To see the other types of publications on this topic, follow the link: Basavaiah.
Journal articles on the topic 'Basavaiah'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 39 journal articles for your research on the topic 'Basavaiah.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
B., Sathish Mohan, Pavan Kumar Y., Ramadevi D., and Basavaiah K. "Investigation of Structural and Thermal Properties of Nanostructured PANI." International Journal of Trend in Scientific Research and Development 2, no. 5 (2018): 1024–28. https://doi.org/10.31142/ijtsrd16970.
Full textAbstract:
In this paper, we report a preparation of poly aniline PANI nanostructure by oxidative polymerisation in presence of HCl as do pant. The structural, morphological and thermal properties of as prepared PANI was investigated by X ray diffraction XRD , Fourier transform infrared FTIR , UV Visible diffuse reflectance spectrophotometer DRS , Field emission scanning electron microscopy FESEM and Thermo gravimetric analysis TGA .It is found that the morphology of PANI is fibril like shape with band gap of 2.74eV. Thermal conductivity of PANI nanostructure was calculated as a function of temperature. B. Sathish Mohan | Y. Pavan Kumar | D. Ramadevi | K. Basavaiah "Investigation of Structural and Thermal Properties of Nanostructured PANI" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-2 | Issue-5 , August 2018, URL: https://www.ijtsrd.com/papers/ijtsrd16970.pdf
2
H.T., Dhananjaiah. "Praja Mitra Mandali: A Re –Appraisal." Shanlax International Journal of Arts, Science and Humanities 6, S1 (2019): 193–95. https://doi.org/10.5281/zenodo.3335900.
Full textAbstract:
Praja Mitra mandali which was established in 1917 in the princely state of Mysore played an important role in bringing awareness among the non Brahmins. It was the rst non Brahmin organization the state. Sahukar Chennaiah, M Basavaian, and a host of others through this organization tried to bring political awareness among the backward classes through which they were able to achive social justice. An attempt is made in this paper to trade growth and development of Praja Mitra Mandali and its attempts in both political and social arena og the princely State of Mysore.
3
Mishra, Mahendra Kumar. "“Basavaraj” Sri Krisna Parijata." POETCRIT 34, no. 1 (2021): 111–14. http://dx.doi.org/10.32381/poet.2020.34.01.16.
Full text
4
Dalavi, Jagdish Vishnu, Asif Tamboli, Ramesh Pujar, Basavaraj Saliyavar, and Shrirang Yadav. "Reinstatement of Portulaca badamica from P. tuberosa with critical notes on variation in P. tuberosa." Phytotaxa 671, no. 3 (2024): 293–300. https://doi.org/10.11646/phytotaxa.671.3.7.
Full textAbstract:
Dalavi, Jagdish Vishnu, Tamboli, Asif, Pujar, Ramesh, Saliyavar, Basavaraj, Yadav, Shrirang (2024): Reinstatement of Portulaca badamica from P. tuberosa with critical notes on variation in P. tuberosa. Phytotaxa 671 (3): 293-300, DOI: 10.11646/phytotaxa.671.3.7, URL: https://doi.org/10.11646/phytotaxa.671.3.7
5
Singh, Kh Kunjo. "Fictionalisation of History In Basavaraj Naikar's The Sun of Freedom." Dialogue: A Journal Devoted to Literary Appreciation 18, no. 1 (2022): 38–43. http://dx.doi.org/10.30949/dajdtla.v18i1.1.
Full textAbstract:

 
 
 
 Basavaraj Naikar's novel The Sun of Freedom (2020) is fictionalization of the colonial history of India, particularly of the Deccan region. Here the conflict between Bhaskararao Bhave, king of Naragund and East India Company around 1857 is presented to reflect the whole Indian history of the time. In the novel traditionally preserved culture is also fictionalised in an artistic manner. The novel is a faithful record of the turbulent period of the Colonial history of India visa-vis Naragund where collective political consciousness and identity collapse with the advent of colonialism and British Paramouncy resulting in the loss of national freedom. By this time Lord Dalhousie, the then Governor General of India passed two Acts - "Doctrine of Lapse" and "Disarmament Bill" around 1845. Both the Acts were against the freedom of the native kings of South India. The East India Company attacked at Naragund Palace and possessed it thereby making Bhaskararao flee. His effort to recover Naragund by meeting even Nana Saheb in Nepal was of no avail. Ultimately the narrative shows the tragic death of Bhaskararao somewhere in North India.
 
 
 
6
Prof. R. G. Vastrad and Prof. K. G. Hiremath. "Fish Diversity in Krishna River Basin Almatti, Basavana Bagewadi Taluk, Karnataka." International Research Journal on Advanced Engineering and Management (IRJAEM) 2, no. 09 (2024): 2844–46. http://dx.doi.org/10.47392/irjaem.2024.0418.
Full textAbstract:
The fish fauna of the Krishna River, Karnataka in relation to physicochemical parameters was studied from September 2023 to January 2024. The water of the River is used for fishery and agriculture. Fish species were collected with the help of gillnets of standardized dimensions with several mesh sizes. A total of 14 fish fauna belonging to 03 orders and o4 families were recorded. Among fish families Cyprinidae consists of 11 species and Channidae, Ambassidae ,Clarridae with 01 species each respectively. The maximum species contribution was made by family Cyprinidae. The limnological parameters indicate the higher trophic status of the pond which can be attributed to anthropogenic pressure.
7
Oliva, Maria Luiza Vilela, Ingrid Dreveny, and Jonas Emsley. "Exosites expedite blood coagulation." Journal of Biological Chemistry 295, no. 45 (2020): 15208–9. http://dx.doi.org/10.1074/jbc.h120.016301.
Full textAbstract:
A careful balance between active-site and exosite contributions is critically important for the specificity of many proteases, but this balance is not yet defined for some of the serine proteases that serve as coagulation factors. Basavaraj and Krishnaswamy have closed an important gap in our knowledge of coagulation factor X activation by the intrinsic Xase complex by showing that exosite binding plays a critical role in this process, which they describe as a “dock and lock.” This finding not only significantly enhances our understanding of this step in the coagulation cascade and highlights parallels with the prothrombinase complex, but will also provide a novel rationale for inhibitor development in the future.
8
Mishra, R. K. "Magnanimity of an Indian Saint: The Portrait of an Apostle of God: A Focus on Basavaraj Naikar's Religious Play The Golden Servant of God." Dialogue: A Journal Devoted to Literary Appreciation 15, no. 1-2 (2019): 57–65. http://dx.doi.org/10.30949/dajdtla.v14i1-2.8.
Full textAbstract:
This article offers a detailed analysis of Basavaraj Naikar's religious play, The Golden Servant of God in terms of its dramatic conflict between worldliness and spirituality that takes place in the soul of Kanakadasa, a great saint of Karnataka. It shows how he, born in a shepherd caste, grows from the level of an Administrator of Bada and Bamkapura villages (appointed by Emperor Sri Krisnadevaraya of Vijayanagara Empire) to that of a renunciate, fighting all through his life against the social evil of caste discrimination, especially against brahmanical orthodoxy and articulates the same in his innumerable musical compositions known as kirtanas. It also shows how Kanakadasa, being disillusioned by the meaninglessness of material life, seeks shelter and salvation in the holy feet of Lord Adikesava of Kaginelli, a tiny village in North Karnataka.
9
Basavaraj, KF, AU Madihalli, Abdul Mujeeb, Samir Mansuri, and Mohammed Abid Hussain. "Advancing Mandibular Swelling: A Diagnostic Dilemma." Journal of Contemporary Dental Practice 14, no. 4 (2013): 754–58. http://dx.doi.org/10.5005/jp-journals-10024-1397.
Full textAbstract:
ABSTRACT Asymmetrical swelling of the mandible in adolescence may pose a significant diagnostic dilemma. The differential diagnosis ranges from traumatic, infectious, and metabolic processes to benign and malignant tumors. Also may present with similar clinical and radiological features, making an accurate diagnosis quite difficult. This is an illustrative case involving a 30-year-old female who initially presented with complaint of pain and swelling in the lower left side of the face for 2 months. Multiple investigations and several biopsies were required to arrive at a diagnosis. This paper deals with a case report of a fibrosarcoma involving the mandible highlighting the importance of early diagnosis and treatment planning. How to cite this article Basavaraj KF, Madihalli AU, Mujeeb A, Mansuri S, Hussain MA. Advancing Mandibular Swelling: A Diagnostic Dilemma. J Contemp Dent Pract 2013;14(4):754-758.
10
Mishra, R. K. "Spiritual Pilgrimage Towards Salvation: A Critical Study of Basavaraj Naikar's Religious Play The Pilgrim of Life." Dialogue: A Journal Devoted to Literary Appreciation 15, no. 1-2 (2019): 30–42. http://dx.doi.org/10.30949/dajdtla.v14i1-2.5.
Full textAbstract:
Evaluation of diversity through genetic variability and correlation studies on vegetative and floral characters of chrysanthemum genotypes were undertaken at experimental farm, Department of Horticulture, NEHU, Tura Campus, Tura, West Garo Hills District, Meghalaya during 2015-2019.Fifteen varieties namely, Korean Red, Korean Yellow, Solan Shringar, Ramblored, Yellow Star, Calabria, Ajay, AAU Yellow, White Star, Korean Bicolour, Charming, Lysid, Safin, Shayana and Gambit were selected for their evaluation. The range of variation was high for number of leaves (38.24-125.11) followed by days to bud initiation (34.60-94.66). Highest phenotypic and genotypic variances were observed for number of leaves (699.74 and 699.70), respectively. The estimates of phenotypic coefficient of variation (PCV) were higher than genotypic coefficient of variation (GCV) for all the traits. Maximum PCV and GCV was observed for dry weight (89.73 and 89.17) followed by number of flowers per spray per plant (78.10 and 78.08). However, maximum heritability were observed in number of leaves (99.98 percent), number of flowers per spray per plant (99.98 percent) and flower longevity (99.97 percent) followed by days to bud initiation (99.95 percent) and plant height (99.94 percent), whereas, maximum genetic advance was noticed in number of leaves (54.49). The high heritability with genetic advance as percentage of mean for number of branches and number of flowers per spray per plant indicates the possible role of additive gene action. The magnitude of genotypic correlation was higher than their corresponding phenotypic correlation for most of the traits, indicating a strong inherent linkage between various traits under study. At genotypic and phenotypic level, number of leaves exhibited highly significant and positive correlation with number of branches (0.889), number of flower head per plant (0.498), number of sprays per plant (0.497) and number of flowers per spray per plant (0.419), while, vase life showed significant and positive correlation with number of flower head per plant (0.315), number of sprays per plant (0.339) and flower diameter (0.311).
11
Mishra, R. K. "A Young Man’s Crusade against Casteism and Untouchability: A Study of Basavaraj Naikar’s Play, Light of Humanity." Poetcrit 36, no. 1 (2023): 51–60. http://dx.doi.org/10.32381/poet.2023.36.01.7.
Full text
12
R, Navyashree, Mummigatti UV, Nethra P, Basavaraj B, and Hanamaratti NG. "Evaluating the Effects of Drought Stress on Biomass and Yield Traits in Sorghum Genotypes." International Journal of Environment and Climate Change 14, no. 5 (2024): 79–87. http://dx.doi.org/10.9734/ijecc/2024/v14i54172.
Full textAbstract:
The study aimed to identify drought-tolerant sorghum genotypes by evaluating twenty sorghum genotypes over two Rabi seasons (2021-22 and 2022-23) under irrigated and rainfed conditions using a split plot design. Results showed that moisture stress significantly affected sorghum performance, including leaf and stem dry matter accumulation, grain yield per plant, stover yield, and harvest index. Among the genotypes, BJV-44 and M-35-1 exhibited the least decline in grain yield per plant under rainfed conditions, with yields of 76.17 and 73.50 g/plant, respectively, compared to irrigated conditions. Conversely, genotypes M 148-138 and Tandur L experienced the most significant reductions in grain yield per plant under rainfed conditions. Basavana pada exhibited the highest harvest index. The study concluded that BJV-44 and M-35-1 are drought-tolerant sorghum genotypes with relatively higher grain yields per plant under rainfed conditions, providing valuable insights into sorghum genotype performance and resource utilization in drought-prone regions.
13
Kavya, K. S. Math, and Basavaraj Mathpathi Dr. "Voice Recognition Wireless Home Automation System Based on IOT." International Journal of Trend in Scientific Research and Development 2, no. 5 (2018): 261–64. https://doi.org/10.31142/ijtsrd15828.
Full textAbstract:
In the modern centuries, the Home Computerization scheme that is automation became one of the important challenges using and controlling the things remotely. The burst increase the electronic technology which made an automation to be a part in the day to day life. The remote technology has seen the rise of numerous criterions, mainly in the manufacturing, technical and medical departments. The wireless home Automation schemes should be executed in present home conditions, devoid of any variations in the structure. The automation hub on acknowledgment of vocal sound instructions and uses a low power IOT communiqué unit alongside controller. This arrangement is most reasonable for the mature, old and the disabled people particularly those who live alone. The system is proposed to regulate all illuminations i.e. light and electrical procedures in homes based on voice. Kavya K S Math | Dr. Basavaraj Mathpathi "Voice Recognition Wireless Home Automation System Based on IOT" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-2 | Issue-5 , August 2018, URL: https://www.ijtsrd.com/papers/ijtsrd15828.pdf
14
Priyanka, Lahande, and Basavaraj Mathpathi Dr. "IoT Based Smart Irrigation System." International Journal of Trend in Scientific Research and Development 2, no. 5 (2018): 359–62. https://doi.org/10.31142/ijtsrd15827.
Full textAbstract:
Water scarcity nowadays is a big concern for farmers and with this growing population of our country agriculture becomes a serious and main problem that our framers are facing today. The main objective of the project is providing automatic irrigation system that switches a motor pump ON OFF by sensing moisture content of the soil through application of Internet of Things IOT . Human intervention can be reduced by proper method of irrigation. The project consists of Arduino microcontroller and sensor, where Arduino microcontroller is programmed to receive the input signal of varying moisture condition of the soil through sensor. Once the controller receives these signal, the output then relay on operating the water pump. The sensing arrangement is made up of two metallic rods inserted to the agriculture field which is required to be controlled. Priyanka Lahande | Dr. Basavaraj Mathpathi "IoT Based Smart Irrigation System" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-2 | Issue-5 , August 2018, URL: https://www.ijtsrd.com/papers/ijtsrd15827.pdf
15
Turamari, Rajesh, and Satishkumar Naikar. "Use of 24/7 Hours Reading Room Facility in Prof. S S Basavanal Library by the users: A Study." Indian Journal of Library & Information Technology 08, no. 04 (2018): 14–17. https://doi.org/10.5281/zenodo.4016186.
Full textAbstract:
Reading room which has been set apart for reading and study, generally provided with hooks and other material 24/7-reading rooms are open around the clock and give students the opportunity of staying at the library after it closes so they can study whenever it suits them. The 24/7-reading areas in Karnatak University campus for students and other users. The article highlights the importance and its problems
16
Mallesh, S. Jambagi, H. Basavaraj, L. Gagan, and R. Prabhu Prateek. "Smart Speaker using Raspberry Pi." International Journal of Trend in Scientific Research and Development 2, no. 4 (2018): 1682–85. https://doi.org/10.31142/ijtsrd14440.
Full textAbstract:
As the software systems are getting more and more complex each day, the ability of the user to put up with this complexity is reducing. An elegant solution to deal with this issue is to build a personal assistant agent which is capable of determining users habits, preferences and intentions and helping them accordingly. This work discusses on developing a Smart Speaker using Raspberry Pi . The work aims at the development of a personal voice assistant which can assist users in performing their personal and professional tasks using speech commands and provide more interactive and user friendly experience. The assistant also helps in controlling home appliances and IoT devices and reduce the workload of the user. The major element of the Smart Speaker is the Raspberry Pi. The Raspberry Pi collects speech input and interprets it to manage certain tasks. Mallesh S Jambagi | Basavaraj H | Gagan L | Prateek R Prabhu "Smart Speaker using Raspberry Pi" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-2 | Issue-4 , June 2018, URL: https://www.ijtsrd.com/papers/ijtsrd14440.pdf
17
Khan, Saleem Akhtar, Waheed Ahmad Khan, and Imran Ali. "Anticolonial Visions and Fictional Versions: A Comparative Study of American and Indian Postcolonial Novels." Global Language Review VI, no. III (2021): 81–90. http://dx.doi.org/10.31703/glr.2021(vi-iii).09.
Full textAbstract:
The research juxtaposes two of the prominent postcolonial literary discourses produced by the nations that resisted the colonial encroachments militarily and, ultimately, gained their independence from the British imperial clutch, America and India. The selected literary works are replete with retrospective representations of the historical landmarks and laden with future ideological aspirations regarding national glory. Remaining awake to the perplexing verisimilitude of postcolonial works of literature, the study aims to explain the pivotal nexus that links the divergent discourses, that is, the anti colonial élan.For the accomplishment of the comparative analysis, two of the novels have been chosen, one for each country, to represent the respective version of resistance: Jeff Shaara's The Glorious Cause (2002) from an array of the American fictional narratives and Basavaraj Naikar's The Sun behind the Cloud (2001)from the Indian anglophone fiction. After outlining the belligerent disposition of these novels, their thematic schemas have been compared and contrasted to make the post coloniality of these polemical fictions manifest. It has been made explicit that the novels are essentially similar in their counter-discursive character and dissemination of the anti colonial sentiment despite some peripheral differences. Thus, these novels contribute to the broader postcolonial continuum that comprehensively accommodates varying versions of the textual resistance.
18
Basavaraj, Chanda, Srikanth Vislavath, and |. Prasanna N. Rao Gopikrishna. "Ayurvedic Intervention in the Management of Post Operative Diabetic Foot Gangrene - A Case Study." International Journal of Trend in Scientific Research and Development 3, no. 1 (2018): 515–20. https://doi.org/10.31142/ijtsrd19016.
Full textAbstract:
Surgical procedures normally carry a risk of wound infection, excessive bleeding or tissue damage. Diabetes has higher risk of wound healing complications following surgery. Wound tends to require more time to heal due to poor blood circulation, nerve damage, or a compromised immune system. In such conditions, non healing wounds can lead to osteomyelitis, sepsis and even death also. Ayurvedic literature has given detailed explanations on wound management from its manifestation to the complete healing, shown good results in Non healing wounds. Acharya Sushruta, explained Shodana purification , Ropana healing procedures for wounds with Ayurvedic formulations includes Panchavalkala Kashaya and Jatyadi Taila. This is a case of 45 years old male, diabetic presented with the complains of non healing wound on 5th right toe with swelling, discharge, foul smell and blackish discoloration of skin, diagnosed as diabetic foot gangrene. Ray's amputation done and post operative wound management was carried under Ayurvedic treatment procedures. Significant improvement seen in wound healing within a short period. In this case Panchavalaka Kashaya and Jatyadi Taila show its Shodhana and Ropana properties. Basavaraj Chanda | Vislavath Srikanth | Gopikrishna | Prasanna N Rao "Ayurvedic Intervention in the Management of Post-Operative Diabetic Foot Gangrene - A Case Study" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-1 , December 2018, URL: https://www.ijtsrd.com/papers/ijtsrd19016.pdf
19
Yao, Zhengui. "Case Studies in Ceramic Product Development, Manufacturing, and Commercialization - Ceramic Transactions Volume 75 Edited by Asish Ghosh, Ronald E. Barks, and Basavaraj Hiremath." Materials and Manufacturing Processes 13, no. 5 (1998): 785–86. http://dx.doi.org/10.1080/10426919808935300.
Full text
20
A M, GOWTHAM, R. B. BELLI, HARISH B P, and NITISH KAWALAGA. "Analysis of Technological Gap and Constraints in Adoption of Chickpea Production Technologies of UAS Dharwad in North Karnataka." Journal of Scientific Research and Reports 31, no. 7 (2025): 166–73. https://doi.org/10.9734/jsrr/2025/v31i73238.
Full textAbstract:
Chickpea (Cicer arientinum L.) is one of the major pulse crops in India as well as in Karnataka grown as a rabi season crops in major parts of Karnataka. This study was purposively conducted in Vijayapura (Vijayapura taluk and Basavana Bagewadi taluk) and Gadag (Gadag taluk and Ron taluk) districts of Karnataka state during 2021-22 with a sample of 120 chickpea growers. The data was elicited through personal interview method and ex-post-facto research design was used for the study. More than one fourth of chickpea growers belonged to medium technological gap (37.50 %), high technological gap (35.83 %) category and 26.67% of Chickpea growers were belonged to low technological gap category. No technological gap was noticed in practices like adoption of recommended soil, land preparation, varieties and harvesting time, season of sowing, very less technological gap was found in intercultivation (08.33%), chemical control of pod borer (19.17%). Huge technological gap was noticed in adoption of fusarium wilt resistant JG-11 variety (75.00%), application of FYM 2-3 weeks before sowing (75.00%) and chemical control of rust disease (80.00%) and intercropping with rabi sorghum (84.17%). This is due to lack of knowledge about specific practices of chickpea production. Inadequate knowledge about balanced fertilizer application, high risk of crop failure due to poor rainfall. Inadequate loan amount and fluctuation in market prices were the major constraints faced by the chickpea growers.
21
Mishra, R. K. "Magnanimity of an Indian Saint: The Portrait of an Apostle of God: A Focus on Basavaraj Naikar’s Religious Play, The Golden Servant of God." POETCRIT 33, no. 2 (2019): 30–39. http://dx.doi.org/10.32381/poet.2020.33.02.4.
Full text
22
Saleem Akhtar Khan, Muhammad Ehsan, and Nasar Iqbal. "S/words versus S/words: A Bidirectional Reading of the Post/colonial Fictions." sjesr 4, no. 1 (2021): 247–56. http://dx.doi.org/10.36902/sjesr-vol4-iss1-2021(247-256).
Full textAbstract:
The article explicates the polemical schema of the novels produced by the British and the Indian writers apropos the historical event of the anticolonial rebellion/ revolution (1857). Grounded in the idea of creating a dialogue between the colonial and counter discursive texts, the research invokes Richard Lane’s bidirectional approach to explain how conflictual political visions trigger the skewed versions of the great defiance. The novelists of both nations have produced prolific fictional yields to represent the epic event. However, keeping in mind the scope of the study, the researchers have delimited their focus upon two of the representative novels, one for each nation: Louis Tracy’s The Red Year: A Story of the Indian Mutiny (1907) for the English version and Basavaraj Naikar’s The Sun behind the Cloud (2001) for the Indian one. Each of the novels voices the sloganized rhetoric of the respective nation while narrating the colossal clash, that is, Tracy portrays the mutiny as nefarious recalcitrance of the Indian rebels to disrupt the civilizational program and Naikar presents it as an auspicious act of defiance against the exploitative encroachment of the usurpers. A comparison has been drawn between the ideology-ridden discursive patterns of both the belligerent narratives and an intriguing concatenation of the diametric contrasts has been identified. The essential argument of the article is entrenched in the postcolonial and the new historicist notions vis-à-vis the chequered nature of the textual narratives and politicized parlance of the discursive records of the historical happenings.
23
Kennedy, Dr S. Hanuman. "Editorial." Ushus - Journal of Business Management 15, no. 2 (2016): v—vi. http://dx.doi.org/10.12725/ujbm.35.0.
Full textAbstract:
This issue largely focuses on the topics related to general management. The first article on ‘Impact of Innovative Strategic Human Resource Management Practices on the Performance of Small and Medium Enterprises’– A Case Study of Karnataka by B.K.Sathyanarayana and Nawal Kishor aims at evaluating the application and implementation of Strategic Human Resource Management (SHRM) practices for Small and Medium Enterprises (SMEs) and to examine its impact on organisational performance. Six hundred & forty SMEs in and around the Bangalore District from both Manufacturing and Services Sector responded to the various Strategic Human Resource Management drivers and organizational drivers and it was inferred that there exists a positive significant correlation between these variables. The next article on sustainable development best management practices in the food processing industry by Uma CS, Basavaraj & Prasanna Joshi attempts to study sustainable development that involves issues like organic farming, food safety and food quality. This paper highlights on the concept of green food system and the approach of good agricultural practices (GAP) which is a new concept that stresses on international quality standards, concerns and commitments about food production, food safety and security, environment sustainability of agriculture. Quality management is equally important in the food industry. Food processing is a capital intensive, water consuming and a polluting industry. Therefore this paper also studies the management practices in this industry to reduce water wastage, ensuring food quality so the concept of green growth can be achieved. It also throws light on the various Governmental laws and regulations passed to control pollution and ensure food quality and health of the people.
24
Mishra, Dr R. K. "Colonial Encounter and its Repercussion on Socio-cultural life of Indian Kingdoms: A Thematic Study of Basavaraj Naikar’s Historical Plays, The Rani of Kittur and A Dreamer of Freedom." POETCRIT 32, no. 2 (2019): 6–16. http://dx.doi.org/10.32381/poet.2019.32.02.2.
Full text
25
I. B, Biradar,, Sreenatha, A., Sanjeevraddi, G. Reddi, et al. "Land Use Planning by Using GIS Techniques for Land Resource Inventory (LRI)- Northern Dry Zone of Karnataka, India." Asian Journal of Soil Science and Plant Nutrition 10, no. 2 (2024): 27–36. http://dx.doi.org/10.9734/ajsspn/2024/v10i2257.
Full textAbstract:
A study was conducted to determine land capability and to develop suitability map based on soil characteristics and climatic factors of watershed area. Detailed soil survey was carried out for Donur-2 micro watershed which comes under Basavana Bagewadi taluka of Vijayapura district, Karnataka to acquire the comprehensive data related land resources. From the study area, it was observed that based on soil-site characteristics four soil series were identified such as Dadamatti, Karjol, Nidoni and Rampur series and mapped into eight mapping units using GIS techniques. Donur-2 watershed area has been grouped into three land capability classes (LCC) viz., II, III and IV with four subclasses IIes, IIIs, IIIse and IVe. Subclass ‘e’ is due to major limitation of soil property group ‘e’ i.e erosion and slope, subclass ‘s’ is due to major limitations group ‘s’ having parameters like texture, depth and gravelliness. Subclass ‘se’ and ‘es’ are due to limitations of both soil parameters group above mentioned, however se and es are different classes which are based major limitation one of the group and followed by other group. Land capability map was developed using GIS techniques which indicates that out of 324.3 ha study area, LCC class IIIs covering major area i.e. 179 ha (55.12%), followed by class IIs i.e. 109 ha (33.51%), class IVe i.e. 23 ha (7.15%) and minor area of 7 ha (2.15%) area is covered by class IIIse. Soil suitability assessment indicates that majority of land is moderately suitable for agriculture. Class III soils are designated as moderately fertile agricultural land with significant constraints. However, with special conservation practices soils under class III can be used for cultivation of different crops. Class IV soils are categorized as reasonably fertile for intermittent cultivation, characterized by significant restrictions that limit crop options but with careful management practices these can be used for cultivation of arable crops. Therefore, the utilization of a land use planning approach (LUP) is instrumental in formulating tailored land resource management strategies to enhance land productivity, mitigate land degradation and attain sustainability goals.
26
Ke, Lei, Lindsey A. George, and Nabil K. Thalji. "Novel Rationally Developed Substrates for Factor IXa Demonstrate Active Site Differentiation between Factor IXa and Factor IXa-Padua." Blood 144, Supplement 1 (2024): 2581. https://doi.org/10.1182/blood-2024-210733.
Full textAbstract:
Background: The goal of achieving therapeutically relevant levels of FIX activity in hemophilia B (HB) has been enhanced with the use of the hyperactive factor IX variant R338L (FIX-Padua). FIX-Padua has between 4 to 9-fold higher specific activity than wild-type (wt-) FIX, although the exact mechanism of enhanced activity is still unknown. In particular, characterizing the active site differences between wt-FIXa and FIXaR338L has been significantly limited by the lack of adequate small peptidyl substrates for FIXa. FIXa demonstrates very weak amidolytic activity with respect to existing substrates (Basavaraj et al., 2020), particularly in the absence of ethylene glycol or other alcohols. These conditions can potentially create non-physiological and detrimental effects on both the FIXa active site and intrinsic Xase complex formation, stability, and function. Given that FIXR338L is the transgene in two FDA-approved HB gene therapy products, understanding the mechanism of its enhanced activity is critical. To this end, we rationally designed novel, efficient FIXa peptidyl substrates that do not require alcohols. These peptides take advantage of the crystallographic observation that P' side interactions (Johnson et al., 2010) are important for FIXa substrate recognition. We then employed these peptides to study the active site function of FIXaR338L. Methods: We synthesized a series of peptides incorporating various residues from natural FIXa substrates on both the P and P' sides of the scissile bond. Typical serine protease peptidyl substrates contain only P side residues, with a fluorophore on the carboxy-terminal side that is liberated after hydrolysis to enable readout. Since our peptides have residues on either side of the scissile bond, we incorporated either MCA/Lys(DNP) or ACC/Lys(DNP) FRET pairs on the amino and carboxy-terminals, respectively, with MCA or ACC serving as the fluorophore and Lys(DNP) functioning as the quencher. Following cleavage by the enzyme, spatial separation from the quencher occurs, rendering the fluorophore available for excitation. Multiple peptide sequences were characterized to evaluate FIXa's ability to hydrolyze them. We then performed detailed kinetic characterization of the most promising sequences and evaluated them for protease selectivity. Finally, we performed kinetic studies with FIXaR338L to determine if there are measurable active site differences between the wild-type form and the variant. Results: We identified a 9-amino acid candidate peptide that had up to 100-fold enhanced kcat and higher affinity for the enzyme compared to existing FIXa peptidyl substrates. This peptide incorporated 3 residues on the P side and 6 residues on the P' side of the scissile bond. Importantly, this enhanced activity was seen without the need for ethylene glycol, and addition of ethylene glycol had no significant effect on amidolytic activity. The FRET pair employing ACC as the fluorophore showed dramatically greater fluorescence and enhanced solubility compared to MCA. To ensure that this was indeed an active site probe, we confirmed that active site blocked FIXa (FIXa-DEGR) did not hydrolyze the substrate. Further, we demonstrated that the active site serine protease inhibitor benzamidine inhibited FIXa competitively with respect to our novel substrate (Ki = 2 mM), consistent with the kinetics of other active site probes. Surprisingly, FIXaR338L was considerably less efficient at hydrolyzing the substrate compared to wt-FIXa while still exhibiting similar substrate affinity (KM = 35.9 - 39.4 uM) but 2 to 6-fold slower turnover (72.5 vs 8.9 RFU/s), which could not be rescued by imparting FVIIIa cofactor function with either FVIIIa, emicizumab, or substrate binding. Finally, we redemonstrated that previous observations with both wt-FIXa and FIXaR338L are inhibited by antithrombin identically. Conclusions: A novel active site probe for FIXa demonstrates that the active site of FIXaR338L is significantly different from that of wt-FIXa. This does not mean that FIXaR338L is less functional, but rather implies that understanding the different activity of FIXaR338L will require understanding how a remote mutation affects the enzyme's active site.
27
Goolyam Basavaraj, Manjunath, and Sriram Krishnaswamy. "A Novel Variant of Factor VIII Yields Cofactor Activity without Proteolysis between the A1 and A2 Domains." Blood 132, Supplement 1 (2018): 3771. http://dx.doi.org/10.1182/blood-2018-99-116267.
Full textAbstract:
Abstract Factor VIII (FVIII) has a multi-domain structure (A1-a1-A2-a2-B-a3-A3-C1-C2), and intracellular processing within the B domain results in its secretion as a heterodimeric procofactor consisting of a variably sized heavy chain (A1-a1-A2-a2-B) and a light chain (a3-A3-C1-C2). Proteolytic cleavage by thrombin at R372, R740, and R1689 removes the B-domain, releases it from vWF by cleaving the a3-acidic region and activates FVIII to the heterotrimeric cofactor, FVIIIa (A1-a1/A2-a2/A3-C1-C2). The requirement for cleavage following a1 to generate active cofactor sets FVIII/FVIIIa apart from factor V, its structural and functional homolog. FVIII binds its cognate protease, factor IXa (FIXa) with high affinity in a membrane-dependent way. However, this complex does not efficiently activate factor X (FX) until R372 is cleaved, indicating that this cleavage reaction is important in facilitating FX recognition and its enhanced activation by intrinsic tenase complex. We speculated that separation of A1-a1 and A2-a2 domains through cleavage at R372 might be replicated by inserting a linker between A1-a1 and A2-a2 domains even when the 372 site was rendered uncleavable. We chose canine FVIII (cFVIII) to test our ideas due to its higher expression levels in cell culture compared to human FVIII. We made cDNA constructs encoding cFVIII variants with flexible (GGGGS, [GGGGS]3, GGGGGG) or rigid (EAAAK, [EAAAK]3, PAPAP) linkers between A1-a1 and A2-a2 domains on the R366Q backbone (corresponding to R372 in human FVIII). All constructs were stably transfected into BHK cells and high expressing clones were selected by one stage aPTT and western blotting of expression media. Clotting times of cFVIII variants with flexible linkers were very similar to cFVIII R366Q without linker (~64 sec). In contrast, clotting times of cFVIII variants with rigid linkers were consistently lower (16 - 26 sec). cFVIII variants (R366Q, R366Q-EAAAK, R366Q-PAPAP) were purified from 15L of expression media each. In one stage aPTT assays purified cFVIII variants (10 nM) showed clotting times (R366Q-EAAAK, 33.3 s, R366Q-PAPAP, 26 s) that were considerably shorter than the R366Q variant (52.2 s) and more in line with wild type cFVIII (cFVIII-WT,19.3 s). To assess possible cleavage at the 366 site, purified cFVIII variants were analyzed by SDS-PAGE following treatment with a high concentration of thrombin. As expected, cFVIII-WT was quantitatively cleaved at R366, R734 and R1689 to produce bands corresponding to A1-a1, A2-a2 and A3-C1-C2. In contrast, both R366Q and R366Q-PAPAP variants were resistant to cleavage at 366, yielding bands corresponding to A1-a1-A2-a2 and A3-C1-C2. The cFVIII-R366Q-EAAAK variant was susceptible to some cleavage, likely at the lysine present within linker. We also performed steady state kinetic studies of FX activation using limiting concentrations of IXa, saturating concentrations of cFVIII variants pretreated with thrombin, membranes and increasing concentrations of FX. Vmax/[E] for FXa formation was 140 ± 7 min-1 with cFVIIIa-WT, 4 ± 0.3 min-1 with cFVIIIa-R366Q, and 42 ± 4 min-1 with cFVIIIa-R366Q-PAPAP. The Km for FX remained unaffected for all variants. The results indicate that the impaired cofactor activity of the FVIII variant that is not cleaved at the 366 site can be substantially rescued by insertion of the PAPAP linker after 366Q. Further optimization of the linker might completely correct defective FX activation associated with the lack of proteolytic cleavage between A1-a1 and A2-a2 domains. Our study indicates that cleavage at the 366 site is not an absolute determinant of FVIII activation and provides new insights into the function of FVIIIa as a cofactor within the intrinsic tenase complex. Disclosures Goolyam Basavaraj: Bayer: Research Funding; Grifols: Research Funding. Krishnaswamy:Portola: Research Funding; Baxalta: Consultancy; Janssen Research & Development: Research Funding.
28
Dinesh Reddy,, Dr Sagam, Dr Sateesh Babu Kaki, and Dr Sarath Chandra Nibhanpudi. "Serum Uric Acid Levels and Dengue Severity: A Comprehensive Meta Analysis." International Journal Of Family Medicine And Public Health 04, no. 01 (2025): 01–04. https://doi.org/10.51521/ijfmph.2025.41115.
Full textAbstract:
tions. Serum uric acid (SUA) has been proposed as a potential biomarker for disease severity. This systematic review and meta-analysis evaluates the association between SUA levels and dengue severity. Methods: A systematic search was conducted in PubMed, Scopus, Web of Science, Embase, Cochrane Library, Google Scholar, MedRxiv, and BioRxiv from January 2000 to January 2025. Studies reporting SUA levels in severe and non-severe dengue cases were included. A random-effects meta-analysis was performed to estimate pooled risk ratios (RR) and mean differences (MD) with 95% confidence intervals (CIs). Heterogeneity was assessed using the I² statistic, and publication bias was examined via funnel plot and Egger’s test. Results: A total of 11 studies with 1,880 participants were included. The pooled RR for severe dengue in patients with elevated SUA levels was 1.32 (95% CI: 1.12–1.52, p < 0.05). Heterogeneity was low to moderate (I² = 10.07%), suggesting consistency among studies. Egger’s test detected significant publication bias (p = 0.034). Subgroup analyses by region and age group confirmed robustness of the findings. Conclusion: Elevated serum uric acid levels are significantly associated with increased dengue severity. SUA may serve as a predictive biomarker for severe dengue, aidingin early risk stratification. Further prospective studies are warranted to confirm these findings. References 1. Huy NT, Van Giang T, Thuy DH, Kikuchi M, Hien TT, Zamora J, et al. Factors associated with dengue shock syndrome: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2013;7(9):e2412. 2. Soo KM, Khalid B, Ching SM, Tham CL, Basir R, Chee HY. Meta-analysis of biomarkers for severe dengue infections. PeerJ. 2017;5:e3589. 3. Sangkaew S, Ming D, Boonyasiri A, Honeyford K, Kalayanarooj S, Yacoub S, et al. Risk predictors of progression to severe disease during the febrile phase of dengue: a systematic review and meta-analysis. Lancet Infect Dis. 2021;21(7):1014–26. 4. Lima WG, Souza NA, Fernandes SOA, Cardoso VN, Godoi IP. Serum lipid profile as a predictor of dengue severity: A systematic review and meta-analysis. Rev Med Virol. 2019;29(5):e2056. 5. Kien ND, El-Qushayri AE, Ahmed AM, Safi A, Mageed SA, Mehyar SM, et al. Association of allergic symptoms with dengue infection and severity: a systematic review and meta-analysis. Virol Sin. 2020;35(1):83–92. 6. Sherif NA, Zayan AH, Elkady AH, Ghozy S, Ahmed AR, Omran ES, et al. Mast cell mediators in relation to dengue severity: A systematic review and meta-analysis. Rev Med Virol. 2020;30(1):e2084. 7. Chen Y, Liao Y, Yuan K, Wu A, Liu L. HLA-A, -B, -DRB1 alleles as genetic predictive factors for dengue disease: A systematic review and metaanalysis. Viral Immunol. 2019;32(3):121–30 8. Naing C, Htet NH, Siew Tung W, Basavaraj AK, Mak JW. Association of tumour necrosis factor-alpha (TNF-alpha) gene polymorphisms (-308 G>A and -238 G>A) and the risk of severe dengue: A meta-analysis and trial sequential analysis. PLoS One. 2018;13(10):e0205413. 9. Honsawek S, Chaiyaratana W, Chirathaworn C, Thavornpitak Y, Pothacharoen P, Thepthai C, et al. Increased levels of serum hyaluronan in patients with dengue infection. J Infect. 2007;54(3):225–9. 10. Soundravally R, Agieshkumar B, Daisy M, Sherin J, Cleetus CC. Ferritin levels predict severe dengue. Infection. 2015;43(1):13–9. 11. Lee IK, Liu JW, Yang KD. Clinical characteristics and risk factors for concurrent bacteremia in adults with dengue hemorrhagic fever. Am J Trop Med Hyg. 2005;72(2):221–6. 12. Wang WK, Chen HL, Yang CF, Hsieh SC, Juan CC, Chang SM, et al. Slower rates of clearance of viral load and virus-containing immune complexes in patients with dengue hemorrhagic fever. Clin Infect Dis. 2006;43(8):1023–30. 13. de Souza LJ, Nogueira RM, Soares LC, Soares CE, Ribas BF, Alves FP, et al. The impact of dengue on liver function as evaluated by aminotransferase levels. Braz J Infect Dis. 2007;11(4):407–10
29
Huang, Jiuzhong, Chunsheng Li, Xiaoning Li, et al. "Recent Advances in the Development of Indolizine Scaffolds: Synthetic Methodology and Mechanistic Insights." Chinese Journal of Chemistry, November 20, 2024. http://dx.doi.org/10.1002/cjoc.202400798.
Full textAbstract:
Comprehensive SummaryIndolizine is a nitrogen‐containing heterocycle with strong aromaticity, possessing a delocalized 10π‐electron system. Based on the indolizine scaffolds, numerous molecules with biological activity and organic functional materials have been synthesized. Since 2016, over 110 papers have been published on the synthesis of indolizine scaffolds, but the reviews on synthesizing indolizine scaffolds have been incomplete and not up‐to‐date. Herein, from the perspective of the structure of indolizine with the combination of pyrrole and pyridine ring, we focus on the construction of indolizine scaffolds through the diversity of starting substrates, including pyridine derivatives (N1‐substituted pyridinium salt derivatives, C2‐substituted pyridine derivatives, N1‐ and C2‐free substituted pyridine derivatives), pyrrole derivatives and unoriginal ring substrates. Furthermore, the corresponding reaction mechanisms of synthetic methodologies are also elaborated. Therefore, this review not only paves the way for indolizine synthesis but also provides insight into exploring new reaction modes for constructing nitrogen‐containing heterocycles. Key ScientistsIndolizine was discovered by Angeli in 1890 and first prepared by Scholtz in 1912 from α‐picoline and acetic anhydride. A general approach was developed by Chichibabin in 1927, that is of practical value for the preparation of 2‐alkyl‐ or 2‐arylindolizines. The Chichibabin reaction was the ring closure of quaternary pyridinium halides. At the begining of the 21st century, Basavaiah introduced a new dimension in the Baylis‐Hillman chemistry leading to a novel facile convenient methodology for synthesis of indolizine scaffolds in one‐pot operation. In 2010, Barluenga reported Cu(I)‐catalyzed regioselective [3+2] cyclization of unsubstituted pyridines toward alkenyldiazoacetates leading to functionalized indolizine derivatives, that was the first successful example of metal‐catalyzed cyclization of a π‐deficient heterocyclic system with alkenyldiazo compounds. In 2019 and 2022, Xi and Liu exploited the methods of non‐pyridine derivatives as starting materials to synthesize indolizines, respectively. In 2022, Guo developed an environmentally benign electrooxidative approach for constructing formyl‐ and acyl‐substituted indolizines.
30
Virupakshappa1, and Basavaraj Amarapur. "Virupakshappa1 and Basavaraj Amarapur." January 30, 2018. https://doi.org/10.5281/zenodo.1205973.
Full textAbstract:
Segmentation of region of interest has a critical task in image processing applications. The accuracy of Segmentation is based on processing methodology and limiting value used. In this paper, an enhanced approach of region segmentation using level set (LS) method is proposed, which is achieved by using cross over point in the valley point as a new dynamic stopping criterion in the level set segmentation. The proposed method has been tested with developed database of MR Images. From the test results, it is found that proposed method improves the convergence performance such as complexity in terms of number of iterations, delay and resource overhead as compared to conventional level set based segmentation approach.
31
Kumar, Rajesh. "Vulnerability Assessment of Mobile Applications." International Journal of Innovative Science and Research Technology (IJISRT), August 29, 2024, 900–905. http://dx.doi.org/10.38124/ijisrt/ijisrt24aug464.
Full textAbstract:
Due to their ease of use and accessibility to a vast array of services, mobile applications have become indispensable in our everyday lives. Still, there are more security dangers as a result of the quick spread of mobile apps (Basavala, 2013). This article examines typical vulnerabilities that affect mobile applications and the techniques used to identify and fix them. It concentrates on the vulnerability assessment of mobile applications (Basavala, 2013). This research tries to highlight the significance of protecting mobile apps by an examination of many vulnerability categories, including inadequate encryption, unsafe communication, and insecure data storage (Basavala, 2013). This article offers insight into how developers, security experts, and organizations may proactively detect and mitigate vulnerabilities in mobile apps by going over the tools, methodologies, and best practices for doing vulnerability assessments (He, 2015). In the end, this paper highlights how important it is to have strong security mechanisms in place to secure user data and mobile apps in an increasingly interconnected digital economy (He, 2015).
32
Mishra, R. K. "Satan’s Satanic Conspiracy against God: An Analytical Study of Basavaraj Naikar’s Play Victory of Christ." Creative Saplings, July 30, 2022, 16–24. http://dx.doi.org/10.56062/gtrs.2022.1.4.2.
Full textAbstract:
The play Victory of Christ by Basavaraj Naikar is designed to familiarize the audience and the readers with the theological concept of eternal clash between Good and Evil. It is based upon the theme of Milton’s epic Paradise Lost and Paradise Regained. The play ingeniously depicts Satan’s Machiavellian conspiracy against God to take revenge on Him for the punishment of damnation inflicted on him and other fallen angels by Him. Although according to Bharata’s Natyasastra, the playwrights were supposed to select their themes from the epics like the Ramayana and the Mahabharata, no dramatist dared to dramatize the entire epics by compressing them into stage-worthy plays. But Basavaraj Naikar;s creative adventure lies in compressing the entire epic of Milton consisting of its two uneven parts by removing the descriptive and narrative element but concentrating on the dramatizable element and highlighting Milton’s essential religious vision.
33
Singh, Shaleen Kumar. "Rewriting the Tale of Patriotism in Basavaraj Naiker's: The Queen of Kittur." October 30, 2015. https://doi.org/10.5281/zenodo.15505366.
Full text
34
Indalkar A.B., Indalkar A. B. "THE SHORT STORIES OF R. K. NARAYAN AND BASAVARAJ NAIKAR: A COMPARATIVE STUDY." International Journal of Researches in Biosciences and Agriculture Technology, 2017. http://dx.doi.org/10.29369/ijrbat.2017.05.ii.0036.
Full text
35
Zhao, Mingfu, LU CHEN, Jianwei Guo, et al. "First Report of Capsicum chlorosis virus Infecting Chromolaena odorata L. in Yunnan, China." Plant Disease, September 8, 2021. http://dx.doi.org/10.1094/pdis-02-21-0341-pdn.
Full textAbstract:
Capsicum chlorosis virus (CaCV) is a negative sense ssRNA virus belonging to the genus Orthotospovirus in the family Tospoviridae. It was first discovered in Australia, and then reported in other places including Thailand, China, India, Greece, and United States (Zheng et al.2011; Melzer et al.2014; Chrysoula et al. 2018; Abudurexiti et al. 2019). CaCV infects plants of the families Amaranthaceae, Apocynaceae, Chenopodiaceae, Cucurbitaceae, Amaryllidaceae, Fabaceae and Solanaceae (Basavaraj et al. 2017; Basavaraj et al. 2020). Chromolaena odorata L. (commonly known as Feiji cao in China) is an invasive weedy herb that belongs to the genus Eupatorium (family Asteraceae), and is native to Central America. In May 2020, serrated chlorotic ring and chlorotic ringspots resembling symptoms of orthotospovirus infection (Supplementary Figure 1) was observed on the leaves of C. odorata plants in Honghe County, Yunnan. Three symptomatic leaf samples were collected and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using antisera targeting Tomato spotted wilt virus (TSWV), Calla lily chlorotic spot virus (CCSV), Capsicum chlorosis virus (CaCV), and Tomato zonate spot virus (TZSV) (Proteintech Group, Inc., China). Buffer solution and healthy leaves were used as a blank and negative controls, respectively. All three symptomatic samples showed positive reactions with only CaCV antiserum (OD450 of 0.315-0.345 relative to 0.078 and 0.076 for healthy plants and the blank control, respectively. The total RNA extracted from the positive samples were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using generic primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435c (CATDGCRCAAGARTGRTARACAGA) which were designed to amplify partial L segment encoding the RNA-dependent RNA polymerase (RdRP) of orthotospoviruses (Chu, et al. 2001). The expected ~800 bp DNA fragment was amplified from all three positive samples by RT-PCR. The amplified DNA was cloned and sequenced. BLAST search of the partial L RNA sequence (GenBank acc. nos. MW964378 to MW964380) revealed that they shared 86.2-97.4% nucleotide (nt) and 97.2-100% amino acid (aa) sequence identities with different isolates of CaCV available in GenBank with CaCV chili isolates (KU941834 to KU941836) from India sharing the highest aa identity of 100%. This confirmed the presence of CaCV in the symptomatic C. odorata plants. The 825 bp complete nucleocapsid protein (NP) of CaCV was also amplified from the samples using primers CaCV-F: ATGTCTAMCGTYAGGCAAC and CaCV-R: TYACACYTCWATAGAWGTACTAG) (Basavaraj et al. 2020), cloned, and sequenced to obtain complete S fragment-nucleocapsid protein (NP) with a size of 825 bp (MW964381 to MW964383). The pairwise comparisons of three fragments showed 85.1-98.3% nt and 87.6-99.6% aa sequence identities with different isolates of CaCV. Maximum-Likelihood phylogenetic trees inferred from the partial RdRP and complete NP aa sequences showed that the C. odorata isolates (CaCV-YN) clustered closely with CaCV tomato isolate from Taiwan and tomato (Yuxi-2013) isolate from China, respectively (Supplementary Figure 1). To our knowledge, this is the first time CaCV has been detected in C. odorata. This study will serve as an important reference for the study of host range of CaCV. Further studies will be required to determine whether thrips could transmit CaCV between C. odorata and other hosts of the virus.
36
Devaraj Wodeyar Hosahally and Tejaswini Padikkal. "Psychosocial Perspective of People Living with HIV/AIDS in India." International Journal of Indian Psychology 3, no. 1 (2015). http://dx.doi.org/10.25215/0301.153.
Full textAbstract:
One of the most major challenges the healthcare system faces till date is the HIV or Human Immunodeficiency Virus and AIDS or the Acquired Immunodeficiency Syndrome. Being a burden on the population’s health, it causes social and economic problems for individuals and their families and communities in many countries (Trapero-Bertran & Oliva-Moreno, 2014). Many of the HIV patients also face social problems such as stigma, poverty, depression and substance abuse that can affect their quality of life (Basavaraj, Navya& Rashmi, 2010). Since the beginning of the HIV epidemic, almost 78 million people are infected with the virus and 39 million people have died because of the epidemic (Herrman, Shekhar & Rob, 2005). At the end of 2014, it is estimated that about 36.9 million people were living with HIV and 1.2 million people have died because of AIDS (Herrman et al., 2005). There is, however, a considerable difficulty in ascertaining the actual number of people who are affected with the virus as the high risk group people are either reluctant to undergo testing or reluctant to disclose their diagnosis. This is because of various factors like societal factors as well as the factors that do not allow for a person to undergo testing (Das & Leibowitz, 2010). The general challenges of the people living with HIV/AIDS are the steadily declining quality of life, fear of death, coping with uncertainty and the additional challenge of facing the stigma attached with the disease and specifically their mental health (Remien&Rabkin, 2001).
37
"TRANSLATION REVIEW -BETRAYAL An English Translation -by Basavaraj Naikar of the Kannada folkplay Sangya-Balya by Rayappa Pattar New Delhi and London: Minerva Publications, 2004." Translation Today 2, no. 1 (2005). http://dx.doi.org/10.46623/tt/2005.2.1.br2.
Full text
38
Kesharwani, Amit Kumar, Aditya Kulshreshtha, Ravinder Pal Singh, Ashish Srivastava, Anupama Sharma Avasthi, and Baljeet Kaur. "First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India." Plant Disease, November 2, 2022. http://dx.doi.org/10.1094/pdis-08-22-1853-pdn.
Full textAbstract:
The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.
39
Sun, Sheng-Ren, Zhu-Qing Wang, Qing-Gan Liang, et al. "First report of Capsicum chlorosis virus naturally infecting Ageratum conyzoides in China." Plant Disease, May 25, 2023. http://dx.doi.org/10.1094/pdis-01-23-0025-pdn.
Full textAbstract:
Capsicum chlorosis virus (CaCV; family Tospoviridae, genus Orthotospovirus) was first reported to infect capsicum (Capsicum annuum) and tomato (Solanum lycopersicum) in Australia in 2002 (McMichael et al., 2002). Subsequently, its infection was detected in different plants including waxflower (Hoya calycina Schlecter) in the United States (Melzer et al. 2014), peanut (Arachis hypogaea) in India (Vijayalakshmi et al. 2016), and spider lily (Hymenocallis americana) (Huang et al. 2017), Chilli pepper (Capsicum annuum) (Zheng et al. 2020), and Feiji cao (Chromolaena odorata) (Chen et al. 2022) in China. Ageratum conyzoides L. (commonly known as goat weed, family Asteraceae) is a natural weed in crop fields distributed in subtropical and tropical areas and a reservoir host of numerous plant pathogens (She et al. 2013). In April 2022, we observed that 90% of plants of A. conyzoides in maize fields in Sanya, Hainan province, China, exhibited typical virus-like symptoms of vein yellowing, leaf chlorosis, and distortion (Fig. S1 A-C). Total RNA was extracted from one symptomatic leaf of A. conyzoides. Small RNA libraries were constructed using the small RNA Sample Pre Kit (Illumina, San Diego, USA) for sequencing with an Illumina Novaseq 6000 platform (Biomarker Technologies Corporation, Beijing, China). A total 15,848,189 clean reads were obtained after removing low-quality reads. Quality-controlled qualified reads were assembled into contigs using Velvet 1.0.5 software with a k-mer value of 17. One hundred contigs shared nucleotide identity ranging from 85.7% to 100% with the CaCV using BLASTn searches online (https://blast.ncbi.nlm.nih.gov/Blast.cgi?). Numerous contigs (45, 34, and 21) obtained in this study were mapped to the L, M, and S RNA segments of the CaCV-Hainan isolate (GenBank accession no. KX078565- KX078567) from spider lily (Hymenocallis americana) in Hainan province, China, respectively. The full-length of L, M, and S RNA segments of CaCV-AC were determined to be 8,913, 4,841, and 3,629 bp, respectively (GenBank accession no. OQ597167- OQ597169). Furthermore, five symptomatic leaf samples were tested to be positive for CaCV using a CaCV enzyme-linked immunosorbent assay (ELISA) kit (MEIMIAN, Jiangsu, China) (Fig. S1-D). Total RNA from these leaves was amplified by RT-PCR with two sets of primer pairs. Primers CaCV-F (5′-ACTTTCCATCAACCTCTGT-3′) and CaCV-R (5′-GTTATGGCCATATTTCCCT-3′) were used for the amplification of 828 bp fragment from nucleocapsid protein (NP) on CaCV S RNA. While another, primers gL3637 (5′-CCTTTAACAGTDGAAACAT-3′) and gL4435c (5′-CATDGCRCAAGARTGRTARACAGA-3′) were used for the amplification of 816 bp fragment from RNA-dependent RNA polymerase (RdRP) on CaCV L RNA (Fig. S1-E and -F) (Basavaraj et al. 2020). These amplicons were cloned into the pCE2 TA/Blunt-Zero vector (Vazyme, Nanjing, China) and three independent positive colonies of Escherichia coli DH5α carrying each viral amplicon were sequenced. These sequences were deposited in the GenBank database under accession nos. OP616700-OP616709. Pairwise sequence comparison revealed that nucleotide sequences of NP and RdRP genes of the five CaCV isolates shared 99.5% (812 bp out of 828 bp) and 99.4% (799 bp out of 816 bp) nucleotide identities, respectively. They showed 86.2-99.2% and 86.5-99.1% nucleotide identities with corresponding nucleotide sequences of other CaCV isolates derived from GenBank database, respectively. The highest nucleotide sequence identity (99%) of the CaCV isolates obtained in the study was observed with the CaCV-Hainan isolate. Phylogenetic analysis based on NP amino acid demonstrated that six CaCV isolates (this study = 5 and NCBI database = 1) clustered into one distinct clade (Fig. S2). Our data confirmed for the first time the presence of CaCV naturally infecting A. conyzoides plant in China, which enriches information on the host range and will be helpful for disease management.