinnon defending a qualified ‘moral realism’, and Cavell, ‘moral perfectionism’. Seen together, a distinctive post-Kantian and post-Wittgensteinian therapeutic moral philosophy is in evidence.
7
Ausich, William, George Sevastopulo, and Hugh Torrens. "Middle Nineteenth-Century Crinoid Studies Of Thomas Austin, Sr. And Thomas Austin, Jr.: Newly Discovered Unpublished Materials." Earth Sciences History 18, no. 2 (1999): 180–97. http://dx.doi.org/10.17704/eshi.18.2.6725415871253142.
Full textAbstract:
Thomas Austin, Sr. (1794-1881) and to a lesser extent his son Thomas Austin, Jr. (1817-before 1881) are recognized as important early students of both Carboniferous and Jurassic crinoids. However, the extent of their understanding of crinoids was not appreciated until the recent discovery of unpublished materials of Austin, Sr., including a manuscript dated 1855, plates indicating the intended continuation of their never finished 1843-1849 systematic monograph, and photographs of fossil crinoids.Within at most three and one-half decades after Johann Samuel Miller (1779-1830) first named the class Crinoidea in 1821, Austin, Sr. accurately summarized the broad outline of crinoid evolutionary history. Furthermore, Austin had a post-natural-historical interpretation of fossil crinoids. Fossil crinoids were not just ancient organisms to be described and classified, but Austin tried to interpret the biology of these fossils. Furthermore, he considered questions of taphonomy, functional morphology, paleoecology, processes controlling evolutionary trends, and crinoid deposits—still topics of interest to paleobiologists 150 years later; and he also discussed crinoid "evolution" and extinction. Other discussion is present on the history of crinoid studies from a middle-1800's perspective and on the superstitious and medicinal uses of crinoid fossils.But fain Saint Hilda's nuns would learn If, on a rock by Lindisfarne, Saint Cuthbert sits, and toils to frame The sea-born beads that bear his name: Such tales had Whitby's fishers told, And said they might his shape behold, And hear his anvil sound; A deaden'd clang,-a huge dim form Seen but, and heard, when gathering storm And night were closing round. But this, as tale of idle fame, The nuns of Lindisfarne disclaim.
8
Düzenli, U., and A. F. Kıroğlu. "Manubrio-incudo-stapedioplasty for reconstruction of Austin–Kartush type B ossicular defects." Journal of Laryngology & Otology 133, no. 06 (2019): 457–61. http://dx.doi.org/10.1017/s0022215119000999.
Full textAbstract:
AbstractObjectiveManubrio-incudo-stapedioplasty functional outcomes were compared to those of other methods for reconstructing Austin–Kartush type B ossicular defects.MethodsForty-two patients underwent Austin–Kartush type B ossicular defect reconstruction using: manubrio-incudo-stapedioplasty (13 patients), an autologous incus (19 patients) or a titanium ossicular replacement prosthesis (10 patients). For manubrio-incudo-stapedioplasty reconstruction, the malleus head was removed, the manubrium was relocated posteriorly and the incus short process was placed on the mobile footplate. The manubrium was placed on the incus body groove and bone cement was applied to stabilise the manubrium–incus junction. Pre- and post-operative hearing thresholds were assessed.ResultsThe air–bone gap decreased from 25.9 ± 6.0 dB to 12.3 ± 5.0 dB (p< 0.05) in the manubrio-incudo-stapedioplasty group. The hearing gain was 13.6 ± 5.2 dB for manubrio-incudo-stapedioplasty, 3.4 ± 14.2 dB with the autologous incus, and 3.3 ± 11.07 dB with the titanium ossicular replacement prosthesis. Hearing improvement was greater for manubrio-incudo-stapedioplasty compared to the other reconstruction methods (p< 0.05).ConclusionManubrio-incudo-stapedioplasty resulted in satisfactory hearing outcomes in patients with Austin–Kartush type B ossicular defects. This technique can be considered a stable, inexpensive and effective method to reconstruct Austin–Kartush type B ossicular defects.
9
Kernozek, Thomas W., and Steven A. Sterriker. "Chevron (Austin) Distal Metatarsal Osteotomy for Hallux Valgus: Comparison of Pre- and Post-Surgical Characteristics." Foot & Ankle International 23, no. 6 (2002): 503–8. http://dx.doi.org/10.1177/107110070202300606.
Full textAbstract:
The purpose of the study was to compare the range of motion, perceived pain and plantar loading characteristics of the Chevron (Austin) corrective procedures in treating hallux valgus (HV) 12 months postsurgically. Twenty-five female participants with the diagnosis of mild to moderate HV deformity were studied. All participants had a distal metatarsal osteotomy (Chevron (Austin)) to correct their deformity. First metatarsophalangeal and talocrural joint range of motion (ROM) and a 10-point analog pain scale were measured presurgically and 12 months post-surgically on each participant. Radiographic measures of hallux valgus and intermetatarsal (IM) angles were taken preoperatively and six weeks postoperatively for comparison. Five pressure distribution measurements were recorded of barefoot walking using the EMED-SF presurgically and 12 months postsurgically. Statistical analyses revealed that plantar loading is still altered 12 months postsurgically despite a decrease in perceived pain and adequate first metatarsophalangeal joint ROM. Greater loading occurred in the central forefoot (CFF) region with decreases in some of the loading parameters in the medial toe (MT) region postsurgically. Loading parameters in the lateral forefoot (LFF), heel (HL), midfoot (MF), and lateral toe (LT) were unchanged 12 months postsurgery compared to presurgery.
10
Das, Deepthy, Gurumani Sriraman, and Valli Rajasekaran. "Establishment of significant improvement of hearing post-surgery for mucosal type of chronic suppurative otitis media." International Journal of Otorhinolaryngology and Head and Neck Surgery 6, no. 5 (2020): 1016. http://dx.doi.org/10.18203/issn.2454-5929.ijohns20201708.
Full textAbstract:
<p>Chronic suppurative otitis media occurs in the population as a common disease among people living in low socio-economic status. The associated complaints such as hearing difficulty, irritation, discharge makes it difficult for the people to carry out their daily activities. Therefore, their immediate need for treatment occurs. This review aims at analysing the post-operative outcome of hearing following tympanoplasty in order to overcome their morbidity. The source of this study has been obtained from Pubmed, Google scholar and EMBASE. The material for this review was selected from a reference published between January 1975 to December 2014, with this analysis was made. The pre-op ABG in the studies were all falling in mild to moderate hearing loss according to WHO classification of hearing loss. The patients were grouped in Austin-Kartush criteria, groups A to E. The Austin-Kartush classification group A had 3 studies included. The mean ABG for each were 11.5,8.3 and 13.5. In group B,3studies were included. The mean ABG for each were 11.9,10.9 and 11.1. Group C had 4 studies. The mean ABG were 17.7,15,17.1 and 15.7. Group D had 4 studies included which had the same mean ABG 16.6. Group E had just 1 study of mean ABG 20.1. This review helped to establish that there was significant improvement in hearing post-surgery, in patients with varying degrees of hearing loss.</p>
11
Griffin, Paula. "Celebrating 20 Years of Outdoor Environmental Education for Preservice Teachers at Stephen F. Austin State University." Journal of Forestry 117, no. 4 (2019): 365–69. http://dx.doi.org/10.1093/jofore/fvz029.
Full textAbstract:
Abstract Preservice teachers at Stephen F. Austin State University have been involved in a 20-year environmental education initiative as a part of the teacher education program. Since 1998, teacher educators and community stakeholders have collaborated with Texas Project Learning Tree to train preservice teachers in environmental education activities to be implemented in the yearly outdoor science education event, Bugs, Bees, Butterflies, and Blossoms. Held on the Stephen F. Austin State University campus, area elementary school students participate in learning stations designed to facilitate investigative inquiry led by preservice teachers. A mixed methods study was implemented to evaluate the overall effectiveness. Data were collected from pre- and post-tests from traditional face-to-face and online preservice teachers. Results showed significant gains in science content knowledge and science teaching efficacy. Open-ended responses submitted by participants in the study addressed self-reflection about personal teacher identity and the overall impact of the initiative.
12
Hollings, James. "REVIEW: Valuable overview of global journalism." Pacific Journalism Review : Te Koakoa 23, no. 2 (2017): 226–27. http://dx.doi.org/10.24135/pjr.v23i2.346.
Full textAbstract:
Global Journalism Education In the 21st Century: Challenges and Innovations, edited by Robyn S. Goodman and Elanie Steyn. Austin, TX: Knight Center for Journalism in the Americas, University of Texas. 2017. 468 pages. ISBN 978-1-58790-388-5IN THE post-truth, fake news world, journalism education has never been more necessary; not only educators, but journalists and journalism academics are grappling with what to teach, how to teach it, when and where.
13
Donnor, Jamel K. "Lies, Myths, Stock Stories, and Other Tropes." Urban Education 51, no. 3 (2016): 343–60. http://dx.doi.org/10.1177/0042085916628613.
Full textAbstract:
Despite being academically unqualified for admission to the University of Texas at Austin, Abigail Fisher, a White female, argued that she was not admitted due to the university’s diversity policy. In addition to framing post-secondary admissions as a zero-sum phenomenon, Ms. Fisher intentionally framed students of color who are admitted to the University of Texas at Austin as academically unqualified. The purpose of this article is to examine Ms. Fisher’s arguments against the University of Texas’s diversity policy as presented in Fisher v. University of Texas from a critical race theoretical perspective. In addition to obfuscating the fact that admission to the top colleges and universities in the United States has become more competitive, Ms. Fisher’s anti-diversity arguments also are consistent with a racial ideology and socially conservative agenda that frames people of color as undeserving of the opportunities traditionally associated with White people. The goal of this article is to not only situate Fisher v. University of Texas as a strategic project of Whiteness, but to also discuss what critical race theory can still teach scholars and researchers concerned with understanding race in education.
14
Manzoor, Basharat, Shehzad Mehmood, and M. Javed Iqbal. "FEMORAL NECK FRACTURE." Professional Medical Journal 25, no. 12 (2018): 1805–8. http://dx.doi.org/10.29309/tpmj/18.4530.
Full textAbstract:
Femoral neck fracture is common in the elderly, with only 2-3% found in patient younger than 50 years. Osteoprosis & co-mordities increase the incidence of their fractures. Non-Operative treatment is indicated only is unfit or non-ambulatory patients age, general health status and Socio economic condition of patients along with availability of facilities are important to select the treatment modality. There are many operative treatment options, prosthetic replacement with Austin Moore prosthesis (AMP) is one of the treatment option in this age group. Post Operative complications are thigh pain, hip dislocation & infection. Objectives: To determine the results of Austin moore prosthesis in fracture neck of femur in elderly patients in terms of mid-thigh pain. Study Design: Descriptive Case series & setting in Orthopedic Department Allied Hospital Faisalabad. Period: Study Period is from April 2008 to August 2010. Setting: All the cases done in Orthopedic department Allied & DHQ Hospital Faisalabad. Methods: All the patients were evaluated in emergency department of Orthopedics as per ATLS protocol and diagnose by obtaining X-Rays pelvis with both Hip Joints and were operated by consultant through moore’s approach Head of Femur was removed and replaced by Austinmoor’s prosthesis of appropriate size. In all cases one dose of prophylactic broad spectrum antibiotic were giving. Results: 56 Patients (31 males 55.4% + 25 female 44.6) with mean age 73.08 +8.13 are Included in the criteria and were operated with same implant. After 2 monthspost operatively 40 Patients had no pain 07 (12.5%) had mild (71.4%). Pain & 08 Patients 14.3 % had moderate pain. After 03 month post operatively 43 Patients (78.2%) had no pain, 02 (3.6%) had mil, 08 Patients (14.5%) moderate and 01(1.8%) had scene. Conclusion: Prosthetic replacement with AMP is one of the treatment options in femoral neck fracture.
15
Mitchell, DA, N. Crawford, BJ Newham, and JR Newton. "The efficacy, safety and acceptability of emergency embedded Psychiatry Assessment and Planning Units: An evaluation of Psychiatry Assessment and Planning Units in close proximity to their associated emergency departments." Australian & New Zealand Journal of Psychiatry 54, no. 6 (2020): 609–19. http://dx.doi.org/10.1177/0004867419899717.
Full textAbstract:
Objective: To determine the efficacy, safety and acceptability as well as the patient demographics of three newly developed emergency department–embedded Psychiatric Assessment and Planning Units located in Metropolitan Melbourne at Austin, Peninsula and Eastern Health Services. Methods: The evaluation reviewed a 12-month period of service activity from 1 September 2017 to 31 August 2018, when all three Psychiatric Assessment and Planning Units services were operational. A 12-month period from 1 September 2014 to 31 August 2015 was compared as the pre-Psychiatric Assessment and Planning Units period. Mixed qualitative and quantitative methods were used. This included semi-structured interviews of 30 Psychiatric Assessment and Planning Units patients and 30 emergency department staff (10 of each for all 3 sites), patient survey, statistical analysis of Client Management Interface data for the emergency department and related Psychiatric Assessment and Planning Units as well as audit of RISKMAN registers. Results: There were 365 Austin, 567 Eastern and 791 Peninsula Psychiatric Assessment and Planning Units admissions. Psychiatric Assessment and Planning Units were generally well accepted by patients and emergency department staff, relatively safe, operating within the Key Performance Indicators with mixed effect on emergency department flow. Austin emergency department processing times improved post-Psychiatric Assessment and Planning Units (4 hours 57 minutes to 4 hours 19 minutes; p < 0.001) while deteriorating at Eastern and Peninsula. Adjustment Disorder and Depression and Borderline Personality Disorder were the most common admission diagnoses. While the Psychiatric Assessment and Planning Units had mixed utility on emergency department processing times, they appear to serve a demographic not previously accommodated in traditional emergency department psychiatry models. Conclusion: The emergency department–embedded Psychiatric Assessment and Planning Unit model of care appears effective on some measures, safe and acceptable to patients and staff. The Psychiatric Assessment and Planning Units seem to service a group not previously accommodated in traditional emergency psychiatry models.
16
Nolutshungu, Sam C. "Beyond the gold standard?: the idea of a (post-apartheid) university." Journal of Modern African Studies 37, no. 3 (1999): 373–87. http://dx.doi.org/10.1017/s0022278x99003080.
Full textAbstract:
We cannot do better than Marcello Cecco's (1984: 1) concise definition of an international gold standard: it exists ‘when gold is the effective numeraire in most countries, and/or when the other means of payment used as monetary numeraire in those countries are readily redeemable in gold at their bearers' request’. Such a standard existed from the mid-1890s to 1914, even though Britain went on the gold standard much earlier than that, in 1816, and Germany a little over a half century later, in 1871. The Latin Union in Europe (France, Belgium, Switzerland and Italy) did not join effectively until 1900 (Mertens 1994). Many claims were, and are still made for the system: that it facilitated international trade by providing a uniform standard of value; and as an automatic adjustment system, it freed markets from the (nationalistic) interference of public authorities while it created price equalisation in traded goods and ensured, over a protracted period, price stability.The ‘Gold Standard’ in the title of this talk refers to the ‘academic gold standard’ invoked by Lord Ashby (1964; see also Austin 1980), one time Master of Clare College, Cambridge, a British educationist who was deeply involved with the development of universities in the later years of colonial rule in British West Africa. Although the University of the Witwatersrand and the city of Johannesburg owe a great deal to the gold industry, my talk is not about money or the metal's place in it. It is about the metaphorical ‘academic gold standard’.
17
Domínguez, Virginia R. "Erotic(izing) Cubans." New West Indian Guide / Nieuwe West-Indische Gids 70, no. 3-4 (1996): 283–90. http://dx.doi.org/10.1163/13822373-90002623.
Full textAbstract:
[First paragraph]Sugar's Secrets: Race and the Erotics of Cuban Nationalism. VERA M. KUTZINSKI. Charlottesville: University Press of Virginia, 1993. xvii + 287 pp. (Cloth US$ 40.00, Paper US$ 17.95)Life on the Hyphen: The Cuban-American Way. GUSTAVO PÉREZ FlRMAT. Austin: University of Texas Press, 1994. xii + 217 pp. (Cloth US$ 30.00, Paper US$ 12.95)When a country is subjected to as much external political and ideological scrutiny as Cuba in the post-Batista years, scholarly explorations of something other than its foreign policy, its political economy, and its human rights abuses provide a breath of fresh air. But I am struck by the other things Sugar's Secrets and Life on the Hyphen have in common and how suspicious I am of their commonalities.
18
Laghari, Muhammad Ayub, Muhammad Khan Pahore, Imran Khan Maher, and Muhammad Saeed Arain. "FEMORAL NECK FRACTURE;." Professional Medical Journal 21, no. 05 (2018): 874–78. http://dx.doi.org/10.29309/tpmj/2014.21.05.2560.
Full textAbstract:
Objective: Objective of this study determines the outcome of unipolarhemiarthoplasty in elderly patients with femoral neck fracture at Liaquat University HospitalHyderabad/ Jamshoro. Materials and methods: Total 50 elderly patients were included in thestudy with femoral neck fracture and all the cases were selected from accident, emergency andOPD. All the patients with the history of pregnancy, those patients who were unfit for anesthesia,malignancy, neurological deficits of lower extremity, rheumatoid arthritis and Parkinson’sdisease regarding with systemically disease were excluded from the study. All the patientsunder went surgical hemiarthoplasty treatment with Austin moor-femoral head prosthesia. In thelast all postoperative complications, functional outcome and mortality were noted on proforma.Results: Total 50 patients were included in the study. Mean age of this study was mean±SD64.98±4.13. Females were found in majority with male/ female ratio 1:1.27. Post operative painwas noted in the 50% of the cases and out of them severe pain was noted only in 4% of thecases. Superficial infection was seen in 4% of the cases and deep infection was not found inthe cases and death was occurred in 10% of the patients. On the outcome, excellent resultswere found in the 44.44% of the study participants, good and fair results were seen in 26.66%and 20% respectively, while poor results were seen in 8.88% of the patients. Conclusions: Itis concluded that unipolar hemiarthoplasty is of the reliable procedure by use of Austin-moorfemoral head prosthesia for the treatment of femoral neck fracture in elderly.
19
Naser, Mohd Abdul, Ritesh Pathak, and Ather Ahmad. "Superiority of fixed stem bipolar prosthesis over Austin Moore prosthetic in fracture neck femur." International Journal of Research in Orthopaedics 4, no. 4 (2018): 577. http://dx.doi.org/10.18203/issn.2455-4510.intjresorthop20182415.
Full textAbstract:
<p class="abstract"><strong>Background:</strong> Hemi arthroplastyis a better option in treatment of fracture neck femur as it eliminates avascular necrosis of femoral head and non-union. It allows immediate weight bearing to return elderly patients to activity which helps in avoiding complications of recumbency and inactivity. The decision to perform hemi arthroplasty using a unipolar or bipolar prosthesis is a controversial issue. Both the prosthesis can be used even in remote areas both are cost effectives, good results can be achieved by general orthopaedic surgeons and post-operatively, it can be well adapted by Indian population. This study was done to compare the efficiency of Austin Moore’s prosthesis (AMP) and bipolar prosthesis for the management of intra capsular fracture neck femur in elderly patients.</p><p class="abstract"><strong>Methods:</strong> Patient’s above 60 years with fracture neck of femur were included. In all total 140 patients were randomly allocated for treatment by either AMP or bipolar prosthesis, in the department of Orthopaedics, IIMSR Medical College, Badnapur, Jalna between March 2014 to March 2017. The patients were followed up at 6 weeks, 12 weeks, 6 months and 1year. Functional outcome was assessed and compared with modified Harris hip score.<strong></strong></p><p class="abstract"><strong>Results:</strong> Modified Harris hip score was better with bipolar group as compared to AMP group. Functional activities like use of public transport were better with bipolar group. Complications like acetabular erosion were rare in bipolar group as comparison to AMP group.</p><p class="abstract"><strong>Conclusions:</strong> Fixed stem bipolar prosthesis is a superior option as compared to Austin Moore’s prosthesis.</p>
20
Phillips, W. S., J. T. Rutledge, T. D. Fairbanks, T. L. Gardner, M. E. Miller, and B. K. Schuessler. "Reservoir Fracture Mapping using Microearthquakes: Austin Chalk, Giddings Field, TX and 76 Field, Clinton Co., KY." SPE Reservoir Evaluation & Engineering 1, no. 02 (1998): 114–21. http://dx.doi.org/10.2118/36651-pa.
Full textAbstract:
Abstract Patterns of microearthquakes detected downhole defined fracture orientation and extent in the Austin chalk, Giddings field, TX and the 76 field, Clinton Co., KY. We collected over 480 and 770 microearthquakes during hydraulic stimulation at two sites in the Austin chalk, and over 3200 during primary production in Clinton Co. Data were of high enough quality that 20%, 31% and 53% of the events could be located, respectively. Reflected waves constrained microearthquakes to the stimulated depths at the base of the Austin chalk. In plan view, microearthquakes defined elongate fracture zones extending from the stimulation wells parallel to the regional fracture trend. However, widths of the stimulated zones differed by a factor of five between the two Austin chalk sites, indicating a large difference in the population of ancillary fractures. Post-stimulation production was much higher from the wider zone. At Clinton Co., microearthquakes defined low-angle, reverse-fault fracture zones above and below a producing zone. Associations with depleted production intervals indicated the mapped fractures had been previously drained. Drilling showed that the fractures currently contain brine. The seismic behavior was consistent with poroelastic models that predicted slight increases in compressive stress above and below the drained volume. Introduction Microearthquakes often accompany reservoir stimulation and production. By collecting high-quality seismic data, the microearthquakes can be mapped, yielding potentially extensive and high-resolution information about the fracture system. Fracture maps can be used to plan infill and horizontal drilling, and to design and evaluate hydraulic stimulation and enhanced recovery, production operations in fracture-dominated oil and gas reservoirs. Borehole geophones at reservoir depths provide the high-quality data needed to determine microearthquake location patterns. But when special observation wells must be drilled, microseismic studies can be expensive. To demonstrate that high-quality data can be collected inexpensively, we deployed geophones in existing wells and developed techniques for analyzing data from the resulting, sparse array of instruments. We hope the demonstration of inexpensive and effective methods will result in the routine application of microearthquake techniques to study reservoir fracture systems. Methods currently applied to study fracture systems include tilt-meter surveys that give gross fracture characteristics, and borehole optical, acoustic or resistivity (formation microscanner) surveys that give detailed information along the borehole. More specialized methods include shear shadowing, coring or mineback experiments and anisotropy from surface seismics. While less detailed than borehole surveys, less convenient than surface measurements such as tiltmeter or seismic, and less directly interpretable than coring studies, the microseismic technique provides a combination of resolution, coverage and economy that is difficult to surpass with other methods. Downhole microseismic monitoring has been applied successfully to hydraulic-stimulation experiments in hot-dry-rock geothermal reservoirs at Fenton Hill, NM, the U.K., Japan and France. Tomography has been performed using these data indicating low-velocity process zones in the seismic region. Additional data processing defined planar features that represent individual joints that slipped. These experiments took place in hard, crystalline rock, through which elastic waves propagate efficiently.
21
Treviño Murphy, Laurel, Shelly Engelman, John L. Neff, and Shalene Jha. "The Native Bees of Texas: Evaluating the Benefits of a Public Engagement Course." Insects 12, no. 8 (2021): 702. http://dx.doi.org/10.3390/insects12080702.
Full textAbstract:
Declines in native bee communities due to forces of global change have become an increasing public concern. Despite this heightened interest, there are few publicly available courses on native bees, and little understanding of how participants might benefit from such courses. In October of 2018 and 2019, we taught the ‘Native Bees of Texas’ course to the public at The University of Texas at Austin Lady Bird Johnson Wildflower Center botanical gardens in an active learning environment with slide-based presentations, printed photo-illustrated resources, and direct insect observations. In this study, we evaluated course efficacy and learning outcomes with a pre/post-course test, a survey, and open-ended feedback, focused on quality improvement findings. Overall, participants’ test scores increased significantly, from 60% to 87% correct answers in 2018 and from 64% to 87% in 2019, with greater post-course differences in ecological knowledge than in identification skills. Post-course, the mean of participants’ bee knowledge self-ratings was 4.56 on a five-point scale. The mean of participants’ ratings of the degree to which they attained the course learning objectives was 4.43 on a five-point scale. Assessment results provided evidence that the course enriched participants’ knowledge of native bee ecology and conservation and gave participants a basic foundation in bee identification. This highlights the utility of systematic course evaluations in public engagement efforts related to biodiversity conservation.
22
Barrios, Roberto E. "From Strangers to Neighbors: Post‐Disaster Resettlement and Community Building in Honduras. RyanAlaniz. Austin: University of Texas Press, 2017. 196 pp." Journal of Latin American and Caribbean Anthropology 25, no. 3 (2020): 490–92. http://dx.doi.org/10.1111/jlca.12501.
Full text
23
Castedo, Sierra, and Nico Doorn. "Collegiate Recovery Programs and Treatment Providers: Supporting Outcomes, Not Admissions." Journal of Recovery Science 1, no. 2 (2018): 9. http://dx.doi.org/10.31886/jors.12.2018.26.
Full textAbstract:
Collegiate Recovery Programs (CRPs), rooted in slow-moving academic institutions, can be contrasted with relatively fast-moving private treatment entities, and this contrast has great potential for both conflict and mutual benefit. Conflict may arise from a misunderstanding about the role of CRPs in the continuum of care - frequently thought to be a referral source, when, in fact, they work best as a post-treatment resource, improving outcomes for students in recovery. Young adults are the fastest growing demographic seeking treatment for substance use disorders, and, because of this changing age profile, more treatment entities are seeking to serve young adults and coming into contact with CRPs. This presentation explores the nuances and ethical challenges facing those interactions and describes the benefits of collaboration when pursued thoughtfully. The experiences of a CRP and a sober living/IOP facility in Austin, Texas will also be presented as a framework for collaboration.
24
MacLean, Dan D., and D. Scott NeSmith. "Rabbiteye Blueberry Postharvest Fruit Quality and Stimulation of Ethylene Production by 1-Methylcyclopropene." HortScience 46, no. 9 (2011): 1278–81. http://dx.doi.org/10.21273/hortsci.46.9.1278.
Full textAbstract:
A postharvest 1-methylcyclopropene (1-MCP) treatment was evaluated for its ability to maintain firmness and delay the ripening of rabbiteye blueberries. Three cultivars, Austin, Brightwell, and Premier, were harvested by hand from the UGA Alapaha Blueberry Farm and treated overnight with 1 μL·L−1 1-MCP as field heat was being removed [0 to 1 °C, 90% to 95% relative humidity (RH)]. Fruit were evaluated for firmness, total soluble solids (TSS), total acidity (TA), ethylene production, and other quality attributes at 0, 1, and 2 weeks after harvest as well as 1 or 4 days post-removal evaluations at room temperature (≈21 °C). In general, the 1-MCP treatment resulted in the stimulation of ethylene production in all three cultivars but had minimal effect on TSS and TA content. Furthermore, the treatment resulted in an accelerated loss of firmness in ‘Brightwell’. The lack of inhibition of fruit ripening likely related to the fact that blueberries were harvested, and subsequently treated with 1-MCP, at a post-climacteric stage of development. Based on current results, more information is required regarding ethylene production during rabbiteye blueberry fruit maturation before establishing a 1-MCP treatment recommendation for use by the rabbiteye blueberry industry.
25
Tulsankar, Smita S., Anthony J. Cole, Marthe Monique Gagnon, and Ravi Fotedar. "Time spent in post-feeding activities including feed preference by different weight groups of marron (Cherax cainii, Austin 2002) under laboratory conditions." Applied Animal Behaviour Science 241 (August 2021): 105376. http://dx.doi.org/10.1016/j.applanim.2021.105376.
Full text
26
Costa, Conceição, Kathleen Tyner, Sara Henriques, and Carla Sousa. "Game Creation in Youth Media and Information Literacy Education." International Journal of Game-Based Learning 8, no. 2 (2018): 1–13. http://dx.doi.org/10.4018/ijgbl.2018040101.
Full textAbstract:
This article presents the preliminary findings of GamiLearning (2015-2018), a research project that aims to promote critical and participative dimensions of Media and Information Literacy (MIL) in children through the creation of digital games. The project presents an innovative approach by arguing that MIL can be promoted through the process of creation and development of videogames. Students ages 9 to 14 years old from Portugal and Austin, Texas (USA) participated in the study. which included an intervention at school, was based on a constructivist/project-based approach. Fieldwork was conducted at four schools and a MIL questionnaire was used, based in a theoretical framework, and were administered before and after the project's intervention. Results from the four schools indicate statistically significant differences between pre and post questionnaires, considering MIL skills in general, and in several groups of skills, namely Operational Skills, Editorial Skills, Digital Identity Management Skills, Critical Media Literacy, Learning and Social Interaction.
27
BAUER, Thomas, Simon MARMOR, Idir GHOUT, et al. "Multiplex Antibody Measurement for Post-treatment Follow-up of Staphylococcal Prosthetic Joint Infection: A Diagnostic Pilot Study." Journal of Bone and Joint Infection 4, no. 5 (2019): 227–33. http://dx.doi.org/10.7150/jbji.36015.
Full textAbstract:
Abstract. Introduction: Multiplex-antibody detection has been recently proposed for the noninvasive diagnosis of staphylococcal prosthetic joint infection (PJI). We evaluated this approach for the post-treatment follow-up of patients.Methods: Nineteen cases of staphylococcal PJI were prospectively followed for one year after treatment. The IgG response against eight staphylococcal antigens was measured before surgery and one year post-surgery using Luminex technology (Austin, TX, USA); median fluorescence intensity values determined for each antigen were transformed into a “Total Response Index” (TRI).Results: Patients (11 women/8 men) had a mean (SD) age of 72.2 (12.4) years. Site of prosthesis was the knee (n=10), the hip (n=8) and the shoulder (n=1). Ten patients were infected by S. epidermidis, six by S. aureus, and three by S. lugdunensis. TRI values at one year were significantly lower than pre-surgery values (mean [SD]: 5.9 [1.8] versus 8.1 [3.4], p=0.02) and decreased, on average, by 21.2%. TRI values markedly increased in two patients. One patient had a relapse of S. aureus PJI at five months post-surgery, with a 37% increase of the TRI. The other had septic failure three months after revision for S. lugdunensis PJI; all intraoperative samples remained culture-negative, but the TRI increased by 51% and the antibody profile showed a marked change, suggesting a reinfection with another staphylococcal species.Conclusion: Multiplex-antibody measurement may be useful for the follow-up of staphylococcal PJI and may help to detect septic failure involving organisms targeted by the assay.
28
Foysal, Md Javed, Thi Thu Thuy Nguyen, Md Reaz Chaklader, et al. "Marked variations in gut microbiota and some innate immune responses of fresh water crayfish, marron (Cherax cainii, Austin 2002) fed dietary supplementation of Clostridium butyricum." PeerJ 7 (August 27, 2019): e7553. http://dx.doi.org/10.7717/peerj.7553.
Full textAbstract:
This study aimed to investigate the effects of Clostridium butyricum as a dietary probiotic supplement in fishmeal based diet on growth, gut microbiota and immune performance of marron (Cherax cainii). Marron were randomly distributed into two different treatment groups, control and probiotic fed group. After 42 days of feeding trial, the results revealed a significant (P < 0.05) increase in growth due to increase in number of moults in marron fed probiotics. The probiotic diet also significantly enhanced the total haemocyte counts (THC), lysozyme activity in the haemolymph and protein content of the tail muscle in marron. Compared to control, the 16S rRNA sequences data demonstrated an enrichment of bacterial diversity in the probiotic fed marron where significant increase of Clostridium abundance was observed. The abundance for crayfish pathogen Vibrio and Aeromonas were found to be significantly reduced post feeding with probiotic diet. Predicted metabolic pathway revealed an increased activity for the metabolism and absorption of carbohydrate, degradation of amino acid, fatty acid and toxic compounds, and biosynthesis of secondary metabolites. C. butyricum supplementation also significantly modulated the expression level of immune-responsive genes of marron post challenged with Vibrio mimicus. The overall results suggest that C. butyricum could be used as dietary probiotic supplement in marron aquaculture.
29
Sobieski, Lynn. "A Voice of the Second Generation: Antje Lenkeit Directs Fassbinder's ‘Katzelmacher’ in Munich." New Theatre Quarterly 6, no. 21 (1990): 70–85. http://dx.doi.org/10.1017/s0266464x00003997.
Full textAbstract:
The heavily-subsidized state theatre system of West Germany is often regarded as a model for emulation by the funding agencies of the English-speaking theatre. Yet the situation of such theatres can give rise to its own problems: and in this case-study of the rehearsals of Fassbinder's Katzelmacher at the Bayerisches Staatsschauspiel, Munich, in 1985. Lynn Sobieski (who was assistant dramaturg on the production) analyzes the resulting personal and artistic conflicts, in the context of a system which encourages a degree of complacency in the bureaucracy, and arguably permits some self-indulgence to the directors – while discouraging those of the first ‘post-war generation’ from giving real opportunities to their successors. Lynn Sobieski is presently teaching in the Department of Drama of the University of Texas at Austin, having recently been awarded her doctorate from New York University for her dissertation on ‘The Crisis in West German Dramaturgy’. Her collection, Postmodernism and Contemporary Performance, will be published later this year, and she is currently working on a study of performance art groups in Britain.
30
Correa, Dale J. "Recovering Yemen’s Cultural Heritage: The Stookey Microfilms." Shii Studies Review 2, no. 1-2 (2018): 308–18. http://dx.doi.org/10.1163/24682470-12340024.
Full textAbstract:
Abstract In 1973, recent PhD and newly-affiliated Research Associate at the University of Texas at Austin, Robert W. Stookey, made microfilm copies of a number of Arabic manuscripts in Yemen on a variety of subjects. Stookey was not himself a manuscripts expert, but was instead invested in preserving and making available for research the intellectual tradition of Yemen, a country in which he had spent considerable time as a researcher and member of the Foreign Service. Stookey’s microfilms were accessioned to the UT Libraries’ Middle East collection in 1980, and digitized starting in 2014. This article discusses the importance of the Stookey microfilms as an early post-custodial arrangement for preserving, making accessible, and ultimately recovering the intellectual heritage of Zaydism in Yemen. Through their inclusion in the Zaydi Manuscript Tradition portal, these microfilms will be made freely and openly available for anyone to discover and study on the Internet. While the destruction of life, property, and cultural memory continues in Yemen, this is an example of a way for North American library collections to help to recover Yemen’s precious heritage.
31
Euraque, Dario A. "Post-Disaster, Resettlement, and Community - From Strangers to Neighbors: Post-Disaster, Resettlement, and Community Building in Honduras. By Ryan Alaniz. Austin: University of Texas Press, 2017. Pp. 196. Graphics. Appendices. Notes. $29.95 paper." Americas 76, no. 3 (2019): 538–40. http://dx.doi.org/10.1017/tam.2019.57.
Full text
32
Townsend, Jeremy, Jaclyn Morimune, Megan Jones, et al. "The Effects of a Protease Enzyme Blend on Post-Resistance Exercise Intramuscular Anabolic Signaling." Current Developments in Nutrition 4, Supplement_2 (2020): 1767. http://dx.doi.org/10.1093/cdn/nzaa066_022.
Full textAbstract:
Abstract Objectives Protease supplementation has been reported to decrease inflammation and indices of muscle damage while increasing functional recovery following strenuous resistance exercise compared to a placebo. While various mechanisms have been proposed, the effects of protease supplementation on the resistance exercise induced anabolic signaling response has not been reported in the literature. To examine the effects of a protease enzyme blend added to whey protein on post-resistance exercise intramuscular anabolic signaling. Methods Ten resistance-trained males (24.4 ± 4.1yrs, 1.79 ± 0.86 m, 92.6 ± 10.4 kg) were enrolled in this double-blind, cross-over, placebo controlled study and engaged in three separate bouts of resistance exercise. Each participant completed 4 sets of leg presses and leg extensions for 8–10 repetitions at 75% of their 1-repetition maximum with 90 seconds of rest between each set. Immediately following the resistance exercise protocol, participants consumed either 250 mg of a protease enzyme blend + 26 g of whey protein (PW), 26 g whey alone (W), or non-caloric control (CON) in a counterbalanced fashion. Skeletal muscle microbiopsies were obtained from the vastus lateralis pre-exercise (PRE), 1-hour (1H), and 3-hours (3H) post-exercise. Multiplex signaling assay kits were used to quantify the phosphorylation status of proteins specific to the mTOR (AKT, mTOR, p70S6K) and MAPK (ERK1/2, JNK, p38) signaling pathways using the MAGPIX® (Luminex, Austin, TX, USA). A 2-way repeated measures analysis of variance (ANOVA) was used to identify differences between treatments over time. Results A main effect for time (p &lt; 0.05) revealed phosphorylation of AKT was decreased at 1H (p &lt; 0.001), mTOR was increased at 1H (P = 0.025) and 3H (P = 0.009) post-exercise, while p70S6K remained unchanged (P &gt; 0.05) from PRE. A main effect for time (p &lt; 0.05) was found with increased phosphorylation at 1H for JNK (P = 0.001), and decreased phosphorylation at 3H for ERK 1/2 (P = 0.022) with respect to baseline. Additionally, there were no differences in any mTOR nor MAPK signaling proteins observed between treatments. Conclusions These data suggest that acute protease supplementation may not alter mTOR or MAPK signaling in skeletal muscle following acute resistance exercise. Funding Sources Deerland Enzymes, Kennesaw, GA.
33
Herzfeld, Ute C., Brian McDonald, and Alexander Weltman. "Bering Glacier and Bagley Ice Valley surge 2011: crevasse classification as an approach to map deformation stages and surge progression." Annals of Glaciology 54, no. 63 (2013): 279–86. http://dx.doi.org/10.3189/2013aog63a338.
Full textAbstract:
AbstractThe dynamics of a surge is manifested in the crevasse patterns: literally, deformation state frozen in ice. This basic observation is utilized as the concept of an automated approach to map and analyze deformation stages and progression of surge kinematics. The classification method allows imagery to be used as geophysical data and is applied to aerial observations (photographic and video imagery, GPS data) collected in September 2011 during the surge of the Bering Glacier–Bagley Ice Valley system, Alaska, USA. As the third dimension that complements two-dimensional imagery, ice-surface elevation is observed using aerial laser altimetry. The classification method builds on concepts from signal processing, geostatistical data analysis and neural networks. Steps include calculation of generalized directional vario functions from image data and composition into feature vectors. The vario function operates as an information filter that retains spatial characteristics at an intermediate scale that captures crevasse spacing, anisotropy and other generalized roughness properties. Association of feature vectors to crevasse classes and hence deformation types employs a connectionist algorithm. In general, the connectionist–geostatistical classification allows the mapping of kinematic changes in crevassed glaciers.Dedicated to the memory of Austin Post
34
Banskota, A. K. "Prosthetic Replacement For Femoral Neck Fractures." Journal of Nepal Medical Association 19, no. 60 (2003): 20–23. http://dx.doi.org/10.31729/jnma.1767.
Full textAbstract:
Prosthetic replacement of the femoral head was performed in series of five selected patients at Shanta Bhawan Hospital, Kathmandu. Although prosthetic replacement surgery is common place in most parts of the globe, this was the first time we had undertaken this type of treatment at our hospital. We used fenestrated stem Austin Moore prosthesis in all our patients. Bone cement (methyl-methacrylate) is not readily available to us at the present and we have not yet used prosthesis with cement at our hospital. One of our patients expired in the immediate post operative period. The remaining four patients were rapidly rehabilitated and left hospital on their feet after an average in-hospital stay of about three weeks. Although it is too early right now to draw conclusions, we feel that given the selected patient, there are definite indications for this type of procedure even in the Nepalese socio-economic context. TABLE 1.Case Age Sex Side Associated conditions 1 63 M (R) ASHD, Diabetes mellitus. 2 63 M (R) ---- 3 65 M (R) ---- 4 72 F (R) Duodenal ulcer disease. 5 70 M (R)
35
Previts, Gary John, and William D. Samson. "S. PAUL GARNER: ACCOUNTANCY'S AMBASSADOR TO THE WORLD." Accounting Historians Journal 24, no. 2 (1997): 153–69. http://dx.doi.org/10.2308/0148-4184.24.2.153.
Full textAbstract:
Samuel Paul Garner spent nearly seven decades, as a student, professor, administrator, leader and visionary, enhancing the understanding and development of our academic community. Born in 1910, he studied at Duke University, then briefly as a non degree student at Columbia before teaching and then entering the Ph.D. program at the University of Texas at Austin. At Texas, under the direction of George Hillis Newlove, he focused upon accounting. His interest in history had been kindled by a noted economic historian Earl J. Hamilton, under whom Garner had studied at Duke. His first post doctoral appointment would be his lifelong assignment, as a member of the faculty of what is now the Culverhouse School of Accountancy at the University of Alabama. Starting in 1939 he served as a faculty member, next as department chair, and then for seventeen years, from 1954 to 1971, as dean of the College of Business. His career achievements are many and include being the only person to serve as President of both the American Accounting Association [1951] and the American Assembly of Collegiate Schools of Business [1964–65]. His post-retirement activities identified with the quarter century from 1971 through 1996 permitted members of subsequent generations to benefit from his knowledge and counsel. Garner's work as a scholar, a historian, an institutional developer and a visionary—especially in the area of international relations, are told in this paper. A special appendix, which contains the last known curriculum vita prepared by Garner, is also provided. Si Monumentum - Requires Circumspice/If You Seek His Monument, Look Around You.
36
MRAZ, JOHN. "David William Foster, Argentine, Mexican, and Guatemalan Photography: Feminist, Queer, and Post-masculinist Perspectives (Austin, TX: University of Texas Press, 2014), pp. xviii + 197, £42.00, hb." Journal of Latin American Studies 48, no. 2 (2016): 410–12. http://dx.doi.org/10.1017/s0022216x1600016x.
Full text
37
Dutton, Donald G. "The Outcome of Court-Mandated Treatment for Wife Assault: A Quasi-Experimental Evaluation." Violence and Victims 1, no. 3 (1986): 163–75. http://dx.doi.org/10.1891/0886-6708.1.3.163.
Full textAbstract:
This study represents an attempt to assess the effectiveness of court-mandated treatment for wife assault. A quasi-experimental design examined post-conviction recidivism rates for men convicted of wife assault. Fifty men who completed a 16-week treatment program had a 4% recidivism rate for a posttreatment period of up to 3 years. A comparable group who were not treated had a 40% recidivism rate in the same period. Hence, the “success” rate of treatment was 36% according to police records (Rosenthal, 1983). Straus Conflict Tactics Scale scores reported both by the treated men and their wives demonstrated significant posttreatment decreases from pretreatment levels. Treated husbands’ average annual use of severe violence dropped from 10.6 to 1.7 times per year (p <0.01). Eighty-four percent of wives reported no posttreatment violence. Rates of verbal aggression also dropped significantly from pretreatment levels. Comparison with CTS scores of a group of men who were arrested but not treated for wife assault (Jaffe, Wolfe, Telford, & Austin 1986) revealed significant decreases in the use of Physical Aggression subscale tactics (as reported by their wives) as a result of treatment. Interpretative difficulties with the quasi-experimental design used in this study are discussed and a randomized design with appropriate psychological assessment of subjects is recommended.
38
Novak-Marcincin, Jozef, Daniela Gîfu, and Mirela Teodorescu. "Florentin Smarandache: Law of Included Multiple-Middle - Book Review." International Letters of Social and Humanistic Sciences 40 (September 2014): 29–34. http://dx.doi.org/10.18052/www.scipress.com/ilshs.40.29.
Full textAbstract:
Florentin Smarandache is known as scientist and writer. He writes in three languages: Romanian, French, and English. He graduated the Department of Mathematics and Computer Science at the University of Craiova in 1979 first of his class, earned a Ph. D. in Mathematics from the State University Moldova at Kishinev in 1997, and continued postdoctoral studies at various American Universities such as University of Texas at Austin, University of Phoenix, etc. after emigration. He did post-doctoral researches at Okayama University of Science (Japan) between 12 December 2013 - 12 January 2014; at Guangdong University of Technology (Guangzhou, China), 19 May - 14 August 2012; at ENSIETA (National Superior School of Engineers and Study of Armament), Brest, France, 15 May - 22 July 2010; and for two months, June-July 2009, at Air Force Research Laboratory in Rome, NY, USA (under State University of New York Institute of Technology). In U.S.A. he worked as a software engineer for Honeywell (1990-1995), adjunct professor for Pima Community College (1995-1997), in 1997 Assistant Professor at the University of New Mexico, Gallup Campus, promoted to Associate Professor of Mathematics in 2003, and to Full Professor in 2008. Between 2007-2009 he was the Chair of Math & Sciences Department.
39
Rosetta, L. "Aetiological approach of female reproductive physiology in lactational amenorrhoea." Journal of Biosocial Science 24, no. 3 (1992): 301–15. http://dx.doi.org/10.1017/s0021932000019866.
Full textAbstract:
There is a wide range of duration of post-partum amenorrhoea and resumption of ovulation between individuals, within an individual or between populations. Several extraneous variables, such as parity, mother's age, sex of the breast-fed baby, socioeconomic status and cultural level of the family, can be controlled; then the remaining variables will probably explain a part of the total variability in post-partum amenorrhoea duration but say nothing about the physiological process. In attempting to question physiological aspects of the return of fertility several observational studies have tended to favour one of the different factors which are supposed to play a major role in the regulation and have compared different levels of it, such as body composition of the mother (Frisch & McArthur, 1974), breast-feeding pattern (Jones, 1989) or the life style of the women. Life style can be related to women's physical activity in normal life (Ellison, 1991), the difference between urban and rural life (Carael, 1981) or the environment (Laurenson et al., 1985). Prolactin as a possible mediator of the central regulation has been carefully considered (Lunn, Austin & Whitehead, 1984; Howie et al., 1982). These studies were mainly observational rather than experimental, supplementing mothers during the lactating period or during the pregnancy. If this information is added to what is known of other animal species (Loudon, 1987) or animal experimentation (Plant et al., 1989; Williams et al., 1990a; Williams et al., 1990b), the combination of several of the main factors believed to have a major role in the human species can be clarified and the aetiology of the resumption of fertility in nursing women investigated.
40
Schuster, Jennifer, Samantha Johnston, Bhinnata Piya, et al. "1106. Infectious Etiologies of Acute Gastroenteritis in Children during the First 100 Days Post-Allogeneic Hematopoietic Cell Transplant." Open Forum Infectious Diseases 5, suppl_1 (2018): S331. http://dx.doi.org/10.1093/ofid/ofy210.940.
Full textAbstract:
Abstract Background Acute gastroenteritis (AGE) is a frequent sequela in children undergoing hematopoietic cell transplant (HCT). Although rotavirus and norovirus have been implicated as important causes of AGE, the frequency of other pathogens is unknown. Little data exist on longitudinal prevalence of infectious AGE in HCT. Methods From February 2015 to May 2016, subjects &lt;18 years undergoing allogeneic HCT were enrolled at four CDC-NVSN sites: Oakland, Kansas City, Seattle, and Nashville. Stool samples were collected at enrollment, weekly until discharge or day 100 (whichever occurred earliest), during re-admissions within the first 100 days, and day 100. AGE was defined as unexplained ≥3 episodes diarrhea and/or ≥1 episode vomiting/24 hours. Specimens were tested using Luminex xTAG Gastrointestinal Pathogen Panel (Austin, TX) and real-time PCR for adenovirus, astrovirus, norovirus, and sapovirus. Results Thirty-one patients were enrolled at four sites (Seattle: 13, Kansas City: 8, Oakland: 6, Nashville: (4) with median age 5 (IQR 3–10) years. Two hundred sixteen samples were obtained with median 7 samples/subject. During the first 100 days, 29 (94%) subjects met the AGE definition. Thirty-six single pathogen detections occurred in 16 (52%) subjects. Clostridium difficile was the most frequent pathogen (Figure 1), with 14 detections in nine patients, all ≥3 years; 50% of detections were asymptomatic. Seven (50%) detections occurred at HCT onset and none received targeted C. difficile therapy. Sapovirus was detected nine times in four patients, with seven (78%) detections associated with AGE symptoms. Rotavirus was detected nine times, during five symptomatic episodes, in three patients. Adenovirus was detected four times in three patients and all were symptomatic. Conclusion We longitudinally characterized the etiology of infectious AGE in children undergoing HCT. Despite the majority of patients meeting the definition for AGE, only half had a pathogen detected, suggesting that differentiating infectious vs. noninfectious AGE (e.g., medication induced) in this population is difficult. Although all subjects with adenovirus and most with sapovirus were symptomatic, asymptomatic C. difficile detection was common. Interestingly, norovirus was not detected. Further investigation of AGE is warranted in this population. Disclosures All authors: No reported disclosures.
41
Wasow, Mona. "Acute, Chronic, and Terminal Care in Neurosurgery Edited by Kalmon Post, Joseph Jaffe, Peggy Reubeus, Austin H. Kutscher, Denise Hoffmeister, Karin M. Muraszko, and Linda Farber Post. Springfield, IL: Charles C Thomas, 1987. 194 pp. $34.50 hardback." Health & Social Work 15, no. 2 (1990): 165–66. http://dx.doi.org/10.1093/hsw/15.2.165.
Full text
42
JONES, VIVIEN. "Post-feminist Austen." Critical Quarterly 52, no. 4 (2010): 65–82. http://dx.doi.org/10.1111/j.1467-8705.2010.01949.x.
Full text
43
Ramón, M. C., O. S. Acuña, M. J. Ruano, M. Avilés, and M. J. Izquierdo-Rico. "199 EXPRESSION OF HAPTOGLOBIN mRNA IN THE OVIDUCT DURING THE OESTRUS CYCLE OF SOWS." Reproduction, Fertility and Development 25, no. 1 (2013): 248. http://dx.doi.org/10.1071/rdv25n1ab199.
Full textAbstract:
The haptoglobin is an acute phase protein that has been recently related with numerous events of mammalian reproduction. The objective of this study was to determine whether haptoglobin mRNA is expressed in the porcine oviduct and to analyse its expression during the different phases of the oestrus cycle. Porcine oviducts collected from a local abattoir were classified based on follicular morphology: prepuberal (containing only follicles 1 to 2 mm in diameter), preovulatory (containing 6 to 12 follicles 8 to 12 mm in diameter), post-ovulatory (containing 6 to 12 hemorrhagic corpora), and luteal phase (containing 6 to 12 corpora lutea). Total RNA was obtained by extracting scraps of isthmus-ampullar junction mucosa using RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions and cDNA was synthesised with an oligo d(T) as primer. This cDNA was used as template in RT-PCR and quantitative PCR (qPCR) amplifications using specific primers (Fw: gctacgtggagcacatggtt and Rv: ggagattcttagccgtggtc for RT-PCR and Fw: ggtgatgcccatttgcctccct and Rv: cagccaccggcagcatgaca for qPCR) designed based on GenBank sequence for Sus scrofa haptoglobin (NM_214000). The amplification by RT-PCR resulted in a 312-bp amplicon. This PCR product was sequenced and a 100% of identity with porcine haptoglobin sequence deposited in GenBank database was confirmed. On the other hand, analysis by qPCR revealed that the haptoglobin mRNA expression was more elevated in luteal and post-ovulatory phases than in prepuber and preovulatory phases. In conclusion, the haptoglobin mRNA is present in porcine oviduct and could be considered as a progesterone-dependent transcript. The role played by this protein in the porcine oviduct remains to be investigated. This study was supported by MICINN (AGL2009-12512-C02-01-02).
44
Gustafson, Bret, Francesco Carpanini, Martin Kalb, et al. "Book Reviews." Environment and Society 9, no. 1 (2018): 164–81. http://dx.doi.org/10.3167/ares.2018.090111.
Full textAbstract:
Cepek, Michael. 2018. Life in Oil: Cofán Survival in the Petroleum Fields of Amazonia. Austin: University of Texas Press. 302 pp. ISBN 978-1477315088.Choné, Aurélie, Isabelle Hajek, and Philippe Hamman, eds. 2017. Rethinking Nature: Challenging Disciplinary Boundaries. Abingdon; New York: Routledge. xiv + 268 pp. (Paperback) ISBN 978-1-138-21493-4.Davis, Diana K. 2016. The Arid Lands: History, Power, Knowledge. Cambridge, MA: MIT Press. 271 pp. ISBN 978-0262034524.Gissibl, Berhard. 2016. The Nature of German Imperialism: Conservation and the Politics of Wildlife in Colonial East Africa. New York: Berghahn Books, 2016. 374 pp. ISBN 978-1-78533-175-6.Ives, Sarah. 2017. Steeped in Heritage: The Racial Politics of South African Rooibos Tea. NC: Duke University Press. 272 pp. ISBN 978-0-8223-6986-8.Martínez-Reyes, José. Moral Ecology of a Forest: The Nature Industry and Maya Post-Conservation. Tucson: University of Arizona Press. 216 pp. ISBN 978-0816531370.Powell, Dana E. 2017. Landscapes of Power: Politics of Energy in the Navajo Nation. Durham, NC: Duke University Press. 336 pp. ISBN 978-0822369943.Raygorodetsky, Gleb. 2017. The Archipelago of Hope: Wisdom and Resilience from the Edge of Climate Change. New York: Pegasus Books. 336 pp. ISBN: 978-1681775326.Wright, Christopher, and Daniel Nyberg. 2015. Climate Change, Capitalism, and Corporations: Processes of Creative Self-Destruction. Cambridge: Cambridge University Press. 254 pp. ISBN 978-1107435131.
45
Schauer, Frederick. "Positivism Before Hart." Canadian Journal of Law & Jurisprudence 24, no. 2 (2011): 455–71. http://dx.doi.org/10.1017/s0841820900005270.
Full textAbstract:
Many contemporary practitioners of analytic jurisprudence take their understanding of legal positivism largely from Hart, and the debates about legal positivism exist largely in a post-Hartian world. But if we examine carefully the writings and motivations of Bentham and even Austin, we will discover that there are good historical grounds for treating both a normative version of positivism and a version more focused on legal decision-making as entitled to at least co-equal claims on the positivist tradition. And even if we conceive of the inquiry in philosophical and not historical terms, there are reasons to doubt the view that a theory of the nature of law is the exclusive understanding of the core commitment of legal positivism. Positivism as a descriptive theory of the nature of law is important, but so too is positivism as a normative theory about the preferable attitude of society or theorists, and so too is positivism as a normative or descriptive theory of adjudication and other forms of legal decision-making. Those who understand positivism and the positivist tradition as being more normative or more adjudication-focused than the contemporary understanding allows are thus committing neither historical or philosophical mistakes, and little would be lost were we to recognize the multiple important contemporary manifestations of the legal positivist tradition.
46
Ul Haq, Muhammad Asrar, Chiew Wong, Itamar Levinger, et al. "Effect of Exercise Training on Left Ventricular Remodeling in Diabetic Patients with Diastolic Dysfunction: Rationale and Design." Clinical Medicine Insights: Cardiology 8 (January 2014): CMC.S14089. http://dx.doi.org/10.4137/cmc.s14089.
Full textAbstract:
Introduction This study will examine the effects of combined aerobic and resistance training on left ventricular remodeling in diabetic patients with diastolic dysfunction. This is the first randomized controlled trial to look for effects of combined strength training and aerobic exercise on myocardial function as well as other clinical, functional, or psychological parameters in diabetic patients with isolated diastolic dysfunction, and will provide important insights into the potential management strategies for heart failure with preserved ejection fraction. Methods and Analysis This is a prospective, randomized controlled investigator initiated single center trial. Diabetic patients with LV diastolic dysfunction suitable for exercise training intervention will be randomized to three months of a supervised combination of aerobic and strength training exercises, or supervised light stretching (control arm). Pre and post intervention assessment will include stress echocardiography, peak aerobic power with 12-lead ECG, dual-energy X-ray absorptiometry, muscle strength, the capacity to perform activities of daily living (ADLs), and questionnaires to assess self-perceived quality of life and symptoms of depression. The primary endpoint is to compare any change in tissue Doppler-derived LV systolic and early diastolic velocities. Ethics and Dissemination The current trial protocol has been approved by the Human Research Ethics Committee of Austin Health and the University of Melbourne, Melbourne. The study will be performed in accordance with the Declaration of Helsinki. The investigator, regardless of the outcome, will publish the results of the study. Trial Registration Australian New Zealand Clinical Trials Registry: ACTRN12610000943044.
47
Lochhead, Ian. "Unbuilt Sixties: The Unsuccessful Entries in the Christchurch Town Hall Competition." Architectural History Aotearoa 2 (March 16, 2021): 23–31. http://dx.doi.org/10.26686/aha.v2i0.6708.
Full textAbstract:
The completion of the Christchurch Town Hall in 1972 marked the end of a process which had begun in 1964 with a national competition, the largest and most prestigious of the post-war era in New Zealand and one of the major architectural events of the 1960s. Although Warren and Mahoney's winning design has assumed a prominent place in New Zealand architecture, unsuccessful designs by among others, Pascoe & Linton; Lawry & Sellars; Austin, Dixon & Pepper; Gabites & Beard and Thorpe, Cutter, Pickmere, Douglas & Partners, are virtually forgotten. These designs deserve to be better known since they offer an invaluable insight into the range of architectural approaches being employed during the mid sixties. Standing apart from the short listed designs is Peter Beaven's more widely published entry, which was singled out by the jury as being especially meritorious. The paper will examine unrealised designs for the Christchurch Town Hall in the context of contemporary attitudes towards concert hall and civic centre design. Approaches ranged from the Miesian international modernism of Lawry and Sellars to the sculptural forms of Beaven's proposal in which influences as diverse as Aalto, Scharoun and Mountfort are strikingly integrated. The paper will also assess Warren and Mahoney's unbuilt civic centre design within the framework of the competition entries as a whole. Such unbuilt designs constitute an important, but largely invisible part of the architecture of the 1960s and deserve to be re-inscribed within in the history of the period.
48
Fujikawa, T., S. Imamura, M. Tokumaru, et al. "43 Cryopreservation of Bovine Sperm Using Antifreeze Polyamino-Acid." Reproduction, Fertility and Development 30, no. 1 (2018): 161. http://dx.doi.org/10.1071/rdv30n1ab43.
Full textAbstract:
Carboxylated poly-l-lysine (CPLL), an ampholytic polymer compound, is reported to have a cryoprotective property similar to that of antifreeze proteins. We previously reported the effectiveness of CPLL as cryoprotective material for bovine sperm (43rd Annual Conference of International Embryo Technology Society, Austin, TX, USA; http://www.iets.org/2017/IETS_2017_Program_Book_FINAL.pdf). In this research, we investigated additional aspects of CPLL for bovine sperm. The conventional cryopreservation medium used for Control group consisted of 6.5% (v/v) glycerin, and the cryopreservation medium used for the CPLL group consisted of 3.25% (v/v) glycerin and 0.5% CPLL (w/v). In experiment 1, sperm motility was measured 1, 3, and 6 h after thawing. The post-thaw motility was assessed by using Sperm Motility Analysis System (DITECT Corp., Tokyo, Japan). The CPLL treatment yielded better motility rate at 6 h (Control v. CPLL; 23.7% v. 38.5%; P < 0.01), average path velocity (μm s−1) at 1 and 3 h (Control v. CPLL; 49.8 v. 57.7, 35.8 v. 42.8; P < 0.01), straight-line velocity (μm s−1) at 1 h (Control v. CPLL; 35.2 v. 45.7; P < 0.01), and curvilinear velocity (μm/s) at 1 and 3 h (Control v. CPLL; 93.7 v. 106.2, 59.9 v. 68.4; P < 0.01) than the Control. In experiment 2, sperm membrane integrity was assessed by using the LIVE/DEAD Sperm Viability Kit (Thermo Fisher Scientific K.K., Kanagawa, Japan). The CPLL group yielded greater sperm membrane integrity rate than control (Control v. CPLL; 49.6% v. 60.6%; P < 0.01). In experiment 3, AI was carried out on 111 cows (Control v. CPLL; 49 v. 62) and the conception rate of the CPLL group was significantly higher than that of the control group (53.1% v. 79.0%; P < 0.01). Previously, we reported the effectiveness of CPLL for bovine sperm. In this study, we clarified how CPLL works to improve the conception rate of AI: CPLL maintains post-thaw motility and protects the sperm membrane. These results suggest that CPLL has potential as a new cryoprotective material for bovine sperm.
49
Gates, Priscilla, Karla Gough, Haryana Dhillon, et al. "Longitudinal exploration of cancer-related cognitive impairment in patients with newly diagnosed aggressive lymphoma: protocol for a feasibility study." BMJ Open 10, no. 9 (2020): e038312. http://dx.doi.org/10.1136/bmjopen-2020-038312.
Full textAbstract:
IntroductionCancer-related cognitive impairment (CRCI) is a distressing and disabling side-effect of cancer treatments affecting up to 75% of patients. For some patients, their cognitive impairment may be transient, but for a subgroup, these symptoms can be long-standing and have a major impact on the quality of life. This paper describes the protocol for a study: (1) to assess the feasibility of collecting longitudinal data on cognition via self-report, neuropsychological testing, peripheral markers of inflammation and neuroimaging and (2) to explore and describe patterns of cancer-related cognitive impairment over the course of treatment and recovery in patients with newly diagnosed, aggressive lymphoma undergoing standard therapy with curative intent.Methods and analysisThis is a prospective, longitudinal, feasibility study in which 30 newly diagnosed, treatment-naive patients with aggressive lymphoma will be recruited over a 12-month period. Patients will complete comprehensive assessments at three time points: baseline (time 1, pre-treatment) and two post-baseline follow-up assessments (time 2, mid-treatment and time 3, 6–8 weeks post-treatment completion). All patients will be assessed for self-reported cognitive difficulties and objective cognitive function using Stroop Colour and Word, Trail Making Test Part A and B, Hopkins Verbal Learning Test-Revised, Controlled Oral Word Association and Digit Span. Blood cell-based inflammatory markers and neuroimaging including a positron emission tomography (PET) with 18F-labelled fluoro-2-deoxyglucose (18F-FDG) and CT (18F-FDG-PET/CT) and a MRI will explore potential inflammatory and neuroanatomical or functional mechanisms and biomarkers related to CRCI. The primary intent of analysis will be to assess the feasibility of collecting longitudinal data on cognition using subjective reports and objective tasks from patients during treatment and recovery for lymphoma. These data will inform the design of a larger-scale investigation into the patterns of cognitive change over the course of treatment and recovery, adding to an underexplored area of cancer survivorship research.Ethics and disseminationEthical approval has been granted by Austin Health Human Rights Ethics Committee (HREC) in Victoria Australia. Peer reviewed publications and conference presentations will report the findings of this novel study.Trial registration numberAustralian New Zealand Clinical Trials Registry (ACTRN12619001649101).
50
Crowley, John W., and Jianliang Huang. "A least-squares method for estimating the correlated error of GRACE models." Geophysical Journal International 221, no. 3 (2020): 1736–49. http://dx.doi.org/10.1093/gji/ggaa104.
Full textAbstract:
SUMMARY A new least-squares method is developed for estimating and removing the correlated errors (stripes) from the Gravity Recovery and Climate Experiment (GRACE) and GRACE Follow-On (GRACE-FO) mission data. This method is based on a joint parametric model of the correlated errors and temporal trends in the spherical harmonic coefficients of GRACE models. Three sets of simulation data are created from the Global Land Data Assimilation System (GLDAS), the Regional Atmospheric Climate Model 2.3 (RACMO2.3) and GRACE models and used to test it. The results show that the new method improves the decorrelation method by Swenson & Wahr significantly. Its application to the release 5 (RL05) and new release 6 (RL06) spherical harmonic solutions from the Center for Space Research (CSR) at The University of Texas at Austin demonstrates its effectiveness and provides a relative assessment of the two releases. A comparison to the Swenson & Wahr and Kusche et al. methods highlights the deficiencies in past destriping methods and shows how the inclusion and decoupling of temporal trends helps to overcome them. A comparison to the CSR mascon and JPL mascon solutions demonstrates that the new method yields global trends that have greater amplitude than those produced by the CSR RL05 mascon solution and are of comparable quality to the JPL RL06 mascon solution. Furthermore, these results are obtained without the need for a priori information, scale factors or complex regularization methods and the solutions remain in the standard form of spherical harmonics rather than discrete mascons. The latter could introduce additional discretization error when converting to the spherical harmonic model, upon which many post-processing methods and applications are built.