Journal articles on the topic 'Basmati 2000'

Breeding research for Basmati rice commenced in 1926 when Rice Farm was established at Kala Shah Kaku in Punjab. 1933 Basmati-370, Mushkan-7, and Mushkan-41 were developed and released for commercial cultivation by the farming community. Despite the high aroma in grains, the Mushkan varieties faced challenges due to low yield potential and other quality issues, making them unsustainable for growers. Hybridization efforts began in 1933, resulting in the first cross of Basmati-370 with Palman-46, aimed at achieving high yield, earliness, and improved grain quality coupled with resistance to stem borers and rice blast. Basmati cultivation is predominant in the Kalar tract of Punjab. Two fine-grain varieties, C-622 and Basmati Pak, were introduced in 1960 through hybridization, with Basmati-Pak gaining popularity as Kernel Basmati. Ongoing research efforts focused on developing high-yielding varieties with enhanced quality. The approval of Basmat-385 in 1985, characterized by long grains measuring 6.6 mm in length and 1.6 mm in breadth, revolutionized Basmati rice production in Punjab. The globally renowned Super-Basmati variety received approval in 1996, featuring extra-long grains measuring 7.5 mm in length and 7.7 mm in breadth. After Super-Basmati, other prominent varieties like Basmati 2000, Basmati 515, PS-2, Kisan-Basmati, Punjab-Basmati, Chenab-Basmati, and Super Kainat-2000 were developed and periodically released for the farming community.

Climate change is posing significant challenges to agriculture, threatening global food security. Among these challenges, drought stress is a formidable obstacle to rice production, a staple food for billions. Drought stress disrupts vital physiological processes, causing yield losses and impacting grain quality. Developing drought-tolerant rice varieties is essential to ensure food production and farmers' livelihoods. This study explores the drought tolerance potential of six Basmati rice genotypes: Basmati 198 (G1), Basmati 385 (G2), Rachna basmati (G3), Super Basmati (G4), Shaheen basmati (G5), and Basmat 2000 (G6). These genotypes have previously demonstrated submergence tolerance. By subjecting them to drought stress, we aim to assess their adaptability to multiple stressors, crucial in changing climates. A Randomized Complete Block Design was employed, ensuring methodological rigor. Seedlings were transplanted into the field, and drought stress was induced during the booting stage. We monitored various traits, including plant height, productive tillers, panicle length, spikelet numbers, fertility, branches, biological yield, grain yield, and harvest index. Statistical analyses revealed significant genotype-specific responses to drought. Results showed significant differences among genotypes under both control and drought conditions, underscoring genetic variability. Drought stress significantly impacted most traits. Basmat 2000 (G6) demonstrated superior performance under drought conditions. Clustering analysis revealed genetic diversity among genotypes, offering insights for breeding programs. Correlation analysis highlighted the importance of specific traits for grain yield. In conclusion, this study contributes to understanding genetic diversity among Basmati rice genotypes under drought stress. The findings emphasize the need for developing drought-tolerant rice varieties and offer valuable insights for sustainable rice cultivation in changing climates.

Rice grain aroma is a promising quality factor that influence consumer acceptability. The principal volatile compound that contributes Basmati rice fragrance is 2-acetyl-1-pyrroline (2AP). Milled White rice samples of promising Basmati rice varieties (Super Basmati, Basmati-515, Basmati 2000, Basmati 370) were analyzed for fragrant volatile compounds by gas chromatography (GC) coupled with Solid Phase Micro Extraction unit (SPME) using Flame ionizing Detector (FID). Six volatile compounds (Nonanal, Decanal, and alcohols such as benzyl alcohol, Indole) were identified in the tested varieties, among them 2-AP is only present in aromatic rice varieties. This study confirmed the occurrence of 2-AP in all studied varieties with highest concentration in Super Basmati followed by Basmati-515, Basmati 2000 and Basmati 370.

SUMMARYIn this study, we compared the weed emergence, water input, water saving, water productivity, panicle sterility, yield outputs and economic returns of transplanting with alternate wetting and drying (TRAWD) and dry direct seeding (DSR) with transplanting under continuous flooding (TRCF) using three fine-grain rice cultivars: Super Basmati; Basmati 2000; and Shaheen Basmati. Higher weed infestation was recorded in DSR than in TRCF and TRAWD. Raising rice as TRAWD and DSR had considerable water savings but a lower grain yield than TRCF. High panicle sterility was primarily responsible for low grain yield in TRAWD and DSR systems. Nonetheless, water productivity was better in DSR and TRAWD than TRCF. Shaheen Basmati in the DSR system and Basmati 2000 in TRCF fetched the highest economic returns during 2008 and 2009, respectively. In conclusion, fine-grain rice cultivars can be grown in water-saving production systems (e.g. TRAWD and DSR); however, these water-saving production systems might incur a yield penalty.

Background: It has been recorded that salt negatively impacts rice crop's seedling and reproductive stages. Globally, soil salinity is 2nd most important abiotic factor, profoundly impacting rice productivity. The purpose of current research is to persuade tolerance for salinity in salt sensitive varieties of Basmati rice [Basmati-385 (Bas-385), Super Basmati (Sup-Bas) and Basmati-2000 (Bas-2000)] by use of in vitro step-up NaCl treatment method.Methods: The in vitro step up NaCl treatment method was used to produce salt-tolerant calli from salt-sensitive Basmati rice varieties. The regeneration of these salt-tolerant calli in a salt-free medium led to the M1 generation. Subsequently, M2 and M3 generations were cultivated and garnered under salt stress conditions.Results: The highest callus induction percentage was achieved for all Basmati rice varieties by using MS medium supplemented with 2.0 mg/L 2,4-D. These calli underwent in vitro step up NaCl treatments, with the maximum tolerance level to NaCl being 1.0% across all varieties. Bas-385 and Bas-2000 exhibited regeneration frequencies of 75% and 85% respectively when cultured in MS medium supplemented with 2.0 mg/L BAP and 0.5 mg/L NAA, while Sup-Bas displayed a regeneration frequency of 79% in MS medium comprising 3.0 mg/L BAP with 0.5 mg/L NAA. In subsequent M2 and M3 generations, a decline was observed in all selected agronomic and morphological features in all varieties under salinity stress in comparison to parent plants.Conclusion: This research validates the induction of salt tolerance in salt susceptible varieties of Basmati rice by in vitro step up NaCl treatment technique.Keywords: In vitro selection; Salt tolerance; Basmati rice; Step up NaCl treatment; Callogenesis; Plant regeneration

A field experiment was conducted during rainy (kharif) and winter (rabl] seasons of 1999-2000 and 2000-01 at Modipuram in Meerut district to identify the most suitable rice (Oryza sativa L.) variety for direct seeding under unpuddled conditions, and also to study the effect of sulphur and weed-control measures on rice-wheat (Triticum aestivum L. emend. Fiori & Paol.] system. Rice varieties 'DRRH 1' and 'Jaya' recorded mean yields of 71.5 and 66.7 qlha respectively, which were significantly higher than of 'PAC 808' (50 qlha) and 'Pusa Basmati' (45.8 q/ ha). Application of sulphur @ 30 kglha and weed control did not influence the productivity of both the crops. However, application of isoproturon @ 1.25 kglha + 2, 4-D @ 0.8 kglha significantly affected the mean yield (49.3 qlha) of wheat than hand-weeding (47.4 qlha). Rice 'Jaya' - wheat (Rs. 39,0941ha) and rice 'DRRH 1'- wheat (Rs 38,8281ha) system gave significantly higher net returns than rice 'Pusa Basmati 1'-wheat (Rs 37,7521 ha) and rice 'PAC 808'-wheat (Rs 33,8711ha) systems.

This article 'Basmati 2000- an extra long-grained aromatic rice variety in Punjab, Pakistan' appeared in the International Rice Research Notes series, created by the International Rice Research Institute (IRRI) to expedite communication among scientists concerned with the development of improved technology for rice and rice-based systems. The series is a mechanism to help scientists keep each other informed of current rice research findings. The concise scientific notes are meant to encourage rice scientists to communicate with one another to obtain details on the research reported.

A field investigation was carried out at the Instructional farm, College of Agriculture, Vellayani during 2000-2001 to assess the effect of spacing and weed management practices on the performance of basmati rice. The treatments comprised of three spacings (15x15, 20x10 and 15x10 cm) and five weed control treatments (weed free check, unweeded control, hand weeding twice at 20 and 40 DAT, anilofos+2,4-DEE (readymix) 0.40+0.53 kg ha at 6 DAT supplemented with hand weeding at 20 DAT and anilofos+2,4-DEE (readymix) 0.40+0.53 kg ha' at 6 DAT supplemented with 2,4-D sodium salt 1 kg ha at 20 DAT). Grasses were the predominant weed species observed in the experimental field. Unchecked weed competition reduced grain yield to the tune of 46%. Herbicides were most effective in controlling the weeds. The results revealed that with 20x1 Ocm spacing (50 hills m2), pre-emergence application of anilofos+2,4-DEE (readymix) 0.40+0.53 kg ha supplemented with 2,4-D sodium salt 1 kg ha¹ could result in maximum grain yield and minimum weed competition.

Inappropriate seed packaging and seed dormancy affects seed quality and consequently leads to reduced crop stand, low seedling vigour and reduced yields. The objective of the study was to determine the effect of seed packaging material and seed treatment on viability and dormancy in rice seeds. Effect of packaging material was evaluated by storing freshly harvested seeds of Basmati 370 and BW 196 varieties in polythene, khaki, cheese cloth, polypropylene (Pp) sack and gunny bag sat room temperature and at 6 oC for six months. Effect of seed treatment on dormancy was determined by pre-treatment of seeds with nitric acid at 0.1 M, 0.2 M, 0.5 M, 1 M and 2 M, gibberellic acid (GA3) at 1000 ppm, 2000 ppm and 5000 ppm, and hydrogen peroxide at 0.5 M, 1 M, 2 M, 3 M, 5 M and dry heat at 50 oC for 48 hours. The seeds were subjected to germination test on moist paper and data on percentage germination, seedling length and seedling dry weight were taken. Packaging material had a significant (P ≤ 0.05) effect on germination and vigour. At room temperature, seed stored in polythene bag had the highest germination 88.2% and 57.8% for BW 196 and Basmati 370, respectively. Basmati 370 in khaki bag stored in the cold room had the highest germination 48.3%, while BW 196 stored in polythene had the highest (86.0%). Pre-treatment of seeds reduced dormancy, with variety BW 196 showing the highest germination of up to 67%, while variety Basmati 370 had the lowest germination of up to 40%. Gibberellic acid (GA3) at 5000 ppm was the most effective in breaking seed dormancy resulting in up to 95.7% germination. The results of the study indicated that packaging rice seed in polythene bags for periods not exceeding six months and pre-treatment with GA3 maintains high seed viability and breaks dormancy, respectively, thus ensuring rapid and uniform germination of vigorous seedlings. This would reduce the period farmers have to wait after harvest before they can plant newly harvested rice seeds.

A field experiment was conducted during 1999-2000 and 2000-2001 to evaluate the performance of rice (Oryza sativa L.) cultivars under different crop establishment methods and their effect on succeeding wheat (Triti- cum aestivum L. emend. Fiori & Paol.) at the Project Directorate for Cropping Systems Research, Modipuram, Meerut, Uttar Pradesh. Rice grown under unpuddled conditions gave higher systems productivity than rice trans- planted after puddling. However, productivity of rice and wheat and system as a whole under unpuddled and transplanted conditions did not differ significantly. Similar trend was observed in basmati rice-equivalent yield (BREY). Net returns were also not influenced significantly by crop establishment methods. Among rice varieties, 'IET 15339' gave superior performance followed by wheat variety 'PBW 226' in respect of yield and net returns.

This study uses data from 1999/2000 to 2004/05 to determine the relative efficiency of major crops (wheat, rice, sugarcane, and cotton) in Punjab (Pakistan) and their comparative advantage in international trade as measured by economic profitability and the domestic resource cost (DRC) ratio. An economic profitability analysis demonstrates that Punjab has a comparative advantage in the domestic production of wheat for self-sufficiency but not for export purposes. In basmati production, Punjab has a comparative advantage, and increasing Basmati production for export is a viable economic proposition. The nominal protection coefficient (NPC), effective protection coefficient (EPC), and DRC for Irri rice are more than 1: the given input-output relationship and export prices do not give Punjab a comparative advantage in production of Irri for export. Sugarcane growers did not receive economic prices (i.e. prices reflecting true opportunity costs) during 2001/02 and 2002/03 in an importing scenario, while in 2003/04, the NPC was 1.02, indicating positive support to sugarcane growers. The NPCs estimated under an exporting situation range from 1.33 to 1.99, indicating that the prices received by growers are higher than the export parity/economic prices.

Two season trials were conducted in the same field during Kharif (May- Sep.) and Rabi (Oct-Feb) seasons of 1999-2000 at wetland farm of Tamil Nadu Agricultural University, Coimbatore in order to assess the performance of scented rice variety Basmati 370 to organic N source. The experiments involved three nitrogen levels viz., 50 (N,), 75 (N) and 100 (N) kg ha and five source combinations viz., 100% organic N 75% through FYM and 25% through Azolla (C,), 100% organic N-75% . through Sesbania rostrata and 25% through Azolla (C), 100% organic N-75% through FYM and 25% through Azolla + 50 kg P,O, +50 kg K,0 ha (C) 100% organic N-75% through Sesbania rostrata and 25% through Azolla 50 kg P,O,+ 50 kg KO ha (C) and 100% inorganic N, P,O, and K,O (C,). Fifteen treatment combinations were tested in a randomized block design replicated thrice. Required quantities of FYM, Sesbania rostrata and Azolla were incorporated in to the soil one week before transplanting of rice as per the treatments. The results revealed significant improvement in growth characters and yield components with higher N levels that ultimately resulted in higher grain yield. The grain yield increase was to the tune of 25 and 45 per cent for 100 kg N ha over 50 kg N ha in kharif and rabi seasons, respectively. Inorganic NPK application produced higher values for growth and yield attributes. Application of 100 per cent inorganic NPK (C) recorded higher grain yield in both the seasons. However, green manuring with Sesbania rostrata along with Azolla and with or without supplementation of inorganic P and K (C, or C,) registered on par values with C..

We testthe technical efficiency, measured by the degreeof integration,of agriculture marketsfor five crops in the Punjabprovince of Pakistanusing daily wholesale market prices from the Agriculture Management Information System (AMIS). We findthat potato, onion and mango markets are well integrated both horizontally and vertically, with the speed of price adjustment in most cases (mango isthe exception) being very rapid. We also find that kinnow and basmati rice markets are bothvertically fairly well integrated. Furthermore, we findthat trends in cropping patternsover the period 2000 to 2014 are in line with the changing market demand and government priceinterventions. The reformsintroducedby thePunjab Agriculture Marketing Regulatory Authority (PAMRA) Act 2020,aimed atincreasing competition in agriculture markets,have the potential tosignificantly improve economic efficiency.

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 μm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5′AGAGTTTGATCATGGCTCAG3′ and 5′AAGGAGGTGATCCAACCGCA3′) of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml–1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml–1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

A field experiment was conducted during 2000-2001 to 2002-2003 to study the combined effect of organic and inorganic sources of nutrients on grain yield of basmati rice (Oryza sativa L.) and wheat (Triticum aestivum L. emend. Fiori & Paol.) in rice-wheat sequence. Six systems of manuring to rice and 3 levels of fertilizers for suc- ceeding wheat were tried. Application of 50% recommended dose and 50% N through green-manure to rice with 100% recommended dose of fertilizers to wheat crop resulted in significantly higher system productivity and ben- efit soil fertility than that of all those treatments, in which, green-manure was not used. The application of 50% rec- ommended dose and 50% N through green-manure to rice gave significantly higher net returns and benefit : cost ratio, irrespective of fertilizer level applied to wheat. Thus 50% NPK dose to rice and wheat crop can be saved without decrease in yield and with maximum net returns and benefit : cost ratio, when line of sunnhemp was grown along with after every sixth row of rice, cut at 45 days after sowing and trampled in inter row space of rice.

Rice (Oryza sativa L.) is a vital staple food crop in Pakistan, second only to wheat. Rice blast, caused by Pyricularia oryzae, is a highly destructive disease affecting rice cultivation. Various fine aromatic and coarse grain rice varieties, including PS-2, Kisan Basmati, Bas-2000, Super Basmati, Bas-515, KSK-434, KSK-133, IRRI-9, and PK-386, are grown across different regions of Punjab. A field survey was conducted across six major rice-growing districts of Punjab over two consecutive growing seasons (2019–2020). Blast-infected leaves and panicles were randomly collected from 30 locations within Bahawalnagar, Sahiwal, Faisalabad, Chiniot, Sialkot, and Narowal. The collected samples were analyzed at the Plant Pathology Laboratory, University of Agriculture Faisalabad, where the pathogen was confirmed. In 2019, the highest leaf blast incidence (10.20%) was recorded at Khaira M. Ali Kaloka (Bahawalnagar), while the lowest (5.33%) was observed at Samundri Road (Faisalabad). In 2020, the highest leaf blast incidence reached 15.66% at Chor Chowk (Sialkot), with the lowest (6.80%) at Wakilwala (Sahiwal). For neck blast, the highest incidence in 2019 was 11.16% at Gopalpur (Sialkot), while the lowest (6.56%) was recorded at 369RB (Faisalabad). In 2020, the highest incidence (18.16%) occurred at Chor Chowk (Sialkot), with the lowest (7.93%) at Teenpullian (Faisalabad). Regarding disease severity, the highest value recorded in 2019 was 23.56% at Gopalpur (Sialkot), while the lowest was 9.86% at Samundri Road (Faisalabad). The most severe case in 2020 was 37.40% at Kundanpur (Sialkot), whereas the lowest (15.07%) was recorded at 93-9L (Sahiwal).

Recently food shortage has become the major flagging scenario around the globe. To resolve this challenge, there is dire need to significantly increase crop productivity per unit area. In the present study, 24 genotypes of rice were grown in pots to assess their tillering number, number of primary and secondary branches per panicle, number of grains per panicle, number of grains per plant, and grain yield, respectively. In addition, the potential function of miR156 was analyzed, regulating seed sequence in rice. Furthermore, OsSPL14 gene for miR156 was sequenced to identify additional mutations within studied region. The results demonstrated Bas-370 and L-77 showed highest and lowest tillers, respectively. Bas-370, Rachna basmati, Bas-2000, and Kashmir Basmati showed high panicle branches whereas, L-77, L-46, Dilrosh, L-48, and L-20 displayed lowest panicle branches. Bas-370 and four other studied accessions contained C allele whereas, L-77 and 18 other investigated accessions had heterozygous (C and T) alleles in their promoter region. C-T allelic mutation was found in 3rd exon of the OsSPL14 gene. The sequence analysis of 12 accessions revealed a novel mutation (C-T) present ~2bp upstream and substitution of C-A allele. However, no significant correlation for novel mutation was found for tillering and panicle branches in studied rice accessions. Taken together present results suggested novel insight into the binding of miR156 to detected mutation found in 3rd exon of the OsSPL14 gene. Nevertheless, L-77, L-46, Dilrosh, L-48, and L-20 could be used as potential breeding resource for improving panicle architecture contributing yield improvement of rice crop.

The rice-wheat cropping zone of Punjab is the main producer of high-valued and fine quality basmati rice in Pakistan. The rice produced in this area is famous for its grain length and aromatic characteristics. Being an important export item, rice contributes significantly to the national foreign exchange earnings. Wheat is the other major crop of the rice-wheat system and being the staple food is central to national agricultural policies. Rice is grown on a vast area in this zone during Kharif mostly followed by wheat in the Rabi season. Studies have shown that a large gap exists between the potential and yields actually realised by the wheat growers of the area [Byerlee, et al. (1984); Hobbs (1985) and Sheikh, et al. (2000)]. Farmers’ practices regarding land preparation for paddy, wheat planting time, and other conflicts endogenous to the rice-wheat based cropping system were identified as the major factors limiting wheat yield in the area. The flooded and puddled soils that are well suited for paddy production as compared to well-drained conditions required for wheat is such an example of the system conflicts.

The Policy Analysis Matrix (PAM) methodology was used to determine the level of economic efficiency and competitiveness in the production of rice crops in Pakistan’s Punjab. The methodology was also used to assess the effect of policy intervention on the production of Basmati and IRRI rice crops. The results indicate that an expansion of the production of Basmati rice can lead to an increase in exports. The production of IRRI in Pakistan’s Punjab is characterized by a lack of economic efficiency implying inefficient use of resources to produce the commodity. On the other hand, both Basmati and IRRI rice production in the Punjab demonstrate a lack of competitiveness at the farm level for the period under analysis. The analysis shows that the prevailing incentive structure affected farmers negatively. A negative divergence between private and social profits implies that the net effect of policy intervention is to reduce the farm level profitability of both rice production systems in Punjab. The results highlight the need for removing existing policy distortions in the structure of economic incentives to enhance economic efficiency and to attain farm level competitiveness in rice production.

Rice (Oryza sativa L.) is a staple food crop worldwide. Yellow stem borer (Scirpophaga incertulas Walker) is considered a major pest of rice. The present study aimed to evaluate the yield-contributing traits of different rice cultivars and to assess the efficacy of various control strategies against yellow stem borer under field conditions. Seven rice cultivars—C1 (Chenab Basmati), C2 (PK-386), C3 (KSK-133), C4 (KSK-434), C5 (Super Basmati), C6 (KSK-282), and C7 (Kissan Basmati)—were collected from the Rice Research Institute, Kala Shah Kaku, and evaluated for their yield performance. Additionally, PK 1121 Aromatic was transplanted at Madina Colony, Meclod Gunj, Bahawalnagar during the 2020 season to study YSB infestation and its management. Key yield parameters included the number of tillers per plant, grains per panicle, 100-grain weight (g), and spike length (cm). Among the cultivars, the yield potential ranked as C7 > C3 > C6 > C4 > C1 > C5 > C2. The efficacy of neem extract (30ml/L), chlorpyrifos (1ml/L), and Metarhizium anisopliae (2ml/L) was tested against YSB, along with a control treatment. Chlorpyrifos (T2) showed the highest effectiveness, with dead hearts recorded as 20.00%, 13.33%, and 13.30% and white heads as 23.66%, 20.33%, and 19.00% after 1st, 2nd, and 3rd applications respectively. Neem extract (T1) showed moderate effectiveness with dead hearts at 33.33%, 22.11%, and 20.99% and white heads at 28.99%, 24.99%, and 22.85%. M. anisopliae (T3) resulted in dead hearts of 28.66%, 20.67%, and 19.75% and white heads of 26.21%, 23.23%, and 22.57%. The control showed the highest infestation with dead hearts of 40.33%, 39.54%, and 42.11%, and white heads of 37.12%, 38.23%, and 40.14%. In conclusion, the number of tillers per plant, grains per panicle, 100-grain weight, and spike length are critical yield-determining traits. Neem extract and M. anisopliae were effective alternatives to chemical pesticides in reducing yellow stem borer infestation.

Gümüşhacıköy Basma is famous for its aromatic structure in oriental type tobacco. However, it is known that new types of oriental tobacco have become widespread by adding Taşova, Erbaa and Niksar lines to the production area of this type of tobacco, especially due to the decrease in production since the beginning of 2000s. In this study, yield and quality performances of some oriental tobacco parents and hybrids in Gümüşhacıköy ecological conditions and heterosis and heterobeltiosis values of these hybrids were emphasized. Hybrid lines were obtained in 2016 by half-diallel hybridization from Xanthi-2A, Erbaa, Nail, Katerini and Canik 10821 (Sıtmasuyu) genotypes. The study was carried out with 5 parents and 4 F1 populations with their hybrids. Yield and yield related characteristics (plant height, number of leaves, leaf width and height), as well as glucose, fructose, nicotine, chlorogenic acid and routine contents were examined. It was determined that genotypes showed significant differences in all traits except leaf length. Hybrids outperformed their parents in all parameters except plant height and number of leaves. This advantage was 8.42% in yield, 7.73% in quality, 8.64% in reducing sugar, 3.49% in nicotine and 15.20% in chlorogenic acid + routine. The effect of leaf width on yield and chlorogenic acid + routine content on quality were determined. As a result of the study, when heterosis and heterobeltiosis data were evaluated, it was found that Xanthi 2A x Katerini hybrid showed promising results.

Background: Currently, controlled ovarian hyperstimulation (COH) is monitored by serum estradiol (E2) levels which are believed to primarily detect functional activity of follicles. Objective: To evaluate estradiol level as a predictor of ovarian response and pregnancy outcome during COH in women from Gaza Strip. Methods: This prospective cohort study consisted of 75 women attending in vitro fertilization (IVF) at Al-Basma Fertility Center in Gaza City. Blood withdrawal for E2 hormone measurement was performed in all the patients and the number of oocytes and embryos were recorded for each female and the occurrence of pregnancy was followed for three months. Obtained data were computer analyzed using SPSS statistical package version 18. Results: The mean age of the study population was 29.2±5.9 years. Questionnaire interview showed that the cause of infertility was mostly referred to husbands. More than half of women seeking IVF had no children and had repeated IVF. The mean level of E2 showed the highest value of 2194.4 (pg/ml) at age group 26-35 years. However, the difference in E2 levels among the age groups was not significant (F=0.940 and P=0.395). When related to the number of oocytes retrieved, E2 level showed general increase with increase ovarian response, recording values of 1642.7, 1665.1, 2156.8 and 1798.7 pg/ml with <4, 4-8, 9-16 and >16 oocytes, respectively, but this change was not significant (F=0.219 and P=0.883). The mean level of E2 showed its maximum value of 2143.6 pg/ml in positive pregnancy. However the difference in E2 levels among the different categories of IVF outcome was not significant (F=0.423 and P=0.656). The numbers of total and mature oocytes, and embryo were significantly increased with increased levels of E2, showing a good response at E2 level=1000-2000 pg/ml. The number of mature oocytes showed positive correlations with E2 and number of embryo (r= 0.159, P= 0.177 and r= 0.890, P=0.000, respectively) and negative correlation with age (r=-0.276, P=.017). Conclusion: Estradiol level 1000-2000 pg/ml at mean age of 27.8±4.9 years, could be a predictor of ovarian response and pregnancy outcome during COH. Consequently, for women to undergo a more likely successful IFV program, it is recommended to optimize E2 level at 1000-2000 pg/ml.DOI: http://dx.doi.org/10.3329/jom.v14i1.14537 J MEDICINE 2013; 14 : 52-56

The article reveals the forms and methods of fighting the partisan (insurgent) movement in the military conflicts of the second half of the 20th century. In particular, there were considered the tactics of the French colonial administration activities against the National Liberation Front of Algeria (1954–1962), tactical techniques of fighting by units of American troops against the insurgents in Vietnam (1964–1975). There were covered views on the Soviet troops’ tactics of fighting against the insurgents in Afghanistan (1979–1989). There were highlighted the forms and methods of tactical actions of Russian Federation’s regular units in the counter-terrorist operation against insurgent formations in the Second Chechen War 1999–2000. After analysis of the available literature and sources on the organizing and conducting the fight against partisanship (insurgency) in military conflicts of the second half of the 20th century there was established that the forms of combating them, as in the first half of the 20th century, remained operations, combat and special actions. During all types of operational and combat activities there were used the same methods of fighting as during the liquidation of Basmatism in Central Asia (1918–1933), the “Kurkul uprising and banditry” in Ukraine (1920–1921), the nationalist underground in the North Caucasus in 1920–1930s, the struggle of the German Wehrmacht troops, SS special formations, security police and SD’s against Soviet partisans in 1941–1944, the liquidation of the formations of the Ukrainian Insurgent Army and “forest brothers” in the Baltic countries in the 1940s–1950s.

Tomato spotted wilt virus (TSWV) (genus Tospovirus, family Bunyaviridae) was first reported in Greece during 1972 (3) and currently is widespread in the central and northern part of the country infecting several cultivated and wild plant species (1,2). In June 2006, virus-like symptoms similar to those caused by TSWV were observed on sweet honey leaf (Stevia rebaudiana (Bertoni) Bertoni, [synonym Eupatorium rebaudianum Bertoni], family Asteraceae) plants in an experimental field in the prefecture of Kilkis and on potato (Solanum tuberosum, family Solanaceae) plants growing close to tobacco in the prefecture of Kozani in northern Greece. Diseased S. rebaudiana plants expressed chlorotic and necrotic rings and line patterns on systemically infected leaves and occasionally a general chlorosis or dwarfing of the plant. Potato plants expressed only necrotic rings or lesions and a mild plant dwarfing. Seven percent of the S. rebaudiana plants, but only 0.1% of the potato plants, were showing symptoms. TSWV was detected by ELISA using polyclonal antisera in all symptomatic plants of both species, but those plants tested negative for Potato Y virus (PVY), Cucumber mosaic virus (CMV), Alfalfa mosaic virus (AMV), and Potato leafroll virus (PLRV); all viruses known to occur in these areas. Sap from symptomatic plants was used to mechanically inoculate Petunia × hybrida cv. Blue magic, Nicotiana tabacum cvs. Samsun NN and Basmas, N. benthamiana, N. glutinosa, N. rustica, Datura stramonium, and Physalis floridana. Sap from both S. rebaudiana and potato produced typical symptoms of TSWV on the diagnostic test plants; all Nicotiana species and cultivars, as well as D. stramonium and P. floridana, reacted with chlorotic and necrotic lesions on the inoculated leaves followed by systemic mosaic and mottling of the leaves. None of the isolates produced systemic infection on P. × hybrida. Adult thrips, identified as Thrips tabaci, were collected from infected plants of both hosts in the field and determined to be infected with TSWV by the petunia leaf disc method (4). Symptoms observed in the field on both hosts where reproduced in the laboratory after infestation of healthy plants with TSWV-infected individuals from a tobacco population of T. tabaci. To our knowledge, this is the first official report of a TSWV infection in S. rebaudiana. Potato is a known host for TSWV, however, to our knowledge, this is the first natural infection detected in Greece. References: (1) E. K. Chatzivassiliou et al. Ann. Appl. Biol. 137:127, 2000. (2) E. K. Chatzivassiliou et al. Plant Dis. 85:40, 2001. (3) J. P. Tsakiridis and G. V. Gooding, Jr. Phytopathol. Mediterr. 11:42, 1972. (4) I. Wijkamp and D. Peters. Phytopathology 83:986,1993.

Background:There are contradictory results in the relevant literature about the relationship between objective determinants of craniocervical posture and temporomandibular disorder (TMD), whereas no study has worked on AS and TMD relationship.Objectives:To evaluate the predictors of TMD in AS patients and its relationship with craniocervical posture, we conducted this studyMethods:AS patients aged between 18-50 years and consecutively admitted to our outpatient clinics were recruited. TMD was diagnosed by ‘Diagnostic Criteria for Temporomandibular Disorders (DC/TMD)’ criteria. Spinal mobility was assessed by BASMI; disease activity by ASDAS-CRP and neck disability by Neck Disability Index. We measured the craniocervical angle, cervical curvature angle, suboccipital distance, atlas-axis distance, anterior translation distance by using the lateral cervical X-rays (Figure).Results:A total of 98 (58.2% female) patients with a mean age of 37.4 ±48.2 years was recruited (Table 1). TMD was diagnosed in 58 (59,2%) patients. Spinal mobility and craniocervical posture measurements were similar among the two groups (Table2). Smoking, bruxism (in females), neck disability and AS activity (in males) were higher in TMD patients (Table 1). Multivariate analysis revealed active smoking (aOR 6.86; CI: 1.83-25.60; p=0.004), bruxism in females (aOR 17.87; CI: 2.0-159.20; p=0.01), high ASDAS in males (aOR 11.82; CI: 1.14-122.5; p=0.038) and neck disability (aOR 12.67; CI: 3.75-42.85; p<0.001) as independent risk factors for TMD in AS patients.Table 1.The clinical and demographical data of the study populationParameterAll patientsTMD (+)(n=58)TMD(-)(n=40)PvalueGender (Female)57 (58.2)38 (65.5)19 (47.5)0.076Age37.4±8.237.8±7.736.9±8.90.57Smoking Smoker33 (33.7)25 (43.1)8 (20.0)0.017 Non-smoker65 (66.3)33 (56.9)32 (80.0)AS disease duration (year)8.1±5.77.8±6.28.6±5.00.47AS treatment NSAID0.52 Regular13 (13.2)8 (13.8)5 (12.5) On-demand49 (50.0)31 (53.4)18 (45.0) Sulphasalazine38 (38.7)24 (41.4)14 (35.0)0.67 Anti-TNF agents59 (60.0)33 (56.9)26 (65.0)0.42Bruxism Present61 (62.2)43 (74.1)18 (45.0)0.003 Nighttime18 (29.5)11 (25.6)7 (38.9) Daytime15 (24.6)10 (23.3)5 (27.8) Whole day28 (45.9)22 (51.2)6 (33.3) Absent37 (37.8)15 (25.9)22 (55.0)Table 2.Comparison of AS-related and craniocervical posture measurementsParameterAll patientsTMD (+)(n=58)TMD(-)(n=40)P valueAS-related measurementsASDAS2.4±0.952.7±0.932.0±0.850.001 Male2.3±1.32.7±1.141.7±0.850.007 Female2.5±0.92.7±0.822.4±0.780.11Tragus-wall distance (cm)11.7±2.5511.6±1.9712.0±3.240.41Cervical rotation (angle)71.6±12.7871.6±12.3271.5±13.590.94Chin-thorax distance (cm)2.1±1.642.1±1.442.1±1.910.90BASMI2.0±1.192.0±1.112.1±1.310.76mSASSS3.5±4.843.4±3.883.8±6.030.70Measurements of craniocervical postureCraniovercival angle79.6±10.3178.9±10.4780.6±10.110.41Cervical curvature angle165.4±12.42165.6±12.89165.0±11.840.82Suboccipital distance (mm)6.3±3.976.2±4.046.5±3.910.71Atlas-axis distance (mm)5.2±2.435.3±2.475.0±2.400.62Anterior translation distance (mm)10.9±13.7411.4±11.7910.1±16.350.66Conclusion:No relationship between the craniocervical posture measurements and TMD was found in AS patients. Active smoking, high disease activity in males, bruxism in females and neck disability were found as predictors of TMD in AS patients.Figure.For the assessment of cranicervical posture; suboccipital distance (A.a.), atlanto-axial distance (A.b.) anterior translation distance (A.c), craniocervical angle (B.a), cervical curvature angle (B.b) were measured on standardized lateral X-rays.Disclosure of Interests:Esra Bilgin: None declared, Emre Bilgin: None declared, Oya Özdemir: None declared, Umut Kalyoncu Consultant of: Abbvie, Amgen, Janssen, Lilly, Novartis, UCB

BackgroundHip involvement occurs in about one-third of patients with spondyloarthritis (SA) [1]. It can be responsible for significant disability and functional impairment.ObjectivesThis study aimed to assess the associated factors with hip involvement in SA.MethodsWe conducted a cross-sectional study, including 165 patients with SA diagnosed according to Assessment of SpondyloArthritis international Society (ASAS) criteria over a period from 2017 to 2021. Demographic, clinical, biological and radiographic data were collected. We compared following parameters assessed at the time of diagnosis of coxitis: Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), Ankylosing Spondylitis Disease Activity Score (ASDAS-CRP), modified Stoke Ankylosing Spondylitis Spine Score (mSASSS), Bath Ankylosing Spondylitis Radiology Index (BASRI), erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP).We used logistic regression analysis to identify factors associated with hip involvement in SA.ResultsA total of 165 Patients were enrolled (121 men and 44 women), the mean age was 46.13 ± 13.07 years. The mean age of disease onset was 35.01 ± 12.55 years. The average diagnostic delay was 37.54 ± 50.51 months. The average disease duration was 10.91 ± 6.94 years.Eighty seven percent of patients had axial spondyloarthritis, 72% had extra-articular manifestations.Mean ESR and CRP values were 37.49 ± 28.1 mm and 30.14 ± 43.55 mg/L, respectively. Mean BASDAI and ASDAS-CRP values were 4 ± 1.8 and 3.09 ± 1.13, respectively.Hip involvement was noted in 60 patients (36.4%). It was bilateral in 75% of cases (n=45). A total number of affected hips was 105.Following parameters were significantly higher in patients with hip involvement: age over 40 years old (73.3 vs 56.3%, p=0.030), symptoms duration over 10 years (60% vs 40.2%, p=0.015), elevated CRP (87.9% vs 73.7%, p=0.036), radiographic sacroiliitis (95% vs 82.7%, p=0.023), frequency of pulmonary involvement (25.0% vs 11.4%, p:0.023), frequency of osteoporosis (20.0% vs 8.6%, p:0.034), BASMI (3.71 vs 1.65, p<0.001), BASRI spine (5.97 vs 2.91, p<0.001), and mSASSS (16.24 vs 5.80, p:0.001). However, no association was found between HLA-B27 and hip involvement (50% vs 28.6%, p=0.099).A multivariable logistic regression model showed that age over 40 years (OR=2.688 [1.020 - 7.083], p=0.045), radiographic sacroiliitis (OR=5.656 [1.007 - 31.769], p=0.049), and very high disease activity (ASDAS-CRP≥3.5) (OR=5.328 [1.774 - 16.002], p=0.003) were independently associated with hip involvement in SA.ConclusionOur study showed that age, symptoms duration, radiographic sacroiliitis, extra-articular manifestations, axial structural damage, elevated CRP, and very high disease activity were associated with hip involvement. These finding suggest that the control of disease activity and inflammation may prevent the onset of hip involvement. There are controversial findings regarding the association between HLA B27 gene and hip involvement [2].References[1]Vander Cruyssen B, Vastesaeger N, Collantes-Estévez E. Hip disease in ankylosing spondylitis. Curr Opin Rheumatol. 2013 Jul;25(4):448-54.[2]Chen HA, Chen CH, Liao HT, Lin YJ, Chen PC, Chen WS, Chou CT. Factors associated with radiographic spinal involvement and hip involvement in ankylosing spondylitis. Semin Arthritis Rheum. 2011 Jun;40(6):552-8.Disclosure of InterestsNone declared

BackgroundAxial Spondyloarthritis (axSpA) can be distinguished in radiographic axSpA (r-axSpA) and non-radiographic (nr-axSpA). Secukinumab (SEC) is a novel treatment for axSpA, but data from real-life are still missing.ObjectivesTo evaluate, in a multicentric-Italian-cohort of axSpA patients on SEC followed for 24-months: a)the long-term effectiveness and safety of SEC; b)the drug-retention-rate and low-disease-activity (LDA) measured as BASDAI<4/ASDAS<2.1 and very-low-disease-activity (VLDA) measured as BASDAI<2/ASDAS<1.3; c)any differences in outcomes according to: line of biological treatment (naïve/non-naïve), gender (male/female), subtype of axSpA (r-axSpA/nr-axSpA).MethodsConsecutive patients with active axSpA (diagnosis according Assessment of SpondyloArthritis International Society ASAS criteria), who started SEC treatment, were evaluated prospectively. Data on disease characteristics, previous/ongoing treatments and imaging were collected. Disease-activity/functional/clinical scores and biochemical values were recorded at baseline (T0), at 6 (T6), 12 (T12), and 24 (T24) months. Effectiveness was evaluated over-time with descriptive statistics; multivariate Cox and logistic regression models were used to evaluate predictors of drug-discontinuation and LDA at T6. Infections, adverse events were recorded.Results249 patients (47.8% male; median age 51 years) were enrolled; 40.9% had HLA-B27; 53.8% had r-axSpA and 46.2% nr-axSpA. SEC was prescribed in 28.9% naïve and in 71.1% non-naïve patients. SEC effectiveness was shown as an improvement in several outcomes, such as ASDAS [T0=3.5(2.9-4.4) vs. T24=1.9(1.2-2.4);p=0.02] and BASDAI [T0=6.5(5.0-7.5) vs. T24=2.8(1.8-4.0);p=0.03]. After 24-months of treatment, 90.7% of naïve and 75.3% of non-naïve patients achieved LDA (BASDAI<4). At T24 naïve-patients showed better physical-functioning and lower disease-activity than non-naïve (Table 1). Similarly, at T24 we observed better physical functioning and lower inflammatory activity in males vs. females and in nr-axSpA vs. r-axSpA subjects. Retention-rate at T24 was 75% in the whole population, with some difference depending on gender (log-rank 9.319; p=0.002) (Figure 1). Treatment was discontinued in 61 patients (24.5%), mainly due to primary/secondary loss of effectiveness events (20 and 24 subjects, respectively), and only 17 patients (6.8%) due to adverse events (7 for reactions at the injection site or skin manifestations, 1 for gastro-intestinal complications, 1 for relapsing uveitis, 1 for hypertransaminasemia, 4 for severe recurrent infections, 3 due to the onset of new cancer).Table 1.Clinical, functional, disease activity and serological parameters of naïve (n=72) and non-naïve (n=177) axSpA patients during the 24-month follow-upT0T6T12T24BASMI [0-10], median (IQR)naïve2.0 (1.0-4.0)2.0 (0.0-3.3)1.0 (0.0-2.8)1.0 (0.0-2.0)non-naïve4.0 (1.0-7.0)4.0 (1.0-7.0)2.0 (1.0-4.0)2.0 (1.0-3.0)pp=0.03p=0.04nsnsHAQ-S [0-8], median (IQR)naïve0.8 (0.5-1.3)0.5 (0.0-1.0)0.3 (0.0-1.0)0.1 (0.0-0.5)non-naïve1.1 (0.8-1.5)1.0 (0.4-1.3)0.6 (0.4-0.9)0.7 (0.1-0.9)pp=0.04p=0.04p=0.04p=0.04ASDAS [0-6], median (IQR)naïve3.3 (2.7-3.9)2.1 (1.6-2.7)2.0 (1.2-2.8)1.3 (1.0-2.2)non-naïve3.7 (2.9-4.7)2.9 (2.0-3.7)2.1 (1.9-3.1)2.3 (1.6-2.3)pnsnsnsp=0.04ESR [0-25](mm/h), median (IQR)naïve14.0 (6.0-27.0)10.0 (4.0-19.5)8.0 (3.1-12.8)5.0 (2.0-15.0)non-naïve18.5 (10.0-31.3)15.0 (8.0-25.0)12.0 (6.0-20.0)12.0 (6.0-19.0)pp=0.04p=0.04p=0.04p=0.04Legend: BASMI: Bath Ankylosing Spondylitis Metrology Index; HAQ: Health Assessment Questionnaire modified for spondyloarthritis; ASDAS: Ankylosing Spondylitis Disease Activity Score; ESR: erythrocyte sedimentation rateConclusionIn a real-life clinical-setting, SEC proved to be safe and effective in axSpA, mainly in naïve-patients, with a notable drug-retention-rate. No differences were observed between r-axSpA and nr-axSpA.AcknowledgementsContributing authors of the Spondyloartritis and Psoriatic Arthritis SIR Study Group “Antonio Spadaro”: Alberto Cauli, MD, PhD, Rheumatology Unit, Department of Medical Sciences, AOU and University of Cagliari, Cagliari, Sardegna, Italy; Angelo Semeraro, MD, Rheumatology Unit, Martina Franca-ASL Taranto, Puglia, Italy; Leonardo Santo, MD, Rheumatology Unit, ASL BT Andria – DSS4 Barletta, Italy, Barletta-Andria-Trani, Puglia, Italy; Emanuela Praino, MD, Rheumatology Unit, ASL BT Andria – DSS4 Barletta, Italy, Barletta-Andria-Trani, Puglia, Italy; Giorgio Amato, MD, Rheumatology Unit, A.O.U. Policlinico S. Marco, Catania, Sicilia, Italy; Nicolò Girolimetto, MD, Rheumatology Unit, Department of Internal Medicine, Azienda USL-IRCCS, Istituto di Ricovero e Cura a Carattere Scientifico, Reggio Emilia, Emilia Romagna, Italy.Disclosure of InterestsGiacomo Cozzi: None declared, Mariagrazia Lorenzin: None declared, Maria Sole Chimenti: None declared, Salvatore D’Angelo: None declared, Antonio Marchesoni: None declared, Carlo Salvarani: None declared, Ennio Lubrano: None declared, Luisa Costa: None declared, Ylenia Dal Bosco: None declared, Elena Fracassi: None declared, Augusta Ortolan: None declared, Mario Ferraioli: None declared, Antonio Carriero: None declared, elisa visalli: None declared, RICCARDO BIXIO: None declared, Francesca Desiati: None declared, ALBERTO BERGAMINI: None declared, elisa pedrollo: None declared, Andrea Doria Grant/research support from: Novartis, Abbvie, Pfizer, MSD, Janssen, Rosario Foti: None declared, Antonio Carletto: None declared, Roberta Ramonda Grant/research support from: Novartis, Abbvie, Pfizer, MSD, Janssen

Background:The efficacy and safety of the interleukin-17 inhibitor ixekizumab (IXE) for the treatment of radiographic (r-) and non-radiographic (nr-) axial spondyloarthritis (axSpA) has been shown for up to 52 weeks.1-2Objectives:To study the efficacy and safety of ixekizumab in the treatment of patients with r- and nr-axSpA for up to 116 weeks.Methods:COAST-Y (NCT03129100) is the 2-year extension of the COAST-V, -W, and -X trials. Patients continued with the dose received at the end of the originating trial at Week 52, either with 80 mg IXE every 4 weeks (Q4W) or every 2 weeks (Q2W). Patients who had been assigned to adalimumab or placebo were re-randomized to IXE Q4W or Q2W at Week 16 in COAST-V and -W. Patients who had received placebo for 52 weeks in COAST-X were switched to IXE Q4W in COAST-Y. Patients who switched from placebo or adalimumab treatment to IXE (COAST-V, -W, or -X) or from IXE Q4W to open-label IXE Q2W (COAST-X) during the originating studies were analyzed separately from patients continuously treated with IXE. Standardized efficacy measures were used (Table 1). Missing data were handled by non-responder imputation for categorical data and modified baseline observation carried forward for continuous data. Safety data were analyzed for all patients who received ≥1 dose of IXE.Table 1.Demographic and efficacy results for patients continuously treated with IXE for 116 weeksIXE Q4W N=157IXE Q2W N=195Demographics Age42.7 (13.0)41.8 (11.2) Male (n, [%])124 (79.0)132 (67.7) Baseline ASDAS3.92 (0.80)3.95 (0.76) Baseline BASDAI7.07 (1.26)7.18 (1.35) Baseline BASFI6.57 (1.76)6.74 (1.86) Baseline BASMI4.08 (1.46)3.97 (1.52) Baseline SF-36 PCS33.90 (7.27)33.26 (6.88)Outcome measureResponse (n, [%])Week 52Week 116Week 52Week 116 ASDAS <2.175 (47.8)69 (43.9)88 (45.1)96 (49.2) ASAS partial remission34 (21.7)31 (19.7)35 (17.9)39 (20.0) ASAS4082 (52.2)89 (56.7)99 (50.8)108 (55.4) BASDAI5078 (49.7)75 (47.8)83 (42.6)99 (50.8)Change from baseline ASDAS-1.64 (1.05)-1.60 (1.15)-1.63 (1.03)-1.78 (1.04) BASFI-2.88 (2.31)-2.76 (2.39)-2.83 (2.38)-3.15 (2.34) BASMI-0.57 (0.95)-0.57 (0.93)-0.53 (0.92)-0.60 (1.00) SF-36 PCS9.03 (8.62)8.43 (8.70)8.87 (7.57)9.86 (8.45)Data are mean (SD) unless otherwise noted. Non-responder imputation was used for categorical variables, and modified baseline observation carried forward for continuous variables.Results:Of the 773 patients enrolled in COAST-Y, 86.0% completed Week 116 of treatment (52 weeks of one of the originating trials and 64 weeks of COAST-Y). Among the patients continuously treated with IXE for 116 weeks (IXE Q4W: N=157; IXE Q2W: N=195), 46.9% achieved low disease activity (ASDAS <2.1), and 19.9% achieved ASAS partial remission at 116 weeks (Table 1; Figure 1). In comparison to baseline, 56.0% achieved ASAS40 (Table 1). The mean change from baseline at Week 116 was –1.70 for ASDAS, –2.98 for BASFI, and 9.22 for SF-36 Physical Component Summary (Table 1). Similar observed responses were achieved between the patients continuously treated with IXE and patients initially treated with placebo or adalimumab. For the 932 patients in the safety population, no new safety signals were identified.Conclusion:Ixekizumab treatment led to consistent and sustained long-term improvements in disease activity and quality of life in patients with r- and nr-axSpA, with no new safety signals after up to 2 years of treatment.References:[1]Dougados, et al. Ann Rheum Dis 2020;79:176-185.[2]Deodhar, et al. Lancet 2020; 395:53-64.Disclosure of Interests:Juergen Braun Speakers bureau: Abbvie, Amgen, BMS, Boehringer, Celgene, Celltrion, Centocor, Chugai, Eli Lilly and Company, Medac, MSD, Mundipharma, Novartis, Pfizer, Roche, Sanofi-Aventis, and UCB, Consultant of: Abbvie, Amgen, BMS, Boehringer, Celgene, Celltrion, Centocor, Chugai, Eli Lilly and Company, Medac, MSD, Mundipharma, Novartis, Pfizer, Roche, Sanofi-Aventis, and UCB, Grant/research support from: Abbvie, Amgen, BMS, Boehringer, Celgene, Celltrion, Centocor, Chugai, Eli Lilly and Company, Medac, MSD, Mundipharma, Novartis, Pfizer, Roche, Sanofi-Aventis, and UCB, Uta Kiltz Speakers bureau: AbbVie, Hexal, MSD, Novartis, Pfizer, Roche, and UCB, Consultant of: AbbVie, Biocad, Eli Lilly and Company, Grünenthal, Hexal, Janssen, Novartis, Pfizer, and UCB, Grant/research support from: AbbVie, Amgen, Biogen, Hexal, Novartis, and Pfizer, Atul Deodhar Consultant of: AbbVie, Amgen, Boehringer Ingelheim, Bristol Myers Squibb, Celgene, Eli Lilly and Company, Giliad, GlaxoSmith & Kline, Janssen, Novartis, Pfizer, and UCB, Grant/research support from: AbbVie, Boehringer Ingelheim, Eli Lilly and Company, GlaxoSmith & Kline, Novartis, Pfizer, and UCB, Tetsuya Tomita Speakers bureau: AbbVie, Astellas, Bristol-Myers Squibb, Eisai, Eli Lilly and Company, Janssen, Mitsubishi Tanabe, Novartis, Takeda, Pfizer, Consultant of: AbbVie, Astellas, Bristol-Myers Squibb, Eisai, Eli Lilly and Company, Janssen, Mitsubishi Tanabe, Novartis, Takeda, Pfizer, Maxime Dougados Consultant of: AbbVie, BMS, Eli Lilly and Company, Merck, Novartis, Pfizer, Roche, and UCB, Grant/research support from: AbbVie, BMS, Eli Lilly and Company, Merck, Novartis, Pfizer, Roche, and UCB, Rebecca Bolce Shareholder of: Eli Lilly and Company, Employee of: Eli Lilly and Company, David Sandoval Shareholder of: Eli Lilly and Company, Employee of: Eli Lilly and Company, David Adams Shareholder of: Eli Lilly and Company, Employee of: Eli Lilly and Company, Chen-Yen Lin Shareholder of: Eli Lilly and Company, Employee of: Eli Lilly and Company, Jessica A. Walsh Consultant of: AbbVie, Amgen, Eli Lilly and Company, Novartis, Pfizer, and UCB, Grant/research support from: AbbVie, Merck, and Pfizer

&nbsp; <strong>ABSTRACT</strong> Citrus is ranked among the most sensitive crops to salinity. This constrainst affects plant morpho-physiology and may lead to yield declines. To assess the effects of salinity on some physiological and biochemical traits, an in vivo screening test was performed under controled saline conditions using different citrus rootstocks i.e. citrumelo 57-98-502, Swingle citrumelo F9-22-55 (80-11), citrumelo 57-98-506, Swingle citrumelo 74-1, citrumelo Winter Haven B2, Carrizo citrange 28608, Troyer citrange C35B6A11, Troyer citrange B2 31655, citrumelo 4475 B2G3, citrumelo 4475 B B6A5, citrumelo 4475 A B6A4, citrumelo Sacaton 30057, Gou-Tou SRA 506, Volkamer lemon B2 28613 andTroyer citrange.Plants were grown on a sand substratum and subjected to three salt treatments including 0 (control), 2 and 5 g.l-1 NaCl during 90 days. Physiological responses to salt stress were evaluated at the end of this period. Results showed that all studied parameters were affected by salinity. High salt concentrations caused a considerable reduction of growth parameters such as fresh and dry weights of shoots and roots, especially in citrumelo 57- 98-502, Swingle citrumelo swingle F9-22-55 (80-11), Carrizo citrange 28608 andcitrumelo 4475 BB6A5. In some rootstocks such as citrumelo 4475 B2G3, citrumelo 4475 B B6A5 and citrumelo 4475 A B6A4, these changes were associated witha decrease in leaf chlorophyll content. In addition, we noted a significant accumulation of proline in the leaves of rootstocks as the salinity of the irrigation solution increased, particularly in citrumelo 4475 A B6A4 and citrumelo Sacaton 30057. We concluded that these osmolytes may play a key role in Sentivity or tolerance of citrus rootstocks to salinity <strong>Key words:</strong> citrus, rootstock, salt stress &nbsp; <strong>REFERENCES</strong> Abbas W, Ashraf M, Akram NA 2010. Alleviation of salt-induced adverse effects in eggplant (Solanum melongena L.) by glycinebetaine and sugar beet extracts. Sci Hortic 125:188-195. Ashraf, M. and Harris, P.J.C. 2004. Potential biochemical indicators of salinity tolerance in plants. Plant Science, 166, pp. 3-16. Ashraf, M., M. H. Bokhari and S. N. Chishti. 1992. Variation in osmotic adjustment of accessions of lentil (Lens culinaris Medic.) in response to drought stress. Acta Bot. Netherlands., 41:51-62. Atienza, S. G., P. Faccioli, G. Perrotta, G. Dalfino, W. Zschiesche, K. Humbeck, A. M. Stanca and L. Cattivelli. 2004. Large-scale analysis of transcripts abundance in barley subjected to several single and combined abiotic stress conditions. Plant Sci., 167: 1359-1365. 5.&nbsp;&nbsp; Banuls&nbsp; J., Legaz F. &amp;&nbsp;&nbsp; Primo&nbsp; Millo E., 1990. Effects of salinity on&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; uptake and distribution of chloride and sodium in some&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Citrus&nbsp;&nbsp; scion-rootstock combinations. J. Hortic. Sci.,65,715-724. Benyahia, H. 1998. Effet de la salinit&eacute; sur le d&eacute;veloppement des maladies &agrave; Phytophthora des agrumes au Maroc. Th&egrave;se de troisi&egrave;me cycle, Universit&eacute; Cadi Ayyad, Facult&eacute; des Sciences Semlalia, Marrakech, 170pp. Benyahia, H. 2007. &ldquo;Am&eacute;lioration de la R&eacute;sistance des Porte-Greffes D&rsquo;Agrumes Vis-&agrave;-Vis des Contraintes Biotiques et Abiotiques.&rdquo; Ph.D. thesis, Mohamed Ben Abdellah University. Benyahia, H., Ait Haddou, M. M., Jrifi, A., and Lamsettef, Y. 2004. &ldquo;Effet de la Salinit&eacute; de L&rsquo;Eau D&rsquo;Irrigation sur la Colonisation des Racines des Porte-Greffes D&rsquo;Agrumes par Phytophtora Parasitica.&rdquo; Fruits 59: 101-108. Benyahia, H., Beniken, L., Omari, F. Z., Bnazzouze, A., Handaji, N., Msatef, Y., and Olitrault, P. 2011. &ldquo;Evaluation of the Resistance of Few Citrus Rootstocks to Alkalinity by Applying a Faste Test of Screening.&rdquo; African Journal of Agricultural Research 6 (4): 780-784. Bhantana P, Lazarovitch N 2010. Evapotranspiration, Crop coefficient and growth of two young pomegranate (Punica granatum L.) varieties under salt stress. Agri Water Manage 97:715-722. Cambrolle J, Redondo-Gomez S, Mateos-Naranjo E, Luque T, Figueroa ME 2011. Physiological responses to salinity in the yellow-horned poppy, Glaucium flavum. Plant Physiol Biochem 49:186-194. Castle, W.S., Tucker, D.P.H., Krezdorn, A.H., Youtsey, C.O., 1993. Rootstocks for Florida citrus:&nbsp; Rootstock selection, the first step to success. Second Edition, SP-42. Institute of Food and Agricultural Sciences, Gainesville, FL, p. 92. University of Florida. Chapman H.D., Reuther W., Batchelor L.D. &amp; Weber H.J., 1968. The mineral nutrition of Citrus. In: Reuther W., ed. The Citrus industry. Vol. 2. Berkeley, USA: University of California, 127-289. Cooper, W.C. 1961. Toxicity and accumulation of salts in Citrus trees on various rootstocks in Texas .Proceeding of the Florida State Horticultural Society 74 : 95-104. Cotlove, E. 1965. &ldquo;Determination of Cl- in Biological Material.&rdquo; In Methods of Biochemical Analysis, edited by Glick D. New York: Interscience. Craine, J. M. 2005. Reconciling plant strategy theories of Grime and Tilman. J. Ecol., 93:1041-1052. Dong, Y., T. Ji and S. Dong. 2007. Stress responses to rapid temperature changes of the juvenile sea cucumber (Apostichopus japonicus Selenka). J. Ocean Uni. Chin., 6:275-280. Dubois M., Gilles K.A., Hamilton J.K., Rebecs P.A., Smith F. 1956. Colorimetric method for d&eacute;termination of sugars and related substances. Anal. Chem., 28 (3) : 350-356. Fadli, A., Chetto, O., Talha, A., Benkirane, R., Morillon, R. and Benyahia, H. 2014. Characterization in greenhouse conditions of tolerant citrumelo (Citrus paradisi Macf. x Poncirus trifoliata (L.) Raf.) cultivars. Journal of life sciences, 8, pp. 955-966. Fekhaoui M., Bennasser L., Seigle-Murandi F &amp; Benoit-Guyod J.L. 1993. Water pollution in the Sebou river basin (Morocco) - preliminary result. First Setac World Congress: Ecotoxicology and environmental chemistry - a global perspective. Lisbon, Portugal, March, 28-31. Fernandez-Ballester G., Vicente M., Dionisio R., Antonio C. 1998. Changes in inorganic and organic solutes in Citrus growing under saline stresses. J. Plant Nutr. 21, p. 2497&ndash;2514. Fetouhi, A. 1981. Les sols sal&eacute;s dans les O.R.M.V.A. Garg, A. K., J. K. Ownes and R. J. Wu. 2002. Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stress. Proceeding of the National Academy of Sciences of the United States of America, 99:15898-15903. Goell A. 1969. salinity effects on citrus trees. Proc. First. Intern. Citrus Symp. 1969, 3: pp.1819-1824. Gomez KA., Gomez AA. 1984. Statistical procedures for agricultural research (2nd ed.). NewYork: Wiley, p. 272&ndash;356. Gomez-Cadenas A., Tadeo F. R., Primo-Millo E., and Talon M. 1998. Involvment of abscisic acid and ethylene in the responses of citrus seelings to salt shock. Physiologia Plantarum, 103: 475-484. Grewal, H.S., 2010. Response of wheat to subsoil salinity and temporary water stress at different stages of the reproductive phase. Plant Soil 330, 100-113. Hayat S, Hasan SA, Yusuf M, Hayat Q, Ahmad A 2010. Effect of 28- homobrassinolide on photosynthesis, fluorescence and antioxidant system in the presence or absence of salinity and temperature in Vigna radiata. Environ Exp Bot 69:105-112. Hoagland, D. R., and Arnon, D. I. 1950. &ldquo;The Water-Culture Method for Growing Plants without Soil.&rdquo; California Agricultural Experiment Station Circular 347: 1-32. Levy Y., Lifshitz J., De Malach Y., David Y. 1999. The response of several Citrus genotypes to high salinity irrigation water. Hort. Sci. 34, p. 878&ndash;881. Levy, Y. and J. P. Syvertsen. 2004. Irrigation water quality and salinity effects in citrus trees.&nbsp; Hortic. Rev., 30:37-82. Levy, Y., Shamhevet, J. 1990. Ranking the tolerance of citrus rootstocks by juice analysis. Sci. Hortic.45, 89-98. Lloyd J., Kriedemann P.E. and Aspinall D.,1990. Contrast between Citrus species in response to salinisation: an analysis of photosynthesis and water relations for different rootstock-scion combinations.&nbsp;&nbsp;&nbsp;&nbsp; Physiol. Plant., 78, 236-246. Loreto, F., M. Centritto and K. Chartzoulakis. 2003. Photosynthetic limitations in olive cultivars with different sensitivity to salt stress. Plant Cell Environ., 26:595-601. Loussert R. 1989. Les agrumes. Techniques agricoles m&eacute;diterran&eacute;ennes, Lavoisier, Paris. Maas E.V. 1993. Salinity and Citriculture, Tree Physiolopgy 12, pp. 195-216. Martino, C. D., S. Delfine, R. Pizzuto, F. Loreto and A. Fuggi. 2003. Free amino acids and glycinebetaine in leaf osmoregulation of spinach responding to increasing salt stress. New Phytol., 158:455-463. Mohanty, A., H. Kathuria, A. Ferjani, A. Sakamoto, P. Mohanty, N. Murata and A. K. Tyagi. 2002. Transgenics of an elite indica rice variety Pusa Basmati1 harbouring the codA gene are highly tolerant to salt stress. Theor. Appl Genet.,&nbsp; 106:51-57. Monneveux P.H., Nemmar M., 1986.&nbsp; Contribution &agrave; l&rsquo;&eacute;tude de la r&eacute;sistance &agrave; la s&eacute;cheresse chez le bl&eacute; tendre (Triticum aestivum L.) et chez le bl&eacute; dur (Triticum durum Desf.): Etude de l&rsquo;accumulation de la proline au cours du cycle de d&eacute;veloppement. Agronomie, 6 (6) 583&ndash;590. Munns R, Richard AJ, Lauchli A, 2006. Approaches to increasing the salt tolerance of wheat and other cereals. Journal of Experimental Botany, Vol. 57, No. 5, pp. 1025&ndash;1043. Munns, R. 2002. Comparative physiology of salt and water stress. (Special issue: Drought stress). Plant, Cell and Environment. 25: 239-250. Murakeozy, E. P., Z. Nagy, C. Duhaze, A. Bouchereau and Z. Tuba. 2003. Seasonal changes in the levels of compatible osmolytes in three halophytic species of inland salinevegetation in Hungary. J. Plant Physiol., 160:395-401. Ndayiragije A. and S. D. Lutts. 2006. Do exogenous polyamines have an impact on the response of a salt sensitive rice cultivar to NaCl? J. Plant Physiol., 163:506-16. Noreen Z, Ashraf M 2009. Assessment of variation in antioxidative defense system in salt- treated pea (Pisum sativum) cultivars and its putative use as salinity tolerance markers. J Plant Physiol 166:1764-1774. Ollitrault, P., Froelicher, Y., Dambier, D., and Seker, M. 2000. Rootstock breeding by somatic hybridisation for the Mediterranean citrus industry. Acta Horticulturae. 157-162. Perez-Perez, J.G., Robles, J.M., Tovar, J.C., Botia, P., 2009. Response to drought and salt stress of lemon &#39;Fino 49&#39; under field conditions: water relations, osmotic adjustment and gas&nbsp; exchange. Sci. Hortic. 122, 83-90. Popp, M. and N. Smirnoff. 1999. Polyol accumulation and metabolism during water deficit. In: Smirnoff, N. (ed.): Environment and plant metabolism: Flexibility and acclimation. Bios Scientific, Oxford, 199-215. Ream C.L. &amp; Furr J.R., 1976. Salt tolerance&nbsp; of some citrus species, relatives, and hybrids tested as rootstocks. J. Am. Soc. Hortic. Sci., 101, 265-267. Romero-Aranda R., Moya JL., Tadeo FR., Legaz F., Primo- Millo E., Talon M. 1998. Physiological and anatomical disturbances induced by chloride salts in sensitive and tolerant Citrus: beneficial and detrimental effects of cations. Plant Cell Environ. 21, p.1243&ndash;1253. Ruiz-Medrano R., Xoconostle C. &amp; Lucas W.J., 2001. The phloem as a conduit for inter-organ communication. Curr. Opin. Plant Biol., 4, 202-209. Singh TN, Paleg LG, Aspinal D, 1973. Stress metabolism. Variations in reponse to water deficit in the barley plant. Aust. J. Biol. Sci.vol 26, pp. 65-75. Siringam K, Juntawong N, Cha-um S, Boriboonkaset T, Kirdmanee C 2012. Salt tolerance enhancement in indica rice (Oryza sativa L. spp. indica) seedlings using exogenous sucrose supplementation. Plant Omics J 5:5259. Sokal, R.R. and Rohlf, J.F. 1981. Biometry: the principles and practice of statistics in biological research. 2nd ed., W. H. Freeman and Company, San Francisco, 859p. Steel, R.G.D., J.H. Torrie et D.A. Dickey, 1997. Prin-ciples and Procedures of Statistics: A Biometrical Approach. Boston, MA, 666 p. Storey, R., Walker, R.R., 1998. Citrus and salinity. Scientia Horticulturae 78, 39&ndash;81. Walker RR., Sedgley M., Blessing MA., Douglas TJ. 1984. Anatomy, ultrastructure and assimilate concentrations of roots of Citrus genotypes differing in ability for salt exclusion. J. Exp. Bot. 35, p. 1481&ndash;1494. Walker R.R., Torokfalvy E., Scott N.S. &amp; Kriedemann P.E., 1981. An analysis of photosynthetic response to salt treatment in Vitis vinifera. Aust. J. Plant Physiol., 8, 359374. Walker, R.R. 1986. Sodium exclusion and potassium-sodium selectivity in salt-treated trifoliate orange ( poncirus trifoliata) and Cleopatra mandarin ( citrus reticulata) plants. Aust. J. plant physiol. 13:393-303. Williams, L.E., R. Lemonie and N. Saucer. 2000. Sugars transporters in higher plants: a diversity of roles and complex regulation trends. Plant Sci, 5:283-290. Zekri M, Lawrance R, Parson R. Salinity tolerance of citrus rootstocks. 1992. Effect on root and leaf mineral concentrations. Plant and Soil; 147: 171-81.

The current study was conducted in Multan, Pakistan to investigate an automated appearance based system for purity level identification of seven common rice (Oryza sativa L.) varieties from mixed rice grain samples. Adulteration is a major hurdle that affects rice export in Pakistan that refers to the mixing of premium rice grain varieties with the low grade rice grains to be marketed at a high cost. This study was based on the dataset collected from Rice Research Institute, Kala Shah Kaku, Pakistan during 2018-2020. Three Pakistani premium rice varieties (Basmati Shaheen, Basmati Super, and Basmati Pak) were mixed with four low quality varieties (Basmati 198, Basmati 2000, Basmati 370 and Basmati 385) in weight ratios of 10%, 15%, 20%, 25% and 30%. Classification and recognition of purity level of basmati rice achieved average accuracy of 89.88% using convolutional neural network. The proposed system has the potential to be used at a commercial scale to test the purity level of exported rice.

India's agricultural products export touched $ 50 billion for the financial year FY22, the highest level ever achieved. Basmati and Non-basmati rice are major exports and doubled during 2010-20 compared to 2000-2010. Export value of basmati and non-basmati rice were about Rs. 32,000 crores and Rs. 23,000 crores respectively during 2019-20. Exports of processed vegetables, fruits, nuts and fresh grapes are growing nearly 3 times during 2010-2020 (Rs.500 crores each) compared to 2000-2010 (around Rs. 3,000 crores each). Exports of cucumbers, gherkins, jaggery and confectionary items are growing at a faster rate in the recent decade (Rs.400 crores during 2005-06 to Rs. 1600 crores during 2019-20). Export basket of agricultural commodities is highly diversified (Herfindahl Index: 0.09 – 0.26) and non-conventional exports like processed vegetables, fruits and vegetables are increasing in faster rate. Hence, policy support to the non-conventional and high value exports as well as small and new exporters has to be continued. Aggregation of small exports and Farmers Producers Companies will directly benefit the farmers.

Basmati rice is a breakthrough cereal crop with distinct characteristics like long grain, superior aroma and unique flavour. Basmati rice is also stated to be the Pearl of Rice. India accounts for over 70% of the world's basmati rice production. So the present study was undertaken with the aim to assess the growth and instability in the area, production and productivity of Basmati rice in India. The secondary data on area, production and productivity of basmati rice were collected for a period of 20 years from 2000 to 2019. The growth performance in production was analysed by using exponential method and instability for the same was worked out of using Coefficient of Variation and Coppock’s Instability Index (CII). The study period was further divided into two sub periods and overall period. The compound growth rate analysis showed that during the overall period, area, production and productivity witnessed a positive and statistically significant growth rate at one per cent level of significance. Production witnessed highest positive growth rate followed by area and productivity. Instability analysis suggested that period I was the most unstable period under study. Coppock’s Instability analysis revealed that during the overall period, variation was highest in production, followed by area and least variation was observed in productivity. The study concluded that efforts must be taken up by the farmers, traders and government to enhance the production and productivity of basmati rice and also explore the possibility of expansion of area under basmati rice cultivation.

"The present study was undertaken to access the price trend of Basmati rice in domestic and International market and export competitiveness of Basmati rice as it accounts a major share to the export basket of India and generates higher earning due to high value in both international and domestic market compared to other agricultural commodities. The secondary data required to achieve the objectives were collected from the APEDA, DGCIS and Indiastat website for a period of 20 years (1999-2000 to 2018-2019). The trend in domestic and international price was estimated by using different parametric models and Nominal Protection Coefficient (NPC) was used to study the export competitiveness. The trend analysis showed that among all the competitive parametric models, exponential model was best fitted for both domestic and international price. The NPC value concluded that for all the three periods taken into consideration, Basmati rice was highly competitive in global market. Therefore, there is comparative advantage in the export of Basmati rice and concerned efforts must be taken up to effectively utilise its export potential."

Abstract Rice is a widely consumed staple food for a large part of the world’s human population. Approximately 90% of the world’s rice is grown in Asian continent and constitutes a staple food for 2.7 billion people worldwide. Bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae is one of the devastating diseases of rice. A field experiment was conducted during the year 2016 and 2017 to investigate the influence of different meteorological parameters on BLB development as well as the computation of a predictive model to forecast the disease well ahead of its appearance in the field. The seasonal dataset of disease incidence and environmental factors was used to assess five rice varieties/ cultivars (Basmati-2000, KSK-434, KSK-133, Super Basmati, and IRRI-9). The accumulated effect of two year environmental data; maximum and minimum temperature, relative humidity, wind speed, and rainfall, was studied and correlated with disease incidence. Average temperature (maximum &amp; minimum) showed a negative significant correlation with BLB disease and all other variables; relative humidity, rainfall, and wind speed had a positive correlation with BLB disease development on individual varieties. Stepwise regression analysis was performed to indicate potentially useful predictor variables and to rule out incompetent parameters. Environmental data from the growing seasons of July to October 2016 and 2017 revealed that, with the exception of the lowest temperature, all environmental factors contributed to disease development throughout the cropping season. A disease prediction multiple regression model was developed based on two-year data (Y = 214.3-3.691 Max T-0.508 Min T + 0.767 RH + 2.521 RF + 5.740 WS), which explained 95% variability. This disease prediction model will not only help farmers in early detection and timely management of bacterial leaf blight disease of rice but may also help reduce input costs and improve product quality and quantity. The model will be both farmer and environmentally friendly.

Abstract Background The All India Coordinated Rice Improvement Project (AICRIP) organizes multi-location tests (METs) with new genotypes from breeding programs. The best performing genotypes in METs for 3–4 years are identified and notified as commercial cultivars by the Government of India (GOI) to authorize breeder seed (BS) production. Methods We created a database and analyzed data on BS production for 24 years (1995–96 to 2018–19) in 475 inbred and 22 F1 hybrid cultivars. Estimates were made to rank cultivars on the proportional contribution of a cultivar, quantity produced and a new BS index. Correlation and regression analyses were used to find the relationships between BS, certified quality seed distributed (CQSD), and milled rice production. We compared cultivars in BS production chain with those grown in farmers’ fields across the country as identified in the production-oriented surveys. Results The top ten inbred cultivars identified are Jaya (notified by GOI in 1969), Swarna, Kranthi, IR 36, Sarjoo 52, Samba Mahsuri and Pusa Basmati 1 (notified in 1980–1989), and IR 64, Vijetha and Cottondora Sannalu (notified in 1991–2000). BS production in hybrid F1 was insignificant. We detected a Pearson correlation (r = 0.806, P &lt; 0.01) between the BS production and CQSD, and a linear relationship between the annual rice production in India and the CQSD (R2 = 0.850, P &lt; 0.01). The rice area coverage in 2018–19 with CQSD estimated was 41%. A total of 1877 cultivars (528 notified and 1349 not notified) were found at farms in rice growing districts in India. Conclusions From 1995–2019, BS and CQSD together increased the annual milled rice production in step with increases in population. Diverse rice genotypes have enabled rice to endure crop constraints in fragmented landholdings spread over 43 m ha. AICRIP’s efforts have sustained availability of &gt; 73 kg rice per capita per year (~ 40% of food grains). The process of notification, receipt of indent for BS from states, allotment and BS production, and de-notification of a cultivar by GOI need a review to ensure profits to farmers. As the 1000-seed weight varies in cultivars, it must be notified by GOI to adjust seed rate and maintain the recommended plant population at the farms. There is scope to increase the priceless BS production in cultivars to raise the country’s production further, facilitate export and ensure profits to all stakeholders.

Identifying appropriate nutrient management options is crucial for reversing the yield plateau and enhancing the nutritional status of basmati rice under the basmati rice-wheat cropping system of the Indo Gangetic Plain (IGP). Alternative to the conventional chemical fertilizer, ZnO nanoparticles as carrier material for the micronutrient Zn has shown promise in reducing the bulkiness of fertilizer use in the soil–plant environment. But whether its integration and interaction with an organic source such as green manuring could enrich basmati rice grain with micronutrients and promote protein nutrition is not well investigated. Therefore, we conducted a field experiment during the summer and rainy seasons (April–October) of 2020 and 2021 at the research farm of the ICAR-Indian Agricultural Research Institute, New Delhi in a split-plot design with two summer green manuring (SGM) options (Sesbania and cowpea, along with fallow) as main plots and six fertilization strategies as subplots: 5 kg Zn ha−1 as bulk ZnO, N at 120 kg N ha−1 as prilled urea (PU), N at 120 kg N ha−1 as PU + 5 kg Zn ha−1 as bulk ZnO, 1% bulk ZnO-coated PU, 0.1% nano ZnO coated PU and 0.2% nano ZnO coated PU replicated thrice. On average, SGM increased basmati rice grain yield by 13.2 and 12.3% during 2020 and 2021, respectively compared to fallow. Integrated application of zinc with urea significantly (p &amp;lt; 0.05) increased the grain yield of basmati rice by 9.56% and by 10.5% relative to urea without zinc and by 33.7 and 33.8% than the sole application of 5 kg Zn ha−1 through ZnO, respectively during 2020 and 2021. On average, SGM boosted Zn, Cu, Mn, and Fe content in milled rice by 25, 22.38, 20.0, and 18.85% during 2020 and 23.75, 21.4, 19.6, and 13.3% during 2021, respectively compared to fallow. Relative to sole urea application, zinc, and urea together improved the Zn and Fe content in milled rice by 2.99 mg kg−1 and 2.62 mg kg–1, respectively during the first year and by 2.83 mg kg−1 and 2.6 mg kg−1, respectively during the second year of study. The highest protein content in basmati rice grain was observed when it was grown after Sesbania aculeata residue incorporated plot during both the years and it decreased in the order: Sesbania aculeata &amp;gt; Vigna unguiculata &amp;gt; summer fallow. Our findings revealed that with the application of 1% bulk ZnO coated PU with Sesbania; the yield response, micronutrient acquisition, and protein accumulation in milled rice was higher than in other plant fertilization methods. However, in plots treated with Sesbania, along with 0.2% nano ZnO-coated PU exhibited statistically equivalent yield and micronutrient loading in edible tissues. Hence, this study unveils the critical role of nano ZnO-coated urea and summer green manuring in elevating micronutrient and protein bioavailability in basmati rice and concurrently reducing Zn dose by 20%, making it a profitable option for farmers.

To assess the effect of nutrient and residue management on the performance of zero till - direct seed rice (DSR) (Oryza sativa L.)-wheat (Triticum aestivum L.) cropping system in partially reclaimed sodic soils, a three-year field experiment was conducted at ICAR-CSSRI during kharif and rabi 2016-18. The experiment was conducted in factorial randomized block design with 8 nutrient management options as first factor and two levels of residue management as second factor with three replications. Plant height, number of tillers and effective tillers were not affected significantly both in rice and wheat due to different nutrient and residue management treatments. Under different N management practices, basmati CSR 30 showed higher physiological efficiency in terms of SPAD reading, relative water content (RWC) and photosynthetic traits under treatments with recommended dose of fertilizers (RDF) + CSR bioformulation and RDF + CSR bioformulation + top cut at 75 days after sowing. Grain yield of basmati CSR 30 was the highest under transplanted conditions (36.0 q/ha) which was 20.0-30.6% higher than different nutrient and residue management treatments under DSR. Additional Zn application and foliar Fe sprays did not increase grain yield than RDF under ZT-DSR. Residual effect of nutrient and residue management was non-significant for all the yield attributes of wheat, viz. ear length, grains/ear and 1000-grain weight as well as for grain and straw yield of wheat. This study concludes that ZT-DSR is not suitable option for replacing puddled transplanted rice.