To see the other types of publications on this topic, follow the link: Beijing Shi (China).
Journal articles on the topic 'Beijing Shi (China)'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Beijing Shi (China).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Qiu, Jane. "Higher education and research innovation in China." National Science Review 1, no. 4 (December 1, 2014): 623–26. http://dx.doi.org/10.1093/nsr/nwu073.
Full textAbstract:
Abstract China places a great emphasis on boosting its innovative capability, which it says is key to meeting the challenges in economic development and global competition. At the heart of the matter is how the country could produce its own agent of innovation—creative graduates and postgraduates. In a forum chaired by National Science Review's executive associate editor Mu-ming Poo, five panelists from top universities discuss the problems and challenges of higher education in China and in what ways the system needs to be reformed. Yuanfang Chen Physician and Vice Chair of Peking Union Medical College's Expert Committee on Education in Beijing Song Gao Chemist and Vice President of Peking University in Beijing Ke Gong Electronic Engineer and President of Nankai University in Tianjin Yigong Shi Biologist and Dean of Tsinghua University's School of Life Sciences in Beijing Chia-Wei Woo Physicist and Founding President of Hong Kong University of Science and Technology in Hong Kong Mu-ming Poo (Chair) Neuroscientist and Director of Chinese Academy of Sciences’ Institute of Neuroscience in Shanghai
2
Wang, Jin, Min Li, and Wei Heng Yan. "The Engineering Application of CO2 Capture by Chemical Absorption in China." Advanced Materials Research 512-515 (May 2012): 2457–62. http://dx.doi.org/10.4028/www.scientific.net/amr.512-515.2457.
Full textAbstract:
With the increasing concentration of CO2 in the atmosphere, climate change has been prominent and brought a series of disasters to human being. In China, the important aspect to control CO2 concentration is to decrease its emission of coal-fuel power plant. The engineering application of chemical absorption technology and economic analysis of the Beijing Gao Bei-dian and the second unit of Shanghai Shi Dong-kou power plants built by China Hua Neng Electric Group is introduced. The achievements of CO2 engineering capture and the effort direction we will towards in the future is also summarized.
3
Hodous, Florence. "A Judge at the Crossroads of Cultures: Shi Tianlin." Asiatische Studien - Études Asiatiques 71, no. 4 (February 23, 2018): 1137–51. http://dx.doi.org/10.1515/asia-2017-0013.
Full textAbstract:
Abstract Shi Tianlin is one of only two known officials who was appointed to act as judge both in the West and the East of the Mongol Empire, during the period of the united empire when officials were often appointed cross-regionally. Coming from near today’s Beijing, he came to prominence for his knowledge of languages, and was granted a Mongol name. He was a judge in a Western campaign, probably that of Batu against the Qipchaqs and Russians. Later, he was sent by Möngke Khan to Qaidu in Central Asia, and detained there for 28 years, before returning to Yuan China. Despite his long absence from China and though his activity as judge was very short (he declined to be re-appointed as judge when he arrived back in China), the prestige of the appointment stuck, and his son and grandson were both judges in China. The shendaobei, or Spirit-Way Inscription, of Shi Tianlin is particularly interesting for the way in which it explains Mongol concepts in Chinese terms. One of these is the jasagh (held to be the law code of Chinggis Khan), which is equated with Chinese falü (statute or law code). Rather than explaining its contents however, the inscription talks about the importance of following “the jasagh of Confucius”, namely the Lunyu or Analects of Confucius. The inscription – and presumably Shi Tianlin during his lifetime – thus uses a widely-known Mongol concept to promote Chinese values, showing the complexities of intercultural communication and exchange during the Mongol era.
4
Qiu, Jane. "Science communication in China: a critical component of the global science powerhouse." National Science Review 7, no. 4 (April 1, 2020): 824–29. http://dx.doi.org/10.1093/nsr/nwaa035.
Full textAbstract:
Abstract China has attached a great significance to bringing science to the public—known as kepu (科普, ‘science popularization’) or kexue chuanbo (科学传播, ‘science dissemination’)—in recent years, partly in response to its unprecedented push for innovation in science and technology. In 2018, it spent 16 billion yuan (US$2.3 billion) on such endeavours, nearly 80% of which was government funding, according to a survey conducted by the Ministry of Science and Technology. With one science-education venue for every million people, approximately 76 million visits were made to the country's 518 general-science museums and 142 million visits were made to 943 museums dedicated to a specific subject matter, such as the Geological Museum of China. In a forum chaired by National Science Review’s executive editor-in-chief, Mu-ming Poo, scientists, journalists and public-information officers discussed the differences in science communication between China and developed nations, the challenges and opportunities of raising scientific literacy in China, how it has played out in a wide range of controversial topics, from stem-cell research to climate change, and the importance of international collaboration. Tao Deng Director of the Institute of Vertebrate Paleontology and Paleoanthropology, Chinese Academy of Sciences, Beijing, China Hepeng Jia Science journalist and science-communication scholar at Soochow University, Suzhou, China Brian Lin Director of the Editorial Content Strategy, EurekAlert!, American Association of the Advancement of Science, Washington DC, USA Joy Ma Manager of the Editorial Content, EurekAlert!, American Association of the Advancement of Science, Washington DC, USA Lai Xu Former chief editor of Guokr.com, Beijing, China Shi Yan Deputy director of the China Research Institute for Science Popularisation, Chinese Association of Science and Technology, Beijing, China Mu-ming Poo (Chair) Director of the Insitute of Neuroscience, Chinese Academy of Sciences, Shanghai, China
5
Xu, Xiuling. "Combating H7N9: an interview with Lanjuan Li and Yi Shi." National Science Review 2, no. 3 (August 24, 2015): 314–17. http://dx.doi.org/10.1093/nsr/nwv051.
Full textAbstract:
Abstract On March 31, 2013, the Chinese government reported that three persons from Shanghai and Anhui had died from a novel avian influenza virus, known as H7N9. This avian flu is unique in that it has a high human mortality rate, while fatality in poultry remains low. In other words, this virus can circulate ‘silently’ among poultry, but be a very possible cause of the next flu pandemic. Since 2013, human cases of H7N9 infection have been reported continuously, posing a potential threat to public health in China and attracting global attention. Will H7N9 be the next flu pandemic? With this question, NSR spoke to clinical expert, Professor Lanjuan Li from Zhejiang University, and the virologist, Dr. Shi Yi, from the Beijing Institutes of Life Science, Chinese Academy of Sciences and Shenzhen Third People's Hospital. In this interview, they share with us the biological information of H7N9, its clinical manifestation and treatment, and its future pandemic potential.
6
Pegg, Richard A. "For the Record: Chinese Investiture Missions to Ryūkyū, 1404–1866." Crossroads 20, no. 1-2 (October 12, 2022): 1–27. http://dx.doi.org/10.1163/26662523-bja10006.
Full textAbstract:
Abstract Every time a Ryūkyū king came to the throne from the fifteenth to nineteenth centuries, a mission was sent from the Chinese court in Beijing to Fuzhou, then via investiture ships from Fuzhou to Naha and finally by land to the royal capital of Shuri, Ryūkyū, to officially acknowledge the new king. From 1404 to 1866 there were a total of twentythree such official missions celebrating the new kings. Each appointed Chinese envoy kept an official record of the entire journey. During the Ming dynasty they took the form of published woodblock-printed books known as Record of a Ryūkyū Mission (Shi Liuqiu lu). During the Qing dynasty a second manuscript format, consisting of a commemorative album containing sets of paintings, also appeared. Both formats, books and albums, are historical records enhancing our understanding of how a part of the wider China Seas maritime trading systems functioned at that time.
7
Zhang, Linting. "Zhong meijing mao guan xi [The political economy of China-US trade relations]. By Yong Wang. Beijing: Zhongguo shi chang chu ban she (China Market Press), 2007. 428 pp. $8.70 (paper)." Journal of East Asian Studies 12, no. 2 (May 2012): 305–8. http://dx.doi.org/10.1017/s1598240800007918.
Full text
8
Rošker, Jana. "Wherever We Find Friends there Begins a New Life: Tagore and China." Asian Studies, no. 1 (December 1, 2010): 45–56. http://dx.doi.org/10.4312/as.2010.-14.1.45-56.
Full textAbstract:
Tagore made a deep impression upon the Chinese culture and society. In 1923, the Jiangxue she 講學社 (Beijing Lecture Association) invited Rabindranath Tagore to deliver a series of talks. The Jiangxue she Association was established in September 1920 and represented one of the many institutions that came to life in China during the May Fourth Movement. Since then, almost all of his works in English have been translated into Chinese. He came to China just when the latter was beginning her Renaissance and his visit certainly gave a great impetus to this new movement. His poems of Stray Birds and The Crescent Moon have created new styles of prosody in the new Chinese poetry. A Crescent Moon Society (for poetry) and a Crescent Moon magazine were started immediately after this event by Hu Shi 胡适 (Hu 2002: 90). During his visit, Tagore raised two basic questions, one about the relation between tradition and modernity, and the other about the usual identification of modernisation with Westernisation. Since the May Fourth Movement, China has also been concerned with these questions and Chinese intellectuals have come out with different answers. These questions, however, were important not only for China but for India as well. Such debates and the revaluation of various answers represented the most important condition for a consolidation of new ideologies, which formed a political basis for the changing societies of both countries.
9
Guo, Gang, Xiangyu Guo, Yachun Wang, Xu Zhang, Shengli Zhang, Xizhi Li, Lin Liu, et al. "Estimation of genetic parameters of fertility traits in Chinese Holstein cattle." Canadian Journal of Animal Science 94, no. 2 (June 2014): 281–85. http://dx.doi.org/10.4141/cjas2013-113.
Full textAbstract:
Guo, G., Guo, X., Wang, Y., Zhang, X., Zhang, S., Li, X., Liu, L., Shi, W., Usman, T., Wang, X., Du, L. and Zhang, Q. 2014. Estimation of genetic parameters of fertility traits in Chinese Holstein cattle. Can. J. Anim. Sci. 94: 281–285. The objective of this study was to estimate genetic parameters for fertility traits in Chinese Holstein heifers and cows. Data of 20169 animals with 42106 records over a period of 10 yr (2001–2010) were collected from Sanyuan Lvhe Dairy Cattle Center in Beijing, China. Traits included age at first service (AFS), number of services (NS), days from calving to first service (CTFS), days open (DO), and calving interval (CI). Genetic parameters were estimated with multiple-trait animal model using the DMU software. Heritability estimates for AFS, NS, CTFS, DO and CI were 0.100±0.012, 0.040±0.017, 0.034±0.011, 0.053±0.019 and 0.056±0.014, respectively. Genetic correlations between traits observed ranged from −0.13 to 0.99. Genetic correlations between AFS with NS, CTFS, DO and CI were −0.31, 0.15, −0.13 and −0.15, respectively. Calving interval was strongly correlated with NS, CTFS and DO (0.49–0.99), and DO showed strong correlation with NS and CTFS (0.49 and 0.58, respectively). The genetic correlation between CTFS and NS was negative moderate (−0.25). Results were in range with previous literature estimates and can be used in Chinese Holstein genetic evaluation for fertility traits.
10
Shi, F., and T. Hsiang. "First Report of Pseudonectria buxi Causing Volutella Blight on Boxwood (Buxus sp.) in Beijing, China." Plant Disease 98, no. 9 (September 2014): 1282. http://dx.doi.org/10.1094/pdis-04-14-0434-pdn.
Full textAbstract:
Pseudonectria buxi (also called Volutella buxi) is a fungal pathogen that causes a disease of boxwood (Buxus spp.). This disease has been reported in several countries in Europe and North America, and has been traditionally considered the primary cause of boxwood decline (1), although box blight caused by Cylindrocladium buxicola has claimed notoriety because of its recent introduction to North America. In August 2013, symptoms resembling Volutella blight were observed at a park in Haidian District, Beijing, China, on leaves and stems of Korean boxwood (B. sinica var. insularis). The plants were still alive, but diseased leaves and twigs were yellowed and showed dieback. Symptoms were common on boxwood throughout this park, and the disease was also seen in other nearby areas. Pink sporodochia were observed on some yellowed leaves and stems. Diseased tissues (stems and leaves) were collected, cut into 1 mm2 pieces, surface sterilized in 1% sodium hypochlorite for 1 min, and placed on potato dextrose agar. After 3 days of incubation at room temperature, white fluffy mycelia were seen. The middle of the colonies turned pink by 7 days, and conidia produced on verticillately branched conidiophores in these pink areas were elliptical, 6 to 9 × 2 to 2.5 μm. DNA was extracted from one colony containing spores and mycelium, and a portion of the beta-tubulin gene was amplified using primers designed from highly conserved regions (5′-AACAACTGGGCCAAGGGTC, 5′-GAAGAGTTCTTGTTCTGGA) (3). The 676-bp amplicon was sequenced (GenBank Accession No. KJ755987), and the top matches were two isolates of P. buxi (KC819609 and DQ522522) with identities of 566/567 bp (99.8%) and 551/567 bp (97.2%), respectively. The next best matches were at 92% for Fusarium spp. For inoculation, four pots of 2-year-old healthy B. sinica var. insularis × B. sempervirens cv. Green Velvet were used. As wounds are required for the infection process (2,3), two parallel light scratches were made using needles on adaxial surface of three leaves per plant. One plant was only sprayed with water until runoff, while the other three plants were sprayed with a spore suspension (106 spores/ml) of P. buxi until runoff, covered with plastic bags, and placed at 25°C. After 3 days, pink sporodochia were observed on inoculated wounded leaves, but not on non-wounded leaves. By 10 days, inoculated wounded leaves turned yellow and became covered with sporodochia all over the adaxial surface, and on wound sites on the adaxial surfaces. No signs or symptoms were observed on either non-wounded inoculated leaves or on plants sprayed only with water. P. buxi was re-isolated from the diseased leaves but not the water-treated leaves, to successfully complete Koch's postulates. To the best of our knowledge, this is the first report of P. buxi causing Volutella blight on boxwood in China. References: (1) J. L. Bezerra. Acta Botanica Neerlandica 12:58, 1963. (2) B. Henricot et al. Plant Pathol. 49:805, 2000. (3) F. Shi and T. Hsiang. Eur. J. Plant Pathol. 138:763, 2014.
11
Li, Qian, Yiya Chen, and Ziyu Xiong. "Tianjin Mandarin." Journal of the International Phonetic Association 49, no. 1 (July 12, 2017): 109–28. http://dx.doi.org/10.1017/s0025100317000287.
Full textAbstract:
Tianjin Mandarin is a member of the northern Mandarin Chinese family (ISO 693-3: [cmn]). It is spoken in the urban areas of the Tianjin Municipality (CN-12) in the People's Republic of China, which is about 120 kilometers to the southeast of Beijing. Existing studies on Tianjin Mandarin have focused mainly on its tonal aspects, especially its intriguing tone sandhi system, with few studies examining the segmental aspects (on tone, see e.g. Li & Liu 1985, Shi 1986, Liu 1993, Lu 1997, Wang & Jiang 1997, Chen 2000, Liu & Gao 2003, Ma 2005, Ma & Jia 2006, Zhang & Liu 2011, Li & Chen 2016; on segmental aspects, see e.g. Han 1993a, b; Wee, Yan & Chen 2005). As also noted in Wee et al. (2005), this is probably due to the similarity in segmental structures between Tianjin Mandarin and Standard Chinese, especially among speakers of the younger generation, and what differentiates the two Mandarin varieties is most notably their tonal systems. The aim of the present description is therefore to provide a systematic phonetic description of both segmental and tonal aspects of Tianjin Mandarin, with main focus on the tonal aspects.
12
TSE, PRISCILLA. "Long Hu Wu Shi (Kung Fu Stuntmen). 2020. Directed by Wei Junzi, 92 minutes. Hong Kong and Beijing, China: Hong Kong Stuntman Association and Acme Image (Beijing) Film Cultural Co." Yearbook for Traditional Music 54, no. 2 (December 2022): 190–95. http://dx.doi.org/10.1017/ytm.2022.13.
Full text
13
Lee, Chang Wook. "The History of “Yan-Yun 16 Prefectures” during the Five Dynasties: Focusing on the Later Jin dynasty, 936-947." Korean Society of Human and Nature 4, no. 2 (December 31, 2023): 41–69. http://dx.doi.org/10.54913/hn.2023.4.2.41.
Full textAbstract:
Historically, “Yan-Yun 16 Prefectures (燕雲16州)” were some of the important strategical places in early imperial China. These areas, which started in modern day Datong (大同) and ended in Tianjin (天津), included the capital city, Beijing (北 京) and were just below location of the Great Wall (長城). The main reason why the “Yan-Yun 16 Prefectures” were created by the imperial Chinese government was to better defend the border from threatening nomadic tribes such as the Xiongnu (匈奴), Xianbei (鮮卑), Youran (柔然), Turks (突厥) and Khitans (契丹), who had consistently attempted to break into the economically and culturally prospering Chinese empire. In other words, imperial China installed the prefectures as a major military bases to solidify state security.
Although there are many past studies on the “Yan-Yun 16 Prefectures,” there are still many un-answered historical questions, including why the Later Jin (後晉) had ceded this strategic area to the Khitan Empire. More specifically, why the first emperor of the Later Jin agreed to this bad policy decision made by his main political advisor Sang Weihan (桑維翰)? And Why did Sang himself, who was one of the top elites in the Chinese Empire, made such a suggestion to the emperor? Finally, during the cessation of the prefectures to the Khitans, what was the position and role of the military warlords, Liu Zhiyuan (劉知遠) and Zhao Dejun (趙德鈞)?
In order to answer these questions, this paper is delved into the historical background of the “Yan-Yun 16 Prefectures” in the first chapter and examines the strategic importance of these areas from the Qin-Han (秦漢) through late Tang (唐後期). Following this, the paper investigates the main reasons as to why the Later Jin ceded the prefectures to the Khitan empire through carefully analyzing the roles of four individuals, specifically emperor Shi Jingtang (石敬塘), Sang Weihan, Liu Zhiyuan and Zhao Dejun. Finally, in the last chapter, the paper discusses the historical significance of the “Yan-Yun 16 Prefectures” through analysis of the Later period of Five Dynasties up to mid Northern Song when the Chinese Empire significantly re-established its diplomatic relations with the Koryo dynasty in 1071.
Through the re-examination of the “Yan-Yun 16 Prefectures,” this paper hope to make an academic contribution to the scholarly world and help us to understand the politically / militarily significant areas in imperial Chinese history.
14
Benton, Gregor. "Otto Brauns frühes Wirken in China (1932–1935) (Otto Braun's Early Activity in China (1932–1935). By Freddy Litten. [Munich: Osteuropa-Institut, April 1988. Working Paper, No. 124, mimeographed. 133 pp.] - Li De yu Zhongguo geming (youguan ziliao) (Li De and the Chinese Revolution [Relevant Materials]). Edited by Shi Zhifu and Zhou Wenqi. [Beijing: Zhonggong dangshi ziliao chubanshe, December 1987. 352 pp.]." China Quarterly 118 (June 1989): 373–74. http://dx.doi.org/10.1017/s0305741000017987.
Full text
15
Wang, Z., Y. Wang, L. Jerzak, and Z. Zhang. "Nest site selection of the Magpie Pica pica sericea in Beijing of China." Studia Biologica 4, no. 1 (2010): 71–82. http://dx.doi.org/10.30970/sbi.0401.106.
Full text
16
Smith, Milton R. "Review of C−H Activation. Topics in Current Chemistry, 292 Review of C−H Activation. Topics in Current Chemistry, 292 . Edited by Jin-Quan, Yu (Scripps Research Institute, La Jolla, CA) and Zhangjie, Shi (Peking University, Beijing, China). Springer-Verlag : Berlin, Heidelberg . 2010 . xx + 384 pp. $309. ISBN 978-3-642-12355-9 ." Journal of the American Chemical Society 133, no. 10 (March 16, 2011): 3684. http://dx.doi.org/10.1021/ja200038d.
Full text
17
Dimitrova, Radina Plamenova, and Karla Sánchez Domínguez. "Historia del arte chino: la creación de capital cultural sobre China en América Latina." Interacción Sino-Iberoamericana / Sino-Iberoamerican Interaction 2, no. 2 (September 1, 2022): 297–308. http://dx.doi.org/10.1515/sai-2022-0014.
Full textAbstract:
Resumen El objetivo de esta reseña es presentar ante el amplio auditorio hispanohablante la publicación de una obra de gran valor cultural para los estudios sinológicos en América Latina: los cuatro volúmenes de Historia del arte chino, publicados entre 2020 y 2021 por la Universidad Veracruzana (México), en colaboración con la Universidad Renmin de Beijing y la Cambridge University Press. La divulgación de obras como ésta surge a raíz del proyecto China Book International (CBI) que pretende difundir libros sobre temas de la historia y la cultura de China. Según Bourdieu, el valor de una obra se construye a partir del reconocimiento de los otros con la intervención de agentes, instituciones, premios, traducciones, canales de divulgación, entre otros. Este texto pretende, en primer lugar, reconstruir los elementos que redimensionan el valor de una obra como Historia del arte chino, subrayando su importancia como bien cultural relacionado con el conocimiento sobre China. Asimismo, se dará cuenta de los contenidos y su estructura de los cuatro volúmenes de la obra, para informar a los lectores e investigadores hispanohablantes de la existencia de esta aportación al capital cultural sobre China en lengua castellana, además de motivarlos a acercarse a esta valiosa publicación.
18
ZHANG, ZHI-SHENG, SHUQIANG LI, and GUO ZHENG. "Comb-tailed spiders from Xishuangbanna, Yunnan Province, China (Araneae, Hahniidae)." Zootaxa 2912, no. 1 (June 9, 2011): 1. http://dx.doi.org/10.11646/zootaxa.2912.1.1.
Full textAbstract:
Spiders of the family Hahniidae from the rainforest area of Xishuangbanna are examined. Totally 7 species, including 5 new species are reported: Alistra annulata sp. nov. (male), A. hippocampa sp. nov. (male, female), Hahnia saccata sp. nov. (male, female), H. submaginii sp. nov. (male, female) and H. senaria sp. nov. (male, female). Two known species, Hahnia flagellifera Zhu, Chen & Sha, 1989 (male, female) and H. himalayaensis Hu & Zhang, 1990 (male, female) are firstly recorded from Yunnan Province and redescribed here. The genus Alistra is firstly recorded from China. Morphological descriptions, illustrations and photos of all species are given. All specimens are deposited in the Institute of Zoology, Chinese Academy of Sciences in Beijing (IZCAS).
19
Billah, Md Baki. "Determination of perfluorinated compounds (PFCs) in the fine particulate matter (PM2.5) in China." Jahangirnagar University Journal of Biological Sciences 5, no. 1 (September 25, 2016): 21–27. http://dx.doi.org/10.3329/jujbs.v5i1.29740.
Full textAbstract:
Perfluorinated chemicals (PFCs) can be absorbed on fine particulate matter (PM2.5) and used as stain, water and grease repellent in a wide range of consumer products. Among the PFCs, perfluorooctane sulfonate (PFOS) and perfluoro octanoic acid (PFOA) are widely detected in human blood and serum and are of concern due to their potential toxicity. In the present experiment, fine particulate matter (PM2.5) from some northern (Beijing, Xian) and southern (Hong Kong, Guangzhou and Xiamen) cities of China were collected and analyzed for perfluoro butanoic acid (PFBA), perfluoro hexanoic acid (PFHxA), perfluoro octanoic acid (PFOA), perfluoro nonanoic acid (PFNA), perfluoro decanoic acid (PFDA), perfluoro undecanoic acid (PFUdA), perfluoro dodecanoic acid (PFDoA), perfluoro hexanesulfonate (PFHxS) and perfluoro octanesulfonate (PFOS) using liquid chromatography mass spectrometry (LC-MS/MS). The total PFCs ranged from 121.2 to 192.2pg/m3, leading by Guangzhou followed by Xian, Beijing, Xiamen and Hong Koung. Among the nine measured PFCs compounds, the level of PFHxS was below the limit of detection in all the sampling cities. The other eight PFCs (PFOS, PFDoA, PFUdA, PFDA, PFNA, PFOA, PFHxA and PFBA) were detected in all the sampling locations except PFDoA in Hong Kong samples. Human exposure estimated to PFCs for adults showed PFOS as the dominant inhaled compound representing 1.59, 1.15, 1.0 and 1.0 ng/day exposure for Hong Kong, Guangzhou, Xiamen, Beijing and Xian respectively. Results from this study contribute to our understanding of exposure pathways of PFCs to humans.Jahangirnagar University J. Biol. Sci. 5(1): 21-27, 2016 (June)
20
Towery, Britt E. "The Contribution of Lao She to the Three-Self Principle and the Protestant Churches of China." Missiology: An International Review 22, no. 1 (January 1994): 89–101. http://dx.doi.org/10.1177/009182969402200108.
Full textAbstract:
This paper analyzes the distant though pertinent relationship the modern Chinese writer Lao She (1899–1966) had with the principle of self-supporting, self-governing, and self-propagating Chinese Christian churches. He became a Christian in Peking (Beijing) in 1922. This “people's artist” was hounded to his death by the Red Guards in the Cultural Revolution. A pioneer in modem Chinese literature, his work revealed the language, the joys, and the hurts of the common people of China. He believed his country and its Christianity needed to be Chinese-led, and not dependent upon the foreigner for funds and direction.
21
Zhang, Donghui. "农民工子女教育过程与分层功能研究 [Educational process and function of stratification for migrant children]. 史秋霞 [Shi, Qiuxia]. 北京, 中国: 社会科学 文献出版社 [Beijing, China: Social Sciences Academic Press], 2017. 210 pp., (paperback), RMB 69, ISBN: 978-7-5201-0062-5." Frontiers of Education in China 13, no. 3 (September 2018): 448–50. http://dx.doi.org/10.1007/s11516-018-0021-1.
Full text
22
Li, Z. J., Z. H. Guo, N. Wang, Z. Y. Xu, Y. Qu, X. Q. Wang, J. Sun, et al. "Cognitive–behavioural therapy for patients with schizophrenia: a multicentre randomized controlled trial in Beijing, China." Psychological Medicine 45, no. 9 (December 23, 2014): 1893–905. http://dx.doi.org/10.1017/s0033291714002992.
Full textAbstract:
BackgroundMeta-analyses support the efficacy of cognitive–behavioural therapy (CBT) for schizophrenia in western cultures. This study aimed to compare the efficacy of CBT and supportive therapy (ST) for patients with schizophrenia in China.MethodA multicentre randomized controlled, single-blinded, parallel-group trial enrolled a sample of 192 patients with schizophrenia. All patients were offered 15 sessions of either CBT or ST over 24 weeks and followed up for an additional 60 weeks. All measures used were standardized instruments with good reliability and validity. The Positive and Negative Syndrome Scale (PANSS) was used to assess symptoms of schizophrenia. The Schedule for Assessing Insight (SAI) was used to assess patients’ insight and the Personal and Social Performance Scale (PSP) was used to assess their social functioning.ResultsEffect-size analysis showed that patients made rapid improvements in all symptoms, insight and social functioning as measured by the PANSS, SAI and PSP at 12 and 24 weeks and maintained these improvements over the course of the study to 84 weeks. Patients in the CBT group showed significantly greater and more durable improvement in PANSS total score (p = 0.045, between-group d = 0.48), positive symptoms (p = 0.018, between-group d = 0.42) and social functioning (p = 0.037, between-group d = 0.64), with significant differences emerging after completion of therapy.ConclusionsBoth CBT and ST combined with medication had benefits on psychopathology, insight and social functioning of patients with schizophrenia. CBT was significantly more effective than ST on overall, positive symptoms and social functioning of patients with schizophrenia in the long term.
23
Zhang, Jing, Zhen Zheng, and Binbin Guo. "Sensitivity and uncertainty-based evaluation and simulation of MIKE SHE model in Guishui River Basin, Beijing, China." International Journal of Water 11, no. 2 (2017): 103. http://dx.doi.org/10.1504/ijw.2017.083760.
Full text
24
Zhang, Jing, Zhen Zheng, and Binbin Guo. "Sensitivity and uncertainty-based evaluation and simulation of MIKE SHE model in Guishui River Basin, Beijing, China." International Journal of Water 11, no. 2 (2017): 103. http://dx.doi.org/10.1504/ijw.2017.10004523.
Full text
25
Tong, An-Ni, Jun-Wei Zhang, Hong-Jun Zhou, He-Hu Tang, Jin-Zhu Bai, Fang-Yong Wang, Zhen Lv, et al. "Ischemic damage may play an important role in spinal cord injury during dancing." Spinal Cord 58, no. 12 (June 19, 2020): 1310–16. http://dx.doi.org/10.1038/s41393-020-0503-x.
Full textAbstract:
Abstract Study design Retrospective analysis. Setting China Rehabilitation Research Center, Beijing, China. Objective To explore possible mechanisms underlying spinal cord injury (SCI) in children caused by hyperextension of the spine while dancing. Methods The clinical records of 88 children with SCI (mean age, 5.97 years; age range, 4–10 years) admitted to our hospital from January 1989 to October 2019 were retrospectively reviewed. Computed tomography and magnetic resonance imaging were performed on the day of injury. The time from injury to development of paralysis, as well as post-injury activities were surveyed, while abnormal patterns on images, the range of the involved vertebrae, and the extents of edema and atrophy were assessed. Results Among the 88 patients, 6 (6.8%) were unable to move immediately after SCI, while paralysis occurred in 42, 23, and 17 patients at <30, 30–60, and >60 min after SCI, respectively. The neurological level of injury of 84 patients was between T4 and T12. On sagittal T2-weighted images (T2WIs), the longitudinal range of spinal cord edema was more than one vertebral body in 65 patients, while spinal cord atrophy below T8 was found in 40 patients. On axial T2WIs, although three patients had none, long T2 signals were found in the central gray matter of seven patients. Meanwhile, necrosis of the central area combined with the peripheral white matter was observed in 57 patients, while three patients had total involvement on a cross section. Conclusion Ischemia-related damage, rather than direct trauma to the spinal cord, may play an important role in SCI due to spinal hyperextension during dancing.
26
Guo, Jianping, Xinyan Chen, Tianning Su, Lin Liu, Youtong Zheng, Dandan Chen, Jian Li, et al. "The Climatology of Lower Tropospheric Temperature Inversions in China from Radiosonde Measurements: Roles of Black Carbon, Local Meteorology, and Large-Scale Subsidence." Journal of Climate 33, no. 21 (November 1, 2020): 9327–50. http://dx.doi.org/10.1175/jcli-d-19-0278.1.
Full textAbstract:
AbstractThe variability of the lower tropospheric temperature inversion (TI) across China remains poorly understood. Using seven years’ worth of high-resolution radiosonde measurements at 120 sites, we compile the climatology of lower tropospheric TI in terms of frequency, intensity, and depth during the period from 2011 to 2017. The TI generally exhibits strong seasonal and geographic dependencies. Particularly, the TI frequency is found to be high in winter and low in summer, likely due to the strong aerosol radiative effect in winter. The frequency of the surface-based inversion (SBI) exhibits a “west low, east high” pattern at 0800 Beijing time (BJT), which then switches to “west high, east low” at 2000 BJT. Both the summertime SBI and elevated inversion (EI) reach a peak at 0800 BJT and a trough at 1400 BJT. Interestingly, the maximum wintertime EI frequency occurs over Southeast China (SEC) rather than over the North China Plain (NCP), likely attributable to the combination of the heating effect of black carbon (BC) originating from the NCP, along with the strong subsidence and trade inversion in SEC. Correlation analyses between local meteorology and TI indicate that larger lower tropospheric stability (LTS) favors more frequent and stronger TIs, whereas the stronger EI under smaller LTS conditions (unstable atmosphere) is more associated with subsidence rather than BC. Overall, the spatial pattern of the lower tropospheric TI and its variability in China are mainly controlled by three factors: local meteorology, large-scale subsidence, and BC-induced heating. These findings help shed some light on the magnitude, spatial distribution, and underlying mechanisms of the lower tropospheric TI variation in China.
27
Zhang, Z. Z., S. Pan, and S. F. Li. "First Report of Chrysanthemum chlorotic mottle viroid in Chrysanthemum in China." Plant Disease 95, no. 10 (October 2011): 1320. http://dx.doi.org/10.1094/pdis-04-11-0335.
Full textAbstract:
During the spring of 2008, a chrysanthemum plant showing mild mottle on young leaves was observed in a garden in Beijing, China. After the plant was moved into a greenhouse, symptoms became severe with obvious yellowing and complete chlorosis on new leaves. In addition, when a survey was conducted for chrysanthemum diseases in 2010, plants with mild chlorotic spots on leaves were also found occasionally in a commercial field in Hainan, China. These symptoms resembled symptoms induced by Chrysanthemum chlorotic mottle viroid (CChMVd). Therefore, total RNA of 13 samples collected from Beijing (cultivar unknown) and Hainan (cv. Golden) was extracted according to Li et al. (2) and tested for CChMVd by northern blot hybridization using DIG-labeled CChMVd cRNA probe (1). All samples were CChMVd positive, and the healthy control was negative. The viroid was further confirmed by reverse transcription (RT)-PCR using CChMVd specific primers (forward: 5′-AGGTCGTA(T)AAACTTCCCCTCTAAA(G)CG-3′, homologous to nucleotides 134 to 159; and reverse: 5′-TCCAGTCGAGACCTGAAGTGGGTTTC-3′, complementary to nucleotides 133 to 108) (1). Two amplified products of approximately 400 bp were cloned into the pGEM-T vector (Promega, Madison, WI) and transformed into E. coli DH5α competent cells. Two positive clones were obtained from each isolate and sequenced. Four sequences obtained have been submitted to GenBank (Accession Nos. HQ891014 to HQ891017). Sequence analysis revealed that the obtained sequences shared 96.49 to 96.99% similarity with the reference sequence CChMVd (GenBank Accession No. NC003540). All the clones are 399 nucleotides long and are thought to be the symptomatic type based on their UUUC sequence at positions 82 to 85 in the CChMVd tetraloop (1). In addition, both isolates were mechanically inoculated to three healthy chrysanthemum plants of the unknown cultivar from Beijing. All inoculated plants developed chlorosis after 5 weeks and CChMVd infections were confirmed by northern blot hybridization and RT-PCR. CChMVd is an important pathogen that may potentially cause losses to the chrysanthemum industry. It is necessary to survey for CChMVd infection in various chrysanthemums cultivated in China. To our knowledge, this is the first report of CChMVd in chrysanthemum in China. References: (1) P. M. De la Pena et al. Proc. Natl. Acad. Sci. USA. 96:9960, 1999. (2) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.
28
Idrizi, Bashkim, and Mirdon Kurteshi. "Web System for Online and Onsite Usage of Geoinformation by Surveying Sector in Kosovo. Case Study: Ferizaj Municipality." Geosfera Indonesia 4, no. 3 (November 25, 2019): 230. http://dx.doi.org/10.19184/geosi.v4i3.13469.
Full textAbstract:
The purpose of research to determine and contribute in more efficient services to geoinformation stakeholders, as well as to give positive impact on increasing income in geo business sector, voluntary based web system for online usage of geoinformation in Kosovo has been developed. The method used was puting in to one place many sourcec via WMS and WFS services, by creating thematic SDI, in order to have online system with dynamic data comming from official databases with update from last day on 5 pm. System is open for usage by all interested parts, however official registration is required. It contains geoinformation from many databases such as cadastral, orthophoto, municipal, and basemaps from open layers. The results show that the system is extendable and it is permanently including new datasets based on the user requirements. All available data is linked via web services, which gives an opportunity to users to use the updated version of datasets as they are published by responsible institution via www (world wide web).
Keywords: web map, geoportal, geoinformation, web services, Kosovo
References
Alameh. N, (2010). Service chaining of interoperable Geographic Information Web Services. Global Science and Technology. Greenbelt, USA.
Brimicombe, A.J. (2002). GIS-where are the frontiers now. GIS 2002. Bahrain.
Bryukhanova, E. A., Krupochkin, Y. P., & Rygalova, M. V. (2018). Geoinformation technologies in the reconstruction of the social space of siberian cities at the turn of the 19–20th centuries (case study of the city of tobolsk). Journal of Siberian Federal University - Humanities and Social Sciences, 11(8), 1229-1242. doi:10.17516/1997-1370-0303
Chaudhuri, S. (2015). Application of Web Based Geographical Information Systems in e-business. Maldives.
Davis, C.A. and Alves L.L. (2007). Geospatial web services, Vicosa, Brazil.
ESRI. (2003). Spatial Data Standards and GIS interoperability. White paper. ESRI. CA. USA.
Ferdousi, . and Al-Faisal, A. (2018). Urban and regional planning. Rajshahi University of Engineering and Technology. Rajshahi. Bangladesh.
Gitis, V., Derendyaev, A., & Weinstock, A. (2016). Web-based GIS technologies for monitoring and analysis of spatio-temporal processes. International Journal of Web Information Systems, 12(1), 102-124. doi:10.1108/IJWIS-10-2015-0032
Glasze, G., & Perkins, C. (2015). Social and political dimensions of the OpenStreetMap project: Towards a critical geographical research agenda doi:10.1007/978-3-319-14280-7_8
Henzen, C. (2018). Building a framework of usability patterns for web applications in spatial data infrastructures. ISPRS International Journal of Geo-Information, 7(11) doi:10.3390/ijgi7110446
Idrizi, B. (2009). Developing of National Spatial Data Infrastructure of Macedonia according to global standardization (GSDI and INSPIRE) and local status. Conference of Nikodinovski. Skopje. Macedonia.
Idrizi, B. (2018). General Conditions of Spatial Data Infrastructure. International Journal on Natural and Engineering Sciences. Turkey.
Idrizi, B. Sulejmani, V. Zimeri, Z. (2018). Multi-scale map for three levels of spatial planning data sets for the municipality of Vitia in Kosova. 7th ICC&GIS conference. Sozopol. Bulgaria.
Mwange, C., Mulaku, G. C., & Siriba, D. N. (2018). Reviewing the status of national spatial data infrastructures in africa. Survey Review, 50(360), 191-200. doi:10.1080/00396265.2016.1259720
Nikolov, B. P., Zharkikh, J. I., Soloviev, A. A., Krasnoperov, R. I., & Agayan, S. M. (2015). Integration of data mining methods for earth science data analysis in GIS environment. Russian Journal of Earth Sciences, 15(4) doi:10.2205/2015ES000559
Sahin, K. and Gumusay, M.U. (2008). Service oriented architecture based web services for geographic information systems. The international archives of the remote sensing, photogrammetry and spatial information sciences. Vol XXXVII. Beijing. China.
Sayar, A. (2008). GIS service oriented architecture. Community grids laboratory. IN, USA.
Shi, S. (2015). Design and development of an online geoinformation service delivery of geospatial models in the united kingdom. Environmental Earth Sciences, 74(10), 7069-7080. doi:10.1007/s12665-015-4243-8
Siles, G., Charland, A., Voirin, Y., & Bénié, G. B. (2019). Integration of landscape and structure indicators into a web-based geoinformation system for assessing wetlands status. Ecological Informatics, 52, 166-176. doi:10.1016/j.ecoinf.2019.05.011
Ummadi, P. (2008). Standards and Interoperability in GIS, Michigan State University. MI, USA.
Vorobev, A. V., & Shakirova, G. R. (2016). Web-based geoinformation system for exploring geomagnetic field, its variations and anomalies doi:10.1007/978-3-319-29589-3_2
Walter, V., & Sörgel, U. (2018). Implementation, results, and problems of paid crowd-based geospatial data collection. PFG - Journal of Photogrammetry, Remote Sensing and Geoinformation Science, 86(3-4), 187-197. doi:10.1007/s41064-018-0058-z
Copyright (c) 2019 Geosfera Indonesia Journal and Department of Geography Education, University of Jember
This work is licensed under a Creative Commons Attribution-Share A like 4.0 International License
29
Zhen, Wang, Alfred Tovias, Peter Bergamin, Menachem Klein, Tally Kritzman-Amir, and Pnina Peri. "Book Reviews." Israel Studies Review 35, no. 1 (March 1, 2020): 109–26. http://dx.doi.org/10.3167/isr.2020.350108.
Full textAbstract:
Aron Shai, China and Israel: Chinese, Jews; Beijing, Jerusalem (1890–2018) (Boston: Academic Studies Press, 2019), 270 pp. Hardback, $90.00. Paperback, $29.95.Raffaella A. Del Sarto, Israel under Siege: The Politics of Insecurity and the Rise of the Israeli Neo-Revisionist Right (Washington, DC: Georgetown University Press, 2017), 298 pp. Paperback, $26.94.Dan Tamir, Hebrew Fascism in Palestine, 1922–1942 (London: Palgrave Macmillan, 2018), 210 pp. Hardback, $99.99.Alan Dowty, Arabs and Jews in Ottoman Palestine: Two Worlds Collide (Bloomington: Indiana University Press, 2019), 312 pp. Hardback, $65.00.Guy Ben-Porat and Fany Yuval, Policing Citizens: Minority Policy in Israel (New York: Cambridge University Press, 2019), 250 pp. Hardback, $89.99.Deborah Golden, Lauren Erdreich, and Sveta Roberman, Mothering, Education and Culture: Russian, Palestinian and Jewish Middle-Class Mothers in Israeli Society (London: Palgrave Macmillan, 2017), 225 pp. Hardback, $114.25.
30
Wei, Zhe, Litao Wang, Simeng Ma, Fenfen Zhang, and Jing Yang. "Source Contributions of PM2.5in the Severe Haze Episode in Hebei Cities." Scientific World Journal 2015 (2015): 1–11. http://dx.doi.org/10.1155/2015/480542.
Full textAbstract:
Beijing-Tianjin-Hebei area is one of the most polluted areas in China. This paper used the Fifth-Generation Penn State/NCAR Mesoscale Model (MM5) and Model-3/Community Multiscale Air Quality (CMAQ) modeling system to quantify the source contribution to PM2.5in Hebei cities in order to obtain an in-depth understanding haze process in January and February 2013, using the Multiresolution Emission Inventory for China (MEIC). The result showed that PM2.5were mainly originated from the southern Hebei (SHB) with the fractions of 70.8% and 66.4% to Shijiazhuang, 70.6% and 63.9% to Xingtai, and 68.5% and 63.0% to Handan in January and February 2013, respectively. The northern Hebei (NHB) contributed 69.8% and 70.7% to Zhangjiakou, 68.7% and 66.2% to Chengde, and 57.7% and 59.6% to Qinhuangdao in January and February. In Cangzhou, Hengshui, and Langfang, regional joint policy making should be implemented due to the pollution of multiple sources. In Baoding and Tangshan, industrial emissions contributed 38.1% and 41.9% of PM2.5to Baoding and 39.8% and 45.8% to Tangshan in January and February, respectively. Industrial and domestic emissions should be controlled in Tangshan and Baoding, especially for industrial emissions of NHB.
31
주신전 and ChoiSeokBeom. "Effects of E-Servicescape on SBI Attractiveness, Customer Trust and Customer Loyalty in China Internet Shopping Malls -Focused on Beijing-." 전자무역연구 13, no. 2 (May 2015): 1–28. http://dx.doi.org/10.17255/etr.13.2.201505.1.
Full text
32
Dobkin, Bruce H., Armin Curt, and James Guest. "Cellular Transplants in China: Observational Study from the Largest Human Experiment in Chronic Spinal Cord Injury." Neurorehabilitation and Neural Repair 20, no. 1 (March 2006): 5–13. http://dx.doi.org/10.1177/1545968305284675.
Full textAbstract:
Background. In China, fetal brain tissue has been transplanted into the lesions of more than 400 patients with spinal cord injury (SCI). Anecdotal reports have been the only basis for assuming that the procedure is safe and effective. Objective. To compare available reports to the experiences and objective findings of patients who received pre-operative and postoperative assessments before and up to 1 year after receiving cellular implants. Methods. Independent observational study of 7 chronic SCI subjects undergoing surgery by Dr Hongyun Huang in Beijing. Assessments included lesion location by magnetic resonance imaging, protocol of the American Spinal Injury Association (ASIA), change in disability, and detailed history of the perioperative course. Results. Inclusion and exclusion criteria were not clearly defined, as subjects with myelopathies graded ASIA A through D and of diverse causes were eligible. Cell injection sites did not always correlate with the level of injury and included the frontal lobes of a subject with a high cervical lesion. Complications, including meningitis, occurred in 5 subjects. Transient postoperative hypotonicity may have accounted for some physical changes. No clinically useful sensorimotor, disability, or autonomic improvements were found. Conclusions. The phenotype and the fate of the transplanted cells, described as olfactory ensheathing cells, are unknown. Perioperative morbidity and lack of functional benefit were identified as the most serious clinical shortcomings. The procedures observed did not attempt to meet international standards for either a safety or efficacy trial. In the absence of a valid clinical trials protocol, physicians should not recommend this procedure to patients.
33
HENNEMANN, FRANK H., OSKAR V. CONLE, and WEIWEI ZHANG. "Catalogue of the Stick and Leaf-insects (Phasmatodea) of China, with a faunistic analysis, review of recent ecological and biological studies and bibliography (Insecta: Orthoptera: Phasmatodea)." Zootaxa 1735, no. 1 (March 31, 2008): 1. http://dx.doi.org/10.11646/zootaxa.1735.1.1.
Full textAbstract:
A complete taxonomic catalogue of the Stick and Leaf-insects (Phasmatodea) recorded or described from the mainland China (excluding Taiwan) is presented. 241 valid species are listed, which are currently attributed to 50 genera, 5 families and 7 subfamilies. Genera and species are listed alphabetically. All available type-data is provided based mainly on literary sources for species described by Chinese workers from 1986 to 2006, including documented depository of typespecimens. The catalogue therefore also provides complete lists of the type-material of Phasmatodea housed in the following Chinese institutions: Administration of Baishuijiang Natural Reserve (ABNR), Beijing Forestry University, Beijing (BFU), China Agricultural University, Beijing (CAU), Geological Museum of China, Beijing (GMC), Inca Science Ltd., Chongqing (INCA), Institute of Zoology, Chinese Academy of Sciences, Beijing (IZCAS), Department of Biology, Nankai University, Tianjin (NKU), Northwest Sci-Tech University of Agriculture and Forestry, Shaanxi (NWAU), Institute of Zoology, Shaanxi Normal University, Xi’an (SNU), Institute of Entomology, Sun Yat-sen University (ICRI), Shanghai Institute of Entomology, Academia Sinica, Shanghai (SIES), Tianjin Natural History Museum, Tianjin (TMNH), Zhejiang Museum of Natural History, Hangzhou (ZMNH). The known distribution of each species, inmeans of provinces is provided as well. 14 species are shown to have been recorded from China in error, several of these based on misidentifications. The “Phasmatodea-like” fossil taxa described from the Late Jurassic Yixian Formation of North Hebei and West Liaoning are listed in a separate section. Two new generic synonyms are recognized: Arthminotus Bi, 1995 synonymised with Lopaphus Westwood, 1859 (n. syn.) and Dianphasma Chen & He, 1997 synonymised with Parasosibia Redtenbacher, 1908 (n. syn.). The genus Linocerus Gray, 1835 (Type-species: Linocerus gracilis Gray, 1835) was erroneously synonymised with the mediterranean Bacillus St. Fargeau & Audinet-Serville, 1825 and is here re-established in Phasmatidae: Pachymorphinae: Gratidiini (rev. stat.). Relationship to Clonaria Stål, 1875 (= Gratidia Stål, 1875, = Paraclonaria Brunner v. Wattenwyl, 1893), Sceptrophasma Brock & Seow-Choen, 2000 and Macellina Uvarov, 1940 is obvious. 21 species are transferred to other genera (new combinations): Asceles dilatatus Chen & He, 2004 and Asceles quadriguttatus Chen & He, 1996 to Pachyscia Redtenbacher, 1908, Arthminotus sinensis Bi, 1995 to Lopaphus Westwood, 1859, Baculum dolichocercatum Bi & Wang, 1998 and Baculum politum Chen & He, 1997 to Medauroidea Zompro, 1999, Dixippus hainanensis Chen & He, 2002, Dixippus huapingensis Bi & Li, 1991, Dixippus nigroantennatus Chen & He, 2002, Dixippus parvus Chen & He, 2002 and Entoria bobaiensis Chen, 1986 to Lonchodes Gray, 1835, Sipyloidea obvius Chen & He, 1995 to Sinophasma Günther, 1940, Paramyronides biconiferus Bi, 1993, Paramyronides leishanensis Bi, 1992, Lonchodes chinensis Brunner v. Wattenwyl, 1907, Lonchodes confucius Westwood, 1859 and Phasgania glabra Günther, 1940 to Phraortes Stål, 1875, Gratidia bituberculata Redtenbacher, 1889 and Leptynia xinganensis Chen & He, 1993 to Sceptrophasma Brock & Seow-Choen, 2002, Prosentoria bannaensis Chen & He, 1997 to Paraentoria Chen & He, 1997, and Mantis squeleton Olivier, 1792 to Phanocloidea Zompro, 2002. Acrophylla sichuanensis Chen & He, 2001 remains of unknown generic assignment, but is shown to be not a member of the Australian genus Acrophylla Gray, 1835. Furthermore, as Baculum Saussure, 1861 is a neotropical genus and most Old World species previously attributed to this genus are now listed in Ramulus Saussure, 1861, all Chinese species described in Baculum Saussure are consequently transferred to Ramulus Saussure. Other changes of specific placements are based on published literature and concern to the following three synonymies not recognized by Chinese workers: Abrosoma Redtenbacher, 1906 (= Prosceles Uvarov, 1940), Necroscia Audinet-Serville, 1838 (= Aruanoidea Redtenbacher, 1908), Lopaphus Westwood, 1859 (= Paramyronides Redtenbacher, 1908). Megalophasma Bi, 1995 is transferred from Necrosciinae to Lonchodinae. Four lectotypes are designated and three new specific synonyms revealed. A lectotype is designated for Rhamphophasma modestus Brunner v. Wattenwyl, 1893, the type-species of Rhamphophasma Brunner v. Wattenwyl, 1893, in order to fix this genus and species. The male paralectotype is shown to be a male of Parapachymorpha nigra Brunner v. Wattenwyl, 1893, the type-species of Parapachymorpha Brunner v. Wattenwyl, 1893. Clitumnus porrectus Brunner v. Wattenwyl, 1907 is synonymised with Bacillus ? artemis Westwood, 1859 and a lectotype designated for the former (n. syn.). A lectotype is designated for Oxyartes lamellatus Kirby, 1904 in order to fix this taxon and confirm the synonymy established by Dohrn, 1910 (= Oxyartes honestus Redtenbacher, 1908, = Oxyartes spinosissimus Carl, 1913). Paracentema stephanus Redtenbacher, 1908 is shown to have been erroneously synonymised with Neohirasea japonica (de Haan, 1842) and here synonymised with Neohirasea maerens (Brunner v. Wattenwyl, 1907) (n. syn.). In order to fix this new synonymy a lectotype is designated for Paracentema stephanus Redtenbacher, 1908. Finally, a biogeographic analysis of the Chinese phasmid fauna is presented. This includes brief background information on the topography and biogeography of China along with maps showing the seven zoogeographical subregions currently recognized as well as the 4 municipalities, 23 provinces, 5 autonomous regions and 2 special administrative regions of China. A summary of the taxonomic compilation of the fauna is provided and its relationships with neighbouring regions, of both the Palaearctic and Oriental realms, are discussed. A study is presented on the distribution of the taxa and species densities of each province / autonomous region. Recent ecological studies are summarized and list of the host plants of 42 different species attached. The pest status of certain species which have become of serious importance for agriculture in China is briefly summarized based on literary sources.
34
Scott, Andrew C. "YANG, Y., ZOU, R., SHI, Z. & JIANG, R. (eds) 1996. Atlas for Coal Petrography of China. vi + 323 pp. Beijing: China University of Mining and Technology Press. Price US $198.00 (hard covers). ISBN 7 81040 519 5. POTTER, J., STASIUK, L. D. & CAMERON, A. R. (eds) 1998. A Petrographic Atlas of Canadian Coal Macerals and Dispersed Organic Matter. viii + 105 pp. Calgary: Geological Survey of Canada, jointly with the Canadian Society for Coal Science and Organic Petrology and the Canmet Energy Technology Centre. Price C$138.00 (C$117.30 for members of the Society); hard covers. ISBN 0 660 17538 X." Geological Magazine 136, no. 6 (November 1999): 697–711. http://dx.doi.org/10.1017/s0016756899353322.
Full text
35
Liu, Lang, Naifang Bei, Jiarui Wu, Suixin Liu, Jiamao Zhou, Xia Li, Qingchuan Yang, et al. "Effects of stabilized Criegee intermediates (sCIs) on sulfate formation: a sensitivity analysis during summertime in Beijing–Tianjin–Hebei (BTH), China." Atmospheric Chemistry and Physics 19, no. 21 (October 30, 2019): 13341–54. http://dx.doi.org/10.5194/acp-19-13341-2019.
Full textAbstract:
Abstract. Sulfate aerosols have profound impacts on the climate, ecosystem, visibility, and public health, but the sulfate formation pathway remains elusive. In the present study, a source-oriented WRF-Chem model is applied to simulate a persistent air pollution episode from 4 to 15 July 2015 in Beijing–Tianjin–Hebei (BTH), China, to study the contributions of four pathways to sulfate formation. When comparing simulations to measurements in BTH, the index of agreement (IOA) of meteorological parameters, air pollutants, and aerosol species generally exceeds 0.6. On average in BTH, the heterogeneous reaction of SO2 involving aerosol water and the SO2 oxidation by OH constitutes the two most important sulfate sources, with a contribution of about 35 %–38 % and 33 %–36 %, respectively. Primary sulfate emissions account for around 22 %–24 % of the total sulfate concentration. SO2 oxidation by stabilized Criegee intermediates (sCIs) also plays an appreciable role in sulfate formation, with a contribution of around 9 % when an upper limit of the reaction rate constant of sCIs with SO2 (κsCI+SO2=3.9×10-11 cm3 s−1) and a lower limit of the reaction rate constant of sCIs with H2O (κsCI+H2O=1.97×10-18 cm3 s−1) are used. Sensitivity studies reveal that there are still large uncertainties in the sulfate contribution of SO2 oxidation by sCIs. The sulfate contribution of the reaction is decreased to less than 3 % when κSCI+SO2 is decreased to 6.0×10-13 cm3 s−1. Furthermore, when κsCI+H2O is increased to 2.38×10-15 cm3 s−1 based on the reported ratio of κSCI+H2O to κSCI+SO2 (6.1×10-5), the sulfate contribution becomes insignificant at less than 2 %. Further studies need to be conducted to better determine κsCI+SO2 and κsCI+H2O to evaluate the effects of sCI chemistry on sulfate formation.
36
Liu, Yunxiang, An Xiao, Fan Zhang, Luying Zhang, and Luying Liao. "Analysis of Precipitation Zone Forecasts and Examination of Numerical Forecasts for Two Heavy Rainfall Processes in June 2019 in Jiangxi, China 2019." Atmosphere 15, no. 1 (January 22, 2024): 137. http://dx.doi.org/10.3390/atmos15010137.
Full textAbstract:
Warm zone rainstorms and frontal rainstorms are two types of rainstorms that often occur in the rainy season in Jiangxi (located in the eastern part of China). The ability to correctly identify the type of rainstorms is important for accurate forecasting of rainstorms. Two heavy rainstorms took place in Jiangxi province. The first heavy rainstorm occurred from 20:00 BJT (Beijing Time) on 6 June to 20:00 BJT on 9 June (referred to as the “6.9” process) and another heavy rainstorm occurred from 20:00 BJT on 21 June to 20:00 BJT on 22 June (referred to as the “6.9” process), 2019. We analyzed the two rainstorms’ processes by using ground-based observation data, NCEP/FNL reanalysis data, ECMWF and CMA-SH9 numerical forecasting products. The results show that: “6.9” process is a warm area rainstorm, and a strong northeast cold vortex exists at 500 hPa geopotential height. The northwesterly flow behind the northeast cold vortex trough is stronger. The position of the northern edge of the subtropical high pressure is more south than that at “6.22” process. The rainstorm is in the precipitation zone of the warm temperature ridge over 925 hPa geopotential height, and with more convective character than “6.22” process. The process of “6.22” is a frontal rainstorm. The convective character of precipitation is weaker. The rainstorm precipitation zones are in a strong temperature front area at 925 hPa geopotential height and there is a tendency for vertical convection to develop into oblique upward convection in the late stage of the rainstorm. The precipitation location and intensity forecast by CMA-SH9 at the “6.9” process is better than that of ECMWF, while ECMWF’s prediction of the precipitation zone and weather condition of the “6.22” process is better.
37
AYAN, Erdal, Fatih TOY, Onur TÜRKTAN, and Mehmet GÖKCE. "Bibliometric Analysis of Academic Studies on Student Support Systems in Open and Distance Learning." Anadolu Üniversitesi Sosyal Bilimler Dergisi 23, no. 4 (December 24, 2023): 1489–516. http://dx.doi.org/10.18037/ausbd.1312165.
Full textAbstract:
The aim of this research is to conduct a bibliometric analysis of educational studies utilising Student Support Systems (SSS) in Open and Distance Learning, as indexed and scanned in the Web of Science (WoS) database under SCI-Expanded, SSCI, and A&HCI. The study employs descriptive and bibliometric analysis methods including journal articles exported as a .txt file from the WoS database. The data (6.366 open-access articles between 2013 and 2023) have been mapped using the VOSviewer. The research findings indicate that the majority of educational studies involving SSS in Open and Distance Learning are constituted by articles, with the number of publications beginning to rise from 2017 and the highest number of publications occurring in 2021. The authors receiving the most shared citations in this field have been identified as Dragan Gasevic, Sanna Jarvela, Abelardo Pardo and Jonna Malmberg respectively. The countries producing the most publications related to Student Support Systems in Open and Distance Learning are, in order, the USA, Australia, the People's Republic of China, Taiwan, Spain, Canada, and Turkey. From the perspective of country citation analysis, the USA has received the most citations and the institutions receiving the most citations are the University of Hong Kong in Hong Kong, Monash University in Australia, Beijing Normal University in the People's Republic of China, and the National University of Science and Technology in Taiwan. Finally, the most frequently used keywords in published studies have been found to be, in order, higher education, e-learning, online learning, and learning analytics.
38
Li, Baoping, and Guoqing Zhao. "Expectations and Experiences of Technology-Rich Classrooms of Preservice and In-service Teachers in China." Journal of Education and Development 3, no. 3 (December 17, 2019): 52. http://dx.doi.org/10.20849/jed.v3i3.673.
Full textAbstract:
Technology-Rich Classrooms (TRCs) have been increasingly constructed in K12 schools. Existing studies revealed that to what extent TRCs play a role in shaping teaching and learning depends on what teachers expect to do and what they do with TRCs. This study aimed at exploring the gap between teachers’ experiences of existing TRCs and their expectations of ideal TRCs. A total of 194 preservice teachers studying at Beijing Normal University (BNU) and 149 in-service teachers who enrolled in a master program at BNU participated in the study. The Smart Classroom Inventory (SCI) a ten-component inventory revised from the previous study, was used to collect the data. Independent-samples t-tests and paired-samples t-tests revealed that: (a) both preservice teachers and in-service teachers reported significantly lower experiences of TRCs than their expectations of ideal ones in terms of most dimensions, with the only exception that preservice teachers’ Technology usage. (b) Whether in existing TRCs, or in ideal ones, both preservice teachers and in-service teachers reported relative lower scores of Flexibility, Learning data, Differentiation, Investigation, and Cooperation than other dimensions. (c) Preservice teachers reported significantly higher scores of Flexibility, Technology usage, Learning data, Differentiation, Investigation, and Cooperation than in-service teachers, while in-service teachers reported significantly higher scores of Physical design, Student Cohesiveness, Equity, and Learning experiences than preservice teachers.4) Preservice teachers reported significantly higher expectation of ideal Physical design, Differentiation than in-service teachers, while they reported significantly lower expectations of ideal Flexibility, Student Cohesiveness, Equity, and Learning experience than in-service teachers. Implications for preservice teachers’ education and in-service teachers’ professional development were discussed.
39
Andreeva, Galina O., Miroslav M. Odinak, Vasiliy N. Tsygan, Igor' V. Litvinenko, and Svetlana A. Mamaeva. "Event I. The development of oriental medicine in Russia in the XVIII-XIX centuries. The role of scientists of the Imperial Medico-Surgical (Military Medical) Academy." Russian Military Medical Academy Reports 42, no. 4 (December 9, 2023): 469–77. http://dx.doi.org/10.17816/rmmar607433.
Full textAbstract:
The article presents the history of nascence traditional oriental medicine in Russia during XVIII–XIX centuries. The first information about oriental medicine was brought to Russia in the XVIII century by doctors, who visited Mongolia and China as members of embassy expeditions. The first decades of the XVIII century can be considered as beginning of a systematic study oriental treatment methods. It was possible thanks to the many years efforts of the employees of the Russian ecclesiastical mission in Beijing. This organization from 1715 to 1864 years served religious, diplomatic and scientific functions. An invaluable contribution to the study of Chinese medicine was made by the leaders of the mission. Major role belongs to Nikita Yakovlevich Bichurin (father Iakinf), archimandrite of the IX mission. He was fluent in Chinese, studied the primary sources of medical literature, translated significant treatises into Russian, and taught Chinese to the mission staff. The head of the X mission, Pavel Ivanovich Kamensky, compiled a Chinese-Russian medical dictionary, reorganized the mission, and insisted on the need to introduce the position of a doctor among the staff. Starting from 1821, doctors O.P. Voitsekhovsky, P.E. Kirillov, A.A. Tatarinov, S.I. Bazilevsky and P.A. Kornievsky, graduates of the Imperial Medical and Surgical (Military Medical) Academy worked as physician of the X–XIV missions. Doctors continued to study the theoretical concepts of Chinese medicine, philosophical and cultural traditions that underlie healthcare. In addition to medical work, in accordance with the instructions of the Medical Council at the Ministry of Foreign Affairs, they explored epidemiology, healthcare organization and the process of training doctors in China, analyzed Eastern approaches in the diagnosis and treatment of diseases, pharmacopoeia, used of herbal remedies, methods of prevention and health maintenance. The scientific approach, knowledge of the Chinese language, and a long stay in the country allowed them to lay the foundations of Oriental medicine in Russian, acquaint medical community with the methods of treatment and prevention of diseases adopted in China, introduce acupuncture, moxa, the use of new types of herbal remedies, enrich the collections of medicinal plants.
40
Niu, Y. B., L. Qing, M. Yao, D. F. Wang, J. D. Liu, and J. S. Wang. "First Report of Tobacco mosaic virus in Abutilon theophrasti in China." Plant Disease 93, no. 11 (November 2009): 1221. http://dx.doi.org/10.1094/pdis-93-11-1221b.
Full textAbstract:
Velvetleaf (Abutilon theophrasti Medic), a tall, fecund, self-fertile annual plant in the family Malvaceae, is widely grown in China as a fiber crop and for its medicinal properties. In July of 2008, we observed diffuse chlorotic and necrotic spots on the oldest leaves of velvetleaf plants in the field in Shanxi Province. Sap extracts from six symptomatic plants were tested by direct antigen coated ELISA using polyclonal antibodies specific to Potato virus Y (PVY) and monoclonal antibodies specific to Tomato mosaic virus (ToMV), Cucumber mosaic virus (CMV), and Tobacco mosaic virus (TMV). Five of the six samples were negative for ToMV, CMV, and PVY but positive for TMV. Double-stranded RNA extracted from leaves of the five velvetleaf plants was used as template for reverse transcription (RT)-PCR as described by Krajačića et al. (1) and Li et al. (2) with some modifications. One-step RT-PCR was performed using a Quant One Step RT-PCR Kit (TIANGEN BIOTECH CO., LTD., Beijing, China) with sense (5′-CTGTTTAGCCGGTTTGGT-3′), and antisense (5′-TCCCTTTACGGACATCAC-3′) primers (3) designed to specifically amplify a fragment of the movement protein coding region of TMV. The expected 470-bp fragments were amplified from dsRNA from these five plants and the amplicon from each plant was cloned and sequenced (GenBank Accession No. FJ873800). Comparisons of a consensus sequence derived from the five amplicons with the nucleotide sequences available in the NCBI database using BLAST showed 99% identity with TMV from South Korea (GenBank Accession No. AB354955) and Spain (Accession No. AJ308692) and 98% with TMV from China (Accession No. AF165190). The serological, RT-PCR results and sequence data revealed that these velvetleaf plants were infected by TMV. On the basis of the serological analysis and genome sequence comparisons, this isolate was tentatively designated as TMV-Velvetleaf. To our knowledge, this is the first report of TMV in Abutilon theophrasti Medic in China. References: (1) M. Krajačić et al. J. Chromatogr A. 1144:111, 2007. (2) H. Li et al. Agric. Sci. Chin. 6:86, 2007. (3) Y. B. Niu et al. Chin. Biotechnol. 29:76, 2009.
41
Li, C. J., Z. F. Wang, N. Chen, and Z. B. Nan. "First Report of Choke Disease Caused by Epichloë typhina on Orchardgrass (Dactylis glomerata) in China." Plant Disease 93, no. 6 (June 2009): 673. http://dx.doi.org/10.1094/pdis-93-6-0673b.
Full textAbstract:
Orchardgrass or cocksfoot (Dactylis glomerata L.) has been widely cultivated as a forage crop in many provinces of China (1). It is also a native perennial forage grass, which grows at the edge of forests, shrubs, and mountainous grasslands in Xinjiang and Sichuan (2). In September of 2007, signs of choke disease on orchardgrass were observed in a native grassland under birch woodland near Altai City, Xinjiang, China. Stromata, which formed on culms of diseased grass, enclosing the inflorescence and leaf sheath, were 4.5 to 5.5 mm long, smooth or wrinkled, white and later becoming yellowish or yellow, tuberculate, dry, and covered with perithecia. Inflorescences surrounded by fungal stromata were choked and failed to mature, thus restricting seed production. Pure cultures were obtained by directly scraping stromata from the surface and incubating it on antibiotic potato dextrose agar (PDA). The colonies were cottony, white on the upper surface, and white to yellow on the reverse. The growth rate was 13 to 21 mm per week at 25°C on PDA. Conidia were hyaline, lunate to reniform, and measured 4.1 ± 0.5 × 2.2 ± 0.5 μm. They accumulated in small globose heads at the tips of conidiogenous cells and were produced singly on conidiophores of 13 to 33 μm long and 2.7 to 4.1 μm wide at the base. Internal transcribed spacer (ITS) sequence by BLAST search had 99% similarity with an Epichloë typhina isolate of orchardgrass in Spain (GenBank Accession No. AM262420.1). Cultural characteristics, microscopic examination, and phylogenetic analysis showed that this choke disease on D. glomerata was caused by the fungus E. typhina (Pers.) Tul. & C. Tul. as described by White (4). To our knowledge, this is the first report of E. typhina causing choke disease on orchardgrass in China. The pathogen has been identified in France, England, Germany, Sweden, Switzerland, and the United States (3,4) with the same symptoms as those reported here. In 1997, choke disease was found in 70% of the fields in the Willamette Valley of Oregon, with disease incidences ranging from 0.05 to 28%. It was predicted to increase and spread under the prevailing climatic conditions (3). This new disease report is to provide observational and diagnostic information to help with recognition and prevention of disease spread in orchardgrass cultivation regions of China. References: (1) X. R. Chao et al. Shandong Agric. Sci. 1:7, 2005. (2) S. X. Jia, ed. China Forage Plant Flora. China Agriculture Press, Beijing, 1987. (3) W. F. Pfender and S. C. Alderman. Plant Dis. 83:754, 1999. (4) J. W. White. Mycologia 85:444, 1993.
42
Goldstein, Jonathan. "China and Israel: Chinese, Jews; Beijing, Jerusalem (1890–2018) Aron Shai Boston: Academic Studies Press, 2019 xii + 260 pp. $29.95 ISBN 978-1-6128-118-95-0." China Quarterly 238 (June 2019): 564–65. http://dx.doi.org/10.1017/s0305741019000638.
Full text
43
Dai, Y. C. "First Report of Sapwood Rot of Peach Caused by Schizophyllum commune in China." Plant Disease 89, no. 7 (July 2005): 778. http://dx.doi.org/10.1094/pd-89-0778a.
Full textAbstract:
Peach,Prunus persica (L.) Batsch, is widely cultivated in gardens and plantations in northern China. During the summer of 2002, a severe sapwood rot of 5-year-old saplings was observed in a commercial nursery near Tieling, Liaoning Province, northeast China, 42°24′N, 123°55′E. More than 80% of saplings were infected and 35% were dead. Leaves were chlorotic or necrotic and dry, and wood discoloration and white sapwood rot were observed in cross sections of infected trees. Basidiocarps on the diseased trees were identified as Schizophyllum commune Fr.:Fr. (2); on potato dextrose agar (PDA), isolates obtained from decayed wood yielded colonies characteristic of S. commune as well (3). Basidiocarps had been initiated in early June and sometimes fruited over the entire length of the stem and some parts of major branches. Liaoning Province had an abnormally cold winter in 2001 and freeze injury may have predisposed the saplings to S. commune. In addition to P. persica, P. pseudocerasus Lindl. and P. salicina Lindl. were symptomatic. Pathogenicity was confirmed by inoculation of healthy saplings of peach in the greenhouse. Saplings were subjected to freezing for 1 week and 15 were inoculated with S. commune and five were inoculated with agar. Mycelial plugs, grown for 9 days on PDA, were the inoculum for stem wounds. The inoculated area was then covered by wet cotton and wrapped in Parafilm for 2 weeks. Symptoms developed on 14 of 15 inoculated saplings after 6 weeks. Symptoms progressed from chlorotic leaves to decayed bark and wood. After 10 weeks, 11 saplings were dead. The pathogen was reisolated from 13 of 14 symptomatic saplings, and fruiting bodies of S. commune developed on eight saplings. Control saplings remained symptomless. In China and the United States, S. commune is widely reported as a saprotroph or opportunistic pathogen of many woody angiosperms (4) and some gymnosperms (1). To our knowledge, this is the first report of S. commune causing sapwood rot of P. persica in China. References: (1) D. F. Farr et al. Fungal Databases, Systematic Botany and Mycology Laboratory. On-line publication. ARS, USDA, 2005. (2) J. P. Lindsey et al. Bibl. Mycol. 63:1, 1978. (3) M. K. Nobles. Can. J. Res. Sect. C Bot. Sci. 26:281, 1948. (4) F. L. Tai. Sylloge Fungorum Sinicorum. Science Press, Beijing, 1979.
44
Yin, L. F., G. K. Chen, S. N. Chen, S. F. Du, G. Q. Li, and C. X. Luo. "First Report of Brown Rot Caused by Monilia mumecola on Chinese Sour Cherry in Chongqing Municipality, China." Plant Disease 98, no. 7 (July 2014): 1009. http://dx.doi.org/10.1094/pdis-01-14-0029-pdn.
Full textAbstract:
Cherry is widely planted in China, from Liaoning, Beijing, Hebei, Shandong, Zhejiang, Jiangsu, and Anhui provinces (eastern China), to Shaanxi, Sichuan, Chongqing, and Guizhou provinces (western China). The brown rot fungus Monilinia fructigena causes considerable production losses in cherry production in Liaoning Province (3). In May 2013, Chinese sour cherry (Prunus pseudocerasus) cv. Wupi displaying symptoms of brown rot was found in an orchard in Chongqing municipality. Diseased cherry fruit had a brown rot sporulating with grayish, conidial tufts. The fruit later succumbed to the soft rot or shivered and became a mummy. Single-spore isolations on PDA resulted in colonies with concentric rings of pigmented mycelium with lobbed margins. Conidia were broadly ellipsoid to subglobose, occasionally even globose, with an average size of 16 × 12.7 μm. Multiple germ tubes were produced from each conidium, a germination pattern unique to Monilia mumecola (1,2,4). The pathogen identity was confirmed by multiplex PCR as described by Hu et al. (2). The PCR resulted in a 712-bp amplicon, which is diagnostic of M. mumecola. Further sequencing of the internal transcribed spacer (ITS) region 1 and 2 and 5.8S gene further indicated 100% identity with that of M. mumecola isolates from China (Accession No. HQ908786) and from Japan (AB125613, AB125614, and AB125620). Koch's postulates were confirmed by inoculating mature cherry fruit with mycelia plugs. Inoculated fruit were placed in a sterilized moist chamber, and incubated at 22°C with 12 h light/dark cycle. Inoculated fruit developed typical brown rot symptoms only 2 days after inoculation, while the control fruit, inoculated with a sterile PDA plug, remained healthy. The pathogen isolated from inoculated symptomatic fruit was confirmed to be M. mumecola based on morphological characteristics and germination pattern. It should be noted that the conidia on inoculated fruit showed an average size of 20 × 15.3 μm, significantly bigger than that of from PDA, and most produced more than three germ tubes. The inoculation experiments were performed in triplicates. M. mumecola was first reported as the causal agent of brown rot of mume in Japan in 2004 (1). Later studies demonstrated that it is also pathogen on other stone fruits, e.g., peach, nectarine (2), and apricot (4). To our knowledge, this is the first report of cherry brown fruit rot caused by M. mumecola, and the first report of M. mumecola in Chongqing municipality. References: (1) Y. Harada et al. J. Gen. Plant Pathol. 70:297, 2004. (2) M. J. Hu et al. Plos One 6(9): e24990, 2011. (3) Z. H. Liu et al. J. Fruit Sci. 29:423, 2012. (4) L. F. Yin et al. Plant Dis. 98:694, 2014.
45
Li, Z. Y., Z. M. Hao, J. G. Dong, D. Wu, and Z. Y. Cao. "First Report of Elm Yellows Subgroup 16SrV-B Phytoplasma as the Cause of Rose Balsam Phyllody in China." Plant Disease 98, no. 4 (April 2014): 565. http://dx.doi.org/10.1094/pdis-07-13-0778-pdn.
Full textAbstract:
Rose balsam (Impatiens balsamina L.) is an ornamental species frequently cultivated in China and the red flower is often used as nail polish in rural regions. The phytoplasmas previously reported with rose balsam phyllody in China have been classified as aster yellows group (16SrI) (1). In August 2012, some rose balsams were observed with typical phytoplasma symptoms in Handan City, Hebei Province, China, with an incidence of about 70% in the fields. The flowers turned green and petals fascicled. The new leaves wrinkled and deformed and internodes shortened. Infected plants were stunted, matured prematurely, and failed to produce seeds. To confirm phytoplasma infection, 100 mg of plant tissue (leaves, petals) was collected from five symptomatic and four asymptomatic plants and total DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) method (2). The 16S rDNA gene was amplified by nested PCR using primer pair P1/P7 followed by R16F2n/R16R2 (3). No amplicons were generated with DNA from asymptomatic samples, but amplicons of approximately 1.2 kb were obtained with DNA from five symptomatic samples. The amplified products were purified with aTIANgel midi purification kit (Tiangen, Beijing) and sequenced at the Sangon Biotech facility (Shanghai, China). The sequences of the amplicons were 100% identical and deposited in NCBI GenBank (Accession No. KC993832). The 16S rDNA gene sequence from this phytoplasma was 99% similar to Jujube witches broom phytoplasma (JQ675716), Puna chicory flat stem phytoplasma (JN582266), Plum yellows phytoplasma (FJ459914), and other elm yellows group phytoplasmas by BLAST search of the NCBI database. Restriction fragment length polymorphism (RFLP) analyses were carried out by digesting the 1.2-kb R16F2n/R16R2 nested PCR product with restriction enzymes AluI, RsaI, HhaI, HpaI, Eco RI, TaqI, HaeIII, HinfI, and KpnI (Takara, Dalian). The 16S rDNA RFLP patterns matched that of Jujube witches broom phytoplasma (JWB, subgroup 16SrV-B) (4). Nucleotide sequences of rose balsam phyllody were analyzed by iPhyClassifier software, which revealed that it had maximum similarity to the reference pattern of 16Sr group V, subgroup B (AB052876). All samples were detected with transmission electron microscopy. The results showed phytoplasma-like cells in phloem sieve element of symptomatic plants, while no phytoplasma-like cells were observed in healthy phloem tissues. The phytoplasma cells ranged from 230 to 470 nm in diameter and were ellipsoidal or orbicular with visible membranes. Combining the RFLP pattern and sequence analysis by iPhyClassifier, we classified the phytoplasma causing rose balsam phyllody into subgroup 16SrV-B. To our knowledge, this is the first report of 16SrV-B group phytoplasmas infecting rose balsam in China. References: (1) Z. N. Li et al. J. Phytopathol. 159:799, 2011. (2) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. 81:8014, 1984. (3) I. M. Lee et al. Phytopathology 83:834, 1993. (4) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998.
46
Lyu, M. D., M. J. Li, J. Li, X. M. Li, and Y. Q. Cheng. "First Report of Grapevine leafroll-associated virus 7 in Two Native Grape Varieties in China." Plant Disease 97, no. 1 (January 2013): 150. http://dx.doi.org/10.1094/pdis-08-12-0760-pdn.
Full textAbstract:
Grapevine leafroll disease (GLD) is one of the most economically important diseases of cultivated grapevines (Vitis vinifera), causing decrease in yield, as well as decreasing the sugar levels and increasing the acidity of the berries (1). There are currently at least 10 serologically distinct viruses, referred to as grapevine leafroll-associated viruses (GLRaVs), from the family Closteroviridae that are associated with leafroll disease (4). China is one of the world's leading grape producers, and nearly 75% of the vineyards in China are located in Xinjiang Uygur Autonomous Region, and Hebei, Shandong, Gansu, Ningxia, and Yunnan provinces. Grapevine leafroll-associated virus 7 (GLRaV-7) isolates have been reported so far in Liaoning (GQ849392, GQ849393, and JF927943) and Henan (EF093187) provinces in China (3). The four Chinese isolates were isolated respectively from grape varieties, Cabernet Sauvignon (GQ849392, GQ849393), Centennial Seedless (JF927943), and Semillon (EF093187), and these grape varieties are introduced from abroad. Cow's Nipple and Dragon's Eye are old grape varieties native to China. Cow's nipple is extensively cultivated in Xinjiang Uygur Autonomous Region, while Dragon's Eye is widely planted in Heibei Province. To determine if GLRaV-7 was present in these two varieties, six samples (three per variety) were collected from six individual grapevines showing GLD-like symptoms in two vineyards in Xinjiang Uygur Autonomous Region and Hebei Province, respectively, in September 2011. Total RNA extracts obtained from phloem scrapings of samples using the RNeasy plant mini kit (QIAGEN) were tested by reverse transcription (RT)-PCR with primers F1 (5′-TATATCCCAACGGAGATGGC-3′) and R1 (5′-ATGTTCCTCCACCAAAATCG-3′) (2) specific to the heat shock protein 70 homologue (HSP-70 gene) of GLRaV-7. All samples produced a single band of the expected size of 502 bp. One GLRaV-7-specific amplicon per variety was cloned into pMD 18-T simple vector (TaKaRa). Plasmid DNA was purified using Column Plasmid DNAOUT (TIANDZ, Beijing, China) from three individual clones and sequenced from both directions. The sequence of the two isolates (GenBank Accession Nos. JX494722 and JX494723) shared 97.81% identity at the nucleotide level and 100% identity at the amino acid level. A pairwise comparison of HSP-70 sequences of the two isolates from this report with nine corresponding sequences of GLRaV-7 isolates (including four previously reported Chinese isolates) showed nucleotide sequence identities ranging from 91.24% (EF093187) to 98.80% (GQ849392). These samples were further analyzed by double antibody sandwich (DAS)-ELISA using antibody specific to GLRaV-7 (NEOGEN Europe, Ayr, Scotland) according to the manufacturer's instructions, and the results confirmed the presence of the virus in these samples that were positive by RT-PCR. To our knowledge, this is the first report of GLRaV-7 occurring in native grape varieties in China. These results could be helpful in developing sound diagnostic systems for implementing efficient disease management strategies. References: (1) B. Akbas et al. Hort. Sci. 36:97, 2009. (2) E. Engel et al. Plant Dis. 92:1252, 2008. (3) X. Fan et al. Acta Hortic. Sinica 39:949, 2012. (4) G. P. Martelli. Extended Abstr. 16th Meet. International Council for the Study of Virus and Virus-like Diseases of Grapevines (ICVG). 15-23, 2009.
47
Li, G. F., M. S. Wei, J. Ma, and S. F. Zhu. "First Report of Broad bean wilt virus 2 in Echinacea purpurea in China." Plant Disease 96, no. 8 (August 2012): 1232. http://dx.doi.org/10.1094/pdis-04-12-0409-pdn.
Full textAbstract:
Field-grown Echinacea purpurea plants showing necrosis, leaf roll, yellow mosaic, and mosaic symptoms in leaves were collected in June 2010 in Huairou, Beijing, China. ELISAs of extracts of four samples showed that one sample with mosaic symptoms had a positive reaction with Broad bean wilt virus 2 (BBWV-2) monoclonal antibody provided by Professor X. P. Zhou (1). The monoclonal antibody recognized the 44.7 kD coat protein subunit of BBWV-2. We used Chenopodium quinoa as an assay species to isolate the virus by sap transmissions and to maintain the virus strain. Sap from infected C. quinoa, when inoculated onto indicator plant species, induced the following symptoms: C. quinoa: local lesions in inoculated leaves, systemic chlorotic mottle in upper leaves, deformation, and apical necrosis; C. amaranticolor: chlorotic local lesions, systemic mosaic and leaf distortion; Nicotiana benthamiana: systemic mosaic; Gomphrena globosa: local purple spots in inoculated leaves and systemic infection in upper leaves; Tetragonia expansa: local lesions, but no symptoms of systemic infection; Physalis floridana: systemic mosaic. No symptoms were observed on Capsicum annuum, Datura stramonium, N. glutinosa, or N. tabacum cv. White Burley. To confirm BBWV-2 infection, total RNAs extracted from infected C. quinoa leaves were reverse transcripted to cDNA using oligo-dT primer (T17V). The primer pair Fab5′R1F (5′-AAATATTAAAACAAACAGCTTTCGTT-3′) and Fab5′R1R (5′-TTCAAAGCTCGTGCCATNTYATTKGC-3′) for specific detection of the Fabavirus genus (2) was used for PCR analysis. The amplified fragment is between the 5′-terminal non-translatable region (NTR) and the beginning of the coding region of RNA1. Amplicons of approximately the expected size (~391 bp) were produced from the virus-infected C. quinoa and a BBWV-2 positive control (ATCC PV131, PV0537). Amplicons of approximately the expected size (~350 bp) were produced from the BBWV-1 positive control (ATCC PV132). However, no such amplicons were observed from healthy C. quinoa plants and water control. The 391-bp amplicons of RNA1 obtained from the infected C. quinoa were cloned and sequenced. Comparison with sequences of other BBWV-2 isolates showed that the isolate we obtained (No. JX070674) had approximately 99% nt identity (98% amino acid identity) with Chinese BBWV-2 isolate BC (No. FJ485686.1) (3). As an ornamental and medicinal plant, E. purpurea is widely cultivated in northern China. Up until now, Tomato ring spot virus, Tobacco rattle virus, Cucumber mosaic virus, and Tomato spotted wilt virus have been detected or isolated from E. purpurea in the world (4). To our knowledge, this is the first report of BBWV-2 infecting E. purpurea in China. BBWV-2-infected E. purpurea may have less secondary metabolites, which could influence the quality and therapeutic efficacy of this herbal medicine. References: (1) L. Qing et al. Acta Microbiologica Sinica 40:166, 2000. (2) R. M. Ferrer et al. J. Virol. Methods 144:156, 2007. (3) C. Sui et al. Plant Dis. 93:844, 2009. (4) B. Dikova. Bulgarian J. Agric. Sci. 17:306, 2011.
48
Bai, Q., Y. Xie, R. Dong, J. Gao, and Y. Li. "First Report of Volutella Blight on Pachysandra Caused by Volutella pachysandricola in China." Plant Disease 96, no. 4 (April 2012): 584. http://dx.doi.org/10.1094/pdis-11-11-0997.
Full textAbstract:
Pachysandra (Pachysandra terminalis, Buxaceae) and Japanese Pachysandra, also called Japanese Spurge, is a woody ornamental groundcover plant distributed mostly in Zhejiang, Guizhou, Henan, Hubei, Sichuan, Shanxi, and Gansu provinces in China. In April 2010, P. terminalis asymptomatic plants were shipped from Beijing Botanical Garden Institute of Botany Chinese Academy of Science to the garden nursery of Jilin Agricultural University (43°48′N, 125°23′E), Jilin Province. In June 2011, Volutella blight (sometimes called leaf blight and stem canker) of P. terminalis was observed on these plants. Infected leaves showed circular or irregular, tan-to-brown spots often with concentric rings and dark margins. The spots eventually grew and coalesced until the entire leaf died. Cankers appeared as greenish brown and water-soaked diseased areas, subsequently turning brown or black, and shriveled and often girdled the stems and stolons. During wet, humid weather in autumn, reddish orange, cushion-like fruiting structures of the fungus appeared on the stem cankers and undersides of leaf spots. Symptoms of the disease were consistent with previous descriptions (2–4). Five isolates were obtained from necrotic tissue of leaf spots and cankers of stems and stolons and cultured on potato dextrose agar. The colony surface was salmon colored and slimy. Conidia were hyaline, one celled, spindle shaped, and 12.57 to 22.23 × 3.33 to 4.15 μm with rounded ends. Morphological characteristics of the fungus were consistent with the description by Dodge (2), and the fungus was identified as Volutella pachysandricola (telemorph Pseudonectria pachysandricola). The internal transcribed spacer (ITS) regions of the nuclear rDNA were amplified using primers ITS4/ITS5 (1). The ITS sequences were 553 bp long and identical among these five isolates (GenBank Accession No. HE612114). They were 100% identical to Pseudonectria pachysandricola voucher KUS-F25663 (Accession No. JN797821) and 99% identical to P. pachysandricola culture-collection DAOM (Accession No. HQ897807). Pathogenicity was confirmed by spraying leaves of clonally propagated cuttings of P. terminalis with a conidial suspension (1 × 106 conidia/ml) of the isolated V. pachysandricola. Control leaves were sprayed with sterile water. Plants were covered with plastic bags and kept in a greenhouse at 20 to 25°C for 72 h. After 5 to 8 days, typical disease symptoms appeared on leaves, while the control plants remained healthy. V. pachysandricola was reisolated from the leaf spots of inoculated plants. Pachysandra leaf blight and stem canker also called Volutella blight, is the most destructive disease of P. terminalis and previously reported in the northern humid areas of the United States (Illinois, Connecticut, Ohio, Indiana, Iowa, Massachusetts, Missouri, Kentucky, and Wisconsin), northern Europe (Britain, Germany, and Poland), and the Czech Republic. To our knowledge, this is the first report of the disease caused by V. pachysandricola in China. The disease may become a more significant problem in P. terminalis cultivation areas if the disease spreads on P. terminalis in nursery beds. References: (1) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (2) B. O. Dodge. Mycologia 36:532, 1944. (3) S. M. Douglas. Online publication. Volutella Blight of Pachysandra. The Connecticut Agricultural Experiment Station, 2008. (4) I. Safrankova. Plant Protect. Sci.43:10, 2007.
49
Wang, H. C., W. H. Li, M. S. Wang, Q. Y. Chen, Y. G. Feng, and J. X. Shi. "First Report of Botrytis cinerea Causing Gray Mold of Tobacco in Guizhou Province of China." Plant Disease 95, no. 5 (May 2011): 612. http://dx.doi.org/10.1094/pdis-01-11-0064.
Full textAbstract:
Tobacco (Nicotiana tabacum L.) is a leafy, annual, solanaceous plant grown commercially for its leaves. Guizhou Province produces more than 30% of the total Chinese tobacco crop. In July 2010, a disease was observed in a commercial field of 5-month-old N. tabacum plants in Bijie, Guizhou in southwestern China. Symptoms first appeared on the leaves as small spots that later increased in size and developed into expanded, dark brown lesions covered with green-gray spore masses. Lesions expanded rapidly under cool, humid conditions. Isolates of Botrytis cinerea were collected from diseased leaves with typical symptoms. Diseased leaf samples were washed with distilled water three times, placed in a moist chamber, and incubated at 25°C in darkness for 48 h to encourage sporulation. Spores produced on leaves were transferred to individual agar discs (5 mm in diameter) with an inoculating needle and then the agar discs were transferred to potato dextrose agar (PDA) and incubated at 25°C for 7 days. Fungal colonies were at first colorless and later became gray to brown when the conidia differentiated. The size of conidia ranged from 5.0 to 9.5 × 6.5 to 12.5 μm (average 7.3 × 8.7 μm) based on 50 spore measurements. Microsclerotia produced in the culture were round or irregular and ranged from 1.2 to 3.0 × 1.0 to 2.5 mm (average 2.1 × 2.0 mm). The pathogen was identified as B. cinerea Pers.:Fr on the basis of morphology and sequence of ITS1-5.8s-ITS2 region of rDNA amplified by PCR using universal primers ITS-1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS-4 (5′-TCCTCCGCTTATTGATATGC-3′). The sequence (GenBank Accession No. HQ902163) exactly matched the sequences of two Botryotinia fuckeliana (anamorph B. cinerea) accessions, (e.g., GenBank Accession Nos. HM849615.1 and HM849047.1). Koch's postulates were conducted by wound inoculating five tobacco leaves (cv. K326) after surface disinfesting them with 5% NaOCl. Plugs of the fungus (5 mm in diameter) obtained from the colony margins were transferred onto 3 × 3 mm wounds made with a needle on the surface of five sterilized leaves. Inoculated leaves were incubated at 25°C, 100 to 120 μE·m–2·s–1, relative humidity >80%, and 16 h light per day for disease development. Typical symptoms developed on leaves within 7 days after inoculation. The pathogen was reisolated from affected leaves but not from the noninoculated control leaves. Botrytis gray mold blight has been recorded on N. tabacum in New Zealand, the United Kingdom, and northern China (1–3). However, to our knowledge, this is the first report of Botrytis blight on N. tabacum in Guizhou Province of China and the disease must be considered in existing disease management practices. References: (1) W. Brian et al. Mol. Plant Pathol. 8:561, 2007. (2) A. G. Mcleod et al. N. Z. J. Crop Hortic. Sci/Exp. Agric. 12:866, 1958. (3) Z. Y. Zhang. Page 37 in: Flora Fungorum Sinicorum. Vol. 26. Science Press, Beijing, 2006.
50
Wang, Q., X. P. Zhou, and J. X. Wu. "First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum)." Plant Disease 98, no. 4 (April 2014): 572. http://dx.doi.org/10.1094/pdis-07-13-0727-pdn.
Full textAbstract:
The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.