Relevant bibliographies by topics / AXA Art

Contents

  1. Journal articles
  2. Dissertations / Theses
  3. Books
  4. Book chapters
  5. Conference papers
  6. Reports

Academic literature on the topic 'AXA Art'

Author: Grafiati
Published: 4 June 2021
Last updated: 1 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'AXA Art.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "AXA Art"

1

Kessler, Kathrin, Thea van Oosten, and Henk van Keulen. "THE AXA ART CONSERVATION PROJECT IN COOPERATION WITH THE VITRA DESIGN MUSEUM: RESEARCH INTO GLASSFIBRE-REINFORCED POLYESTER." Studies in Conservation 49, sup2 (September 1, 2004): 86–90. http://dx.doi.org/10.1179/sic.2004.49.s2.019.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Newson, Adele S., and Vincent O. Odamtten. "The Art of Ama Ata Aidoo: Polylectics and Reading against Neocolonialism." World Literature Today 69, no. 4 (1995): 851. http://dx.doi.org/10.2307/40151778.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Niemi, Minna, and Yaba Badoe. "Making The Art of Ama Ata Aidoo: An Interview with Yaba Badoe." ariel: A Review of International English Literature 49, no. 2-3 (2018): 257–69. http://dx.doi.org/10.1353/ari.2018.0020.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Jiang, Long, An Chun Cheng, Ming Shu Wang, De Kang Zhu, and Ren Yong Jia. "Identification of Translationally Optimal Codons and Suitable Expression Host of DPV gB Gene." Advanced Materials Research 343-344 (September 2011): 729–36. http://dx.doi.org/10.4028/www.scientific.net/amr.343-344.729.

Full text
Abstract:
In this report, we conduct study on codon composition and codon usage of DPV glycoprotein B (gB) gene, its homologs constitute the most highly conserved family of herpesvirus glycoproteins and are present in members of each herpesvirus subfamily. Our results show that sixty-one codons (excluding the termination codons) in the polypeptide, a high level of diversity in codon usage bias existed for coding the Ala, Gly, Leu, Pro, Arg, Ser, Thr and Val amino acids. Sixteen codons (each for a amino acid), including GCA (Ala), GAT (Asp), GAA (Glu), GGA (Gly), CAT (His), ATA (Ile), AAA (Lys), CTA (Leu), AAT (Asn), CCA (Pro), CAA (Gln), AGA (Arg), TCT (Ser), ACT (Thr), GTA (Val) and TAT (Tyr) were determined as the translationally optimal codons. The codon preferences of DPV gB gene were compared with those of E. coli, yeast, and H. sapiens, we can speculate that the DPV gB gene may be more efficiently expressed in the E. coli system. In summary, knowledge of codon usage of herpesvirus gB genes provides insights into molecular and species evolution, and also plays important role in furthering some biotechnological applications. These would be fruitful areas for further study.
APA, Harvard, Vancouver, ISO, and other styles
5

Silajdžić, Tarik, and Salmedin Mesihović. "Votive ara of the Iupiter Capitolian." Godišnjak Centra za balkanološka ispitivanja 43 (2014): 121–26. http://dx.doi.org/10.5644/godisnjak.cbi.anubih-43.40.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Gil Naveira, Isabel. "La reapropiación de la maternidad en la obra de Ama Ata Aidoo." Archivum 66, no. 66 (November 9, 2016): 107. http://dx.doi.org/10.17811/arc.66.2016.107-136.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Dragunoiu, Dana. "Vladimir Nabokov's Ada : Art, Deception, Ethics." Contemporary Literature 46, no. 2 (2005): 311–39. http://dx.doi.org/10.1353/cli.2005.0022.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Okuyama, Harumi, and Tomohito Hamazaki. "Is arachidonic acid supplementation necessary for elderly people？." Journal of Lipid Nutrition 22, no. 1 (2013): 25–34. http://dx.doi.org/10.4010/jln.22.25.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Lipiński, Konrad. "Niektóre problemy tożsamości czynu ciągłego (art. 12 § 1 k.k.). Uwagi na marginesie wyroku Sądu Apelacyjnego w Warszawie z 4 września 2019 r. (II AKa 53/19)." Studia Iuridica, no. 86 (June 14, 2021): 129–40. http://dx.doi.org/10.31338/2544-3135.si.2020-86.8.

Full text
Abstract:
The article explores the issue of unity of a continuous act referred to in Art. 12 para 1 of the Criminal Code. The author considers whether and (if so) to what extent it is permissible for the adjudicating court to transform separate, concurrent offenses (as listed in the indictment) into one - supplemented by an element of continuity - continuous act of Art. 12 para 1 CC. According to the thesis advanced in the article, such a transformation should be considered admissible as long as the attributed offence does not encompass any additional behavior not expressly listed in the indictment, occurring chronologically before the first behavior of the indictment, after the last one, or between them.
APA, Harvard, Vancouver, ISO, and other styles
10

Kelley, William N. "A new role for the ara in guiding our destiny." Arthritis & Rheumatism 30, no. 11 (November 1987): 1201–4. http://dx.doi.org/10.1002/art.1780301101.

Full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "AXA Art"

1

Lhotská, Tereza. "Pojištění v oblasti umění." Master's thesis, Vysoká škola ekonomická v Praze, 2014. http://www.nusl.cz/ntk/nusl-201949.

Full text
Abstract:
The diploma thesis is focused on insurance of art. In the first part of the thesis the chapters contain areas of art which are insured in practice. The paper analyzes insurance of cultural heritage, works of art, musical instruments and cultural events. Each chapter describes the specifics of the areas and the most used kinds of insurance, including practical examples. In the last chapter of the first part I outline the situation abroad and its comparison with the Czech market. As an example, a foreign insurance company has been selected by AXA Art. The second part is devoted to insurance of Czech Philharmonic. It contains links to the orchestra, the historic building and the gallery. Funded organizations of the Ministry of Culture occupy a significant portion of the paper. In this thesis, I do not mention insurance in the film industry.
APA, Harvard, Vancouver, ISO, and other styles
2

Liberatti, Elisângela. "Ara, Chico." Florianópolis, 2012. http://repositorio.ufsc.br/xmlui/handle/123456789/100652.

Full text
Abstract:
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Comunicação e Expressão. Programa de Pós-Graduação em Estudos da Tradução
Made available in DSpace on 2013-06-25T21:17:18Z (GMT). No. of bitstreams: 1 309863.pdf: 6321954 bytes, checksum: afe6f76a500e5b7db68ec4fb19d30b1c (MD5)
Esta pesquisa situa-se na intersecção entre Estudos da Tradução, tradução de quadrinhos e funcionalismo nordiano (1991). Seu objetivo é propor uma tradução comentada com enfoque funcionalista de duas histórias em quadrinhos (HQs) do Chico Bento, no par linguístico português-inglês, sob a perspectiva teórico-metodológica do funcionalismo nordiano e do conceito de pseudodialeto caipira sugerido por Bagno (2011). A tradução da variação linguística presente nos quadrinhos do Chico Bento faz-se importante para a área de Estudos da Tradução pelo fato de que (pseudo)dialetos caracterizam e marcam o usuário da língua e, portanto, são elementos significativos em traduções cujo propósito seja a manutenção no texto alvo (TA) das características linguísticas presentes no texto fonte (TF). Com isso, é papel do tradutor identificar o propósito do (pseudo)dialeto presente no TF e assegurar que tal propósito mantenha-se consistente na tradução. Partindo-se do princípio de que as HQs do Chico Bento buscam retratar, ficcionalmente, a vida do caipira brasileiro e que a fala dos personagens seja uma tentativa de representação do cenário caipira dessas histórias, a tradução proposta busca manter o pseudodialeto caipira representado nas HQs, além de adaptar tais HQs ao público a quem o TA se destina, conceito da teoria funcionalista de Nord.
This research is situated at the intersection between Translation Studies, comics' translation, and Nord's functionalist approach (1991). Its objective is to propose a functionalist translation with commentary of two Chuck Billy's comics, in the linguistic-pair Portuguese-English, from the theoretical and methodological perspective of Nord's functionalist approach and the concept of hillbilly (pseudo)dialect suggested by Bagno (2011). The translation of the linguistic variation present in Chuck Billy's comics is important to the Translation Studies area because (pseudo)dialects characterize and mark the language user, being meaningful elements in translations in which the purpose is the maintenance in the target text (TT) of the linguistic characteristics present in the source text (ST). Therewith, it is the translator's role to identify the purpose of the (pseudo)dialect present in the ST and ensure that such purpose is still consistent in the translation. Assuming that Chuck Billy's comics try to fictionally portray the life of a Brazilian hillbilly and that the character's speech is an attempt to represent the hillbilly scenario of such comics, the proposed translations try to maintain the hillbilly (pseudo)dialect represented in the comics, as well as to adapt such comics to the public to whom the TT is destined, a concept from Nord's functionalist approach.
APA, Harvard, Vancouver, ISO, and other styles
3

Liza, Rodríguez Jacqueline Susann. "Determinación del sexo en guacamayos de las especies Ara ararauna, Ara macao, Ara chloropthera, Ara militaris, Propyrrhura couloni mediante el uso del ADN." Bachelor's thesis, Universidad Nacional Mayor de San Marcos, 2006. https://hdl.handle.net/20.500.12672/685.

Full text
Abstract:
Con la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas. Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo.
--- With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.
Tesis
APA, Harvard, Vancouver, ISO, and other styles
4

Boldt, Andrea. "Charakterisierung der Erdnussallergene Ara h 1, Ara h 3/4 und ihrer Isoformen." [S.l.] : [s.n.], 2005. http://deposit.ddb.de/cgi-bin/dokserv?idn=976057409.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

On, Calvin. "ANA : a method for ARM-on-ARM execution." Thesis, Massachusetts Institute of Technology, 2007. http://hdl.handle.net/1721.1/45973.

Full text
Abstract:
Thesis (M. Eng.)--Massachusetts Institute of Technology, Dept. of Electrical Engineering and Computer Science, 2007.
Includes bibliographical references (p. 61-62).
This thesis proposes and implements ANA, a new method for the simulation of ARM programs on the ARM platform. ANA is a lightweight ARM instruction interpreter that uses the hardware to do a lot of the work for the read-decode-execute piece of simulation. We compare this method to the two existing methods of full simulation and direct execution that have been traditionally used to achieve this. We demonstrate that despite some setbacks caused by the prefetching and caching behaviors of the ARM, ANA continues to be a very useful tool for prototyping and for increasing simulator performance. Finally, we identify the important role that ANA can play in our current efforts to virtualize the ARM.
by Calvin On.
M.Eng.
APA, Harvard, Vancouver, ISO, and other styles
6

Marques, Adriana Ribeiro de Oliveira. "Caracterização da estrutura genética populacional das araras vermelhas Ara chloropterus e Ara macao (Psittaciformes, Aves)." Universidade de São Paulo, 2011. http://www.teses.usp.br/teses/disponiveis/41/41131/tde-12052011-152811/.

Full text
Abstract:
O objetivo do presente estudo foi caracterizar a estrutura genética populacional de duas espécies de araras: Ara chloropterus e Ara macao. Foram analisadas amostras de sangue e penas de diferentes regiões no Brasil, de uma localidade na Bolívia e outra no Peru. Foram realizadas análises com DNA mitocondrial (região controladora e citocromo oxidase I) e nuclear (microssatélites) das duas espécies. Para A. chloropterus foram obtidos 2166 pares de base do DNA mitocondrial de 89 amostras e dados de seis locos de microssatélites de 95 amostras. A rede de haplótipos e a árvore de neighbor-joining construídas com dados mitocondriais e os índices de FST obtidos com os dois marcadores revelaram fraca estruturação genética. Isso pode ser devido a alto fluxo gênico apresentado ou retenção de polimorfismo ancestral. Portanto, a espécie parece se organizar em metapopulações (baixa estruturação genética e alto fluxo gênico). Nesse caso, seria interessante conservar indivíduos de diversas localidades e seus corredores. Para Muscular Dystrophy foram obtidos 2094 pares de base do DNA mitocondrial de 68 amostras e dados de sete locos de microssatélites de 64 amostras. A rede de haplótipos e a árvore de neighbor-joining construídas com dados mitocondriais e os índices de FST obtidos com os dois marcadores indicam ausência de diferenciação genética entre as localidades estudadas. A análise demográfica dessa espécie indica expansão populacional há pouco mais de 50.000 anos atrás e declínio populacional desde o último período máximo de glaciação. Estes resultados sugerem que essa espécie é constituída de uma única grande população que poderia ser considerada como uma única unidade de manejo caso outras diferenças (ex.: adaptações ecológicas locais) não sejam encontradas. Ambas as espécies estudadas apresentam alta diversidade genética, possivelmente devido a um intenso fluxo gênico dentro de cada uma.
The present study aimed to characterize the population genetic structure of two macaw species: Ara chloropterus and Ara macao. Samples from various localities in Brazil, one in Bolivia and another in Peru were analyzed. Mitochondrial (control region and cytochrome oxidase I) and nuclear (microsatellites) DNA were analyzed. For A. chloropterus 89 individuals had 2166 bp of mitochondrial DNA sequenced and 95 individuals were genotyped for six polymorphic microsatellite loci. Network and the neighbor-joining tree constructed based on mitochondrial data and FST values obtained with both molecular markers revealed weak genetic structure. This can be due to high gene flow or retained ancestral polymorphism. Thus, A. chloropterus seems to be organized in metapopulations (low genetic structure and high gene flow). Under this scenario, it would be desirable to preserve individuals from various locations and there corridors. For Muscular Dystrophy we obtained 2094 bp of mitochondrial DNA for 68 individuals and data on seven microsatellites for 64 individuals. The haplotype network and the neighbor-joining tree constructed based on mitochondrial data and FST values obtained with both molecular markers revealed no genetic differentiation among localities. The demographic analysis of this species indicated a population expansion 50,000 years ago and a population decline since the last glaciation maximum. These results suggest that this species is organized as a large population that could be considered as a single management unit for conservation purposes if other differences are not found (eg. local ecological adaptations). Both species have high genetic diversity, possibly due to extensive gene flow within each one.
APA, Harvard, Vancouver, ISO, and other styles
7

Cooke, Jacqueline. "Art ephemera, aka "Ephemeral traces of 'alternative space' : the documentation of art events in London 1995-2005, in an art library"." Thesis, Goldsmiths College (University of London), 2007. http://research.gold.ac.uk/3475/.

Full text
Abstract:
This research is based on reflexive practice as a subject librarian for visual art, concerned with representation (of artists) and context (of art practice and its representation) in the academic library, as a heterotopia. My thesis is that the aim to create an ‘alternative’ art space remained operative in London between 1995 and 2005, although the term was decried. The research addresses the problem of documentation of transient contemporary art practices, by collecting and analysing ephemera and developing a resource based upon them. Art ephemera are by-products of institutions, galleries, exhibitions, and curatorialactivities that may be significant in terms of criticality but which are often not recorded adequately and remain un-archived. The strategies of representation that ephemera mobilise take place at an interface of art aims and social structures, an area that has been a vital site of contemporary practice. I review major issues in contemporary criticism of the ‘avant-garde’ and ‘alternative’,showing the discourse of the alternative to be an ethical discourse about practice. Identifying citation as means of interpretation, I draw my account from a reading ofephemera in the chapters: “Citation, marginalia, mockery, fakes and tailpieces” where I identify visual and textual qualities of ephemera, “Artists, spaces and institutions,”where I present the themes of mapping London and self-institutionalisation, and “Counter to ?” where I report a distancing from counter-cultural aims and development of complex alternatives. I evaluate existing collections of art ephemera in libraries, projects to facilitate access to them, and cataloguing and collecting policies. I advocate use of catalogues to recontextualise ephemera. In conclusion, I present a complex notion of ‘alternative space’ in art practice as a space for dialogue with, rather than opposition to established institutions and circuits of contemporary art and I endorse collection of ephemera as a source for diverse histories.
APA, Harvard, Vancouver, ISO, and other styles
8

Vieira, Carlos Jorge Canto. "Capitéis de ara do Municipium Olisiponense." Master's thesis, Instituições portuguesas -- UNL-Universidade Nova de Lisboa -- FCSH-Faculdade de Ciências Sociais e Humanas -- -Departamento de História da Arte, 1998. http://dited.bn.pt:80/30318.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Sadeghi, Seyedeh Tara. "De la violence dans l'art contemporain à partir des oeuvres de Valie Export, Marie-Jo Lafontaine, Ana Mendieta et quelques autres." Thesis, Aix-Marseille, 2018. http://www.theses.fr/2018AIXM0670.

Full text
Abstract:
A partir des réflexions plastiques, cette recherche vise à étudier des liens entre la violence et l’art contemporain. La violence s’inscrit dans différentes perspectives. Elle est d’abord une force physique qui génère un certain nombre d’effets tangibles. Ensuite elle est un concept qui permet aux philosophes, psychologues, écrivains et artistes d'explorer un vaste champ de recherche dans leurs domaines. La première partie va étudier l’histoire de l’art visuel du XIe siècle à nos jours et ensuite porte un regard sur l'art figuratif en Iran, La deuxième partie vise à étudier l’usage du corps dans l’art contemporain, notamment dans l'installation, en tant que sujet de violence physique, en nous basant sur les faits historiques et psychologiques. La troisième partie, consacrée à la performance, permettra d’analyser des représentations d’actes violents dans les œuvres d’artistes femmes en particulier, et révèlera le rôle essentiel de la violence sur nos concepts visuels. Ensuite, dans la dernière partie, qui traite de l'art vidéographique, nous examinerons les vidéos dont la violence est vue comme une action permanente qui, de plus, portent une réflexion sur les artistes et nous permet de s’intéresser à des œuvres plus récentes
From the plastic reflections, this research aims to study links between violence and contemporary art. Violence has different perspectives. It is primarily a physical force that generates numbers of tangible effects. Then it is a concept that allows philosophers, psychologists, writers and artists to explore a vast field of research in their domain.The first part is going to study the history of visual art from the XIth century to our days and then take a look at the figurative art in Iran. The second part aims to study the use of the body in contemporary art, especially in installation, as the subject of physical violence based on historical and psychological facts. The tird part, dedicated to performance, will analyze representations of violent acts in artistical works and reveals the essential role of violence on our visual concepts. Then, in the last part, which speak about video art, we will examine videos where the violence is a permanent action that, moreover, reflect on the artists and allows us to take an interest in more recent works
APA, Harvard, Vancouver, ISO, and other styles
10

Sanchez, Wendy. "Redefining identities in art through Santeria." Honors in the Major Thesis, University of Central Florida, 2009. http://digital.library.ucf.edu/cdm/ref/collection/ETH/id/1323.

Full text
Abstract:
This item is only available in print in the UCF Libraries. If this is your Honors Thesis, you can help us make it available online for use by researchers around the world by following the instructions on the distribution consent form at http://library.ucf.edu/Systems/DigitalInitiatives/DigitalCollections/InternetDistributionConsentAgreementForm.pdf You may also contact the project coordinator, Kerri Bottorff, at kerri.bottorff@ucf.edu for more information.
Bachelors
Arts and Humanities
Humanities
APA, Harvard, Vancouver, ISO, and other styles
More sources

Books on the topic "AXA Art"

1

Odamtten, Vincent O. The art of Ama Ata Aidoo: Polylectics and reading against neocolonialism. Gainesville: University Press of Florida, 1994.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Aurèlia, Capmany Maria. Ara. Esplugues de Llobregat, Barcelona: Plaza & Janés, 1988.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Amaral, Ana Luisa. Ara. Porto: Porto Editora, 2013.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Shaari, U.-Wei Hj. Wajah M50 Kini: Di Galeri Morne (Apa Ada dengan Tarikh). Kuala Lumpur: Institut Terjemahan & Buku Malaysia, 2014.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Rome (Italy). Assessorato alle politiche culturali. and Rome (Italy). Sovraintendenza ai beni culturali., eds. Ara Pacis. Milano: Electa, 2006.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Güler, Ara. Ara Güler. Beyoğlu, İstanbul: Antartist Yayıncılık, 2004.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

Çapan, Cevat. Ara sıcak. Beyoğlu, İstanbul: YKY, 2009.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Bosch, Lolita. Ara, escric. Barcelona: Empúries, 2011.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

Ara sıcak. Beyoğlu, İstanbul: YKY, 2009.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

1935-, Kuspit Donald B., and Centro Galego de Arte Contemporanea., eds. Ana Mendieta. [Galicia, Spain]: Centro Galego de Arte Contemporanea, 1996.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "AXA Art"

1

Williams, Tony G. "Ara Unit Tests." In Reaching Algebra Readiness (RAR), 23–34. Rotterdam: SensePublishers, 2011. http://dx.doi.org/10.1007/978-94-6091-509-3_4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Meures, Thomas. "The Askaryan Radio Array (ARA)." In Development of a Sub-glacial Radio Telescope for the Detection of GZK Neutrinos, 37–57. Cham: Springer International Publishing, 2015. http://dx.doi.org/10.1007/978-3-319-18756-3_4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Lan Tien Nguyen Do, Lynna. "Americans with Disabilities Act (ADA)." In Encyclopedia of Child Behavior and Development, 85–86. Boston, MA: Springer US, 2011. http://dx.doi.org/10.1007/978-0-387-79061-9_116.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Geddes, Patrick, and Ray Bromley. "City Quarters Continued, Ara Bazar." In Town Planning towards City Development, 157–58. Abingdon, Oxon ; New York, NY : Routledge, 2017. | Series: Studies in: Routledge, 2017. http://dx.doi.org/10.4324/9781315761961-31.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Rustum, Youcef M., and Joel Campbell. "Metabolic Modulation of Ara-C." In Biochemical Modulation of Anticancer Agents: Experimental and Clinical Approaches, 153–70. Boston, MA: Springer US, 1986. http://dx.doi.org/10.1007/978-1-4613-2331-0_8.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Freund, A., A. Gescher, and J. Boos. "Modulation of Ara-C Cytotoxicity by Coadministration with Antisignalling Drugs in HL60 and Ara-C-Resistant HL60/Ara-C Cells." In Haematology and Blood Transfusion / Hämatologie und Bluttransfusion, 620–27. Berlin, Heidelberg: Springer Berlin Heidelberg, 1998. http://dx.doi.org/10.1007/978-3-642-71960-8_83.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Kawasaki, Hajime, Masamune Higashigawa, Toshiki Ohkubo, Hitoshi Kamiya, and Minoru Sakurai. "Relationship between Intraellular dCTP/Ara-CTP Ratio and Cytotoxic Effect of Ara-C." In Advances in Experimental Medicine and Biology, 369–74. Boston, MA: Springer US, 1989. http://dx.doi.org/10.1007/978-1-4684-5676-9_54.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Steimle, Josh. "Ada Chen Rekhi." In Chief Marketing Officers at Work, 109–19. Berkeley, CA: Apress, 2016. http://dx.doi.org/10.1007/978-1-4842-1931-7_11.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Buckberrough, Sherry. "Ana Mendieta's Silueta Series (1973–1980)." In Iconic Works of Art by Feminists and Gender Activists, 146–61. Abingdon, Oxon; New York: Routledge, 2021.: Routledge, 2021. http://dx.doi.org/10.4324/9781003147770-9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Shreve, Gregory M., Erik Angelone, and Isabel Lacruz. "Chapter 3. Are expertise and translation competence the same?" In American Translators Association Scholarly Monograph Series, 37–54. Amsterdam: John Benjamins Publishing Company, 2018. http://dx.doi.org/10.1075/ata.18.03shr.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "AXA Art"

1

Golovchinksy, Gene, Scott Carter, and Anthony Dunnigan. "ARA." In the 19th ACM international conference. New York, New York, USA: ACM Press, 2011. http://dx.doi.org/10.1145/2072298.2072464.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Zhang, Hongwei, Yong Guan, Ahmed Kamal, Daji Qiao, Mai Zheng, Anish Arora, Ozdal Boyraz, et al. "ARA." In ACM MobiCom '21: The 27th Annual International Conference on Mobile Computing and Networking. New York, NY, USA: ACM, 2021. http://dx.doi.org/10.1145/3477086.3480837.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Lisek, Robert B. "AIA: Artificial intelligence for art." In Electronic Visualisation and the Arts. BCS Learning & Development, 2018. http://dx.doi.org/10.14236/ewic/eva2018.5.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Kraft, M., M. Görtz, J. A. Müntjes, W. Mokwa, N. J. Cleven, and T. Schmitz-Rode. "D9.3 - State of the Art Telemetric Implantable Sensors and Their Encapsulation." In AMA Conferences 2013. AMA Service GmbH, Von-Münchhausen-Str. 49, 31515 Wunstorf, Germany, 2013. http://dx.doi.org/10.5162/sensor2013/d9.3.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Ng, Audrey. "Grown microbial 3D fiber art, Ava." In UbiComp '17: The 2017 ACM International Joint Conference on Pervasive and Ubiquitous Computing. New York, NY, USA: ACM, 2017. http://dx.doi.org/10.1145/3123021.3123069.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Li, Bo, Jianwei Gong, Yan Jiang, Hany Nasry, and Guangming Xiong. "ARA*+: Improved Path Planning Algorithm Based on ARA*." In 2012 IEEE/WIC/ACM International Joint Conferences on Web Intelligence (WI) and Intelligent Agent Technologies (IAT). IEEE, 2012. http://dx.doi.org/10.1109/wi-iat.2012.13.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Schmidt, Nicholas. "Theory Of The Root Lines Of The General Polynomial." In ARA 40th Congress. American Romanian Academy of Arts and Sciences, 2016. http://dx.doi.org/10.14510/40ara2016.4026.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Sabau, Isabelle, and Carmen Sabau. "Dialogue and Critical Thinking Online." In ARA 40th Congress. American Romanian Academy of Arts and Sciences, 2016. http://dx.doi.org/10.14510/40ara2016.4010.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Stoica, Angela. "Towards a preventive approach in ethnotherapy." In ARA 40th Congress. American Romanian Academy of Arts and Sciences, 2016. http://dx.doi.org/10.14510/40ara2016.4011.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Costea, Ileana. "An emigration story, “Exercises in not-forgetting”, and 3 ARA Congresses." In ARA 40th Congress. American Romanian Academy of Arts and Sciences, 2016. http://dx.doi.org/10.14510/40ara2016.4006.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "AXA Art"

1

SIMMONS SA. AMEC GEOMATRIX/ARA GROUNDWATER REMEDIAITON TRIP REPORT. Office of Scientific and Technical Information (OSTI), August 2008. http://dx.doi.org/10.2172/936783.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Dass, William C., and Douglas H. Merkle. Computational Aspects of the ARA Three Invariant Constitutive Model. Fort Belvoir, VA: Defense Technical Information Center, May 1986. http://dx.doi.org/10.21236/ada170072.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Dr. Richard WOol, Dr. X. Susan Sun, and Rich Chapas. Affordable Resins and Adhesives From Optimized Soybean Varieties (ARA Program). Office of Scientific and Technical Information (OSTI), April 2004. http://dx.doi.org/10.2172/823365.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Cheung, Yin-Wong, and Menzie Chinn. Are Macroeconomic Forecasts Informative? Cointegration Evidence from the ASA-NBER Surveys. Cambridge, MA: National Bureau of Economic Research, February 1999. http://dx.doi.org/10.3386/w6926.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Judge, Elizabeth, James E. Barefield, John M. Berg, and Leonardo Trujillo. LANL Testing of DTRA Sponsored ARA Portable LIBS Instruments: Isotopic Module. Office of Scientific and Technical Information (OSTI), March 2013. http://dx.doi.org/10.2172/1068953.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Kujak, S. K. ATR for the AX-101 pumping and instrumentation control skid. Office of Scientific and Technical Information (OSTI), June 1996. http://dx.doi.org/10.2172/662087.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Dick, David R. Slaying the Software Dragon ... A Look at How Software Engineering, the Ada Programming Language and Process Maturity Are Changing Software Development. Fort Belvoir, VA: Defense Technical Information Center, June 1991. http://dx.doi.org/10.21236/ada237156.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Collins, Sara R. Collins, Michelle M. Doty Doty, and Munira Z. Gunja Gunja. Following the ACA Repeal-and-Replace Effort, Where Does the U.S. Stand on Insurance Coverage? Findings from the Commonwealth Fund Affordable Care Act Tracking Survey, March–June 2017. New York, NY United States: Commonwealth Fund, September 2017. http://dx.doi.org/10.15868/socialsector.28211.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Pickett, S. L., and S. L. Morton. Health and Safety Plan for Operations Performed for the Environmental Restoration Program: Task, Characterization of Potential Waste Sources at Auxiliary Reactor Area-1 Operable Unit 5--07 site ARA-02. Office of Scientific and Technical Information (OSTI), June 1992. http://dx.doi.org/10.2172/7117630.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Pickett, S. L., and S. L. Morton. Health and Safety Plan for Operations Performed for the Environmental Restoration Program: Task, Characterization of Potential Waste Sources at Auxiliary Reactor Area-1 Operable Unit 5--07 site ARA-02. Office of Scientific and Technical Information (OSTI), June 1992. http://dx.doi.org/10.2172/10164253.

Full text
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'AXA Art' for particular source types:
Journal articles Dissertations / Theses Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography