To see the other types of publications on this topic, follow the link: Begona o`t.
Journal articles on the topic 'Begona o`t'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Begona o`t.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Isroilov, Dostonbek Rustam o'g'li, and Davronbek Mamarajab o'g'li Mamarajabov. "G'o'zada ZELLEK AGRO 10,4 % em. k. ("Awiner Agro" MCHJ QK, O'zbekiston) gerbitsidini bir va ko'p yillik boshoqli begona o'tlarga qarshi samaradorligi." JOURNAL OF SCIENCE-INNOVATIVE RESEARCH IN UZBEKISTAN 2, no. 2 (2024): 350–57. https://doi.org/10.5281/zenodo.10672397.
Full textAbstract:
GERBITSIDLAR (lot. herba – o‘t, o‘simlik va caedo — o‘ldiraman) — begona o‘tlarni yo‘qotishda qo‘llaniladigan kimyoviy moddalar. Qishloq xo‘jaligida dala, bedazor, bog‘ va tokzorlar, o‘tloqlardagi, yo‘l yoqalaridagi begona o‘tlarga qarshi qo‘llaniladi. Gerbitsidlarning bir necha xil preparat ko‘rinishlari mavjud: suvda eriydigan kukunlar (dalapon va b.), suv bilan aralashib suspenziya hosil qiluvchi kukunlar (Paxton, kotoran, kotofor, prometrin, gezagard, atrazin, agelon va b.), suv bilan aralashib emulsiya hosil qiluvchi konsentratlar (treflan, dual, banol va b.) va boshqalar
2
Xo'shboqova, Sabrina. "YERBAG'IR TUGMACHAGULI HAQIDA: INDUSTUTUKSIYASI, URUG'CHILIGI VA KO'CHATCHILIGI." ACTIVE RESEARCHER 2, no. 1 (2025): 29–33. https://doi.org/10.5281/zenodo.15376074.
Full textAbstract:
<em>Gulxayridoshlar oilasining vakilli hisoblangan tugmachagul turkumi vakillarini yer yuzining ko‘pgina mintaqalarida uchratishimiz mumkin. Ularning barchasi o‘zining morfologik tuzilishi va amaliy ahamiyatining turlicha ekanligi bilan farqlanadi. Tugmachagul turkumi sug‘oriladigan va bahorikor yerlarda keng tarqalgan bo‘lib, begona o‘t sifatida o‘sadi.</em>
3
Rustamov, Sanjar Ashiraliyevich, and Gulshanoy Muxtorjon qizi Raxmonova. "QIZIL TASMA (POLYGONUM AVICULARE L) O'SIMLIGINI BOTANIK TAVSIFI VA O'ZIGA XOS DORIVORLIK XUSUSIYATLARI." Universal International Scientific Journal 2, no. 4 (2025): 308–13. https://doi.org/10.5281/zenodo.15352112.
Full textAbstract:
Torondoshlar turkumi vakili hisoblangan qushtaron o’simligini yer yuzida hamma mintaqalarda uchratishimiz mumkin. Ularning barchasi o’zining morfologik tuzilishi dorivorlik xususiyati va amaliy ahamiyati turlicha ekanligi bilan farq qiladi. Qushtaron (Polygonum aviculare L) o’simligi daryolar, yo’l yoqalari, asosan zich tuproqlarda tarqalgan bo’lib, begona o’t sifatida o’sadi. Iyuldan kech kuzgacha gullab meva tugadi. Ushbu maqolada o’simlikning o’ziga xos dorivorlik xususiyatlari, kimyoviy tarkibi biologik faol moddalar haqida keltirilgan
4
Norquziyeva, Madina Sharof qizi Raximova Rayxona Nizamaddinovna. "TUGMACHAGUL (MALVA) TURKUMI O'SIMLIKLARINING BOTANIK TAVSIFI." International Journal of Education, Social Science & Humanities. Finland Academic Research Science Publishers 11, no. 5 (2023): 541–46. https://doi.org/10.5281/zenodo.7935365.
Full textAbstract:
<em>Gulxayridoshlar oilasining vakilli bo</em><em>ʻ</em><em>lgan tugmachagul turkumi vakillarini yer yuzining ko</em><em>ʻ</em><em>plab mintaqalarda uchratishimiz mumkin.Tugmachagul turkumi sug</em><em>’</em><em>oriladigan va bahorikor yerlarda keng tarqalgan bo</em><em>’</em><em>lib begona o</em><em>’</em><em>t sifatida sifatida o</em><em>’</em><em>sadi. Aprel- sentabr oylarida gullab meva beradi.Bu oila vakillari gulkosachasi 5 ta va 5 tagultojbarglari borliligi bilan ajralib turadi. O’zbekistonda uning Malva neglecta, M. mauritana, M. silvestris, M.bucharica singari turlari keng tarqalgan.</em>
5
Fitriani, Linna, Reny Dwi Riastuti, and Destien Atmi Arisandy. "Perbedaan Media Tanam Limbah Kulit Buah Kolang Kaling dan Kulit Kopi terhadap Pertumbuhan Tanaman Begonia." BIOEDUSAINS:Jurnal Pendidikan Biologi dan Sains 4, no. 2 (2021): 502–7. http://dx.doi.org/10.31539/bioedusains.v4i2.2621.
Full textAbstract:
This study aims to determine the differences in the planting media of kolang kaling fruit peel waste and coffee skin on the height, number of leaves and leaf width of begonia plants. The method used in this research is a quantitative experimental method with two treatments of growing media, namely the waste of kolang kaling fruit peel and coffee rind waste. Data collection techniques using observation sheets. The results of observations on the growth of begonias were analyzed using independent t-test. The results showed that there was a difference in begonia plant height with the value of Sig. of 0.648. The number of begonia plant leaves obtained the value of Sig. by 0.007 and the width of the leaves of begonia plants by 0.309. In conclusion, there are differences in the use of planting media for waste skin of kolang kaling fruit and coffee husk waste planting media on the number of leaves on begonia plants.
 Keywords: Planting Media, Begonia Growth
6
Gilbertz, David A. "VARIETAL RESPONSE OF LANDSCAPE ANNUALS TO GREENHOUSE-APPLIED TRIAZOLE GROWTH REGULATORS." HortScience 27, no. 6 (1992): 634c—634. http://dx.doi.org/10.21273/hortsci.27.6.634c.
Full textAbstract:
Seven to 9 cvs each of Begonia semperflorens, Tagetes erecta, T. patula, and Petunia hybrida (grandiflora and multiflora types) were sown into seedling trays. One to 3 weeks after transplanting to flats (75 cm3/cell), paclobutrazol (PB) was sprayed at concentrations of 10 (begonia), 60 (marigold) or 100 (petunia) mg liter-1 at a 200 ml m-2 rate. Uniconazole (UC) was applied at one-half the PB concentrations. Plant height was measured before planting in the field May 17 and monthly through July. Species were analyzed separately and generally, there were no cultivar by triazole interactions. During the greenhouse phase, the triazoles controlled height of both marigold species compared to control, but in July the PB and UC treated plants were 100 and 91%, respectively, of control plant height. Flowering was delayed up to 4 days for UC treated T. patula plants. Height of triazole-treated petunias was 60-67% of control height during the greenhouse phase and 84-95% after 2 months in the field. Begonia height was reduced by triazoles during both phases. After 2 months in the field, PB and UC treated begonias were 72 and 44%, respectively, of control plant height.
7
Michel, T., Y.-H. Tseng, H. P. Wilso, K.-F. Chung, and C. A. Kidner. "A HYBRID CAPTURE BAIT SET FOR BEGONIA." Edinburgh Journal of Botany 79, no. 409 (2022): 1–33. https://doi.org/10.24823/EJB.2022.409.
Full textAbstract:
Michel, T., Tseng, Y.-H., Wilso, H. P., Chung, K.-F., Kidner, C. A. (2022): A HYBRID CAPTURE BAIT SET FOR BEGONIA. Edinburgh Journal of Botany 79 (409): 1-33, DOI: 10.24823/EJB.2022.409, URL: http://dx.doi.org/10.24823/ejb.2022.409
8
Tandang, Danilo N., Rosario R. Rubite, Jr Raul T. Angeles, and Guzman Margaret C. De. "Begonia titoevangelistae (sect. Baryandra, Begoniaceae) a new species from Catanduanes Island, the Philippines." Phytotaxa 282, no. 4 (2016): 273–81. https://doi.org/10.11646/phytotaxa.282.4.4.
Full textAbstract:
Tandang, Danilo N., Rubite, Rosario R., Angeles Jr, Raul T., De Guzman, Margaret C. (2016): Begonia titoevangelistae (sect. Baryandra, Begoniaceae) a new species from Catanduanes Island, the Philippines. Phytotaxa 282 (4): 273-281, DOI: 10.11646/phytotaxa.282.4.4, URL: http://dx.doi.org/10.11646/phytotaxa.282.4.4
9
Deb, PK, and MA Rahman. "Present state of knowledge on the family Begoniaceae CA Agardh (Magnoliopsida) of Bangladesh." Journal of Biodiversity Conservation and Bioresource Management 4, no. 1 (2018): 35–46. http://dx.doi.org/10.3329/jbcbm.v4i1.37875.
Full textAbstract:
The inventory and assessment of species diversity in the mono-generic family Begoniaceae C. A. Agardh of Bangladesh were made through long term field investigations, collections, identification, survey and examination of preserved herbarium specimens and review of relevant taxonomic and floristic literature. The family is recognized to be represented in the flora of Bangladesh by 19 species under the genus Begonia L. Of these, 11 species were known to be previously recorded from the area of Bangladesh, hence additional 8 species of the present account are being reported here for the first time as new records from Bangladesh, these are: Begonia grandis Dryand. ssp. holostylla Irmsch. , B. heracleifolia Cham. and Schltdl. Cult., B. maculata Raddi Cult. B. modestiflora Kurz, B. muliensis T. T. Yu. Cult., B. scintillans Dunn, B. surculigera Kurz and B. thomsonii A. DC. An enumeration of these 19 species is prepared, and each species is cited with detailed taxonomic data. All species of the Begonia L. are herbaceous in nature and possess potential economic values, viz. 11 (52%) medicinal, 5 (24%) ornamental, 3 (14%) beverage, 1 (5%) food and 1 (5%) poisonous. Determination of status of occurrence showed that 2 (10.53%) species are common, 5 (26.32%) cultivated, 9 (47.36%) threatened and 3 (15.79%) possibly extinct in Bangladesh. Field photographs and hand drawings of recorded taxa are provided.J. Biodivers. Conserv. Bioresour. Manag. 2018, 4(1): 35-46
10
Tu, Wen-Hui, Bing-Mou Wang, Yi Huang, Gang Yao, Jiu-Xiang Huang, and Yu-Ling Li. "Begonia guangdongensis, a new species of Begonia (Begoniaceae) from Guangdong, China." PhytoKeys 162 (October 7, 2020): 29–36. http://dx.doi.org/10.3897/phytokeys.162.51913.
Full textAbstract:
A new species of Begonia section Coelocentrum, B. guangdongensis W.H. Tu, B.M. Wang &amp; Y.L. Li from Guangdong Province, China, is described and illustrated here. Morphologically, the new species is most similar to B. biflora T. C. Ku and B. longistyla Y. M. Shui &amp; W. H. Chen, but differs from B. biflora by its rugose leaves and glabrous capsules and from B. longistyla by its glabrous stipules without ciliate margin, densely hirsute-pilose leaves and obtuse apex of bracts. Additionally, it is also somewhat similar to B. chongzuoensis Yan Liu, S. M. Ku &amp; C.-I Peng, but there are significant distinctions in their stipules, leaves and bracts. The conservation status of B. guangdongensis is assessed as Critically Endangered (CR), according to the IUCN Red List Categories and Criteria.
11
Tu, Wen-Hui, Bing-Mou Wang, Yi Huang, Gang Yao, Jiu-Xiang Huang, and Yu-Ling Li. "Begonia guangdongensis, a new species of Begonia (Begoniaceae) from Guangdong, China." PhytoKeys 162 (October 7, 2020): 29–36. https://doi.org/10.3897/phytokeys.162.51913.
Full textAbstract:
A new species of Begonia section Coelocentrum, B. guangdongensis W.H. Tu, B.M. Wang & Y.L. Li from Guangdong Province, China, is described and illustrated here. Morphologically, the new species is most similar to B. biflora T. C. Ku and B. longistyla Y. M. Shui & W. H. Chen, but differs from B. biflora by its rugose leaves and glabrous capsules and from B. longistyla by its glabrous stipules without ciliate margin, densely hirsute-pilose leaves and obtuse apex of bracts. Additionally, it is also somewhat similar to B. chongzuoensis Yan Liu, S. M. Ku & C.-I Peng, but there are significant distinctions in their stipules, leaves and bracts. The conservation status of B. guangdongensis is assessed as Critically Endangered (CR), according to the IUCN Red List Categories and Criteria.
12
Rubite, R. R., D. B. H. Ubaldo, J. C. Salcedo, et al. "BEGONIA HEMICARDIA (SECT. PETERMANNIA, BEGONIACEAE), A RESURRECTED HETEROTYPIC SYNONYM AND NOMEN NUDUM." Edinburgh Journal of Botany 79, no. 403 (2022): 1–7. https://doi.org/10.24823/EJB.2022.403.
Full textAbstract:
Rubite, R. R., Ubaldo, D. B. H., Salcedo, J. C., Chung, K.-F., Evangelista, L. T., Tandang, D. N., Hughes, M. (2022): BEGONIA HEMICARDIA (SECT. PETERMANNIA, BEGONIACEAE), A RESURRECTED HETEROTYPIC SYNONYM AND NOMEN NUDUM. Edinburgh Journal of Botany 79 (403): 1-7, DOI: 10.24823/EJB.2022.403, URL: http://dx.doi.org/10.24823/ejb.2022.403
13
Rubite, Rosario R., Ching-I. Peng, Kuo-Fang Chung, et al. "Three new species of Begonia (section Baryandra, Begoniaceae) from Luzon Island, the Philippines." Phytotaxa 347, no. 3 (2018): 201–12. https://doi.org/10.11646/phytotaxa.347.3.1.
Full textAbstract:
Rubite, Rosario R., Peng, Ching-I, Chung, Kuo-Fang, Lin, Che-Wei, Evangelista, Luisito T., Tandang, Danilo N., Callado, John Rey C., Hughes, Mark (2018): Three new species of Begonia (section Baryandra, Begoniaceae) from Luzon Island, the Philippines. Phytotaxa 347 (3): 201-212, DOI: 10.11646/phytotaxa.347.3.1, URL: http://dx.doi.org/10.11646/phytotaxa.347.3.1
14
Karlsson, Meriam G. "Leaf Unfolding Rate in Begonia × hiemulis." HortScience 27, no. 2 (1992): 109–10. http://dx.doi.org/10.21273/hortsci.27.2.109.
Full textAbstract:
The rate of leaf unfolding as a function of temperature was determined for Begonia × hiemalis Fotsch under long-day (16 hours of light) conditions before flower initiation. Irradiance was maintained at 280 ± 20 μmol·m–2·s–1 (16.1 mol·m–2·day–l). The two cultivars Hilda and Ballet had similar rates of leaf unfolding in the range from 13 to 28C. The rate increased to a maximum of 0.116 leaves/day at 21C and then decreased at higher temperature. The following quadratic function (where T is the temperature in °C) was selected to describe initial long-day leaf unfolding rate in B. × hiemalis: leaves/day = -0.2083 + 0.03145 × T – 0.0007631 × T2, (r2 = 0.97). The leaf unfolding response to temperature varied for plants of `Hilda' and `Ballet' during short days (10 hours of light) following the initial long-day period. Plants of `Ballet' continued to unfold leaves at a similar rate as under initial long photoperiods, while the leaf unfolding rate for `Hilda' decreased to half the rate observed under long days.
15
Tseng, Y.-H., C. L. Hsieh, L. Campos-Domínguez, et al. "Additional file 1 of Comparative chloroplast genomics reveals the phylogeny and the adaptive evolution of Begonia in China." Edinburgh Journal of Botany 79, no. 408 (2022): 1–32. https://doi.org/10.24823/EJB.2022.408.
Full textAbstract:
Tseng, Y.-H., Hsieh, C. L., Campos-Domínguez, L., Hu, A. Q., Chang, C. C., Hsu, Y. T., Kidner, C. A., Hughes, M., Moonlight, P. W., Hung, C. H., Wang, Y. C., Wang, Y. T., Liu, S. H., Girmansyah, D., Chung, K.-F. (2022): Additional file 1 of Comparative chloroplast genomics reveals the phylogeny and the adaptive evolution of Begonia in China. Edinburgh Journal of Botany 79 (408): 1-32, DOI: 10.24823/EJB.2022.408, URL: http://dx.doi.org/10.6084/m9.figshare.24452402.v1
16
Ganzeboom, Harry B. G. "De Nederlandse sociologie begint bij (’t) Steinmetz." Mens & Maatschappij 97, no. 3 (2022): 295–98. http://dx.doi.org/10.5117/mem2022.3.008.ganz.
Full text
17
Tian, X., Y. Zheng, K. Chintaluri, and B. Meng. "First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada." Plant Disease 97, no. 2 (2013): 291. http://dx.doi.org/10.1094/pdis-09-12-0868-pdn.
Full textAbstract:
Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5′CCAAGCTCAACATGTTTAGC 3′, nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5′ACTGCATCTTGCCTATCCTT 3′, nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.
18
Dadley-Moore, Davina. "The journey begins for αβ and γδ T cells". Nature Reviews Immunology 6, № 3 (2006): 168–69. http://dx.doi.org/10.1038/nri1812.
Full text
19
Marx, J. "The T cell receptor begins to reveal its many facets." Science 267, no. 5197 (1995): 459–60. http://dx.doi.org/10.1126/science.7824945.
Full text
20
Schmid, Peter, Piotr Wysocki, Yeon H. Park, et al. "Abstract PD11-08: PD11-08 Trastuzumab deruxtecan (T-DXd) + durvalumab (D) as first-line (1L) treatment for unresectable locally advanced/metastatic hormone receptor-negative (HR−), HER2-low breast cancer: updated results from BEGONIA, a phase 1b/2 study." Cancer Research 83, no. 5_Supplement (2023): PD11–08—PD11–08. http://dx.doi.org/10.1158/1538-7445.sabcs22-pd11-08.
Full textAbstract:
Abstract Background: Patients with HR− advanced/metastatic breast cancer (a/mBC) with a low level of HER2 (immunohistochemistry [IHC] score 1+ or IHC 2+ and negative in situ hybridization [ISH]) have poor prognosis. Combining 1L chemotherapy with immune checkpoint inhibitors can modestly improve outcomes vs chemotherapy alone, but treatment benefit is largely seen in patients with PD-L1+ disease. BEGONIA (NCT03742102) is an ongoing 2-part, open-label platform study, evaluating safety and efficacy of D, an anti–PD-L1 antibody, combined with other novel therapies in 1L triple-negative a/mBC, including HR−, HER2-low disease. T-DXd is a trastuzumab-topoisomerase I inhibitor antibody-drug conjugate that improves survival in patients with previously treated HR−, HER2-low mBC (NCT03734029; Modi NEJM 2022). Here, we report updated results of the T-DXd + D combination from BEGONIA. Methods: Patients with unresectable HR−, HER2-low (per local testing, IHC 2+/ISH−, IHC 1+/ISH−, or IHC 1+/ISH untested) a/mBC were enrolled in the T-DXd + D arm. Patients eligible for 1L treatment, regardless of PD-L1 status, received intravenous T-DXd 5.4 mg/kg + D 1120 mg every 3 weeks until progression or unacceptable toxicity. PD-L1, assessed using the VENTANA PD-L1 (SP263) Assay, was defined as high if ≥ 5% of the tumor area was populated by PD-L1–expressing tumor or immune cells. Primary endpoints were safety and tolerability. Secondary endpoints included investigator-assessed objective response rate (ORR; RECIST v1.1); progression-free survival [PFS]; and response duration. Patients included in the efficacy analysis had ≥ 2 on-treatment disease assessments, progressed, died, or withdrew from the study. Results: As of April 8, 2022, 56 patients received T-DXd + D (34 ongoing) and 46 were included in the efficacy analysis. Median (range) follow-up was 10.1 (0–22) months. Median age was 53.5 years, 71% had received prior treatment for early stage BC, and 64% had visceral metastases at baseline. Confirmed ORR was 26/46 (57%; 95% CI, 41–71) and unconfirmed ORR was 33/54 (61%; 95% CI, 47–74); 1/46 patients (2%) had complete and 25/46 (54%) had partial responses. Confirmed response occurred irrespective of PD-L1 expression (PD-L1 high ORR, 5/7 [71%]; PD-L1 low, 13/21 [62%]; PD-L1 missing, 8/18 [44%]). Median duration of response was not reached; however, 64% of patients remained in response at 12 month follow-up and 73% had an ongoing response at data cutoff. Median PFS was 12.6 months (95% CI, 8–not reached). Adverse events (AEs) were consistent with the agents’ known safety, with treatment-related AEs occurring in 49 patients (88%), any Grade 3/4 AEs in 18 patients (32%), and any serious AEs in 10 patients (18%). The most common all-Grade AEs were nausea (41 [73%]), fatigue (26 [46%]), and vomiting (17 [30%]). Adjudicated treatment-related interstitial lung disease/pneumonitis occurred for 5 patients (9%), which were mostly Grade 1 or 2 and 1 case of Grade 5 associated with COVID pneumonia. Seven patients (13%) and 21 patients (38%) had T-DXd dose reduction and dose delay, respectively; 22 (39%) had D dose delay. Seven patients (13%) discontinued treatment due to AEs. Conclusions: For patients with HR−, HER2-low a/mBC, T-DXd in combination with D in the 1L setting shows manageable safety and promising efficacy including durable responses and an encouraging PFS. Although subgroups were small, responses were observed irrespective of PD-L1 expression. Analysis of additional translational data is ongoing. Funding: AstraZeneca/Daiichi Sankyo Citation Format: Peter Schmid, Piotr Wysocki, Yeon H. Park, Jacek Jassem, Kyung Hae Jung, Simon Lord, Robert Huisden, Ross Stewart, Petra Vuković, Ana T. Nunes, Zbigniew Nowecki. PD11-08 Trastuzumab deruxtecan (T-DXd) + durvalumab (D) as first-line (1L) treatment for unresectable locally advanced/metastatic hormone receptor-negative (HR−), HER2-low breast cancer: updated results from BEGONIA, a phase 1b/2 study [abstract]. In: Proceedings of the 2022 San Antonio Breast Cancer Symposium; 2022 Dec 6-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2023;83(5 Suppl):Abstract nr PD11-08.
21
Andrzejak, Roman, Beata Janowska, Beata Reńska, and Tomasz Kosiada. "Effect of Trichoderma spp. and Fertilization on the Flowering of Begonia × tuberhybrida Voss. ‘Picotee Sunburst’." Agronomy 11, no. 7 (2021): 1278. http://dx.doi.org/10.3390/agronomy11071278.
Full textAbstract:
The aim of the study was to assess the influence of Trichoderma spp. and different fertilization levels on the flowering and nutritional status of Begonia × tuberhybrida Voss. ‘Picotee Sunburst’ plants. Before planting, the tubers were soaked in water or a mixture of spore of Trichoderma spp. (T. viride Schumach–Tv14, T. harzianum Rifai–Thr2, T. hamatum/Bonord/Bainier–Th15) in the form of a suspension for 24 h. The plants were fertilized every 7 days with the multi-component Peters Professional Allrounder fertilizer (20:20:20 + microelements) at a concentration of 0.0%, 0.2%, and 0.3%. Trichoderma spp. accelerated the flowering of the ‘Picotee Sunburst’ cultivar by 2.7–8.7 days, stimulated the development of buds and flowers in the plants and affected their size. The plants bloomed most intensively and had the biggest flowers after the treatment with the 0.3% fertilizer. Trichoderma spp. and the fertilization had no effect on the height of the plants and the number of shoots regardless of the fertilizer concentration, but they stimulated the development of leaves. Trichoderma spp. stimulated the production of chlorophyll. They did not affect the uptake of macroelements, but they stimulated the uptake of microelements (Zn, Fe, and B). The higher the fertilizer concentration was, the higher was the content of microelements in the plants.
22
Akbar, Akbar, Ardiansyah Ali, and Nursyam AR. "PENGARUH KEPUASAN KERJA DAN MOTIVASI KERJA TERHADAP KINERJA PEGAWAI PADA KANTOR SAMSAT MAKASSAR." Indonesian Journal of Business Economics and Management 2, no. 1 (2023): 33–41. https://doi.org/10.57152/ijbem.v2i1.660.
Full textAbstract:
Penelitian pengaruh kepuasan kerja dan motivasi kerja terhadap kinerja pegawai kantor SAMSAT Makassar, untuk mengetahui variabel manakah yang berpengaruh secara dominan diantara dua variabel kepuasan kerja dan motivasi kerja terhadap kinerja pegawai pada kantor SAMSAT Makassar. Penelitian ini menggunakan metode kualitatif dengan metode kuantitatif yang menggunakan 4 rumus yaitu analisis regresi beganda, Uji T-test, Uji F, Uji T (uji parsial) dengan bantuan software SPSS 16.0 for windows Adapun sampel yang digunakan adalah metode purposive sampling yaitu dengan memilih lansung seluruh pegawai sebanyak 44 orang. Pengumpulan data yang digunakan dengan memberikan kuesioner kepada pengawai sesuai dengan penelitian, dari penelitian ini menunjukkan bahwa faktor yang paling berpengaruh terhadap kinerja pegawai adalah faktor motivasi kerja. Hal ini dapat dilihat dari nilai t hitung, motivasi kerja lebih besar >t hitung kepuasan kerja (0,370>0,301).
23
Derridj, Amel, Khadidja Ouzegane, Jean-Robert Kienast, and Djelloul Belhaı̈. "P–T–X evolution in garnet pyroxenites from Tin Begane (Central Hoggar, Algeria)." Journal of African Earth Sciences 37, no. 3-4 (2003): 257–68. http://dx.doi.org/10.1016/j.jafrearsci.2003.05.006.
Full text
24
Muhammadinah, Muhammadinah. "KETIMPANGAN PEMBANGUNAN DI PULAU SULAWESI." Jurnal Riset Ilmu Ekonomi 3, no. 2 (2023): 64–75. http://dx.doi.org/10.23969/jrie.v3i2.57.
Full textAbstract:
Tujuan dari penelitian ini guna melihat pengaruh IPM dan tingkat kemiskinan terhadap ketimpangan pembangunan di Pulau Sulawesi. Populasi semua propinsi yang terdapat di Pulau Sulawesi sebanyak 6 Propinsi dimana semua diambil sebagai sampel dengan periode penelitian selama 12 tahun dari tahun 2011 – 2022. Pengujian hipotesis menggunakan regresi beganda dengan t-test dan F-test melalui program eviews. Hasil yang diperoleh secara parsial IPM memiliki pengaruh atas ketimpangan pembangunan sedangkan kemiskinan tidak memiliki pengaruh atas ketimpangan pembangunan. Namun secara bersamaan IPM dan tingkat kemiskinan memiliki pengaruh atas ketimpangan pembangunan.
25
McDonnell, Alison M., Bruce W. S. Robinson, and Andrew J. Currie. "Tumor Antigen Cross-Presentation and the Dendritic Cell: Where it All Begins?" Clinical and Developmental Immunology 2010 (2010): 1–9. http://dx.doi.org/10.1155/2010/539519.
Full textAbstract:
Dendritic cells (DCs) are professional antigen-presenting cells (APCs) that are critical for the generation of effective cytotoxic T lymphocyte (CTL) responses; however, their function and phenotype are often defective or altered in tumor-bearing hosts, which may limit their capacity to mount an effective tumor-specific CTL response. In particular, the manner in which exogenous tumor antigens are acquired, processed, and cross-presented to CD8 T cells by DCs in tumor-bearing hosts is not well understood, but may have a profound effect on antitumor immunity. In this paper, we have examined the role of DCs in the cross-presentation of tumor antigen in terms of their subset, function, migration, and location with the intention of examining the early processes that contribute to the development of an ineffective anti-tumor immune response.
26
Najar, Basma, Ylenia Pieracci, Filippo Fratini, et al. "Exploring the Volatile Composition and Antibacterial Activity of Edible Flower Hydrosols with Insights into Their Spontaneous Emissions and Essential Oil Chemistry." Plants 13, no. 8 (2024): 1145. http://dx.doi.org/10.3390/plants13081145.
Full textAbstract:
In the circular economy framework, hydrosols, by-products of the essential oil industry, are gaining attention for their potential in waste reduction and resource reuse. This study analyzed hydrosols from six edible flowers, investigating their chemical composition (VOC-Hyd) and antibacterial properties alongside volatile organic compounds of fresh flowers (VOC-Fs) and essential oils (EOs). Antirrhinum majus exhibited ketones as major VOC-Fs (62.6%) and VOC-Hyd (41.4%), while apocarotenoids dominated its EOs (68.0%). Begonia cucullata showed alkanes (33.7%) and aldehydes (25.7%) as primary VOC-Fs, while alkanes were prevalent in both extracts (65.6% and 91.7% in VOC-Hyd and in EOs, respectively). Calandula officinalis had monoterpenoids in VOC-Fs and VOC-Hyd (89.3% and 49.7%, respectively), while its EOs were rich in sesquiterpenoids (59.7%). Dahlia hortensis displayed monoterpenoid richness in both VOC-Fs and extracts. Monocots species’ VOC-Fs (Polianthes tuberosa, Tulbaghia cominsii) were esters-rich, replaced by monoterpenoids in VOC-Hyd. P. tuberosa EO maintained ester richness, while T. cominsii EOs contained a significant percentage of sulfur compounds (38.1%). Antibacterial assays indicated comparable minimum inhibitory concentration profiles across VOC-Hyd: B. calcullata and P. tuberosa against Staphylococcus aureus and Salmonella enterica ser. typhimurium, T. cominsii against Escherichia coli and S. enterica, A. majus and C. officinalis against S. aureus, and D. hortensis against S. enterica.
27
Pérez Bernabeu, B. "How to Determine the Existence of a Tax Advantage · Case T-865/16 F.C. Barcelona · Annotation by Begoña Pérez Bernabeu." European State Aid Law Quarterly 18, no. 3 (2019): 377–81. http://dx.doi.org/10.21552/estal/2019/3/17.
Full text
28
Ottu, Frengky Harim Ronaldo, Florianus Aloysius Nay, Osniman Paulina Maure, Sefri Imanuel Fallo, and Kamelia Mauleto. "Analisis Faktor-Faktor yang Mempengaruhi Permintaan Volume Air pada PDAM Kota Kupang." Leibniz: Jurnal Matematika 2, no. 2 (2022): 23–34. http://dx.doi.org/10.59632/leibniz.v2i2.178.
Full textAbstract:
Tulisan ini membahas tentang Analisis Regresi Linear Beganda. Untuk menganalisis pengaruh pendapatan rumah tangga (X1), jumlah anggota keluarga (X2)dan tarif air PDAM (X3) terhadap permintaan volume air pada PDAM Kota Kupang (Y). Setelah itu melakukan Analisa data kuantitatif meliputi, uji validitas, uji asumsi klasik, analisis regresi linear berganda, pengujian hipotesis dengan uji t dan uji F, serta analisis Koefisien Determinan (R2). Data-data yang sudah diuji menghasilkan persamaan regresi linear sebagai berikut: Y = 18474,335 - 770,685X1 + 256,091X2 - 55,197X3. Pengujian hipotesis menggunakan uji t menunjukan bahwa dari variabel X1, X2, dan X3 (Variabel Bebas) yang diteliti tidak terbukti secara signifikan mempengaruhi variabel Y (Variabel Terikat). Kemudian melakukan uji F menunjukan bahwa variabel X1, X2, dan X3 (Variabel Bebas) memang layak untuk menguji variabel Permintaan Volume Air pada PDAM. Angka Adjusted R Square sebesar 0,066 menunjukan bahwa 6,6% variasi Permintaan Volume Air pada PDAM dapat dijelaskan oleh variabel X dalam persamaan regresi. Sedangkan sisanya 93.4% dijelaskan oleh variabel lainnya yang tidak diteliti dalam penelitian ini.
29
Mila Mulya Sari, Titin Agustin Nengsih, and Ahmad Sayhrizal. "Pengaruh Literasi Keuangan Dan Gaya Hidup Terhadap Perilaku Konsumtif Mahasiswa Manajemen Keuangan Syariah Angkatan 2018-2019." Journal of Creative Student Research 1, no. 2 (2023): 137–51. http://dx.doi.org/10.55606/jcsrpolitama.v1i2.1165.
Full textAbstract:
Penelitian ini bertujuan untuk menegetahui bagaimana pengaruh literasi keuangan dan gaya hidup terhadap perilaku konsumtif mahasiswa manajemen keuangan syariah angkatan 2018-2019. Metode yang digunakan dalam penelitian ini adalah metode kuantitatif, dan metode analisis data yang digunakan adalah uji koefisien determinaasi. Sampel pada penelitian ini sebanyak 66 sampel mahasiswa Manajemen Keuangan Syariah angkatan 2018-2019, dengan menyebarkan kuesioner skala likert. Analisis data yang digunakan adalah analisis linear beganda. Hasil penelitian ini menunjukkan dalam uji t masing-masing variable literasi keuangan dan gaya hidup secara parsial berpengaruh positif dan signifikan terhadap perilaku konsumtif. Pada hasil uji F menunjukkan bahwa literasi keuangan dan gaya hidup secara simultan berpengaruh positif dan signifikan terhadap perilaku konsumtif mahasiswa.
30
BEGENAT NEUSCHAEFER, Anne. "Temps narré et temps existentiel dans Œdipe sur la route d’Henry Bauchau." Revue internationale Henry Bauchau. L’écriture à l’écoute, no. 1 (January 1, 2008): 53–66. http://dx.doi.org/10.14428/rihb.v0i1.16783.
Full textAbstract:
Anne Begenat-Neuschaefer présente dans cet article une réflexion sur le traitement de la temporalité dans le roman Œdipe sur la route. Il faut que le lecteur suive l’auteur dans le labyrinthe imaginaire de la pré-histoire et accepte l’effacement de la temporalité. Ainsi gagne-t-il, en arpentant le chemin, un nouvel ordre temporel souverain en se donnant lui-même le temps que Bauchau prit pour l’écriture d’Œdipe sur la route. Se donner du temps, c’est le grand don qu’on doit se faire, celui qu’attend l’inconscient pour prendre confiance et se manifester. Le véritable hypotexte est l’inconscient que le poète ne peut rencontrer que dans un acte de liberté établissant confiance et liberté.
31
Pérez Bernabeu, B. "Football Glory, Credit Crisis and State’s Paternalism · Case T-766/16 Hércules CF v European Commission · Annotation by Begoña Pérez Bernabeu." European State Aid Law Quarterly 18, no. 4 (2019): 549–54. http://dx.doi.org/10.21552/estal/2019/4/12.
Full text
32
Grubbs, Robert H. "Olefin Metathesis: A Powerful Reaction Begins to Reach Its Potential." Advanced Synthesis & Catalysis 344, no. 6-7 (2002): 569. http://dx.doi.org/10.1002/1615-4169(200208)344:6/7<569::aid-adsc569>3.0.co;2-t.
Full text
33
Haustein, Jens, Christa Jansohn, Barbara Kuhn, and Manfred Lentzen. ""Man schwimmt zwischen zwei Welten". Identität und Akkulturation in Ella Hoffmanns Briefen aus Patagonien." Archiv fur das Studium der neueren Sprachen und Literaturen 260, no. 1 (2023): 19–35. https://doi.org/10.37307/j.1866-5381.2023.01.03.
Full textAbstract:
1923 brach Ella Hoffmann mit ihren drei Töchtern nach Patagonien auf, um ihrem bereits 1919 ausgewanderten Mann, Hermann Brunswig, zu folgen. Noch bevor das Schiff in Hamburg vor Anker ging, begann Hoffmann einen Briefwechsel mit ihrer Mutter in Lübeck, der bis 1929, dem Jahr ihrer vorübergehenden Rückkehr nach Deutschland, anhalten sollte. Die Briefe spiegeln die Schwierigkeiten des komplexen Anpassungsprozesses wider und stellen damit ein Instrument der schriftlichen kulturellen Assimilation dar. Sie lesen sich wie ein Tagebuch, das nicht nur Hoffmanns emotionale Irrungen und Wirrungen aufzeigt, sondern auch das Leben und die Sitten an diesem abgelegenen und unwirtlichen Ort aus der Sicht einer Frau detailliert beschreibt. Durch die Symbiose der Korrespondenz der Mutter mit den Erinnerungen der Tochter Maria, die sechzig Jahre später beschließt, die außergewöhnliche Familiengeschichte durch die Veröffentlichung der Briefe zu dokumentieren, entsteht ein interkultureller Text, der sowohl reiseliterarische als auch geschlechtsspezifische Aspekte aufwirft und damit ein bemerkenswertes Zeugnis der Rolle der reisenden Frau in der Gesellschaft und in der Literatur darstellt.
34
Schmid, Peter, Seock-Ah Im, Anne Armstrong, et al. "BEGONIA: Phase 1b/2 study of durvalumab (D) combinations in locally advanced/metastatic triple-negative breast cancer (TNBC)—Initial results from arm 1, d+paclitaxel (P), and arm 6, d+trastuzumab deruxtecan (T-DXd)." Journal of Clinical Oncology 39, no. 15_suppl (2021): 1023. http://dx.doi.org/10.1200/jco.2021.39.15_suppl.1023.
Full textAbstract:
1023 Background: Chemotherapy with immune checkpoint inhibitors can improve outcomes vs chemotherapy alone in patients (pts) with metastatic TNBC; however, many still have poor clinical outcomes. BEGONIA is an ongoing 2 part, multicenter, multiarm, open-label platform study evaluating safety and efficacy of D (anti–PD-L1)+P and D±P combined with novel therapies as first-line (1L) treatment for metastatic TNBC (NCT03742102). We report initial results from Part 1 of Arm 1, D+P, and Arm 6, D+T-DXd, an antibody-drug conjugate comprising an anti-HER2 antibody, tetrapeptide-based cleavable linker, and topoisomerase I inhibitor payload. Methods: Eligible pts had untreated unresectable locally advanced or metastatic TNBC. Pts with HER2-low–expressing tumors (IHC 2+/ISH–, IHC 1+/ISH–, or IHC 1+/ISH untested) per local testing were assigned to the D+T-DXd arm. Pts received D (1500 mg IV Q4W)+P (90 mg/m2 IV Day 1, 8, 15 Q4W) in Arm 1 and D (1120 mg IV)+T-DXd (5.4 mg/kg IV) Q3W in Arm 6, until progression or unacceptable toxicity. Primary objectives are safety and tolerability. Secondary endpoints include objective response rate (ORR), duration of response (DoR), and progression-free survival (PFS). Tumors were assessed Q8W (D+P) or Q6W (D+T-DXd). The first 6 pts treated with D+T-DXd were evaluated for dose-limiting toxicities (DLTs), with additional pts enrolled if D+T-DXd was tolerated. Study arms are noncomparable due to differing eligibility criteria, treatments, and data maturity. Results: Arm 1 D+P (data cutoff Sep 2020): 23 pts received D+P (7 ongoing); 2 discontinued D+P due to AEs. Median follow-up time was 16.6 (range 8.5–19.8) mos. Any Grade 3/4 AEs and SAEs were experienced by 10 (44%) and 1 (4%) pts, respectively. D dose was delayed for 7 (30%) pts. Confirmed ORR was 13/23 (57%) with 54% of those remaining in response at 12 mos (median DoR not reached). Median PFS was 7.3 (95% CI 5.4–13.8) mos in the D+P arm. Arm 6 D+T-DXd (data cutoff Nov 2020): 11 pts received D+T-DXd to date (all ongoing). Median follow-up time was 2.3 (0–6) mos. Any Grade 3/4 AEs and SAEs were experienced by 4 (36%) and 1 (9%) pts, respectively. Pts who received D+T-DXd had no DLTs and 1 had a Grade 1 troponin increase. D dose was delayed and T-DXd dose reduced for 2 (18%) pts each. Confirmed ORR was 4/4 (100%; only 4 pts had the opportunity to complete 2 on-treatment disease assessments) with all 4 remaining in response at data cutoff (median DoR not reached). Conclusions: D+P demonstrated a tolerable safety profile and response rate as expected for a 1L TNBC IO/taxane combination. D+T-DXd showed promising early safety and efficacy in 1L HER2-low–expressing TNBC; pt evaluation and enrollment for D+T-DXd are ongoing. D+T-DXd data will be updated and the impact of PD-L1 expression in both arms will be examined. Clinical trial information: NCT03742102 .
35
Rajendra, Basaula, Singh Om Prakash, and Dahal and Bhagawan Raj. "Abundance and diversity of waterbirds around the Begnas Lake of Pokhara Valley, Nepal." Global Journal of Ecology 8, no. 1 (2023): 011–18. http://dx.doi.org/10.17352/gje.000076.
Full textAbstract:
We studied the seasonal abundance and diversity of waterbirds around the Begnas lake of Pokhara Valley. The status of waterbirds in Begnas wetland is not documented so; we monitored the waterbirds using the point count method in 12 different plots around the lake and compared the seasonal abundance and diversity during the 2019 Summer and 2020 winter with 24 hours of observation in each plot. A total of 585 individuals of 25 waterbird species from 10 families were recorded during the study period. Among the recorded species two species were globally threatened and the remaining were the least concerned categories. The greater abundance of waterbirds was recorded during winter (t = -5.98, p < 0.001). The abundance of all feeding guilds was found higher during winter. Cattle egret was recorded with the greatest abundance (N = 85) and Relative abundance (RA = 14.52), it was followed by great cormorant (N = 57, RA = 9.74) and common pochard was the least abundant (N = 2, RA = 0.34). There was no seasonal variation in the Shannon Wiener index (H’) and species evenness however, the species richness was higher during winter (W = 16.5, p < 0.01). Distance to the forest, road, and settlement did not affect the abundance and diversity of waterbirds however, the abundance of insectivore birds was increased with the decrease of distance to croplands (t = -3.13, p < 0.05). The Begnas wetland was found with a lower abundance and diversity of waterbirds in comparison to the Phewa and other wetlands of the Terai region of Nepal. The lake water pollution, infrastructural development, anthropogenic activities, recreational activities, and infestation of invasive plants like water hyacinth were the main threats to the waterbirds around Begnas lake. An awareness program about the conservation of waterbirds and regular monitoring of waterbirds in Begnas was recommended.
36
Repenning, Peter, Desmond Lau, Diana C. Hernaez, et al. "Abstract 6716: DLL3 TriTCE Co-Stim: A next generation trispecific T cell engager with integrated CD28 costimulation for the treatment of DLL3-expressing cancers." Cancer Research 84, no. 6_Supplement (2024): 6716. http://dx.doi.org/10.1158/1538-7445.am2024-6716.
Full textAbstract:
Abstract Small cell lung cancer (SCLC) is an aggressive neuroendocrine cancer with a poor prognosis and high unmet medical need. Current standards of care, including chemotherapy, targeted therapy and immunotherapy, are associated with limited duration of response. Furthermore, SCLC is characterized by an immunosuppressive microenvironment and poor T cell infiltration which present additional treatment challenges. Delta-like ligand 3 (DLL3) is an inhibitory Notch ligand that is aberrantly overexpressed in SCLC and other neuroendocrine tumors, but minimally expressed in normal tissues, and is a new therapeutic target. Bispecific T cell engagers (TCE) targeting DLL3 have entered the clinic and demonstrated promising anti-tumor activity in SCLC patients; however, we believe there is room to improve on the rate and depth of response. To address treatment challenges and enhance the durability and sustainability of T cell activation, we have engineered a trispecific co-stimulatory T cell engager (TriTCE Co-stim) molecule that optimally engages CD3 and CD28 and redirects and enhances cytotoxic T cell responses to DLL3-expressing tumor cells while maintaining a desired safety profile. A panel of DLL3xCD3xCD28 trispecific antibodies (Abs) was engineered with a conventional anti-CD28 agonist paratope in a variety of Ab formats, geometries, paratope affinities and specificities. Geometry and design features of the tri-specific Abs were informed by prior TriTCE Co-stim molecule optimization1. AzymetricTM and EFECTTM platforms were used to facilitate heterodimeric multi-chain antibody assembly with silenced Fc gamma function. Lead TriTCE Co-stim Abs were selected for enhanced DLL3-dependent antitumor cytotoxic activity and increased T cell function including T cell activation, proliferation and cytokine production, compared to competitor bispecific TCEs. DLL3-independent activity and cytokine release were assessed with human PBMCs in solid and solution phase assays to evaluate the potential for cytokine release induction. In summary, we have identified multiple TriTCE Co-Stim Ab formats with improved DLL3-dependent cytotoxicity and T cell activation over competitor bispecific TCEs across multiple DLL3-expressing tumors. By screening various Ab formats, geometries and paratope affinities, we have selected lead DLL3 TriTCE Co-stim Abs displaying target-dependent activation of T cells with potent anti-tumor activity which may translate to improved and more durable antitumor responses in the treatment DLL3-expressing cancers. Citation Format: Peter Repenning, Desmond Lau, Diana C. Hernaez, Alec Robinson, Diego P. Escanda, Mariana Rocha, Begonia S. Moreno, John Zhang, Polly Shao, Nichole Escalante, Lisa Newhook, Purva Bhojane, Chayne L. Piscitelli, Paul A. Moore, Thomas Spreter Von Kreudenstein, Nina E. Weisser. DLL3 TriTCE Co-Stim: A next generation trispecific T cell engager with integrated CD28 costimulation for the treatment of DLL3-expressing cancers [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6716.
37
Lau, Desmond, Peter Repenning, Diana Canals Hernaez, et al. "Abstract 7318: ZW209, a DLL3 targeted trispecific T cell engager with integrated CD28 co-stimulation, demonstrates safety and potent preclinical efficacy in models of small cell lung cancer." Cancer Research 85, no. 8_Supplement_1 (2025): 7318. https://doi.org/10.1158/1538-7445.am2025-7318.
Full textAbstract:
Abstract Small cell lung cancer (SCLC) is a highly aggressive and difficult-to-treat malignancy with limited treatment options. Delta-like ligand 3 (DLL3), a cell surface protein overexpressed in SCLC, has emerged as a promising therapeutic target. Bispecific T cell engagers (TCE) targeting DLL3, including tarlatamab which has received accelerated approval, have demonstrated anti-tumor activity in the clinic with an improved duration of response compared to current standard of care, including chemotherapy and immunotherapy. Despite these advances, we believe there is opportunity to improve the rate and depth of response as the clinical activity of bispecific T cell engagers may be limited by low T cell infiltration and poor T cell function characteristic of SCLC tumors, and by the emergence of treatment-related T cell anergy due to T cell stimulation via signal 1 (CD3) only. The incorporation of signal 2 co-stimulation, via CD28 signaling, has the potential to improve response rates by stimulating increased T cell activation, proliferation and survival. To address treatment challenges and enhance the durability and sustainability of T cell activation, we engineered ZW209, a trispecific co-stimulatory T cell engager (TriTCE Co-stim) that optimally engages CD3 and CD28 and redirects and enhances cytotoxic T cell responses to DLL3-expressing tumor cells while maintaining a desired safety profile. Our development candidate, ZW209, is designed to optimally engage CD3 and CD28 in an obligate cis manner, supported by a lack of T cell cross-linking and fratricide. The addition of CD28 co-stimulation in ZW209 demonstrated enhanced DLL3-dependent cytokine induction and T cell proliferation with improved antitumor activity relative to clinical bispecific TCEs benchmarks. In a serial, repeated challenge in vitro cytotoxicity assay, ZW209 displayed superior T cell fitness and anti-tumor activity to a bispecific control and clinical benchmark. In vivo, ZW209 exhibited potent anti-tumor activity in multiple humanized SCLC xenograft models. In aqueous and solid phase cytokine release assays, ZW209 exhibited minimal DLL3-independent cytokine production. Importantly, a ZW209 cynomolgus cross-reactive surrogate molecule displayed a favorable safety profile as it was well tolerated in non-human primates with repeat dosing at 10 mg/kg with no abnormal clinical signs. In summary, these preclinical data support that ZW209 promotes improved anti-tumor activity against DLL3-positive cancer cells relative to competitor bispecific TCEs. By integrating CD28 co-stimulation into our trispecific T cell engager, ZW209 has the potential to improve the rate and duration of response for better clinical outcomes. Citation Format: Desmond Lau, Peter Repenning, Diana Canals Hernaez, Alec Robinson, Diego Perez Escanda, John Zhang, Hamed Shirvani, Catherine Wu, Kurt Stahl, Aditi Deshmukh, Nichole Escalante, Mariana Rocha, Begonia Silva Moreno, Lisa Newhook, Purva Bhojane, Paul A. Moore, Nina E. Weisser, Thomas Spreter von Kreudenstein. ZW209, a DLL3 targeted trispecific T cell engager with integrated CD28 co-stimulation, demonstrates safety and potent preclinical efficacy in models of small cell lung cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2025; Part 1 (Regular Abstracts); 2025 Apr 25-30; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2025;85(8_Suppl_1):Abstract nr 7318.
38
Jenkins, Liam, Laura Kazlauskas, Matt Wilson, Scott A. Hammond, Theresa Proia, and Jerome Mettetal. "Abstract 1366: Dual immune checkpoint inhibition enhances the anti-tumor activity of trastuzumab deruxtecan in preclinical models." Cancer Research 84, no. 6_Supplement (2024): 1366. http://dx.doi.org/10.1158/1538-7445.am2024-1366.
Full textAbstract:
Abstract Background Trastuzumab deruxtecan (T-DXd) is an antibody-drug conjugate (ADC) composed of an anti-human epidermal growth factor receptor 2 (HER2) antibody, a cleavable tetrapeptide-based linker, and a topoisomerase I inhibitor payload. Recent clinical trials such as BEGONIA have highlighted the potential therapeutic benefit in combining T-DXd with immuno-oncology (IO) agents such as the PD-L1 inhibitor durvalumab. Here, we report preclinical findings demonstrating enhanced anti-tumor activity when T-DXd is combined with dual immune checkpoint inhibition. Methods HER2-expressing human cancer cell lines were treated in vitro with T-DXd and assessed for induction of immunogenic cell death (ICD) markers and expression of NK cell-activating ligands. Human macrophages and T cells were incubated with supernatants from treated cancer cells, and their activation status evaluated via flow cytometry. In vivo, the effects of T-DXd in combination with inhibitors of PD-L1, CTLA-4, and a monovalent bispecific anti-PD-1/TIGIT antibody - a murine surrogate of rilvegostomig - on tumor growth were evaluated in BALB/c mice bearing human HER2-low EMT6 murine mammary tumors. The anti-tumor activity of T-DXd in combination with volrustomig, a monovalent bispecific antibody targeting PD-1 and CTLA-4, was also assessed in hu-CD34+ NSG mice bearing HER2-low Caki-1 renal cell carcinoma tumors. Results In vitro, T-DXd induced ICD via DXd-mediated extracellular release of inflammatory mediators ATP and HMGB1, and cell surface exposure of calreticulin. This was associated with a greater than 2-fold increase in expression of NK cell-activating ligands, and activation of both macrophages and T cells. In immunocompetent mice bearing human HER2 expressing EMT6 tumors, T-DXd treatment drove tumor growth inhibition (53%, P &lt;0.001) that was associated with an increase in tumoral T cells (2.6-fold, P &lt;0.05) and increased CD8+ T cell expression of the immune checkpoints PD-1, TIGIT, and TIM-3. Tumor growth inhibition relative to vehicle-treated mice was enhanced when T-DXd was combined with inhibitors of PD-L1 (108%, P &lt;0.001), PD-L1 plus CTLA-4 (172%, P &lt;0.001), or a bispecific PD-1/TIGIT inhibitor (181%, P &lt;0.001). Pharmacodynamic analysis revealed how the combination of T-DXd and PD-1/TIGIT inhibition increased tumoral NK cells (3.2-fold, P &lt;0.001) and CD8+ T cells (3.8-fold, P &lt;0.001) relative to vehicle. Consistent with findings in syngeneic models, the combination of T-DXd with a bispecific PD-1/CTLA-4 inhibitor also enhanced tumor growth inhibition in a humanised Caki-1 model (121%) compared to T-DXd alone (72%) (P &lt;0.001). Conclusions These data provide insight into the clinical activity observed with T-DXd and provide scientific rationale for combination strategies with novel, bispecific IO agents targeting CTLA-4 or TIGIT in addition to the PD-1/PD-L1 axis. Citation Format: Liam Jenkins, Laura Kazlauskas, Matt Wilson, Scott A. Hammond, Theresa Proia, Jerome Mettetal. Dual immune checkpoint inhibition enhances the anti-tumor activity of trastuzumab deruxtecan in preclinical models [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1366.
39
von Rossum, Anna, Genevieve Desjardins, Nichole Escalante, et al. "Abstract 2926: PROTECTTM, a novel trispecific antibody masking platform with integrated immune modulation displays unique activity and differentiated modes of action." Cancer Research 83, no. 7_Supplement (2023): 2926. http://dx.doi.org/10.1158/1538-7445.am2023-2926.
Full textAbstract:
Abstract Many T-cell engagers (TCE) and immuno-oncology biologics have limited efficacy in the clinic due to narrow therapeutic windows, checkpoint upregulation, and emergence of resistance mechanisms over time. The PROTECTTM (PROgrammed Tumor Engagement & Checkpoint/Costimulation Targeting) platform is designed to tackle these challenges by combining a masking domain that, when cleaved, provides additional immune-modulatory properties. The PROTECTTM mask consists of a PD1-PDL1 protein pair that sterically hinders CD3 binding in the periphery. The PD-L1 moiety is fused to the anti-CD3 antibody via a linker sequence containing a protease cleavage site. Once cleaved, the resultant molecule is a trispecific antibody providing TCE activity, checkpoint inhibition, and additional differentiated functionality. Previous studies employing pan T cell cytotoxicity assays showed the PROTECTTM mask increased the therapeutic window by 400-fold. We have now expanded our in vitro evaluation to include more relevant PBMC systems showing a greater expansion of the therapeutic window. In vivo treatment of established tumours with the unmasked trispecific results in complete and durable anti-tumour responses. Here we extend those in vivo studies (in context of established tumour models) to evaluate unmasking and pharmacokinetic properties. We further evaluated the unique and differentiated mechanism of action of the cleaved trispecific to not only enhance engagement of effector T-cells with tumor cells through avidity driven cis-engagement of a tumor associated antigen (TAA) and PD-L1 co-expressed on tumor cells, but to also enhance co-engagement of a TAA with effector T cells co-expressing PD-L1. In addition, the ability of the cleaved trispecific to bridge autologous T cells with DCs results in enhanced T cell activation and proliferation. Finally, TCR dependent signaling assays confirmed the ability of the cleaved trispecific to overcome PD1/PDL1 checkpoint activity. Taken together, the PROTECTTM platform integrates a masking and immune-modulatory technology that has the potential to widen the therapeutic window of CD3 engagers. Citation Format: Anna von Rossum, Genevieve Desjardins, Nichole Escalante, Wingkie Wong, Bryant Harbourne, Janessa Li, Begonia Silva Moreno, Prajwal Raghunatha, Richard Kunze, Madeline Fung, Florian Heinkel, Harsh Pratap, Kevin Haworth, Eric Escobar-Cabrera, Brandon Clavette, Surjit Dixit, Nina Weisser, Thomas Spreter von Kreudenstein. PROTECTTM, a novel trispecific antibody masking platform with integrated immune modulation displays unique activity and differentiated modes of action [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 2926.
40
Granelli-Piperno, Angela, Victoria Finkel, Elena Delgado, and Ralph M. Steinman. "Virus replication begins in dendritic cells during the transmission of HIV-1 from mature dendritic cells to T cells." Current Biology 9, no. 1 (1999): 21–29. http://dx.doi.org/10.1016/s0960-9822(99)80043-8.
Full text
41
Shalak, Oksana. "MYKOLA BILOZERSKYI AND HIS "TARAS HRYGORYEVYCH SHEVCHENKO ACCORDING TO THE MEMORIES OF DIFFERENT PERSONS (1831–1861)": WHERE MEMORIES END AND FOLKLORE BEGINS." Shevchenko Studies, no. 1 (27) (2024): 230–24. https://doi.org/10.17721/2410-4094.2024.1(27).2/230-248.
Full textAbstract:
B a c k g r o u n d . Creating a source base for reconstruction of biography is one of the most urgent problems of biography. Little is known about the folklorist Mykola Bilozerskyi, the history of the study of his activities, which began with the obituary, includes the names of A. Krymskyi, B. Kyrdan, and N. Barabash, whose works only outline the main directions of research. The article by M. Bilozersky "Taras Grigoryevich Shevchenko according to the memoirs of various persons (1831–1861)" belongs to the undeservedly left on the margins of Shevchenko studies. The goal is to study the memories of Shevchenko as a kind of folklore material important for specialists. M e t h o d s . There are fundamental scientific methods of analysis and synthesis, as well as historical methods that are based on historicism and objectivity and allow the interpretation of biographical principles. That allows us to highlight the most important at recollection expressed by M. Bilozersky, to create folk ideas about the figure of T. Shevchenko, recorded in folklore. R e s u l t s . Thanks to the analysis, it was found that among the memoirs of Vasyl Tarnovskyi (senior), Viktor Zabyla, Oleksiy Senchyl-Stefanovskyi, Andrii Lyzogub, and Mykhailo Lazarevskyi, M. Bilozerskyi published tales, legends, and folklore stories of an anecdotal nature, which are of great importance for folkloristics. These plots, on the one hand, are a continuation of the tradition of sacralization of the hero, and on the other, they are an interpretation of the figure in a social and everyday and ironic way. Samples are marked not only by signs of orality, collective creation, but also have variants, which are defining features of folklore. Some contain characteristic folklore concepts that add traditionality to the narratives. C o n c l u s i o n s . M. Bilozerskyi worked using folkloristic methods: he directed the narration with questions, focused the narrator's attention on the essential. Recording memories of T. Shevchenko, the folklorist was able to recreate a kind of folk poetic "semantic field" in which Shevchenko's genius was formed. To this day, his records have weight as one of the first publications of folklore about T. Shevchenko.
42
Wahyuni, Syahri, Masitah Masitah, Doddy Ismunandar Bahari, et al. "FAKTOR-FAKTOR YANG MEMPENGARUHI PRODUKTIVITAS KAKAO DI KECAMATAN PAKUE TENGAH KABUPATEN KOLAKA UTARA." Jurnal Sains Agribisnis 4, no. 1 (2024): 84–95. http://dx.doi.org/10.55678/jsa.v4i1.1468.
Full textAbstract:
Penelitian ini bertujuan untuk mengetahui seberapa besar produktivitas kakao dan faktor-faktor apa saja yang berpengaruh terhadap produktivitas kakao di Kecamatan Pakue Tengah Kabupaten Kolaka Utara. Penelitian ini dilaksanakan sejak bulan November tahun 2023 sampai bulan Januari tahun 2024 di Kecamatan Pakue Tengah Kabupaten Kolaka Utara. Penentuan responden menggunakan metode Slovin. Alat analisis yang digunakan adalah analisis regresi linear beganda. Dari hasil penelitian nilai produktivitas kakao di Kecamatan Pakue Tengah Kabupaten Kolaka Utara sebesar 628,03 Kg/ha pertahunnya. Hasil analisis menunjukkan nilai koefisien determinasi (R2) sebesar 0,711, hal ini diartikan bahwa pengaruh variabel independen terhadap variabel dependen sebesar 71,1% yang diteliti oleh peneliti, sedangkan sisanya 28,9% dipengaruh oleh variabel lain diluar parameter penelitian. Hasil uji-F menunjukkan bahwa secara bersama-sama jumlah pohon berproduksi (X1), pupuk (X2), pestisida (X3) dan tenaga kerja (X4) berpengaruh secara nyata terhadap produktivitas kakao. Hasil uji-T menjelaskan bahwa secara parsial variabel independen (jumlah pohon berproduksi, pupuk, pestisida dan tenaga kerja) berpengaruh secara nyata terhadap variabel dependen (produktivitas).
43
Gunawan, Agung, Dian Novita, and Angga Febrian. "PERAN CELEBRITY ENDORSER DAN EFEKTIVITAS IKLAN MELALUI MEDIA TELEVISI PADA MINAT BELI ( Survei pada konsumen situs belanja online shopee)." Journals of Economics and Business 1, no. 1 (2022): 1–8. http://dx.doi.org/10.33365/jeb.v1i1.78.
Full textAbstract:
Celebrity endorser dan efektivitas iklan merupakan salah bentuk strategi komunikasi pemasaran yang dilakukan baik secara offline atau online untuk menarik perhatian minat konumen. Metode yang digunakan dalam penelitian ini adalah metode kuantitatif. Penelitian ini menggunakan sampel dari 280 responden yang pernah menggunakan shopee dan memahami peran celebrity endorser. SPSS 16.0 digunakan dalam teknik analisis data dengan menggunakan uji regresi linier beganda dan uji t, untuk melihat pengaruh celebrity endorser pada dimensi (attractiveness, expertise, and trustworthiness) dan efektivas iklan dimensi (empathy, persuasion, impact, communication) pada minat beli. Hasil penelitian secara parsial menunjukan bahwa dukungan celebrity endorser pada dimensi (attractiveness, expertise, and trustworthiness) mempengaruhi minat beli konsumen jika celebrity yang digunakan sesuai dengan produk yang diiklankan dan evektivitas iklan pada dimensi (empathy, persuasion, impact, communication) mempunyai pengaruh terhadap minat beli, dimana semakin tinggi evektivitas iklan di televisi semakin tinggi pula minat beli konsumen. Penelitian selanjutnya dapat menambahkan variabel lain selain celebrity endorser dan efektivitas iklan pada minat beli.
44
Gholamin, Sharareh, Heini Natri, Yuqi Zhao, et al. "Abstract P015: Targeting SPP1 to enhance CAR T cell therapy in glioblastoma: Implications for integrating radiation therapy in resistant solid tumors." Clinical Cancer Research 31, no. 2_Supplement (2025): P015. https://doi.org/10.1158/1557-3265.targetedtherap-p015.
Full textAbstract:
Abstract In the evolving landscape of glioblastoma (GBM) treatment, clinical trials exploring chimeric antigen receptor (CAR) T cell therapies have shown promise; however, their therapeutic efficacy remains constrained, particularly due to the immunosuppressive tumor microenvironment (TME). Emerging evidence highlights that the TME, especially myeloid-driven suppressive networks, plays a central role in resistance to CAR T cell therapy. Despite progress in elucidating these mechanisms, significant ambiguities endure, particularly regarding patient-specific TME heterogeneity and its impact on therapeutic outcomes. Radiation therapy remains a cornerstone in GBM management, known not only for its direct cytotoxic effects but also for its ability to modulate the TME and potentially enhance immune responses. However, the combination of radiation with CAR T cell therapy has not been fully explored, particularly in the context of targeting suppressive myeloid subsets. Recent studies suggest that radiation may induce immunogenic changes within the TME, potentially enhancing CAR T cell infiltration and activity. Our study seeks to investigate how targeting key suppressive mediators, such as SPP1-expressing macrophages, can reshape the TME, setting the stage for combinatorial approaches that leverage the immunomodulatory effects of radiation therapy In this study, we utilized single-cell RNA sequencing to analyze tumors from 41 glioma patients undergoing IL13Rα2-targeted CAR T cell therapy. Our findings revealed heightened suppressive extracellular matrix (ECM) remodeling and immunosuppressive signatures driven by SPP1-expressing myeloid cells, predominantly in non-responsive tumors. Elevated SPP1 expression and increased infiltration of SPP1+ myeloid cells were associated with poor clinical outcomes. Functional transcriptomic analyses demonstrated that SPP1-high macrophages exhibited reduced antigen presentation, impaired phagocytosis, and enhanced ECM biogenesis, coupled with elevated lipid metabolism and non-glycolytic ATP production. These metabolic adaptations were linked to a suppressive immunophenotype that hindered CAR T cell efficacy. To explore therapeutic strategies, we assessed the impact of SPP1 blockade in preclinical syngeneic glioma models. Pre-treatment with anti-SPP1 antibodies prior to CAR T cell infusion significantly reprogrammed the TME, enhancing CAR T cell efficacy and reversing resistance in previously non-responsive models. These results highlight the potential of targeting SPP1 to disrupt suppressive macrophage networks, thereby augmenting CAR T cell responses. Our findings underscore SPP1 as a promising target to overcome resistance in CAR T cell therapies for GBM. This study lays the groundwork for future integration of targeted therapies, such as SPP1 inhibition, with radiation therapy to potentially improve therapeutic outcomes in resistant gliomas, offering new avenues for combinatorial therapeutic innovation. Citation Format: Sharareh Gholamin, Heini Natri, Yuqi Zhao, Shengchao Xu, Maryam Aftabizadeh, Begonya CominAnduix, Supraja Saravanakumar, Christian Masia, Robyn Wong, Lance Peter, Mei-i Chung, Evan D. Mee, Brenda Aguilar, Davis Y. Torrejon, Anusha Kalbasi, Darya Alizadeh, Xiwei Wu, Antoni Ribas, Stephen Forman, Behnam Badie, Terence M. Williams, Nicholas E. Banovich, Christine E. Brown.Targeting SPP1 to enhance CAR T cell therapy in glioblastoma: Implications for integrating radiation therapy in resistant solid tumors.[abstract]. In: Proceedings of the AACR Special Conference in Cancer Research: Translating Targeted Therapies in Combination with Radiotherapy; 2025 Jan 26-29; San Diego, CA. Philadelphia (PA): AACR; Clin Cancer Res 2025;31(2_Suppl):Abstract nr P015
45
Mulia Sosiady. "MEMBANGUN KEPUASAN KERJA KARYAWAN MELALUI LINGKUNGAN KERJA DAN SISTEM PENGEMBANGAN KARIER PADA BPR HARTA MANDIRI PEKANBARU." Jotika Journal In Management and Entrepreneurship 2, no. 1 (2022): 59–70. https://doi.org/10.56445/jme.v2i1.65.
Full textAbstract:
Perusahaan memberikan perhatiaan khusus untuk karyawan tersebut pun dapat terpenuhi sehingga kepuasan kerja pun dapat meningkat, Penelitian ini dilakukan dengan tujuan untuk mengetahui bagaimana Kepuasaan kerja karyawan BPR Artha Mandiri Pekanbaru yang dipengaruhi oleh Lingkungan Kerja dan Pengembangan Karir Populasi untuk penelitian ini adalah seluruh karyawan BPR Artha Mandiri Pekanbaru yang berjumlah 30 karyawan, Metode pengumpulan data dalam penelitian ini dengan menggunakan Kuesioner adalah daftar pertanyaan/pernyataan yang dibuat berdasarkan indikator-indikator dari variabel penelitian yang harus direspon oleh responden Dalam penelitian ini penulis untuk menganalisis menggunakan metode regresi linier berganda, yaitu suatu metode statistik yang digunakan untuk mengetahui hubungan antara variabel bebas dan variabel terikat. Analisis regresi linier beganda memberikan kemudahan bagi pengguna untuk memasukkan lebih dari variabel Adapun yang mempengaruhi kepuasan kerja karyawan pada Artha Mandiri Pekanbaru adalah dipengaruhi oleh lingkungan kerja dan pengembangan karir hal ini dapat dilihat berdasarkan uji T hitung, dimana diperoleh nilai T yang paling tinggi adalah sebesar 3,911 yang artinya variabel lingkungan kerja adalah variabel yang sangat berpengaruh terhadap kepuasan kerja karyawan BPR Harta Mandiri Pekanbaru Nilai R Square sebesar 0,663 atau 66,3% berarti terdapat hubungan antara lingkungan kerja dan pengembangan karir terhadap kepuasan kerja karyawan pada BPR Artha Mandiri Pekanbaru Sisanya 33,7% dipengaruhi oleh variabel lain yang tidak digunakan dalam penelitian ini seperti kemampuan kerja, motivasi, keahlian, dan kompetensi.
46
Klosinski, G. "Zur Bedeutung der Kunst- und Gestaltungstherapie für die Psychiatrie und Psychotherapie am Beginn eines neuen Jahrtausends." Musik-, Tanz- und Kunsttherapie 11, no. 4 (2000): 179–86. http://dx.doi.org/10.1026//0933-6885.11.4.179.
Full textAbstract:
Zusammenfassung. Kunst- und Gestaltungstherapie im weiteren Sinne, sei sie präventiv, psychotherapeutisch, psychiatrisch oder rehabilitativ orientiert und eingebunden, hat sich in den Dienst am Patienten zu stellen, muß auf ihn bezogen sein, kann und darf nicht Selbstzweck von Überzeugungen und Vorurteilen ihrer Vertreter und Anbieter sein. Kunst- und Gestaltungstherapie, sei sie flankierend im Rahmen einer stationären Psychotherapie eingesetzt oder intermittierend fokussierend, ist, wie jedes ärztliche Handeln, insbesondere das psychotherapeutische, eine “Kunst”, deren Wirkfaktoren z. T. unspezifisch sind und auf der Qualität des Dialoges beruhen, d. h. auf einer positiven Therapeut-Patienten-Beziehung. Folgende Fragen werden erörtert: Wie und wohin hat sich Kunst- und Gestaltungstherapie bis heute entwickelt? Welche Rolle spielt die Kunsttherapie im Konzert der unterschiedlichen psychotherapeutischen Richtungen und welche Bedeutung wird ihr im Rahmen einer zukünftigen, integrierten mehrdimensionalen Betrachtungsweise in der Psychiatrie und Psychotherapie zuerkannt?
47
Shober, Amy L., Christine Wiese, Geoffrey C. Denny, Craig D. Stanley, Brent K. Harbaugh, and Jianjun Chen. "Plant Performance and Nutrient Losses during Containerized Bedding Plant Production Using Composted Dairy Manure Solids as a Peat Substitute in Substrate." HortScience 45, no. 10 (2010): 1516–21. http://dx.doi.org/10.21273/hortsci.45.10.1516.
Full textAbstract:
Recent concerns over the environmental impact of peat harvesting have led to restrictions on the production of peat in Florida and other areas. The objectives of this study were to evaluate the use of composted dairy manure solids as a substitute for sphagnum or reed-sedge peat in container substrates on the growth of Solenostemon scutellarioides L. Codd ‘Wizard Velvet’, Tagetes patula L. ‘Safari Queen’, and Begonia ×hybrida ‘Dragon Wing Red’ and to examine the nutrient content in leachate from pots. Plants were grown for 5 weeks in a greenhouse in 15-cm plastic pots with seven substrates containing various proportions of sphagnum peat (S) or reed-sedge peat (R) and composted dairy manure solids (C), each with 20% vermiculite and 20% perlite. Substrate composition had no effect on plant quality ratings, number of flowers, or root dry mass for any of the plant species evaluated. Substrate composition did not affect the growth index (GI) or shoot dry mass of S. scutellarioides ‘Wizard Velvet’ or the GI of T. patula ‘Safari Queen’. However, growth of B. ×hybrida ‘Dragon Wing Red’ (GI and shoot dry mass) and T. patula ‘Safari Queen’ (shoot dry mass only) was highest in the 3S:0R:0C substrate. The substrates containing sphagnum peat and/or composted dairy manure solids (3S:0R:0C, 2S:0R:1C and 1S:0R:2C) had the highest NH4-N losses through the first 7 d of production. The 0S:3R:0C substrate had the highest initial leachate NO3+NO2-N losses and this trend persisted throughout most of the production cycle. Significantly more dissolved reactive phosphorus was leached from substrate mixes containing composted dairy manure solids than mixes containing only sphagnum or reed-sedge peat materials through 19 d after planting. All substrates tested as part of this study appeared to be commercially acceptable for production of container-grown bedding plant species based on plant growth and quality. However, nutrient losses from the containers differed depending on the peat or peat substitute used to formulate the substrates.
48
Judd, Lesley A., Brian E. Jackson, and William C. Fonteno. "Rhizometer: An Apparatus to Observe and Measure Root Growth and Its Effect on Container Substrate Physical Properties Over Time." HortScience 50, no. 2 (2015): 288–94. http://dx.doi.org/10.21273/hortsci.50.2.288.
Full textAbstract:
Container production of plants use substrates that are formulated to have adequate physical properties to sustain optimal plant growth; however, these properties can change over time as a result of substrate settling and root growth of the growing plant in the container. An apparatus (rhizometer) was developed that measures the changes caused by plant roots on physical properties of substrates during crop production in containers. The design of the rhizometer included a clear core, which allowed for observing and measuring a range of root system characteristics in situ, including total root length visible along the rhizometer. Physical properties of planted and fallow rhizometers were measured, and the effect of four species on substrate physical properties was determined. There was a general decrease in substrate total porosity and air space (AS) over time with both fallow and planted rhizometers as a result of both settling of the substrate and root growth into the substrate. Container capacity did not change over time with or without roots. Plants with large root systems such as Begonia ×hybrida acut. decreased AS over time, whereas plants of Rudbeckia hirta L. with a smaller root system did not have the same effect. Measured total root length was highly correlated to the total dry root mass of Tagetes erecta L. and Zinnia marylandica D.M. Spooner, Stimart & T. Boyle plants. This may allow tracing and measuring root lengths to be another (alternative) method to measure root systems. Planted rhizometers also allowed easy access for viewing the root system non-destructively, providing the ability to observe and measure root growth.
49
Manjula and Krutika Chaudhary. "Comprehensive review of Sariva (Indian sarsaparilla) and its botanical sources." Journal of Drug Research in Ayurvedic Sciences 9, no. 6 (2024): 356–67. https://doi.org/10.4103/jdras.jdras_386_23.
Full textAbstract:
Abstract Sariva [Hemidesmus indicus (L.) R. Br. ex Schult.], a widely used medicinal plant in India, although well-established as H. indicus (L.) R. Br. ex Schult., Apocynaceae; different botanical sources are used. This study reviews botanical sources available in the drug market, their classical references, and contemporary documentation. This study is an exclusive documentation of scattered information of Sariva and its various botanical resources. Significant keywords used were Sariva, Krishnasariva, Utpalasariva, Shyama, Ananta, Asphota, Gopavalli, Krishnavalli, Bhadra, Chandana, Kalindi, H. indicus, Ichnocarpus frutescens, Cryptolepis buchanani, and Decalepis hamiltonii. Different textual references suggest Sariva to be H. indicus (L.) R. Br. ex Schult., Cryptolepis buchanani Roem. & Schult., I. frutescens (L.) W. T. Aiton, Decalepis hamiltonii Wight & Arn., and Asphota (Phyllanthus distichus (L.) Müll. Arg. or Clitoria ternatea (L.)). Substitutes discussed are Decalepis hamiltonii Wight & Arn., Maerua arenaria Hook. f. & Thomson, Smilax china L., Periploca aphylla Decne., stem pieces of Cryptolepis buchanani, Ichnocarpus, Goravaganja, Karanta (Barleria prionites L.), and Vallaris species, whereas adulterants include Begonia carpreolata L., Bignoniaceae, and Polygonum amplexicaulis D. Don. Results indicate that Sariva is more similar to H. indicus (L.) R. Br. ex Schult., Asphotaa as H. indicus, or Vallaris heynei Spreng. Shweta and Krishnasariva are mentioned as H. indicus and Cryptolepis buchanani, respectively. The potential to identify all the possible sources will definitely assist in detecting adulteration. Furthermore, as many plants are becoming endangered, different botanical sources may be further tested through experimental and clinical studies to identify species exhibiting properties and actions more closer to those of the original Sariva.
50
Henson, D. Yvette, Steven E. Newman, and David E. Hartley. "Performance of Selected Herbaceous Annual Ornamentals Grown at Decreasing Levels of Irrigation." HortScience 41, no. 6 (2006): 1481–86. http://dx.doi.org/10.21273/hortsci.41.6.1481.
Full textAbstract:
This study was conducted to evaluate the growth, visual quality, and stress response of 17 species of bedding plants and Kentucky bluegrass (Poa pratensis L.) grown outdoors for 10 weeks during the summer of 2003 at three locations in Colorado. Plants were irrigated at 100% of the reference evapotranspiration (ET0) (amount required to maintain Kentucky bluegrass in an optimum condition) for 2 weeks followed by 8 weeks at five irrigation levels: 0%, 25%, 50%, 75%, and 100% ET0. Begonia carrieri Hort. `Vodka', Lobelia erinus L. `Cobalt Blue', and Viola ×wittrockiana Gams. `Crown Gold' grew well with a minimum of 50% or more ET0 based on Kentucky bluegrass. Impatiens walleriana Hook. fil. `Tempo White' grew well only with 100% ET0. Antirrhinum majus L. `Sonnet Yellow', Dianthus L. `First Love', Lobularia maritima (L.) Desv. `Carpet White', and Pelargonium ×hortorum L.H. Bailey performed well with 25% to 50% ET0. The species Catharanthus roseus (L.) G. Don `Peppermint Cooler', Rudbeckia hirta L. `Indian Summer', Senecio cineraria D.C. `Silver Dust', Tagetes erecta L. `Inca Yellow' and T. patula L. `Bonanza Gold', Zinnia angustifolia Kunth., and Salvia farinacea Benth. `Rhea Blue', which are adapted to midsummer heat and low water, performed well with 0% to 25% ET0. Species considered to be heat or drought tolerant—Petunia ×hybrida hort. ex. E. Vilm. `Merlin White' and Glandularia J.F. Gmel. `Imagination'—required little or no irrigation. The bedding plant species evaluated in this study that required 25% or less ET0 are well adapted for low-water landscape installations.