To see the other types of publications on this topic, follow the link: AXA Art.
Dissertations / Theses on the topic 'AXA Art'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 dissertations / theses for your research on the topic 'AXA Art.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
Lhotská, Tereza. "Pojištění v oblasti umění." Master's thesis, Vysoká škola ekonomická v Praze, 2014. http://www.nusl.cz/ntk/nusl-201949.
Full textAbstract:
The diploma thesis is focused on insurance of art. In the first part of the thesis the chapters contain areas of art which are insured in practice. The paper analyzes insurance of cultural heritage, works of art, musical instruments and cultural events. Each chapter describes the specifics of the areas and the most used kinds of insurance, including practical examples. In the last chapter of the first part I outline the situation abroad and its comparison with the Czech market. As an example, a foreign insurance company has been selected by AXA Art. The second part is devoted to insurance of Czech Philharmonic. It contains links to the orchestra, the historic building and the gallery. Funded organizations of the Ministry of Culture occupy a significant portion of the paper. In this thesis, I do not mention insurance in the film industry.
2
Liberatti, Elisângela. "Ara, Chico." Florianópolis, 2012. http://repositorio.ufsc.br/xmlui/handle/123456789/100652.
Full textAbstract:
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Comunicação e Expressão. Programa de Pós-Graduação em Estudos da TraduçãoMade available in DSpace on 2013-06-25T21:17:18Z (GMT). No. of bitstreams: 1 309863.pdf: 6321954 bytes, checksum: afe6f76a500e5b7db68ec4fb19d30b1c (MD5)
Esta pesquisa situa-se na intersecção entre Estudos da Tradução, tradução de quadrinhos e funcionalismo nordiano (1991). Seu objetivo é propor uma tradução comentada com enfoque funcionalista de duas histórias em quadrinhos (HQs) do Chico Bento, no par linguístico português-inglês, sob a perspectiva teórico-metodológica do funcionalismo nordiano e do conceito de pseudodialeto caipira sugerido por Bagno (2011). A tradução da variação linguística presente nos quadrinhos do Chico Bento faz-se importante para a área de Estudos da Tradução pelo fato de que (pseudo)dialetos caracterizam e marcam o usuário da língua e, portanto, são elementos significativos em traduções cujo propósito seja a manutenção no texto alvo (TA) das características linguísticas presentes no texto fonte (TF). Com isso, é papel do tradutor identificar o propósito do (pseudo)dialeto presente no TF e assegurar que tal propósito mantenha-se consistente na tradução. Partindo-se do princípio de que as HQs do Chico Bento buscam retratar, ficcionalmente, a vida do caipira brasileiro e que a fala dos personagens seja uma tentativa de representação do cenário caipira dessas histórias, a tradução proposta busca manter o pseudodialeto caipira representado nas HQs, além de adaptar tais HQs ao público a quem o TA se destina, conceito da teoria funcionalista de Nord.
This research is situated at the intersection between Translation Studies, comics' translation, and Nord's functionalist approach (1991). Its objective is to propose a functionalist translation with commentary of two Chuck Billy's comics, in the linguistic-pair Portuguese-English, from the theoretical and methodological perspective of Nord's functionalist approach and the concept of hillbilly (pseudo)dialect suggested by Bagno (2011). The translation of the linguistic variation present in Chuck Billy's comics is important to the Translation Studies area because (pseudo)dialects characterize and mark the language user, being meaningful elements in translations in which the purpose is the maintenance in the target text (TT) of the linguistic characteristics present in the source text (ST). Therewith, it is the translator's role to identify the purpose of the (pseudo)dialect present in the ST and ensure that such purpose is still consistent in the translation. Assuming that Chuck Billy's comics try to fictionally portray the life of a Brazilian hillbilly and that the character's speech is an attempt to represent the hillbilly scenario of such comics, the proposed translations try to maintain the hillbilly (pseudo)dialect represented in the comics, as well as to adapt such comics to the public to whom the TT is destined, a concept from Nord's functionalist approach.
3
Liza, Rodríguez Jacqueline Susann. "Determinación del sexo en guacamayos de las especies Ara ararauna, Ara macao, Ara chloropthera, Ara militaris, Propyrrhura couloni mediante el uso del ADN." Bachelor's thesis, Universidad Nacional Mayor de San Marcos, 2006. https://hdl.handle.net/20.500.12672/685.
Full textAbstract:
Con la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas.
Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo.--- With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.
Tesis
4
Boldt, Andrea. "Charakterisierung der Erdnussallergene Ara h 1, Ara h 3/4 und ihrer Isoformen." [S.l.] : [s.n.], 2005. http://deposit.ddb.de/cgi-bin/dokserv?idn=976057409.
Full text
5
On, Calvin. "ANA : a method for ARM-on-ARM execution." Thesis, Massachusetts Institute of Technology, 2007. http://hdl.handle.net/1721.1/45973.
Full textAbstract:
Thesis (M. Eng.)--Massachusetts Institute of Technology, Dept. of Electrical Engineering and Computer Science, 2007.Includes bibliographical references (p. 61-62).
This thesis proposes and implements ANA, a new method for the simulation of ARM programs on the ARM platform. ANA is a lightweight ARM instruction interpreter that uses the hardware to do a lot of the work for the read-decode-execute piece of simulation. We compare this method to the two existing methods of full simulation and direct execution that have been traditionally used to achieve this. We demonstrate that despite some setbacks caused by the prefetching and caching behaviors of the ARM, ANA continues to be a very useful tool for prototyping and for increasing simulator performance. Finally, we identify the important role that ANA can play in our current efforts to virtualize the ARM.
by Calvin On.
M.Eng.
6
Marques, Adriana Ribeiro de Oliveira. "Caracterização da estrutura genética populacional das araras vermelhas Ara chloropterus e Ara macao (Psittaciformes, Aves)." Universidade de São Paulo, 2011. http://www.teses.usp.br/teses/disponiveis/41/41131/tde-12052011-152811/.
Full textAbstract:
O objetivo do presente estudo foi caracterizar a estrutura genética populacional de duas espécies de araras: Ara chloropterus e Ara macao. Foram analisadas amostras de sangue e penas de diferentes regiões no Brasil, de uma localidade na Bolívia e outra no Peru. Foram realizadas análises com DNA mitocondrial (região controladora e citocromo oxidase I) e nuclear (microssatélites) das duas espécies. Para A. chloropterus foram obtidos 2166 pares de base do DNA mitocondrial de 89 amostras e dados de seis locos de microssatélites de 95 amostras. A rede de haplótipos e a árvore de neighbor-joining construídas com dados mitocondriais e os índices de FST obtidos com os dois marcadores revelaram fraca estruturação genética. Isso pode ser devido a alto fluxo gênico apresentado ou retenção de polimorfismo ancestral. Portanto, a espécie parece se organizar em metapopulações (baixa estruturação genética e alto fluxo gênico). Nesse caso, seria interessante conservar indivíduos de diversas localidades e seus corredores. Para Muscular Dystrophy foram obtidos 2094 pares de base do DNA mitocondrial de 68 amostras e dados de sete locos de microssatélites de 64 amostras. A rede de haplótipos e a árvore de neighbor-joining construídas com dados mitocondriais e os índices de FST obtidos com os dois marcadores indicam ausência de diferenciação genética entre as localidades estudadas. A análise demográfica dessa espécie indica expansão populacional há pouco mais de 50.000 anos atrás e declínio populacional desde o último período máximo de glaciação. Estes resultados sugerem que essa espécie é constituída de uma única grande população que poderia ser considerada como uma única unidade de manejo caso outras diferenças (ex.: adaptações ecológicas locais) não sejam encontradas. Ambas as espécies estudadas apresentam alta diversidade genética, possivelmente devido a um intenso fluxo gênico dentro de cada uma.The present study aimed to characterize the population genetic structure of two macaw species: Ara chloropterus and Ara macao. Samples from various localities in Brazil, one in Bolivia and another in Peru were analyzed. Mitochondrial (control region and cytochrome oxidase I) and nuclear (microsatellites) DNA were analyzed. For A. chloropterus 89 individuals had 2166 bp of mitochondrial DNA sequenced and 95 individuals were genotyped for six polymorphic microsatellite loci. Network and the neighbor-joining tree constructed based on mitochondrial data and FST values obtained with both molecular markers revealed weak genetic structure. This can be due to high gene flow or retained ancestral polymorphism. Thus, A. chloropterus seems to be organized in metapopulations (low genetic structure and high gene flow). Under this scenario, it would be desirable to preserve individuals from various locations and there corridors. For Muscular Dystrophy we obtained 2094 bp of mitochondrial DNA for 68 individuals and data on seven microsatellites for 64 individuals. The haplotype network and the neighbor-joining tree constructed based on mitochondrial data and FST values obtained with both molecular markers revealed no genetic differentiation among localities. The demographic analysis of this species indicated a population expansion 50,000 years ago and a population decline since the last glaciation maximum. These results suggest that this species is organized as a large population that could be considered as a single management unit for conservation purposes if other differences are not found (eg. local ecological adaptations). Both species have high genetic diversity, possibly due to extensive gene flow within each one.
7
Cooke, Jacqueline. "Art ephemera, aka "Ephemeral traces of 'alternative space' : the documentation of art events in London 1995-2005, in an art library"." Thesis, Goldsmiths College (University of London), 2007. http://research.gold.ac.uk/3475/.
Full textAbstract:
This research is based on reflexive practice as a subject librarian for visual art, concerned with representation (of artists) and context (of art practice and its representation) in the academic library, as a heterotopia. My thesis is that the aim to create an ‘alternative’ art space remained operative in London between 1995 and 2005, although the term was decried. The research addresses the problem of documentation of transient contemporary art practices, by collecting and analysing ephemera and developing a resource based upon them. Art ephemera are by-products of institutions, galleries, exhibitions, and curatorialactivities that may be significant in terms of criticality but which are often not recorded adequately and remain un-archived. The strategies of representation that ephemera mobilise take place at an interface of art aims and social structures, an area that has been a vital site of contemporary practice. I review major issues in contemporary criticism of the ‘avant-garde’ and ‘alternative’,showing the discourse of the alternative to be an ethical discourse about practice. Identifying citation as means of interpretation, I draw my account from a reading ofephemera in the chapters: “Citation, marginalia, mockery, fakes and tailpieces” where I identify visual and textual qualities of ephemera, “Artists, spaces and institutions,”where I present the themes of mapping London and self-institutionalisation, and “Counter to ?” where I report a distancing from counter-cultural aims and development of complex alternatives. I evaluate existing collections of art ephemera in libraries, projects to facilitate access to them, and cataloguing and collecting policies. I advocate use of catalogues to recontextualise ephemera. In conclusion, I present a complex notion of ‘alternative space’ in art practice as a space for dialogue with, rather than opposition to established institutions and circuits of contemporary art and I endorse collection of ephemera as a source for diverse histories.
8
Vieira, Carlos Jorge Canto. "Capitéis de ara do Municipium Olisiponense." Master's thesis, Instituições portuguesas -- UNL-Universidade Nova de Lisboa -- FCSH-Faculdade de Ciências Sociais e Humanas -- -Departamento de História da Arte, 1998. http://dited.bn.pt:80/30318.
Full text
9
Sadeghi, Seyedeh Tara. "De la violence dans l'art contemporain à partir des oeuvres de Valie Export, Marie-Jo Lafontaine, Ana Mendieta et quelques autres." Thesis, Aix-Marseille, 2018. http://www.theses.fr/2018AIXM0670.
Full textAbstract:
A partir des réflexions plastiques, cette recherche vise à étudier des liens entre la violence et l’art contemporain. La violence s’inscrit dans différentes perspectives. Elle est d’abord une force physique qui génère un certain nombre d’effets tangibles. Ensuite elle est un concept qui permet aux philosophes, psychologues, écrivains et artistes d'explorer un vaste champ de recherche dans leurs domaines. La première partie va étudier l’histoire de l’art visuel du XIe siècle à nos jours et ensuite porte un regard sur l'art figuratif en Iran, La deuxième partie vise à étudier l’usage du corps dans l’art contemporain, notamment dans l'installation, en tant que sujet de violence physique, en nous basant sur les faits historiques et psychologiques. La troisième partie, consacrée à la performance, permettra d’analyser des représentations d’actes violents dans les œuvres d’artistes femmes en particulier, et révèlera le rôle essentiel de la violence sur nos concepts visuels. Ensuite, dans la dernière partie, qui traite de l'art vidéographique, nous examinerons les vidéos dont la violence est vue comme une action permanente qui, de plus, portent une réflexion sur les artistes et nous permet de s’intéresser à des œuvres plus récentesFrom the plastic reflections, this research aims to study links between violence and contemporary art. Violence has different perspectives. It is primarily a physical force that generates numbers of tangible effects. Then it is a concept that allows philosophers, psychologists, writers and artists to explore a vast field of research in their domain.The first part is going to study the history of visual art from the XIth century to our days and then take a look at the figurative art in Iran. The second part aims to study the use of the body in contemporary art, especially in installation, as the subject of physical violence based on historical and psychological facts. The tird part, dedicated to performance, will analyze representations of violent acts in artistical works and reveals the essential role of violence on our visual concepts. Then, in the last part, which speak about video art, we will examine videos where the violence is a permanent action that, moreover, reflect on the artists and allows us to take an interest in more recent works
10
Sanchez, Wendy. "Redefining identities in art through Santeria." Honors in the Major Thesis, University of Central Florida, 2009. http://digital.library.ucf.edu/cdm/ref/collection/ETH/id/1323.
Full textAbstract:
This item is only available in print in the UCF Libraries. If this is your Honors Thesis, you can help us make it available online for use by researchers around the world by following the instructions on the distribution consent form at http://library.ucf.edu/Systems/DigitalInitiatives/DigitalCollections/InternetDistributionConsentAgreementForm.pdf You may also contact the project coordinator, Kerri Bottorff, at kerri.bottorff@ucf.edu for more information.Bachelors
Arts and Humanities
Humanities
11
Ara, Fardaus [Verfasser]. "Women in Electoral Politics. Does Development Matter? / Fardaus Ara." München : GRIN Verlag, 2021. http://d-nb.info/1238431860/34.
Full text
12
Monardes, Díaz Lisette Valeska. "Descripción y comparación de las características anatómicas diferenciales de huesos de Amazona aestiva, Ara ararauna, Ara macao y Ara chloroptera, que contribuye a la identificación de las especies, en casos de tráfico de aves, en Brasil." Tesis, Universidad de Chile, 2017. http://repositorio.uchile.cl/handle/2250/143677.
Full textAbstract:
Memoria para optar al Título Profesional de Médico Veterinario.Los delitos contra la fauna silvestre son cada vez más frecuentes. Dentro de estos se destaca el tráfico animal, una práctica ilegal que tiene impacto directo en la conservación de la fauna, porque extraen individuos de su habitad, introduce especies invasoras a otras regiones, genera movimiento de patógenos entre fronteras, además del maltrato que sufren las especies por las condiciones en las que son transportadas. Por esta razón, surge la necesidad de generar herramientas que permitan cuantificar el real impacto de este delito y las principales especies victimizadas, para así emplear medidas de mitigación. Para esto, es de gran relevancia lograr identificar los restos óseos de las especies halladas en los sitios de suceso. La identificación de especies a través de restos óseos, es una técnica rápida y de bajo costo, la cual se puede usar en terreno. Para lograr la correcta identificación de las especies en cuestión, es necesario contar con una guía estandarizada de los huesos de las diferentes especies. En el presente estudio se logró describir estructuras anatómicas de los huesos de cráneo, mandíbula, húmero, esternón, pelvis y fémur de las cuatro especies de interés: amazona frentiazul (Amazona aestiva), guacamayo azul-amarillo (Ara ararauna), guacamayo escarlata (Ara macao) y guacamayo rojo (Ara chloreoptera). Además, se consiguió comparar las características morfológicas diferenciales y específicas, que permiten identificarlas correctamente. Así, en el análisis de los resultados, se encontraron diferencias en la forma y desarrollo de ciertas estructuras, principalmente en el cráneo, esternón, pelvis y fémur, que permiten diferenciar una especie respecto de las otras, convirtiéndose en los huesos más relevantes en el proceso de identificación de amazona en relación a las tres especies de guacamayo, pero no así entre guacamayos mismos. El cráneo, es la estructura que presentó las mayores diferencias anatómicas, en la unión entre el proceso postorbital y arco suborbital, en la forma y disposición de las narinas, y en la proyección del hueso prefontal. Esto nos permitirá construir una guía anatómica osteológica comparativa, que permita su identificación en el sitio de suceso.
Crimes against wildlife are becoming more frequent. These include animal trafficking, an illegal practice that has a direct impact on the conservation of wildlife, because they extract individuals from their habitat, introduce invasive species into other regions, generate movement of pathogens across borders, as well as the mistreatment of the animals. Species by the conditions in which they are transported. For this reason, the need arises to generate tools to quantify the real impact of this crime and the main victimized species, in order to use mitigation measures. For this, it is of great relevance to identify the bone remains of the species found in the sites of success. Identification of species through skeletal remains is a quick and inexpensive technique, which can be used on the ground. To achieve the correct identification of the species in question, it is necessary to have a standardized guide of the bones of the different species. In the present study, anatomical structures of the skull, jaw, humerus, sternum, pelvis and femur bones of the four species of interest were described: amazona frentiazul (Amazona aestiva), blue-yellow macaw (Ara ararauna), scarlet macaw Ara macao) and red macaw (Ara chloreoptera). In addition, it was possible to compare the differential and specific morphological characteristics, which allow to identify them correctly. Thus, in the analysis of the results, differences were found in the shape and development of certain structures, mainly in the skull, sternum, pelvis and femur, that allow differentiating one species from the others, becoming the most relevant bones in the Process of identification of Amazon in relation to the three species of macaw, but not so among macaws themselves. The skull is the structure that presented the greatest anatomical differences, in the union between the postorbital process and suborbital arch, in the shape and arrangement of the nostrils, and in the projection of the prefrontal bone. This will allow us to construct a comparative anatomical osteological guide, allowing its identification at the site of occurrence.
13
Hudson, Michelle L. "Beyond Self: Strategic Essentialism in Ana Mendieta's "La Maja de Yerba"." Digital Archive @ GSU, 2011. http://digitalarchive.gsu.edu/art_design_theses/72.
Full textAbstract:
Artist Ana Mendieta frequently conjoined the female body with nature to express her search for personal identity and support for feminist topics. Her last intended and least scholarly examined work, La Maja de Yerba (Grass Goddess), continues specific visual and thematic elements of her previous Silueta Series (Silhouette) yet also presents an aesthetically unique creation. Despite its incompletion as a result of her premature death, the preserved maquette directly stipulates a female form to be planted in grass on the Bard College campus grounds. This alignment of women and nature garners criticism for its reliance on universalism and categorizations of women’s experiences; however, Mendieta’s use of essentialism in public art contributes to circulating feminist discourse to a wider audience. This paper considers the artistic influences, thematic concepts, and employment of strategic essentialism in Mendieta’s La Maja de Yerba.
14
Lingerfelt, Wes, and Dan Dawson. "A Small State-of-the Art Range Safety Telemetry System." International Foundation for Telemetering, 1993. http://hdl.handle.net/10150/611839.
Full textAbstract:
International Telemetering Conference Proceedings / October 25-28, 1993 / Riviera Hotel and Convention Center, Las Vegas, NevadaThe US Air Force is required to protect the lives of individuals and property in areas potentially hazardous as a result of launch vehicle failures occurring from Vandenberg AFB, California. This paper describes the application of modern telemetry processing equipment to the Range Safety function.
15
Reilly, Virginia J. Jr. "Essential Standards for Institutional Self-Evaluation of The Americans with Disabilities Act." Diss., Virginia Tech, 1997. http://hdl.handle.net/10919/29823.
Full textAbstract:
The purpose of this study was to identify standards related to the Americans with Disabilities Act (ADA) that are desirable for colleges conducting a self-study regarding program accessibility. A Delphi technique was used to determine standards and reach agreement among a panel of professionals concerning criteria to evaluate implementation of the ADA during a self-study or during an accreditation process. The panel's standards were compared to information from a focus group of university students with disabilities.
The panel of experts consisted of 30 professionals representing three areas: (a) agencies involved in the implementation and enforcement of the ADA, (b) postsecondary service providers recognized as leaders in their field by the Association on Higher Education and Disability (AHEAD), and (c) legal professionals specializing in the ADA. Students with various disabilities comprised a focus group to provide different voices of the stakeholders' perspective.
The panel generated standards from an open questionnaire in the first round of the Delphi. The results were compiled and organized into questionnaire form for phase II. The questionnaire was structured with a four point Likert-type scale allowing the panel to react positively or negatively to including each standard in the evaluation criteria. The scale consisted of: (4) critical, (3) valuable, (2) minimal, and (1) unnecessary. The panel was able to add or change standards in Phase II. In Phase III the standards were listed, and the mean from the ratings in Phase II were reported along with a reminder of the individual's rating in Phase II. The panel could change their ratings to agree with the mean, or they could provide their argument for keeping their original ranking if not matching the mean.
The mean was recalculated after Phase III, and data from this round was used to establish the acceptable standards. All standards receiving a total of two-thirds of the responding panel members' votes in the critical and valuable categories were included in the proposed evaluation model. This information was then compared to information collected in the student focus group.
The results of both the student focus group and the Delphi technique indicated a difference in perspectives of the stakeholders and experts. The research study revealed that the students were more concerned about services for high-schoolers prior to entering college. In contrast, the experts focused more on policy and administrative responsibilities. The Delphi panel and student focus group agreed on several issues important to program access. Both groups saw financial assistance, including support of assistive technology, as critical. They also agreed on the importance of training faculty, administrators and students about accommodations, as well as legal rights and responsibilities under the ADA. Students and panelists acknowledged a shared responsibility between the college and agencies such as the Department of Rehabilitative Services. However, the panelists did not agree with the students on the areas of outreach and collaboration. Although students valued strengthened transition services and training sessions in secondary schools, the Delphi panel did not mention these as areas for an ADA self-evaluation.
It was recommended that the accepted standards be shared with AHEAD, the National Association of ADA Coordinators (NAADAC) and the Council for the Advancement of Standards for Student Services/Development Programs (CAS). AHEAD and NAADAC can use the standards as guidelines for self-evaluation and as a resource for training. It was also recommended that CAS and other accreditation agencies use the developed standards to add more guidance regarding accessibility to the accreditation and self-study process.Ph. D.
16
Çetin, Hasibe Hande Kutlu Akif. "Sanal mikro denetleyici laboratuarı için sistem yöneticisi ara yüzü tasarımı /." Isparta: SDÜ Fen Bilimleri Enstitüsü, 2006. http://tez.sdu.edu.tr/Tezler/TF00987.pdf.
Full text
17
Moraes, Josiane Borges de. "Intersecções semióticas: a Istambul de Orhan Pamuk e Ara Güler." Pontifícia Universidade Católica do Rio Grande do Sul, 2014. http://hdl.handle.net/10923/7064.
Full textAbstract:
Made available in DSpace on 2015-03-11T02:01:27Z (GMT). No. of bitstreams: 1
000466163-Texto+Completo-0.pdf: 4405555 bytes, checksum: f9f26d750766a50363983c0c95bb665d (MD5)
Previous issue date: 2014The goal with this Master’s Thesis is the analysis of the hybridism between two distinctive arts, Photography and Literature, especially in Pamuk’s Istambul. In this sense, a previous incursion in the world of Photography and its intersections among several literary works will trigger the starting point. Photographers as Marey, Muybridge, Nakaji Yusui, Alfred Stieglitz illustrate the permeable way that the art of writing through light relates to other kinds of art. Duane Michals shows his avant-garde photographic narrative, and Leonardo da Vinci reveals how the art of the numbers works in “eye-catching” images. As a contribution Roland Barthes sews up the theory of these worlds amongst Susan Sontag, Derrida, Hegel and Benjamin, turning possible a safe landing in Istambul where, in the end, the study about Pamuk’s text, which is illustrated with Ara Güler’s photographic work, culminates. The search here takes another bias and Sebald helps doing a counterpoint: writing the text with the pictures that were previously chosen versus subsequent choice, that is the way Pamuk does seeking in Güler’s Istambul the hüzün eye as genuine as his own.
A dissertação apresentada tem por objetivo a análise do hibridismo de duas artes, Fotografia e Literatura, especialmente na obra Istambul de Orhan Pamuk. Para tanto, uma incursão prévia no mundo da Fotografia e intersecções com outras obras literárias dará o ponto de partida. Fotógrafos como Marey, Muybridge, Nakaji Yusui, Alfred Stieglitz ilustram o modo permeável como a arte da escrita com a luz se relaciona com outras artes. Duane Michals dá o testemunho de uma narratividade fotográfica à frente de seu tempo e Leonardo da Vinci mostra como a arte dos números faz com que nosso olhar se fixe em determinado ponto da imagem. Para contribuir Roland Barthes faz a sutura teórica destes dois mundos juntamente com Susan Sontag, Derrida, Hegel e Benjamin, possibilitando uma aterrissagem segura em Istambul onde, por fim, o estudo sobre o texto de Pamuk ilustrado com a obra fotográfica de Ara Güler culmina. A busca aqui toma um viés particular e Sebald auxilia em um contraponto: a produção do texto com as fotografias previamente escolhidas versus escolha posterior, como Pamuk faz buscando na Istambul de Güler o hüzün de um olhar tão genuíno como o seu.
18
Muller, Daliana. "Desenvolvimento de filtros cerâmicos fibrosos ara gases a altas temperaturas." Florianópolis, SC, 2008. http://repositorio.ufsc.br/xmlui/handle/123456789/91499.
Full textAbstract:
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro Tecnológico. Programa de Pós-graduação em Ciência e Engenharia de MateriaisMade available in DSpace on 2012-10-23T23:39:59Z (GMT). No. of bitstreams: 1 255098.pdf: 3928389 bytes, checksum: 494a766f18af25327a7e680e3bf8b306 (MD5)
Estruturas fibrosas são especialmente indicadas para filtração a temperaturas elevadas, pela alta permeabilidade aliada à alta eficiência de coleta. Neste trabalho, mantas refratárias sílico-aluminosas comerciais foram prensadas uniaxialmente, utilizando-se 10% em massa de acetato de polivinila como ligante. Após a prensagem as amostras foram submetidas a um tratamento térmico a 500°C durante 1 h para degradação do polímero. Subsequentemente, as amostras foram sinterizadas a temperaturas de 1200°C e 1350°C durante 1 h, resultando em uma estrutura fibrilar porosa com densidades relativas entre 0,28 e 0,43, que correspondem a porosidades na faixa de 53% a 73%, respectivamente. A arquitetura tridimensional de uma cerâmica celular/fibrosa (densidade relativa <0,3) foi caracterizada pelos seguintes parâmetros morfométricos: distribuição de tamanho de poro, espessura da parede, grau de anisotropia, densidade de conectividade, índice estrutural, porosidade e natureza de poros (fechados/abertos). Neste trabalho foi avaliada a influência desses parâmetros nas propriedades mecânicas de filtros fibrosos. A morfologia dos filtros fibrosos foi caracterizada através de microscopia eletrônica de varredura, software de análise de imagem (IMAGO®) e microtomografia computadorizada ( -CT). A resistência mecânica foi avaliada através de ensaios de compressão. Ensaios de permeabilidade, resistência à flexão de 4 pontos e eficiência de coleta em função da temperatura foram efetuados e os resultados comparados aos filtros existentes. Os valores obtidos para a permeabilidade e eficiência de coleta estão na ordem de grandeza esperada para filtros de gases, apresentando assim grande potencial para aplicações industriais.
19
Tolley, Rebecca. "Review of Ida Applebroog: Are You Bleeding Yet?" Digital Commons @ East Tennessee State University, 2002. https://dc.etsu.edu/etsu-works/5715.
Full text
20
Kuykendall, Rene D. "Americans with Disabilities Act, title III compliance." Thesis, This resource online, 1995. http://scholar.lib.vt.edu/theses/available/etd-03032009-041012/.
Full text
21
Bahiense, Carla Rodrigues. "Determina??o de par?metros hematol?gicos e bioqu?micos de arara Canind? (Ara ararauna), no Estado do Rio de Janeiro." Universidade Federal Rural do Rio de Janeiro, 2010. https://tede.ufrrj.br/jspui/handle/jspui/1794.
Full textAbstract:
Submitted by Sandra Pereira (srpereira@ufrrj.br) on 2017-06-20T15:46:28Z
No. of bitstreams: 1
2010 - Carla Rodrigues Bahiense.pdf: 694207 bytes, checksum: 012f3bf71990c09f742e165f567b3e77 (MD5)Made available in DSpace on 2017-06-20T15:46:28Z (GMT). No. of bitstreams: 1 2010 - Carla Rodrigues Bahiense.pdf: 694207 bytes, checksum: 012f3bf71990c09f742e165f567b3e77 (MD5) Previous issue date: 2010-07-13
Belonging to the Order Psittaciformes, Family Psittacidae, the Ara ararauna, like other parrots, is a Brazilian bird much exploited in the pet market, which makes it a frequent veterinary patient. Despite of the extreme clinical relevance of laboratory examinations, data on hematology and serum biochemistry of this species are scarce. Several factors can interfere with the birds results of hematological and biochemical values, such as age, sex, reproductive period, among others. The study aimed to recognize patterns and to determine haematological and serum biochemical parameters for the species in question, explaining possible variations related to sex, management and method of restraint. In the experiment was used 68 specimens, 33 from a commercial breeding facility and 35 from the live collection of the RIOZOO Foundation. The blood samples were collected by jugular vein, transferred into tubes containing EDTA and other with no anticoagulant. Only the birds of RIOZOO were subjected to a new collection, which occurred 10 minutes after of anesthesia with isoflurane, thus forming a group of 33 animals anesthetized and another 35 unanesthetized. Of each animal were determined trombocyte conts, erythrocyte counts, total and specific leucocyte counts, concentrations of total plasmatic protein, urea, creatinine, uric acid, cholesterol, tryglicer?des, total serum protein, albumin and globulin, and activityes of alkaline phosphatase, aspartate aminotransferase, amylase, lipase, and creatine-kinase enzymes. The results were analyzed by ANOVA and paired T tests. Females had higher trombocitometria. Non-anesthetized animals had a greater total WBC count. Weren?t significant differences between anesthetized males and females. The birds originated from RIOZOO had higher values of PCV, red blood cell count, MCV, eosinophils, basophils, urea, AST and CK, however, lower values of albumin and creatinine. The study revealed that was a significant level of discrepancies between the different groups, allowing the creation of a standard more specific hematologic, according to the individual characteristics of each patient.
Pertencente ? Ordem Psittaciforme e Fam?lia Psittacidae, a Ara ararauna, assim como os demais psitac?deos, ? uma ave brasileira muito explorada no mercado pet, o que a torna um freq?ente paciente veterin?rio. Apesar da extrema relev?ncia cl?nica dos exames laboratoriais, dados acerca da hematologia e bioqu?mica s?rica dessa esp?cie ainda s?o escassos. Importante ? considerar tamb?m que diversos fatores n?o patol?gicos podem interferir em resultados dos exames hematol?gicos e bioqu?micos das aves, como a idade, sexo, per?odo reprodutivo, entre outros. O estudo teve como finalidade reconhecer e determinar padr?es hematol?gicos e bioqu?mico-s?ricos para a esp?cie em quest?o, elucidando poss?veis varia??es relacionadas a sexo, manejo e m?todo de conten??o. No experimento foram utilizados 68 exemplares, sendo 33 provenientes de um criat?rio comercial e 35 oriundos do acervo vivo da Funda??o RIOZOO. As amostras sangu?neas foram obtidas na veia jugular, transferidas, para tubos contendo EDTA e para outros sem anticoagulante. Somente as aves do RIOZOO foram tamb?m submetidas a uma nova coleta, que ocorreu 10 minutos ap?s anestesia com isoflurano, formando assim um grupo de 33 animais anestesiados e 35 n?o anestesiados. De cada animal foram aferidos trombocitometria, eritrocitometria, leucometrias global e espec?fica, determina??o de prote?nas plasm?ticas totais, ur?ia, creatinina, fosfatase alcalina, ?cido ?rico, colesterol, trigicer?deos, aspartato-aminotransferase, amilase, l?pase, creatinakinase, prote?nas totais s?ricas, albumina e globulinas. Os resultados foram analisados pelo teste ANOVA e teste t pareado. As f?meas apresentaram maior valor de trombocitometria. Os animais n?o anestesiados demonstraram um maior valor de leucometria global. N?o houve nenhuma diferen?a significatica entre machos e f?meas anestesiados. As aves oriundas do RIOZOO tiveram maior VG, hematimetria, VGM, contagem de eosin?filos e bas?filos, ur?ia, AST e CK, por?m, menores concentra??es de albumina e creatinina. O estudo revelou discrep?ncias a n?vel significativo entre os diferentes grupos estudados, permitindo um padr?o hematol?gico mais adequado com as caracter?sticas individuais de cada paciente.
22
Oliveira, Patricia Gomes De. "Avalia??o de acessos de psidium spp. Visando resist?ncia a o nematoide Meloidogyne enterolobii e ? salinidade." Universidade Estadual de Feira de Santana, 2017. http://localhost:8080/tede/handle/tede/572.
Full textAbstract:
Submitted by Jadson Francisco de Jesus SILVA (jadson@uefs.br) on 2018-01-26T22:52:48Z
No. of bitstreams: 1
Disserta??o Final_Patricia Gomes de Oliveira.pdf: 1649219 bytes, checksum: bbddc913ad0687cec74a62d0e8eb2b79 (MD5)Made available in DSpace on 2018-01-26T22:52:48Z (GMT). No. of bitstreams: 1 Disserta??o Final_Patricia Gomes de Oliveira.pdf: 1649219 bytes, checksum: bbddc913ad0687cec74a62d0e8eb2b79 (MD5) Previous issue date: 2017-06-14
Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior - CAPES
The world food production and the crop production has been affected by pests, insects, fungous, bacteria, viruses and nematodes and also by abiotic factors as water availability, soil salinity among others that affect several crops. The guava crop has important role in the economy, particularly in the family farming in Northeast Brazil especially in the irrigated crops of the Semiarid region. In this crop, Meloidogyne enterolobii, a gall nematode together with the Fusarium solani, cause a complex disease that make unviable several production areas. Besides these problems, the irrigated areas are prone to soil salinity that can also affect the crop. Thus, the search for genotypes in the genus Psidium to be used as resistant rootstock to these stresses or to be used in breeding programs that are devoted to obtain clones that allow the commercial production of guava in the country. Therefore, the aim of this work was to evaluate the reaction of Psidium spp. accessions to different doses of inoculum and also to evaluate the effect of osmoconditioning of Psidium guineense to saline stress. The first trial was carried out in a completely randomized bloc with eight replications. The accessions were inoculated with three inoculum densities (600, 1600 and 2000 eggs/mL) and they were evaluated 135 days after inoculation. The second trial was carried out in a completely randomized block with 25 seeds per replication, using osmoconditionated and not osmoconditionated seeds. It was found genetic variability among and within the accessions to reaction to M. enterolobii. Different inoculum densities can affect, in a differential way, the reproduction rate of the nematode in the root system of each plant and, thus, to make it difficult to identify the reaction of plants to the nematode M. enterolobii. Different electric conductivities affected the seeds regarding all variables evaluated in osmoconditionated and non condicionated seeds. The osmoconditioning can decrease the average and speed of seed germination of P. guineense in conditions of medium salinity level.
A produ??o mundial de alimentos e a produtividade agr?cola t?m sido bastante afetadas por agentes bi?ticos como pragas, insetos, fungos, bact?rias, v?rus e nematoides e tamb?m por fatores abi?ticos como a baixa disponibilidade h?drica, salinidade dos solos dentre outros afetando diversas culturas. A cultura da goiabeira tem importante papel na economia, com destaque para a agricultura familiar no Nordeste brasileiro, especialmente os cultivos irrigados do Semi?rido. Nessa cultura, Meloidogyne enterolobii, o nematoide-das-galhas da goiabeira, juntamente com Fusarium solani, causam doen?a complexa que tem inviabilizado muitas ?reas de produ??o. Al?m desses problemas, as ?reas irrigadas do Semi?rido s?o sujeitas a problemas de salinidade dos solos e que podem atingir tamb?m a cultura da goiabeira. Em vista disso, a busca, dentro do g?nero Psidium, por gen?tipos para uso direto como porta-enxertos resistentes a esses estresses ou para subsidiar programas de melhoramento gen?tico com vistas ? obten??o de clones que viabilizem a produ??o comercial da goiabeira, tornou-se a linha mais atual de alguns programas de pesquisa no Brasil. Assim o presente trabalho teve como objetivo avaliar a rea??o de acessos de Psidium spp. a diferentes densidades de in?culo e avaliar o efeito do osmocondicionamento de sementes de Psidium guineense submetidas ao estresse salino. O primeiro experimento foi realizado em delineamento inteiramente casualizado com oito repeti??es, onde os acessos foram inoculados com tr?s densidades de in?culo 600, 1600 e 2000 ovos/mL e avaliados 135 dias ap?s inocula??o. O segundo experimento foi em delineamento inteiramente casualizado com 25 sementes por repeti??es utilizando sementes osmocondicionadas e n?o osmocondicionadas. Existe variabilidade entre e dentro dos acessos avaliados para rea??o a M. enterolobii. Diferentes densidades de in?culo podem afetar de modo diferenciado, a taxa de reprodu??o do nematoide no sistema radicular de cada planta e, assim, dificultar a identifica??o da rea??o das plantas ao nematoide. M. enterolobii. Diferentes condutividades el?tricas afetaram todas as vari?veis avaliadas em sementes osmocondicionadas e n?o osmocondicionadas. O osmocondicionamento pode diminuir o tempo m?dio e velocidade m?dia de germina??o de sementes de Psidium guineense em condi??es de mediana salinidade.
23
Bracht, Christian. "Kunstkommentare der sechziger Jahre : Funktionen und Fundierungsprogramme /." Weimar : VDG, 2002. http://www.h-net.org/review/hrev-a0d4g3-aa.
Full text
24
Palomo, Chinarro Ana María. "La Maternidad en la creación plástica femenina. El caso de Ana Álvarez-Errecalde. Un estudio narrativo a propósito de la elaboración de un discurso expositivo y su materialización." Doctoral thesis, Universitat de Vic, 2015. http://hdl.handle.net/10803/313229.
Full textAbstract:
La tesi crea un nou espai de reflexió en torn a un concepte, controvertit i àmpliament qüestionat, com és el de “maternitat”, i l’ubica en la representació que del mateix concepte s’ha portat a terme en la plàstica contemporània femenina. Tracta de connectar àmbits de coneixement, tradicionalment isolats.
25
Moseley, Joseph. "Identifying Barriers to Enrollment of Diverse Populations in Arizona Following the Initial Open Enrollment Period of the Affordable Care Act." Thesis, The University of Arizona, 2017. http://hdl.handle.net/10150/623987.
Full textAbstract:
A Thesis submitted to The University of Arizona College of Medicine - Phoenix in partial fulfillment of the requirements for the Degree of Doctor of Medicine.While it is known that over 266,000 Arizonans enrolled in health coverage through the federal Marketplace and Medicaid from October 2013 through May 2014, little analysis has been performed to examine whether enrollment by diverse racial and ethnic groups sufficiently reduced disparities in coverage. We obtained publicly available data from the Census Bureau comparing rates of uninsured by race/ethnicity from 2013 to 2014 in Arizona from the American Community Survey. The uninsured rate in Arizona for the total civilian no institutionalized population dropped from 17% in 2013 to 13.6% in 2014. The uninsured rate in Arizona for whites declined from 15.7% to 12.2%, for African Americans declined from 17.4% to 11.1%, for American Indian/Alaskan Natives declined from 26.9% to 24.1%, for Asian Americans declined from 15.1% to 11.0% and for Hispanic/Latino declined from 27.5% to 22.2%. We conducted interviews with nine community organizations in order to identify barriers that must be addressed moving forward to lessen insurance coverage disparities among various minority groups. Technological literacy and functionality, lack of funding, lack of personnel, physical vastness of many populations, language, and cultural differences were commonly identified as barriers to enrollment. Mistrust of government and confusion regarding the specific provisions within the ACA pertaining to Native individuals were also cited.
26
Trapp, Franziska. "Lectures de cirque contemporain : un modèle d'analyse des représentations circassiennes axé sur des textes et contextes." Thesis, Montpellier 3, 2019. http://www.theses.fr/2019MON30002.
Full textAbstract:
En 1996, après avoir assisté à la dernière représentation de la septième édition du Centre National des Arts du Cirque, le journal parisien Libération prédit une troisième ère du Cirque : « Après les cirques traditionnels, puis les nouveaux cirques, il faut désormais compter avec le cirque contemporain. » Le pronostic devient réalité : la pièce du metteur en scène Joseph Nadj est considérée, en France comme ailleurs, comme le point de départ d’un nouveau genre dont la définition reste des plus vagues jusqu’à aujourd’hui : « Le cirque contemporain, lui, n’a strictement aucune unité formelle, ou disons, sans craindre le paradoxe, que c’est la diversité de ses formes qui l’unifie. » D’une part, cela s’explique par le fait que, dans le cirque contemporain, l’originalité est un moteur central et, d’autre part, que le genre se situe encore dans une phase de développement. Cela est en outre dû à l’absence jusqu’à aujourd’hui, dans la recherche scientifique, d’une analyse détaillée des représentations du cirque contemporain et qu’en plus on ne dispose pas d’un modèle d’analyse cohérente des représentations du genre. Le discours actuel autour du genre s’intéresse moins de savoir comment les spectacles de cirque contemporain engendrent du sens et quels sont les procédés caractéristiques qui les définissent. Au lieu de cela, on s’interroge sur ce qui devrait caractériser les pièces. Notre thèse tient compte de ce desiderata en développant pour la première fois une méthode pour analyser les représentations de cirque contemporain. En outre, elle explique et interprète résolument le genre au moyen d’une méthode solide, c’est-à-dire d’une description contextualisée de l’objet – à savoir la représentation – dans son contexte historique et culturel et fournit ainsi, au sens lessingien du terme, une dramaturgie du cirque contemporain qui, malgré la diversité des représentations, révèle des caractéristiques généralisables, le procédé fondamental, la structure des pièces et l'effet qu'elles produisent. Le développement du modèle de lecture pour les spectacles de cirque contemporain ainsi que l’évolution consécutive et la spécification du modèle s’appuient sur l'analyse textuelle de la poétique de la culture que justifie l’historien de la littérature Moritz Baßler dans son œuvre La fonction d’une poétique de la culture et l’archive sur la base du New Historicism conçu par Stephen Greenblatt. En outre, le travail présent se situe dans le domaine des théories de lecture relevant de la science du théâtre (Fischer-Lichte) et de la danse (Foster et Brandstetter). Le noyau de l‘argumentation se fonde sur l’hypothèse selon laquelle les représentations de cirque sont lisibles en tant que textes culturelsIn 1996, the Paris newspaper Libération predicted a third era of circus after visiting the seventh edition of the Centre National des Arts du Cirque: “After traditional and new circus, we now have to account for contemporary circus.” The prognosis became reality: nowadays, in France as elsewhere, the performance of Joseph Nadj is considered as the starting point of a new genre whose definition however remains vague: “The contemporary circus has no formal unity. It is paradoxically the diversity of its forms that unifies the genre.” On the one hand, this is explained by the fact that originality is a central motor in contemporary circus; on the other hand, the genre is still developing . A further reason for the lack of a clear definition lies in the absence of detailed analyses of contemporary circus performances in circus research, and in the desideratum regarding a coherent model for its interpretation. The current discourse dedicated to the genre is less interested in knowing how contemporary circus performances generate meaning and in outlining the characteristic techniques and processes. Instead, one wonders what should characterize the performances. The present thesis takes into account this desideratum by developing for the first time a method to analyse representations of contemporary circus. In addition, it resolutely explains and interprets the genre by means of a contextualized description of the object - namely representation - in its historical and cultural context. In the Lessingian sense of the term, the thesis therefore provides a dramaturgy of contemporary circus which, despite the diversity of representations, reveals generalizable characteristics of the genre, the fundamental techniques and structures of the performances. and the effects they produce. The development of a reading model for contemporary circus performances as well as the consequent evolution and the specification of the model are grounded in the textual analysis of poetics of culture that the literary scholar Moritz Baßler justifies in his work on the basis of the theory of New Historicism designed by Stephen Greenblatt. In addition, the present work situates itself in the field of reading theories pertaining to theatre (Fischer-Lichte ) and dance studies (Foster and Brandstetter ). The core of the argument is based on the assumption that circus performances are readable as cultural texts
27
Kanders, Erik. "Recombinant production and immunological characterization of major peanut allergen Ara h 2." Thesis, Uppsala universitet, Institutionen för biologisk grundutbildning, 2004. http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-379735.
Full text
28
Garvey, Cathryn E. "Cloning, Expression, and Characterization of Ara h 3, a Major Peanut Allergen." ScholarWorks@UNO, 2012. http://scholarworks.uno.edu/td/1565.
Full textAbstract:
Abstract There are eight foods that contribute to food allergies in the western world and peanut is the most common. Currently, there are no medical treatments that can cure an individual of food allergy, so avoidance of the allergic food is the only option. In the United States, there are three immunodominant allergic proteins accountable for patient sensitization to peanut, Arachis hypogea 1, 2, and 3 (Ara h 1, Ara h 2, Ara h 3). Therefore, research into why peanuts are more allergic than other foods that have homologous proteins is critical and may be obtained by studying the structural and allergenic properties of individual allergens and the changes that occur due to food processing. In this study, the basic and acidic subunits of Ara h 3 were cloned, expressed, and purified, and compared with each other and with the native Ara h 3 purified from peanut for differences in binding to IgE from peanut allergic individuals. Also, an in vitro Maillard reaction was performed on purified native raw Ara h 3 and patient serum IgE western blots were performed. This study concluded that an in vitro Maillard reaction enhanced IgE binding to Ara h 3, IgE binding to native Ara h 3 was in most cases higher than to the recombinant Ara h 3 subunits, and recognition of the acidic subunit was much higher than the and basic subunits in both the recombinant and native forms of the protein were investigated. Keywords:
29
Oliveira, Andre Barbosa de. "Escola ItÃ-Ara: a afirmaÃÃo da identidade Pitaguary atravÃs da escola diferenciada." Universidade Federal do CearÃ, 2016. http://www.teses.ufc.br/tde_busca/arquivo.php?codArquivo=19658.
Full textAbstract:
CoordenaÃÃo de AperfeÃoamento de Pessoal de NÃvel SuperiorA afirmaÃÃo da identidade Pitaguary atravÃs educaÃÃo diferenciada na escola ItÃ-Ara, tÃtulo desta pesquisa, à um trabalho de investigaÃÃo antropolÃgico sobre o papel da educaÃÃo escolar indÃgena na constituiÃÃo do sujeito Pitaguary. O estudo objetiva compreender como a escola desenvolve a construÃÃo da âculturaâ desta etnia gerando o sentimento de pertencimento atravÃs de formas educacionais que acontecem pelo modelo formal de educaÃÃo, por meios de suas disciplinas curriculares normais, mas ao optar por estudar a forma como esse ensino à realizado nas disciplinas ministradas pela escola, nÃo deixa-se de perceber como outros elementos educativos, que pode ser percebido como nÃo curriculares, sÃo trabalhados atravÃs dessa instituiÃÃo de ensino. A metodologia utilizada foi a observaÃÃo direta do lÃcus pesquisado que pretendeu apreender as relaÃÃes sociais existentes entre a pessoas que trabalham e estudam na escola indÃgena. Para uma melhor apreensÃo sobre estas pessoas foram feitas entrevistas semiestruturadas e aplicaram-se questionÃrio e atividades com os alunos para captar dados sobre as suas interpretaÃÃes sobre a etnia Pitaguary. Os capÃtulos foram divididos de forma a apreender como a Escola ItÃ-Ara està formada dentro da educaÃÃo escolar e da educaÃÃo especÃfica. No primeiro capÃtulo, faz-se um breve contexto sobre os Ãndios do Nordeste do PaÃs, a construÃÃo da sua identidade e a educaÃÃo escolar indÃgena. No segundo capÃtulo, hà uma contextualizaÃÃo histÃrica da educaÃÃo escolar indÃgena no Brasil atà o momento atual. No terceiro descrevo os elementos que podem contribuir com a formaÃÃo da identidade indÃgena dos Pitaguary. No Ãltimo capÃtulo, explora-se como os professores e alunos compreendem a escola indÃgena.
30
Oliveira, Andre Barbosa de. "Escola Itá-Ara: a afirmação da identidade Pitaguary através da escola diferenciada." reponame:Repositório Institucional da UFC, 2016. http://www.repositorio.ufc.br/handle/riufc/24241.
Full textAbstract:
OLIVEIRA, Andre Barbosa de. Escola Itá-Ara: a afirmação da identidade Pitaguary através da escola diferenciada. 2016. 151f. – Dissertação (Mestrado) – Universidade Federal do Ceará, Programa de Pós-graduação em Sociologia, Fortaleza (CE),Submitted by Gustavo Daher (gdaherufc@hotmail.com) on 2017-07-10T16:04:59Z No. of bitstreams: 1 2016_dis_aboliveira.pdf: 3132386 bytes, checksum: 351939cd9a840882a9e70e451a7eff6a (MD5)
Approved for entry into archive by Márcia Araújo (marcia_m_bezerra@yahoo.com.br) on 2017-07-25T13:31:00Z (GMT) No. of bitstreams: 1 2016_dis_aboliveira.pdf: 3132386 bytes, checksum: 351939cd9a840882a9e70e451a7eff6a (MD5)
Made available in DSpace on 2017-07-25T13:31:00Z (GMT). No. of bitstreams: 1 2016_dis_aboliveira.pdf: 3132386 bytes, checksum: 351939cd9a840882a9e70e451a7eff6a (MD5) Previous issue date: 2016
A afirmação da identidade Pitaguary através educação diferenciada na escola Itá-Ara, título desta pesquisa, é um trabalho de investigação antropológico sobre o papel da educação escolar indígena na constituição do sujeito Pitaguary. O estudo objetiva compreender como a escola desenvolve a construção da “cultura” desta etnia gerando o sentimento de pertencimento através de formas educacionais que acontecem pelo modelo formal de educação, por meios de suas disciplinas curriculares normais, mas ao optar por estudar a forma como esse ensino é realizado nas disciplinas ministradas pela escola, não deixa-se de perceber como outros elementos educativos, que pode ser percebido como não curriculares, são trabalhados através dessa instituição de ensino. A metodologia utilizada foi a observação direta do lócus pesquisado que pretendeu apreender as relações sociais existentes entre a pessoas que trabalham e estudam na escola indígena. Para uma melhor apreensão sobre estas pessoas foram feitas entrevistas semiestruturadas e aplicaram-se questionário e atividades com os alunos para captar dados sobre as suas interpretações sobre a etnia Pitaguary. Os capítulos foram divididos de forma a apreender como a Escola Itá-Ara está formada dentro da educação escolar e da educação específica. No primeiro capítulo, faz-se um breve contexto sobre os índios do Nordeste do País, a construção da sua identidade e a educação escolar indígena. No segundo capítulo, há uma contextualização histórica da educação escolar indígena no Brasil até o momento atual. No terceiro descrevo os elementos que podem contribuir com a formação da identidade indígena dos Pitaguary. No último capítulo, explora-se como os professores e alunos compreendem a escola indígena.
31
Lindgren, Mattias, and David Norberg. "I jakt på tillämpning : Om F.O.V. Fabrics möjligheter att understödja kommersialiseringen av algbatteriforskning." Thesis, Uppsala universitet, Företagsekonomiska institutionen, 2011. http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-155791.
Full textAbstract:
The purpose of this essay is to explore the actor network of a high technology company in the textile industry called F.O.V. Fabrics. The background for doing this is a recent project, which we choose to call the Salt & Paper Battery Group, aiming to commercialize a newly discovered technology – a battery based on cellulose from an alga. We start by examining a range of network theories in order to eventually shape a framework of our own. This framework focuses on the environment defined by actor bonds to three groupings, namely business actors, academic actors and political actors. Two factors appear to be essential in these networks, the creation of an identity and in-depth relations to other actors. Thirteen qualitative interviews were conducted of which the empirical input is based upon. It seems that F.O.V. Fabrics communicates a rather homogenous image to its first hand bonds, which emphasizes the innovativeness, the flexibility and technical knowledge the company possesses. F.O.V. Fabrics’ relations are key priorities and by building long terms relations the company manages to establish a large amount of trust in the actor bonds. The essay concludes by stating that F.O.V. Fabrics, based on the discoveries of this study, is likely to be a valuable player in the Salt & Paper Battery Group.
32
Pinto, Herbert Prince Favero. "Três estratégias para análise quantitativa ou qualitativa por espectroscopia de fluorescência de raios-X por energia dispersiva." Universidade de São Paulo, 2013. http://www.teses.usp.br/teses/disponiveis/3/3137/tde-18082014-104010/.
Full textAbstract:
Este trabalho apresenta estratégias para análise quantitativa e semiquantitativa por Espectrometria de Fluorescência por Dispersão de Energia de Raios-X (EDXRF) em três situações típicas: a) materiais homogêneos cujos componentes estejam majoritariamente dentro do campo de detecção da técnica (análise quantitativa), b) materiais homogêneos cujos componentes estejam majoritariamente fora do campo de detecção da técnica (análise quantitativa de elementos minoritários detectados) e, c) materiais heterogêneos em camadas sobrepostas cujos componentes de interesse analítico estejam dentro do campo de detecção da técnica (análise semi-quantitativa de elementos detectados). O trabalho descreve os dois espectrômetros utilizados para as medidas, desenvolvidos no laboratório. Para a determinação das áreas dos picos, foi utilizado principalmente o software PyMCA, desenvolvido pelo CERN. Para a determinação de composições, foram utilizados dois softwares de análise quantitativa que utilizam o método dos Parâmetros Fundamentais. O primeiro é o PyMCA, que efetua de forma integrada o ajuste dos picos e a determinação dos teores. O segundo pertence ao pacote Ara-Lihuen, desenvolvido no próprio laboratório, e obtém teores a partir de áreas dos picos. O trabalho apresenta o desenvolvimento de rotinas do Ara-Lihuen que permitem a verificação de etapas intermediárias de cálculo.This work presents the strategies for quantitative and semi quantitative analyses by Energy Dispersive X-Ray Fluorescence (EDXRF) in three typical situations: a) homogeneous materials whose components are mainly within the field of detection of the technique (quantitative analysis), b) homogenous materials whose components are mostly outside the field of detection of the technique (quantitative analysis of low-content detected elements), and c) heterogeneous materials in superposed layers (semi-quantitative analysis of detected elements). The work describes the two spectrometers used for measurement, developed in the laboratory. For the determination of peak areas, it was used mainly PyMCA software developed by CERN. For the determination of compositions, two quantitative Fundamental- Parameters based (FP) softwares were used. The first is PyMCA, that performs simultaneously the fitting of peaks and the determination the contents. The second belongs to the Ara-Lihuen package, developed in the laboratory, and obtains contents from peak areas. The work presents the development of Ara-Lihuen routines that allow verification of intermediate calculation steps.
33
January, LaTricia M. "Beyond the Threshold: Allusions to the Òrìsà in Ana Mendieta's Silueta Series." VCU Scholars Compass, 2007. http://scholarscompass.vcu.edu/etd/1391.
Full textAbstract:
The Cuban-born artist Ana Mendieta (1948-1985) created the Silueta Series during the 1970s and 80s. It consists of earth-body works in situ featuring the silhouette of the artist's body fashioned from mud, plants, rocks, gunpowder and other materials. Underlying the creation of the Silueta Series is Mendieta's belief that the elements are sentient and powerful beings. This perception is particularly strong in the Afro-Cuban religion Santeria, a creolized form of the Òrìsà tradition of the Yoruba of West Africa introduced to the Americas during the trans-Atlantic slave trade. While scholars have noted Mendieta's incorporation of Santeria in her art, a thorough analysis of the iconographical references to the deities have yet to be explored. This thesis aims to provide such an analysis of Mendieta's works; thus enriching the current discourse on the Silueta Series.
34
Richard, Patricia. "Dynamique intranucléaire et biogenèse des ARNs H/ACA." Toulouse 3, 2006. http://www.theses.fr/2006TOU30081.
Full textAbstract:
Les ARNs H/ACA sont de petits ARNs nucléaires qui remplissent des fonctions variées dans la cellule. Ils servent d'ARNs guides pour les conversions d'uridines en pseudouridines des ARNs ribosomiques et des snARNs du spliceosome. Nous avons mis en évidence la présence d'un signal particulier au niveau des ARNs H/ACA guidant les modifications des snARNs et permettant leur accumulation dans les Cajal bodies. Ce signal est également présent au niveau de l'ARN de la télomérase qui s'accumule également dans les Cajal bodies. Grâce à des expériences de microscopie à fluorescence, nous avons apporté des éléments importants permettant d'émettre l'hypothèse que l'ARN de la télomérase est délivré au niveau d'une sous-population de télomères en phase S du cycle cellulaire. Finalement, nos travaux sur l'expression et la maturation des ARNs H/ACA introniques montrent que l'épissage et l'assemblage de la particule H/ACA chez l'Homme sont deux évènements indépendantsH/ACA RNAs are small nuclear RNAs that have many different functions in the cell. They are guide RNAs for the conversion of the uridine into pseudouridine of ribosomal RNAs and spliceosomal snRNAs. We showed that box H/ACA RNAs directing modifications of spliceosomal snRNAs carry a special signal that direct these box H/ACA RNAs into Cajal bodies. This signal is also present in the telomerase RNA that accumulates in Cajal bodies. With fluorescent microscopy, we were able to propose that Cajal bodies may deliver telomerase RNA at a subset of telomeres in S phase cells. Finally, our work on the expression and processing of box H/ACA RNAs revealed that splicing and assembly of box H/ACA RNP particles are two independent molecular events in human cells
35
Hammer, Wiebke. "Entwicklung einer isokratischen Methode zur Bestimmung von intrazellulärem F-Ara-ATP mittels HPLC /." Frankfurt a.M, 2006. http://opac.nebis.ch/cgi-bin/showAbstract.pl?sys=000254190.
Full text
36
Moraes, Josiane Borges de. "Intersec??es semi?ticas : a Istambul de Orhan Pamuk e Ara G?ler." Pontif?cia Universidade Cat?lica do Rio Grande do Sul, 2015. http://tede2.pucrs.br/tede2/handle/tede/2210.
Full textAbstract:
Made available in DSpace on 2015-04-14T13:39:28Z (GMT). No. of bitstreams: 1
466163.pdf: 4405555 bytes, checksum: f9f26d750766a50363983c0c95bb665d (MD5)
Previous issue date: 2015-01-22The goal with this Master s Thesis is the analysis of the hybridism between two distinctive arts, Photography and Literature, especially in Pamuk s Istambul. In this sense, a previous incursion in the world of Photography and its intersections among several literary works will trigger the starting point. Photographers as Marey, Muybridge, Nakaji Yusui, Alfred Stieglitz illustrate the permeable way that the art of writing through light relates to other kinds of art. Duane Michals shows his avant-garde photographic narrative, and Leonardo da Vinci reveals how the art of the numbers works in eye-catching images. As a contribution Roland Barthes sews up the theory of these worlds amongst Susan Sontag, Derrida, Hegel and Benjamin, turning possible a safe landing in Istambul where, in the end, the study about Pamuk s text, which is illustrated with Ara G?ler s photographic work, culminates. The search here takes another bias and Sebald helps doing a counterpoint: writing the text with the pictures that were previously chosen versus subsequent choice, that is the way Pamuk does seeking in G?ler s Istambul the h?z?n eye as genuine as his own.
A disserta??o apresentada tem por objetivo a an?lise do hibridismo de duas artes, Fotografia e Literatura, especialmente na obra Istambul de Orhan Pamuk. Para tanto, uma incurs?o pr?via no mundo da Fotografia e intersec??es com outras obras liter?rias dar? o ponto de partida. Fot?grafos como Marey, Muybridge, Nakaji Yusui, Alfred Stieglitz ilustram o modo perme?vel como a arte da escrita com a luz se relaciona com outras artes. Duane Michals d? o testemunho de uma narratividade fotogr?fica ? frente de seu tempo e Leonardo da Vinci mostra como a arte dos n?meros faz com que nosso olhar se fixe em determinado ponto da imagem. Para contribuir Roland Barthes faz a sutura te?rica destes dois mundos juntamente com Susan Sontag, Derrida, Hegel e Benjamin, possibilitando uma aterrissagem segura em Istambul onde, por fim, o estudo sobre o texto de Pamuk ilustrado com a obra fotogr?fica de Ara G?ler culmina. A busca aqui toma um vi?s particular e Sebald auxilia em um contraponto: a produ??o do texto com as fotografias previamente escolhidas versus escolha posterior, como Pamuk faz buscando na Istambul de G?ler o h?z?n de um olhar t?o genu?no como o seu.
37
Santos, Veridiano Maia do. "EJA: saberes na articula??o curricular da Escola Municipal Professor Amadeu Ara?jo." Universidade Federal do Rio Grande do Norte, 2014. http://repositorio.ufrn.br:8080/jspui/handle/123456789/14590.
Full textAbstract:
Made available in DSpace on 2014-12-17T14:36:51Z (GMT). No. of bitstreams: 1
VeridianoMS_DISSERT.pdf: 1769603 bytes, checksum: 9df34aba4d9cbb532e74204caf668df8 (MD5)
Previous issue date: 2014-07-31Universidade Federal do Rio Grande do Norte
The target of this paper is to investigate the possibilities of inscribing into the EJA curriculum the knowledge detected in the neighborhood of a school if the point of view of the student body regarding the basic schooling deserves its due consideration. The empirical field of our research focuses on the elementary school of professor Amadeu Ara?jo Municipal School in Natal. Our investigative course tried to understand the way pupils think the curriculum contents of knowledge spread around the school from the vision furnished by their elementary school. With this, we hoped to develop a creative understanding concerning that question. Then we reviewed, along the debate, questions related to Nova Natal Housing Estate and its historic, social and cultural beginnings taking in account the participants memories of this research and their suggestions concerning the utility of the community knowledge to the curriculum practices. This project is supplied by the qualitative research and reinforced by the Focal Group s methodological procedures and semi-structured interviews. This procedure allowed us to discern different points of viewing, feeling and understanding in the complexity of the daily life around school and its environment. With these elements, we could note that some students perceptions pointed to a basic schooling fomented by traditionalized pedagogical practices in which teacher and pupil seldom dialogue with each other, what corroborates the impression of undervaluation of the pupil s role. Consequently, the nets of knowledge waved around the school in Nova Natal Housing Estate become useless, when they could be of great utility if inserted in the curriculum contents
Este trabalho tem como objeto de estudo as possibilidades de inser??o de saberes presentes no entorno da escola no curr?culo da EJA a partir do olhar discente sobre sua forma??o escolar. O campo emp?rico de nossa pesquisa concentra-se na citada modalidade do Ensino Fundamental da Escola Municipal Professor Amadeu Ara?jo, pertencente ao sistema educativo do munic?pio do Natal/RN. Nosso itiner?rio de pesquisa buscou investigar o modo como os alunos pensam a inser??o curricular de saberes presentes no entorno da escola, com aten??o especial ao seu olhar sobre a sua forma??o escolar, a fim de que pud?ssemos desenvolver uma discuss?o propositiva sobre outras possibilidades de inser??o curricular desses mesmos saberes, mas agora em articula??o com o olhar discente. Assim, debatemos sobre o Conjunto Habitacional de Nova Natal e seu itiner?rio hist?rico, social e cultural sob o recorte e mem?ria dos participantes desta investiga??o e suas falas sobre os saberes pertinentes da comunidade que pudessem tecer correla??o dial?gica nas pr?ticas curriculares. Este projeto ? ancorado na pesquisa qualitativa e amparado em procedimentos metodol?gicos do Grupo Focal e de Entrevista Semiestruturada, que nos permitiram captar formas diversas de olhares, de sentidos e de entendimentos dentro de um contexto cotidiano complexo seja na escola, seja no seu entorno. Isso nos permitiu inferir que existem percep??es do discente da EJA na referida escola que apontam para uma forma??o baseada em pr?ticas pedag?gicas tradicionalizadas, esvaziadas de um di?logo emancipador entre docente e discente (de modo geral), um ambiente escolar que corrobora o sentimento de desvaloriza??o discente e que em seu entorno existem redes de saberes que s?o tecidos no cotidiano de Nova Natal e que poderiam estar inseridos ao curr?culo escolar oficial, mas que na pr?tica n?o s?o reconhecidas de modo geral pela mencionada escola
38
Kim, Tracy. "Genetic Characterization of Central and South American Populations of Scarlet Macaw (Ara macao)." Thesis, University of North Texas, 2016. https://digital.library.unt.edu/ark:/67531/metadc849620/.
Full textAbstract:
The wild populations of the Scarlet Macaw subspecies native to southern Mexico and Central America, A. m. cyanoptera, have been drastically reduced over the last half century and are now a major concern to local governments and conservation groups. Programs to rebuild these local populations using captive bred specimens must be careful to reintroduce the native A. m. cyanoptera, as opposed to the South American nominate subspecies (A. m. macao) or hybrids of the two subspecies. Molecular markers for comparative genomic analyses are needed for definitive differentiation. Here I describe the isolation and sequence analysis of multiple loci from 7 pedigreed A. m. macao and 14 pedigreed A. m. cyanoptera specimens. The loci analyzed include the 18S rDNA genes, the complete mitogenome as well as intronic regions of selected autosomally-encoded genes. Although the multicopy18S gene sequences exhibited 10% polymorphism within all A. macao genomes, no differences were observed between any of the 21 birds whose genomes were studied. In contrast, numerous polymorphic sites were observed throughout the 16,993 bp mitochondrial genomes of both subspecies. Although much of the polymorphism was observed in the genomes of both subspecies, subspecies-specific alleles were observed at a number of mitochondrial loci, including 12S, 16S, CO2 and ND3. Evidence of possible subspecies-specific alleles were also found in three of four screened nuclear loci. Collectively, these mitochondrial and nuclear loci can be used as the basis to distinguish A. m. cyanoptera from the nominate subspecies, A. m. macao, as well as identify many hybrids, and most importantly will contribute to further reintroduction efforts.
39
Thalinsson, Ranhagen Elias, and Josefin Norstedt. "Goda relationer – En förutsättning för morgondagens entreprenörer." Thesis, Uppsala universitet, Företagsekonomiska institutionen, 2015. http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-246394.
Full textAbstract:
I takt med en ökad internationalisering och hårdnad global konkurrens ställs större krav på morgondagens entreprenörer. I Uppsala kommun har den omfattande kapaciteten inom utbildning och forskning uppfattats som ett särskilt viktigt verktyg för att möta dessa utmaningar, varför studiens fokus riktas på hur de entreprenörskapsfrämjande aktörerna som existerar kring Uppsala universitet tillsammans verkar för att skapa förutsättningar för studenter och forskare. Syftet med denna uppsats är således att erhålla en så pass heltäckande bild som möjligt av detta nätverk av relationer för att sedan kunna analysera hur dessa kan vidareutvecklas. För att besvara detta syfte har en kvalitativ fallstudie genomförts, där studien primärt fokuserade på fyra aktörer som ansågs vara särskilt vitala. Studiens resultat visar på att det finns goda möjligheter för vidareutveckling genom bland annat ökade resurs- och aktivitetsutbyten mellan olika aktörer.
40
Silva, Barbara Xavier. "Rela??es anat?micas entre a origem e a distribui??o da art?ria cel?aca no gato dom?stico." Universidade Federal Rural do Rio de Janeiro, 2010. https://tede.ufrrj.br/jspui/handle/jspui/1706.
Full textAbstract:
Submitted by Sandra Pereira (srpereira@ufrrj.br) on 2017-05-30T16:11:15Z
No. of bitstreams: 1
2010 - B?rbara Xavier Silva.pdf: 1788178 bytes, checksum: 96ff6d70aeb442564d90879a261fb5f6 (MD5)Made available in DSpace on 2017-05-30T16:11:15Z (GMT). No. of bitstreams: 1 2010 - B?rbara Xavier Silva.pdf: 1788178 bytes, checksum: 96ff6d70aeb442564d90879a261fb5f6 (MD5) Previous issue date: 2010-08-27
The knowledge of anatomical variations is important for radiological and surgical procedures and has a theoretical and practical significance for experimental research and surgical practice in domestic animals. The aim of this study was to describe the origin and measures of the main branches of celiac artery in domestic cats of both sexes. The anatomical dissections were performed on 30 cadavers of adult cats, 15 male and 15 female, with a rostrum-sacral length of 47.9 cm and 46.6 cm respectively. Cats were positioned in right lateral decubit and a thoracic incision was made to remove the 6th to 10th ribs to cannulate the thoracic portion of aorta. The vascular system was fixated with 10% formaldehyde solution and then filled with coloured Petrolatex S-65. After five days emerged in 10% formaldehyde solution, all the animals were washed in current water. The celiac artery and its proximal branches were ?in situ? dissected, lengthen and measured with a pachymeter. No organs were removed. The average length and standard deviation of the celiac, lienal, left gastric and hepatic artery were calculated and compared in both sexes by unpaired t test. To verify if the frequency distributions observed for the 30 examined animals is in accordance with the literature, we performed the Qui-square test, with a 5% level of significance, to test if the nullity hypothesis is true for the origin of the celiac artery, number of gastric arteries, and the number of lienal artery main ramifications. The relationship between the celiac, lienal, left gastric and hepatic artery length, with rostrum-sacral length was calculated by the correlation coefficient ?r? varying between -1 r +1. The celiac artery arose as a single artery in 15 (100%) females. In males the celiac artery arose as a single artery in 12 (80%) cats; in three (20%) cats we observed the presence of celiac-mesenteric trunk. The average length of the celiac artery in females was 1.32 cm, and originated at the level of the 13th thoracic vertebra in two (13.3%) animals, between the 13th and the 1st lumbar vertebra in one (6.7%) animal, at the level of 1st lumbar vertebra in six (40%) cats, and between the 1st and 2nd lumbar vertebra in six (40%) cats. The average length of the celiac artery in males was 1.27 cm, and originated at the level of 13th thoracic vertebra in three (20%) animals, between 13th thoracic vertebra and 1st lumbar vertebra in three (20%) animals, at the level of 1st lumbar vertebra in four (26.7%) animals, between 1st and 2nd lumbar vertebra in one (6.7%) and at the level of the 2nd lumbar vertebra in four (26.7%) animals. In female the gastrolienal trunk was the predominant morphological arrangement (53.3%) with medium length of 0.31 cm. In males, the classic celiac trifurcation was the predominant morphological arrangement (53.3%). No relation was observed between the celiac, lienal, left gastric and hepatic artery length and the rostrum-sacral length in cats. The origin of the celiac artery, number of gastric arteries, and the number of lienal artery main ramifications are not gender dependent.
O conhecimento das varia??es anat?micas ? importante para procedimentos cir?rgicos e radiol?gicos e tem um significado pr?tico e te?rico para a pesquisa experimental e a pr?tica cir?rgica em animais dom?sticos. O objetivo deste estudo foi descrever a origem e medidas da art?ria cel?aca e de suas ramifica??es em gatos de ambos sexos correlacionando seus valores com o comprimento do animal. As dissec??es foram realizadas em 30 cad?veres de gatos adultos, 15 machos e 15 f?meas, com m?dia do comprimento rostro-sacral de 47,9cm e 46,6 cm respectivamente. Os gatos foram posicionados em dec?bito lateral direito e feita uma incis?o tor?cica para remo??o da 6? a 10? costelas para canula??o da por??o tor?cica da aorta. Em seguida, o sistema vascular foi fixado com solu??o de formaldeido a 10% e preenchidos com solu??o de Petrolatex S-65 corado. Ap?s cinco dias imersos em solu??o de formaldeido a 10%, todos os animais foram lavados em ?gua corrente. A art?ria cel?aca e seus ramos proximais foram dissecados "in situ" e medidos com um paqu?metro. O comprimento m?dio e desvio padr?o da art?ria cel?aca, lienal, g?strica esquerda e hep?tica foram calculados e comparados em ambos os sexos atrav?s do teste t n?o pareado. Com o intuito de verificar se a distribui??o de freq??ncias observadas para os 30 animais examinados est? de acordo com a literatura, aplicou-se o teste do X2 (qui-quadrado) considerando o n?vel de signific?ncia 5% para testar se a hip?tese de nulidade ? verdadeira, no que diz respeito a origem da art?ria cel?aca, n?mero de art?rias g?strica, e n?mero de ramifica??es principais da art?ria lienal. Em rela??o ao comportamento conjunto do comprimento da art?ria cel?aca, lienal, g?strica esquerda e hep?tica em fun??o do comprimento rostro-sacral, optou-se por calcular o coeficiente de correla??o ?r?, que pode variar entre -1 r +1. A art?ria cel?aca surgiu como uma art?ria ?nica em 15 (100%) f?meas examinadas. Nos machos a art?ria cel?aca surgiu como uma art?ria ?nica em 12 (80%) gatos e em tr?s (20%) gatos foi observada a presen?a do tronco cel?aco-mesent?rico. O comprimento m?dio da art?ria cel?aca nas f?meas foi de 1,32 cm, emergindo em n?vel da 13? v?rtebra tor?cica em dois (13,3%) animais, entre a 13? v?rtebra tor?cica e a 1? v?rtebra lombar em um (6,7%) animal, em n?vel da 1? v?rtebra lombar em seis (40%) animais, e entre a 1? e 2? v?rtebra lombar em seis (40%) animais. O comprimento m?dio da art?ria cel?aca no sexo masculino foi de 1,27 cm, emergindo em n?vel da 13? v?rtebra tor?cica em tr?s (20%) animais, entre 13? v?rtebra tor?cica e 1? v?rtebra lombar em tr?s (20%) animais, em n?vel da 1? v?rtebra lombar em quatro (26,7%) animais, entre a 1? e 2? v?rtebra lombar em um (6,7%) e em n?vel da 2? v?rtebra lombar em quatro (26,7%) animais. Nas f?meas o tronco gastro-lienal foi o arranjo morfol?gico predominante (53,3%) com um comprimento m?dio de 0,31 cm. Nos machos, a trifurca??o cl?ssica da art?ria cel?aca foi o arranjo morfol?gico predominante (53,3%). N?o foi observada rela??o entre o comprimento da art?ria cel?aca, lienal, g?strica esquerda e hep?tica em fun??o do comprimento rostro-sacral. A origem da art?ria cel?aca, n?mero de art?rias g?stricas e n?mero de ramifica??es principais da art?ria lienal independem do sexo.
41
Pinheiro, Marco Aur?lio Soares. "Fitossociologia de ?reas enriquecidas com o palmiteiro Euterpe edulis (martius) em paisagens alteradas da Mata Atl?ntica." Universidade Federal Rural do Rio de Janeiro, 2008. https://tede.ufrrj.br/jspui/handle/jspui/2180.
Full textAbstract:
Submitted by Sandra Pereira (srpereira@ufrrj.br) on 2018-01-25T12:42:16Z
No. of bitstreams: 1
2007 - Marco Aur?lio Soares Pinheiro.pdf: 727221 bytes, checksum: 4a4a5210bea956397c8eb8b3c6ed9487 (MD5)Made available in DSpace on 2018-01-25T12:42:16Z (GMT). No. of bitstreams: 1 2007 - Marco Aur?lio Soares Pinheiro.pdf: 727221 bytes, checksum: 4a4a5210bea956397c8eb8b3c6ed9487 (MD5) Previous issue date: 2008-08-30
The present study was developed at Santuary of Silvester Life, Serra da Conc?rdia, Valen?a (RJ), aiming to collect informations which can subsidize the handling and the preservation of Euterpe edulis at the Atlantic Forest; to study the floristics and the structure of a secondary forest, which was submited to enrichment; to valuate the E. edulis development in a plantation of enrichment, and to confirm the viability of development of palm cabbage culture in impacted forestal remainings. Were used collecting of floristic and phytosociological facts in two parcels of 20x50m. It was estimated the viability of plantation of enrichment with E. edulis by analysing the growth in two parcels of 20x50m. It was established four classes of size of exposed stirps (C1= up to 0,5m; C2 from 0,5 to 1,5m; C3 from 1,3 to 3,0m and C4 from 3,0m on and with circumference at chest level (CAP) > 15cm). Each parcel was devided in ten subparcels of 10x10m, in which all palm cabbage plantation of (C4 class) had their CAP measurings and exposed etirps height taken.In each subparcel of 10x10m it was allocated a subparcel of 4,0x4,0m, where the individuals of the classes C1,C2 and C3 have had their measurings of diameter of colon, CAP and height of stirps taken. All palm cabbage were identified with aluminium plate printed in low relief and fixed with copper nails.The parcel 1 can be found at the bottom of the region nearby a stream, while the parcel 2 can be found almost 50m above the first parcel. It has been done two measurings in an interval of six months and, at the and of this period, it had been estimated the percentage of survival and of changing of class. The analyses of growth in each sample, and also between one another was done by the non parametric test of Kruskal-Wallis. The fragment was characterized by the index of similarity and diversity, by Margalef with some other seven remainings of Atlantic Forest with different degrees of impactation and distincts successional stages. It was also compared some abiotic characteristics between the fragments. The individuals of C1; C2 and C3 from parcel1 were significantly grown, speaking about the diameter of colon. The individuals of the same classes of parcel 2 have not had an expressive growth, but there have had a significative growth in height of exposed stirps for these classes. The C4 from parcel 1 were grown concerning to the CAP, but those one of the parcel 2 didn?t. Speaking about the height of stirps in both of the parcels, the growth was very significative. The percentage of survival were about 95,8% and 100% in the parcels 1 and 2, respectively.
O presente estudo foi desenvolvido no Santu?rio de Vida Silvestre, Serra da Conc?rdia, Valen?a (RJ), com o objetivo de coletar informa??es que possam subsidiar o manejo e a conserva??o de Euterpe edulis na Floresta Atl?ntica; estudar a flor?stica e a estrutura de uma floresta secund?ria submetida a enriquecimento; avaliar o desenvolvimento de E. edulis em plantio de enriquecimento e confirmar a viabilidade do desenvolvimento da cultura de palmito em remanescentes florestais impactados. Foram utilizados levantamentos flor?stico e fitossociol?gico em duas parcelas de 20x50m. Avaliou-se a viabilidade do plantio de enriquecimento com E. edulis atrav?s de an?lise de crescimento em duas parcelas de 20x50m. Foram estabelecidas quatro classes de tamanho de estipe exposta (C1=at? 0,5m; C2 de 0,5 a 1,5m; C3 de 1,3 a 3,0m e C4 acima de 3,0m e com circunfer?ncia a altura do peito (CAP) 15cm) Cada parcela foi dividida em dez subparcelas de 10x10m, onde todos os palmiteiros da classe C4 tiveram suas medidas de CAP e altura de estipe exposta tomadas. Em cada subparcela de 10x10m foi alocada uma subparcela de 4,0x4,0m, em que os indiv?duos das classes C1, C2 e C3 tiveram suas medidas de di?metro de colo, CAP e altura de estipe tomados. Todos os palmitos foram identificados com placas de alum?nio impressas em baixo relevo e afixadas com pregos de cobre. A parcela 1 se encontra em regi?o mais baixa, pr?xima ao c?rrego, enquanto que a parcela 2 se localiza cerca de 50m acima da primeira parcela. Foram feitas duas medi??es com intervalo de seis meses e, ao final deste per?odo, foram calculados os percentuais de sobreviv?ncia e de mudan?a de classe. A an?lise do crescimento em cada amostra, e tamb?m entre elas, foi feita atrav?s do teste n?o param?trico de Kruskal-Wallis. Caracterizou-se o fragmento atrav?s do ?ndice de similaridade e diversidade de Margalef com outros sete remanescentes de Mata Atl?ntica com diferentes graus de impacta??o e est?gios sucessionais distintos. Tamb?m foram comparadas algumas caracter?sticas abi?ticas entre os fragmentos. Os indiv?duos de C1, C2 e C3 da parcela 1 cresceram significativamente quanto ao di?metro de colo. Os indiv?duos das mesmas classes da parcela 2 n?o tiveram crescimento significativo, mas houve crescimento significativo em altura de estipe exposta para estas classes. Os C4 da parcela 1 cresceram quanto ao CAP, mas os da parcela 2, n?o. Quanto ? altura de estipe, em ambas as parcelas o crescimento foi significativo. Os percentuais de sobreviv?ncia foram de 95,8% e 100% nas parcelas 1 e 2, respectivamente.
42
Parisy, Philippe. "Axe numérique intégré à courant continu." Grenoble 2 : ANRT, 1986. http://catalogue.bnf.fr/ark:/12148/cb376002525.
Full text
43
Peres, Narah Vieira. "Estratégias de fornecimento de ração para Araras Canindé (Ara ararauna, LINNAEUS, 1758) em cativeiro /." Ilha Solteira, 2018. http://hdl.handle.net/11449/180630.
Full textAbstract:
Orientador: Rosemeire da Silva FilardiResumo: Os estudos abordando a nutrição e alimentação de aves silvestres em cativeiro são bastante escassos. Os psitacídeos representam um grande grupo de aves que necessitam de atenção quanto aos aspectos conservacionistas devido ao tráfico e à grande perda de seu habitat natural. Devido a esses fatores atualmente o número de araras em zoológicos e centros de conservação é grande. A alimentação correta dessas aves em cativeiro representa um desafio, isso por possuírem alta sensibilidade gustativa, o que causa certa seletividade na alimentação e desperdício de ração. Objetivou-se avaliar diferentes estratégias de fornecimento de uma ração comercial associada à banana para Arara Canindé (Ara ararauna). O experimento foi realizado no Centro de Conservação da Fauna Silvestre, no município de Ilha Solteira, Estado de São Paulo. Foram utilizadas 8 Araras Canindé (Ara ararauna) alojadas individualmente em gaiolas adaptadas para coleta de excretas (0,75 x 0,75 x 1,0 m) e sobras ou desperdício de alimento. As aves foram distribuídas em um delineamento inteiramente casualizado com 4 tratamentos e medida repetida no tempo, totalizando seis repetições por tratamento (24 unidades experimentais). Os tratamentos avaliaram quatro estratégias de alimentação de araras: ração comercial; associação de 70% de ração comercial com 30% de banana; associação de 50% de ração comercial com 50% de banana e ração comercial moída aglomerada à banana (50% ração, 50% banana). As dietas que apresentaram a banana ti... (Resumo completo, clicar acesso eletrônico abaixo)
Abstract: Studies addressing the nutrition and feeding of wild birds in captivity are rather scarce. Macaws represent a large group of birds that need attention to conservation issues due to trafficking and the great loss of their natural habitat. Due to these factors currently, the number of macaws in zoos and conservation centers is great. The correct feeding of these birds in captivity poses a challenge because they have a high gustatory sensitivity, which causes certain selectivity in feed and wastage of feed. The objective of this study was to evaluate different strategies for supplying a commercial ration associated with the banana for Arara Canindé (Ara ararauna). The experiment was carried out at the Wild Fauna Conservation Center, in Ilha Solteira city, State of São Paulo. Eight Araras Canindé (Ara ararauna) were housed individually in cages adapted for collection of excrement (0.75 x 0.75 x 1.0 m) and leftovers or food waste. The birds were distributed in a completely randomized design with four treatments during three periods of five days of harvest, with seven days of adaptation between harvests, totaling six replicates per treatment (24 experimental units). The treatments evaluated four strategies of macaw feeding: commercial ration; association of 70% commercial ration with 30% of banana; 50% commercial ration with 50% banana and ground commercial ration agglomerated with banana (50% ration, 50% banana). The diets that had fruit had a higher total food consumption, but wh... (Complete abstract click electronic access below)
Mestre
44
Oliveira, Vânia Silva. "Ara-ìtàn: a dança de uma rainha, de um carnaval e de uma mulher." Escola de Dança, 2016. http://repositorio.ufba.br/ri/handle/ri/19744.
Full textAbstract:
Submitted by Diana Alves (ppgdancaufba.adm@gmail.com) on 2016-07-21T12:31:52Z
No. of bitstreams: 1
DISSERTAÇÃO VÂNIA.pdf: 2940692 bytes, checksum: c6b317f160860fc1d270b52444487399 (MD5)Approved for entry into archive by Patricia Barroso (pbarroso@ufba.br) on 2016-07-21T16:30:00Z (GMT) No. of bitstreams: 1 DISSERTAÇÃO VÂNIA.pdf: 2940692 bytes, checksum: c6b317f160860fc1d270b52444487399 (MD5)
Made available in DSpace on 2016-07-21T16:30:02Z (GMT). No. of bitstreams: 1 DISSERTAÇÃO VÂNIA.pdf: 2940692 bytes, checksum: c6b317f160860fc1d270b52444487399 (MD5)
Ara-ìtàn: a dança de uma rainha, de um carnaval de uma mulher... apresenta temas pertinentes aos aspectos da historiografia do negro no Brasil, especificamente em Salvador – Bahia, em suas dimensões socioculturais e, principalmente, acerca da mulher negra e a sua relação com a dança. A pesquisa está amparada por autores como: Oliveira (1992, 2008, 2013), Munanga (1993, 2006), Santos (2002) e Santos (2010), com o objetivo de apresentar questões que podem problematizar e ampliar discussões sobre o empoderamento da mulher negra e as possibilidades que se ampliam em instituições como os Blocos Afro de Salvador Ilê Aiyê, Malê Debalê e Muzenza. Revela em seu escopo o questionamento norteador: Como a Dança se apresenta como potência de empoderamento e transformação a partir de experiências de mulheres que se tornaram Rainhas de Blocos Afro da cidade de Salvador? Pretende-se, assim, permear as tramas desta dissertação, desenhando caminhos como os trançados de cabelo num penteado labiríntico. A partir de questões observadas nos contextos da pesquisa, apresento a hipótese de que a dança como pensamento do corpo seja a grande catalizadora e propulsora de transformações e empoderamento da mulher negra, sejam elas individuais ou coletivas, transformando efetivamente comportamentos, atitudes e tomadas de decisão.
45
Guillaume, Henri. "Du miel au café, de l'ivoire à l'acajou : la colonisation de l'interfluve Sangha-Oubangui et l'évolution des rapports entre chasseurs-collecteurs pygmées Aka et agriculteurs, Centrafrique, Congo, 1880-1980 /." Louvain ; Paris ; Sterling (Va.) : Paris : Peeters ; SELAF, 2001. http://catalogue.bnf.fr/ark:/12148/cb388805199.
Full text
46
Peruchi, F?bian Maccarini. "Viabilidade do enxerto ?sseo da crista il?aca vascularizado pelo ramo il?aco da art?ria iliolombar : estudo experimental em ratos." Pontif?cia Universidade Cat?lica do Rio Grande do Sul, 2009. http://tede2.pucrs.br/tede2/handle/tede/1504.
Full textAbstract:
Made available in DSpace on 2015-04-14T13:34:38Z (GMT). No. of bitstreams: 1
411954.pdf: 1943189 bytes, checksum: b8512a0b7a8966dc29fb921e76e53ab4 (MD5)
Previous issue date: 2009-03-04Introdu??o: Os enxertos ?sseos continuam sendo utilizados com freq??ncia na resolu??o de situa??es cl?nicas com perda de subst?ncia ?ssea. A viabilidade das c?lulas ?sseas transferidas com o enxerto ? um dos fatores determinantes para as propriedades mec?nicas e fisiol?gicas do enxerto. Uma d?vida inerente ao procedimento cir?rgico quando se utiliza enxertos ?sseos vascularizados ?: ser? que o enxerto ?sseo manter? sua viabilidade atrav?s do ped?culo vascular com o decorrer do tempo? Atrav?s de um modelo experimental, almejamos criar infer?ncias sobre a viabilidade do enxerto ?sseo vascularizado da crista il?aca em ratos e verificar suas caracter?sticas histol?gicas. M?todos: Foram utilizados 23 ratos machos isog?nicos da linhagem Kyoto, os quais foram divididos em dois grupos, o primeiro composto por animais submetidos ? t?cnica do enxerto ?sseo vascularizado da crista il?aca baseado no ramo il?aco da art?ria iliolombar, e o segundo (grupo controle) submetidos ao mesmo procedimento que o primeiro com a adi??o da ligadura do ped?culo vascular. A viabilidade dos enxertos ?sseos foi verificada durante tr?s semanas, atrav?s da visualiza??o direta do enxerto, histologia e imuno-histoqu?mica. Resultados: Todos os enxertos vascularizados avaliados na primeira semana apresentaram viabilidade segundo a observa??o direta, histologia e imuno-histoqu?mica. Entretanto na segunda e terceira semana os enxertos mostraram-se invi?veis em 75% dos casos quando submetidos ? avalia??o segundo a observa??o direta e em 50% dos casos quando realizada a an?lise histol?gica e imuno-histoqu?mica. Conclus?o: Alguns enxertos vascularizados em sua concep??o tornaram-se invi?veis e passaram a se comportar como enxertos n?o-vascularizados sob a an?lise da observa??o direta e histol?gica. Apesar da possibilidade de falha, o uso de enxertos ?sseos vascularizados deve ser incentivado, pois a histologia descritiva demonstrou maior densidade celular na por??o ?ssea medular, oste?citos com maior funcionalidade na deposi??o de matriz ?ssea, com rede vascular intra-?ssea preservada.
47
Higa, Thaís Tiemi. "Imunolocalização de supressores (FOXO3a e PTEN) e ativadores (Akt e phospho-Akt) da transição de folículos primordiais e primários em tecido ovariano humano." Universidade de São Paulo, 2017. http://www.teses.usp.br/teses/disponiveis/17/17145/tde-26042018-152648/.
Full textAbstract:
Mulheres com risco de falência ovariana prematura, assim como aquelas diagnosticadas com câncer que desejam preservar sua fertilidade, têm como opção a criopreservação do tecido ovariano. Esse tecido seria destinado, dependendo do caso, ao reimplante posterior ou para o cultivo in vitro de folículos ovarianos isolados do tecido criopreservado. Nesse contexto, os folículos primordiais são uma população importante tanto por serem mais resistentes ao processo de criopreservação, como por representarem cerca de 90% da população total folicular. Porém o uso destes folículos para procedimentos de Reprodução Assistida ainda é bastante limitado, pois os mecanismos responsáveis pelo seu processo de ativação ainda não são completamente conhecidos. A via de sinalização fosfatidilinositol 3- quinase (PI3K) foi recentemente identificada como determinante para o controle da ativação dos folículos primordiais. Portanto o objetivo deste estudo foi identificar e localizar os fatores componentes da via: supressores (FOXO3a e PTEN) e ativadores (Akt e Phospho-Akt). O que ofereceria uma valiosa ferramenta para elucidar os mecanismos envolvidos na ativação do pool de reserva folicular e permitiria o desenvolvimento de sistemas de cultivo folicular que atuassem diretamente nestes mecanismos. Sendo assim, foi realizado um estudo transversal com amostras de tecido ovariano humano, que foram submetidas à reação imunohistoquímica dos fatores previamente citados. Foram incluídas na casuística 40 pacientes, com idade média de 27,7 anos ± 7,26. Foi realizada uma análise comparativa da expressão dessas proteínas entre os folículos primordiais e primários. Foi encontrada diferença significativa para a proteína Akt, (p<0,05) em que os folículos primordiais (oócito e células da granulosa) manifestaram mais expressão da proteína Akt em comparação aos folículos primários. Também foi encontrada diferença significativa para a proteína phospho-Akt, porém apenas nas células da granulosa, em que houve maior expressão em folículos primordiais comparados aos primários. Enquanto ambos os estágios tiveram marcação negativa para o PTEN e FOXO3a na maioria dos folículos analisados. Sendo assim, neste estudo não foi possível identificar dentre as proteínas escolhidas uma que tivesse expressão claramente característica de uma ou de outra fase folicular, não sendo possível inferir que a atividade de qualquer uma das proteínas fosse estritamente ligada à ativação dos folículo primordiais.Women at risk of premature ovarian failure, as well as those diagnosed with cancer who wish to preserve their fertility, have, as option, the ovarian tissue cryopreservation. This tissue would be destined, depending on the case, to posterior reimplantation, or for the in vitro culture of ovarian follicles isolated from the cryopreserved tissue. In this context, primordial follicles are an important population of cells. As they are more resistant to the cryopreservation process and they represent about 90% of the whole follicular population. However, the use of these follicles for Assisted Reproduction procedures is still quite limited, since the mechanisms responsible for its activation process are not fully understood. The phosphatidylinositol 3-kinase (PI3K) signaling pathway has recently been identified as determinant for the control of primordial follicle activation. Therefore, the aim of this study was to identify and localize the components of this pathway: suppressors (FOXO3a and PTEN) and activators (Akt and phospho-Akt). This would offer a valuable tool to elucidate the mechanisms involved in the activation of the follicular reserve pool and would allow the development of in vitro culture protocols that would act directly in these mechanisms. Thus, a cross-sectional study with samples of human ovarian tissue was performed. These samples were submitted to the immunohistochemical reaction of the previously mentioned factors. Forty patients were included in the study, with a mean age of 27.7 ± 7.26. A comparative analysis of the expression of these proteins was performed between primordial and primary follicles. A significant difference was found for the Akt protein (p<0.05) in which the primordial follicles (oocyte and granulosa cells) showed more Akt expression than primary follicles. Another significant difference was found for the phosphor-Akt protein, but only for the granulosa cells, where there was a greater expression in primordial follicles compared to the primary ones. While both stages were negatively stained for PTEN and FOXO3a in most of the follicles analyzed. Thus, in this study it was not possible to identify among the selected proteins one that had clearly characteristic expression of one or the other follicular phase, and it was not possible to infer that the activity of any of the proteins was strictly linked to the activation of the primordial follicles.
48
Briggs, Kevin. "The Americans With Disabilities Act and Title I 'Why The ADA Has Not Increased Employment for Persons with Disabilities." Thesis, Virginia Tech, 2006. http://hdl.handle.net/10919/33879.
Full textAbstract:
The Americans with Disabilities Act (ADA) has been hailed as a landmark piece of civil rights legislation and a boon to people with disabilities in the United States. Title I of the ADA specifically addresses employment discrimination toward persons with disabilities. Congressional proponents of the ADA anticipated that the statute would bring about a reversal of the high unemployment numbers among the disabled. This thesis examines the unemployment data for persons with disabilities 10 years following enactment of the ADA. It shows that the ADA has not reversed unemployment trends among persons with disabilities. This work compares the expectations of the billâ s sponsors and/or advocates for improvements in employment opportunities for working aged adults with disabilities, provided for by Title I of the ADA, with the actual outcomes. This thesis highlights some the principal problems inherent with the law itself, problems that may be contributing to the ADAâ s inability to reverse high unemployment numbers among the disabled. This paper also addresses concerns within the US business community regarding implementation of the law. The results presented show that the ADA has not brought about the flood of litigation originally anticipated by American business, neither has it increased frivolous litigation. Data are also offered which demonstrate that compliance with the law in the form of accommodation expenses for persons with disabilities is not onerous. Finally, this study presents some of the ongoing problems with regard to discrimination against persons with disabilities in the workplace.Master of Arts
49
Friend, Sheena Anne. "Phylogeny of the Genus Arachis and its Application to the Evolution of the Major Peanut Allergen Ara h 2." Diss., Virginia Tech, 2010. http://hdl.handle.net/10919/77180.
Full textAbstract:
Peanuts (A. hypogaea) are an economically important crop, a source of food allergies and a member of the South American genus Arachis. The eighty species of genus Arachis have been divided into nine sections. The largest, section Arachis, has been further subdivided into three genome groups. The current intuitive understanding of the evolutionary relationships among Arachis is based on morphological, geographic and cytogenetic data, but a comprehensive phylogenetic study for the genus is lacking. A total of 48 species representing all nine sections were used to reconstruct a phylogeny based on sequence information from plastid trnT-trnF and nuclear ITS genomic regions. Phylogenetic analysis resolved section Extranervosae at the base, followed by sections Triseminatae and Caulorrhizae. Two major terminal lineages were recovered. One is comprised of sections Erectoides, Heteranthae, Procumbentes, Rhizomatosae, and Trierectoides, referred to here as group erectoides. The other is comprised of two major clades, arachis I (B genome, D genome, and aneuploid species) and arachis II (A genome species). The phylogenetic trees show that sequence data partially agrees with the relationships described in the monograph; however, some further investigation is necessary to clarify relationships within and among species of the two terminal lineages. In addition, the major allergen Ara h 2 from 12 wild species from across the genus was analyzed for mutations that could potentially produce a hypoallergenic ortholog. It was found that the evolution of the allergen mostly reflected the species phylogenies based on ITS and combined. The majority of substitutions and length variations were concentrated in the loop connecting helices H2 and H3. Section Arachis species tended to have larger H2-H3 loops, while those from other sections had shorter loops. The immunodominant epitopes #6 and #7, located within this loop, tended to contain mutations or were truncated among species outside of section Arachis. Dot immunoblots showed reduced IgE-binding to peptides representing portions of the H2-H3 loop from A. guarantica and A. triseminata. Orthologs from wild species have demonstrated that they could potentially contain variations of the allergen Ara h 2 that could be utilized to develop a safer peanut cultivar.Ph. D.
50
Tolsma, Shaun, and Ingrid Torfgård. "Recycling of concrete for sustainable road construction : Why are proven methods not currently used?" Thesis, Uppsala universitet, Byggteknik, 2018. http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-355724.
Full textAbstract:
This report aims to investigate why proven methods for recycling concrete waste as road construction material are not practiced in Sweden. An additional objective is to investigate how concrete is handled as a waste product and whether it would be environmentally friendly and financially beneficial to clients and contractors. Information has been extracted via interviews conducted with experts from various positions within the civil engineering industry. Additional information was obtained through literature studies and questionnaires sent and received via email. Results which were frequently mentioned by engineering professionals included the extra expense of transporting and processing crushed concrete, parties involved in the design and construction processtend to follow traditional methods of using tried and tested virgin materials, the assumption of responsibility for structural failure due to alternative materials and general lack of knowledge surrounding crushed concrete as a construction material. Conclusions are that crushed concrete is suitable for construction of subbases in roads and base courses of cycle/pedestrian paths. Traditionally used virgin materials are generally less expensive than crushed concrete. Existing legislation makes the use of recycled construction material difficult. Awareness and education regarding recycled concrete, as a construction material, should be increased.