Journal articles: 'Biocompatible $$x chemistry'

1

Šugár, Peter, Barbora Ludrovcová, Jaroslav Kováčik, Martin Sahul, and Jana Šugárová. "Laser-Based Ablation of Titanium–Graphite Composite for Dental Application." Materials 13, no. 10 (May 18, 2020): 2312. http://dx.doi.org/10.3390/ma13102312.

Full text

Abstract:

Biocompatible materials with excellent mechanical properties as well as sophisticated surface morphology and chemistry are required to satisfy the requirements of modern dental implantology. In the study described in this article, an industrial-grade fibre nanosecond laser working at 1064 nm wavelength was used to micromachine a new type of a biocompatible material, Ti-graphite composite prepared by vacuum low-temperature extrusion of hydrogenated-dehydrogenated (HDH) titanium powder mixed with graphite flakes. The effect of the total laser energy delivered to the material per area on the machined surface morphology, roughness, surface element composition and phases transformations was investigated and evaluated by means of scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), confocal laser-scanning microscopy (CLSM) and X-ray diffraction analysis (XRD). The findings illustrate that the amount of thermal energy put to the working material has a remarkable effect on the machined surface properties, which is discussed from the aspect of the contact properties of dental implants.

APA, Harvard, Vancouver, ISO, and other styles

2

Wang, Chang-Hai, Chi-Jen Liu, Cheng-Liang Wang, Chia-Chi Chien, Y. Hwu, Ru-Shi Liu, Chung-Shi Yang, Jung-Ho Je, Hong-Ming Lin, and G. Margaritondo. "Intense X-ray induced formation of silver nanoparticles stabilized by biocompatible polymers." Applied Physics A 97, no. 2 (August 20, 2009): 295–300. http://dx.doi.org/10.1007/s00339-009-5377-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Baron, Raluca Ioana, Gabriela Biliuta, Vlad Socoliuc, and Sergiu Coseri. "Affordable Magnetic Hydrogels Prepared from Biocompatible and Biodegradable Sources." Polymers 13, no. 11 (May 22, 2021): 1693. http://dx.doi.org/10.3390/polym13111693.

Full text

Abstract:

Magnetic hydrogels composed of poly(vinyl alcohol) (PVA)/water-soluble tricarboxy cellulose (CO)/magnetic fluids (MFs) have been prepared by a freeze–thaw cycle technique. The system designed here combines the renewability and biocompatibility aspects of PVA and CO, as well as the magnetic properties of MFs, thereby offering special properties to the final product with potential applications in medicine. In the first step, the water-soluble CO is synthesized using a one-shot oxidation procedure and then the aqueous solutions of CO are mixed with PVA solutions and magnetic fluids in the absence of any additional cross-linking agent. The magnetic hydrogels were thoroughly investigated by Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), X-ray diffraction (XRD), magnetometry (VSM), and thermogravimetric analysis. The morphological results show an excellent distribution of magnetic particles and CO inside the PVA matrix. The VSM results show that the magnetic hydrogels possess superparamagnetic properties.

APA, Harvard, Vancouver, ISO, and other styles

4

Morais, P. C., V. K. Garg, A. C. Oliveira, L. B. Silveira, J. G. Santos, M. M. A. Rodrigues, and A. C. Tedesco. "Nanoscaled biocompatible magnetic drug-delivery system: preparation and characterization." Hyperfine Interactions 190, no. 1-3 (April 2009): 87–93. http://dx.doi.org/10.1007/s10751-009-9968-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Baruah, Jejiron Maheswari, Sanjeeb Kalita, and Jyoti Narayan. "Green chemistry synthesis of biocompatible ZnS quantum dots (QDs): their application as potential thin films and antibacterial agent." International Nano Letters 9, no. 2 (March 27, 2019): 149–59. http://dx.doi.org/10.1007/s40089-019-0270-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Gadzhimagomedova, Zaira, Peter Zolotukhin, Oleg Kit, Daria Kirsanova, and Alexander Soldatov. "Nanocomposites for X-Ray Photodynamic Therapy." International Journal of Molecular Sciences 21, no. 11 (June 3, 2020): 4004. http://dx.doi.org/10.3390/ijms21114004.

Full text

Abstract:

Photodynamic therapy (PDT) has long been known as an effective method for treating surface cancer tissues. Although this technique is widely used in modern medicine, some novel approaches for deep lying tumors have to be developed. Recently, deeper penetration of X-rays into tissues has been implemented, which is now known as X-ray photodynamic therapy (XPDT). The two methods differ in the photon energy used, thus requiring the use of different types of scintillating nanoparticles. These nanoparticles are known to convert the incident energy into the activation energy of a photosensitizer, which leads to the generation of reactive oxygen species. Since not all photosensitizers are found to be suitable for the currently used scintillating nanoparticles, it is necessary to find the most effective biocompatible combination of these two agents. The most successful combinations of nanoparticles for XPDT are presented. Nanomaterials such as metal–organic frameworks having properties of photosensitizers and scintillation nanoparticles are reported to have been used as XPDT agents. The role of metal–organic frameworks for applying XPDT as well as the mechanism underlying the generation of reactive oxygen species are discussed.

APA, Harvard, Vancouver, ISO, and other styles

7

Ghazanfari, Adibehalsadat, Shanti Marasini, Huan Yue, Son Long Ho, Xu Miao, Mohammad Yaseen Ahmad, Ji Ae Park, et al. "D-Glucuronic Acid-Coated Ultrasmall Bi2O3 Nanoparticles for CT Imaging." Journal of Nanoscience and Nanotechnology 20, no. 8 (August 1, 2020): 4638–42. http://dx.doi.org/10.1166/jnn.2020.17817.

Full text

Abstract:

Ultrasmall Bi2O3 nanoparticles (davg = 1.5 nm) coated with biocompatible and hydrophilic D-glucuronic acid were prepared for the first time through a simple one-step polyol process and their potential as CT contrast agents were investigated by measuring their X-ray attenuation properties. Their observed X-ray attenuation power was stronger than that of a commercial iodine CT contrast agent at the same atomic concentration, as consistent with the magnitudes of atomic X-ray attenuation coefficients (i.e., Bi > I), and much stronger at the same number density. The results indicate that the nanoparticle sample is a potential CT contrast agent.

APA, Harvard, Vancouver, ISO, and other styles

8

Faisal, Shah, Abdullah, Hasnain Jan, Sajjad Ali Shah, Sumaira Shah, Muhammad ad Rizwan, Nasib Zaman, et al. "Bio-Catalytic Activity of Novel Mentha arvensis Intervened Biocompatible Magnesium Oxide Nanomaterials." Catalysts 11, no. 7 (June 27, 2021): 780. http://dx.doi.org/10.3390/catal11070780.

Full text

Abstract:

In the present study Mentha arvensis medaited Magnesium oxide nanoparticles were synthesized by novel green route followed by advanced characterization via XRD, FTIR, UV, SEM, TEM, DLS and TGA. The mean grain size of 32.4 nm and crystallite fcc morphology were confirmed by X-ray diffractive analysis. Scanning and Transmission electron microscopy analysis revealed the spherical and elliptical morphologies of the biosynthesized nanoparticles. Particle surface charge of −16.1 mV were determined by zeta potential and zeta size of 30–120 nm via dynamic light scattering method. Fourier transform spectroscopic analysis revealed the possible involvement of functional groups in the plant extract in reduction of Mg2+ ions to Mg0. Furthermore, the antioxidant, anti-Alzheimer, anti-cancer, and anti-H. pylori activities were performed. The results revealed that MgO-NPs has significant anti-H. pyloric potential by giving ZOI of 17.19 ± 0.83 mm against Helicobacter felis followed by Helicobacter suis. MgO-NPs inhibited protein kinase enzyme up to 12.44 ± 0.72% at 5 mg/mL and thus showed eminent anticancer activity. Significant free radicals scavenging and hemocompatability was also shown by MgO-NPs. MgO-NPs also displayed good inhibition potential against Hela cell lines with maximum inhibition of 49.49 ± 1.18 at 400 µg/mL. Owing to ecofriendly synthesis, non-toxic and biocompatible nature, Mentha arvensis synthesized MgO-NPs can be used as potent antimicrobial agent in therapeutic applications.

APA, Harvard, Vancouver, ISO, and other styles

9

Grande Tovar, Carlos David, Jorge Iván Castro, Carlos Humberto Valencia, Paula A. Zapata, Moisés A. Solano, Edwin Florez López, Manuel N. Chaur, Mayra Eliana Valencia Zapata, and José Herminsul Mina Hernandez. "Synthesis of Chitosan Beads Incorporating Graphene Oxide/Titanium Dioxide Nanoparticles for In Vivo Studies." Molecules 25, no. 10 (May 14, 2020): 2308. http://dx.doi.org/10.3390/molecules25102308.

Full text

Abstract:

Scaffold development for cell regeneration has increased in recent years due to the high demand for more efficient and biocompatible materials. Nanomaterials have become a critical alternative for mechanical, thermal, and antimicrobial property reinforcement in several biopolymers. In this work, four different chitosan (CS) bead formulations crosslinked with glutaraldehyde (GLA), including titanium dioxide nanoparticles (TiO2), and graphene oxide (GO) nanosheets, were prepared with potential biomedical applications in mind. The characterization of by FTIR spectroscopy, X-ray photoelectron spectroscopy (XRD), thermogravimetric analysis (TGA), energy-dispersive spectroscopy (EDS) and scanning electron microscopy (SEM), demonstrated an efficient preparation of nanocomposites, with nanoparticles well-dispersed in the polymer matrix. In vivo, subdermal implantation of the beads in Wistar rat′s tissue for 90 days showed a proper and complete healing process without any allergenic response to any of the formulations. Masson′s trichrome staining of the histological implanted tissues demonstrated the presence of a group of macrophage/histiocyte compatible cells, which indicates a high degree of biocompatibility of the beads. The materials were very stable under body conditions as the morphometry studies showed, but with low resorption percentages. These high stability beads could be used as biocompatible, resistant materials for long-term applications. The results presented in this study show the enormous potential of these chitosan nanocomposites in cell regeneration and biomedical applications.

APA, Harvard, Vancouver, ISO, and other styles

10

Xiang, Li, Wonyeong Ryu, Jehan Kim, and Moonhor Ree. "Cyclic topology effects on the morphology of biocompatible and environment-friendly poly(ε-caprolactone) under nanoscale film confinement." Polymer Chemistry 11, no. 28 (2020): 4630–38. http://dx.doi.org/10.1039/d0py00665c.

Full text

Abstract:

Quantitative grazing incidence X-ray scattering analysis combined with X-ray reflectivity using synchrotron radiation sources was explored for the first time cyclic topology effects on the nanoscale film morphology of poly(ε-caprolactone).

APA, Harvard, Vancouver, ISO, and other styles

11

Odella, Emmanuel, R. Darío Falcone, Marcelo Ceolín, Juana J. Silber, and N. Mariano Correa. "Structural Characterization of Biocompatible Reverse Micelles Using Small-Angle X-ray Scattering, 31P Nuclear Magnetic Resonance, and Fluorescence Spectroscopy." Journal of Physical Chemistry B 122, no. 15 (March 28, 2018): 4366–75. http://dx.doi.org/10.1021/acs.jpcb.7b11395.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Erol, Arzu, Derya B. Hazer Rosberg, Baki Hazer, and Beyza S. Göncü. "Biodegradable and biocompatible radiopaque iodinated poly-3-hydroxy butyrate: synthesis, characterization and in vitro/in vivo X-ray visibility." Polymer Bulletin 77, no. 1 (March 18, 2019): 275–89. http://dx.doi.org/10.1007/s00289-019-02747-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Yu, Chang, Xu Zhang, Kan He, Yue Liu, and Jie Shan Qiu. "Synthesis and Characterization of Fe²⁺-CTS/CA-CNTs Composite and its Magnetic Properties." Advanced Materials Research 680 (April 2013): 49–53. http://dx.doi.org/10.4028/www.scientific.net/amr.680.49.

Full text

Abstract:

A novel biocompatible Fe2+-chitosan (CTS)/citric acid modified carbon nanotube (CA-CNTs) composite (Fe2+-CTS/CA-CNTs) has been successfully synthesized by covalent bonding and crosslinking chemistry, followed by the reduction. The samples were characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), UV-Vis spectrum, X-ray diffraction (XRD), inductively coupled plasma (ICP), thermal gravimetric analysis (TGA), and vibrating sample magnetometer (VSM) techniques. The results show that the CTS has been successfully grafted to the CA-CNTs carrier and Fe2+ ions are absorbed on the CTS by coordination bond mode. It was found that the Fe2+-CTS/CA-CNTs composite shows good magnetic properties with a low ratio of remanence to saturation magnetization and is in a superparamagnetic state at room temperature. It is believed that the Fe2+-CTS/CA-CNTs composite will be potential for application in MRI.

APA, Harvard, Vancouver, ISO, and other styles

14

Ahani, Elnaz, Majid Montazer, Tayebeh Toliyat, and Mahnaz Mahmoudi Rad. "A novel biocompatible antibacterial product: Nanoliposomes loaded with poly(hexamethylene biguanide chloride)." Journal of Bioactive and Compatible Polymers 32, no. 3 (November 28, 2016): 242–62. http://dx.doi.org/10.1177/0883911516675367.

Full text

Abstract:

In this study, nanoliposome-loaded poly(hexamethylene biguanide) is introduced as a novel biocompatible antibacterial product with higher activity than microliposomes. Soy lecithin as a clean product was used to prepare various nanoliposomes through sonication, high-pressure homogenizer, and normal homogenizer and also microliposomes through two methods of lipid film hydration and incubation methods. The nanoliposomes were formed under sonication with the size of 50 nm. The prepared liposomes were then loaded with poly(hexamethylene biguanide chloride) and the inclusion percentage was measured. The release profile of liposomes in buffer showed a release of 92% for poly(hexamethylene biguanide) during 24 h. The loaded liposomes were characterized with particle size analyzer, nuclear magnetic resonance, X-ray diffraction, Fourier transform infrared spectroscopy, and scanning electron microscopy. The antibacterial properties of different micro and nanoliposomes were investigated against a Gram-negative ( Escherichia coli) and a Gram-positive ( Staphylococcus aureus) bacteria. The poly(hexamethylene biguanide)–loaded nanoliposomes indicated higher antibacterial activities than microliposomes. Nanoliposomes have the potential to entrap lower poly(hexamethylene biguanide) dosages while retaining optimum therapeutic efficacy in the target site having lower cytotoxicity with lower side effects. The cytotoxicity of poly(hexamethylene biguanide) entrapped in liposomes was studied in human dermal fibroblasts and compared with free poly(hexamethylene biguanide) and blank liposomes. The maximum cytotoxicity was observed for free poly(hexamethylene biguanide) that is substantially decreased through loading within liposomes structure. Overall, the encapsulation of poly(hexamethylene biguanide) in liposomes improved the biocompatibility and safety of the product introducing a useful biocompatible antibacterial polymer for treatments of infectious diseases.

APA, Harvard, Vancouver, ISO, and other styles

15

Yang, Xue, Ziyang Wang, Yongsheng Zhang, and Wei Liu. "A Biocompatible and Sustainable Anti-ultraviolet Functionalization of Cotton Fabric with Nanocellulose and Chitosan Nanocomposites." Fibers and Polymers 21, no. 11 (November 2020): 2521–29. http://dx.doi.org/10.1007/s12221-020-1339-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Khare, Deepak, Angaraj Singh, and Ashutosh Kumar Dubey. "Influence of Na and K contents on the antibacterial response of piezoelectric biocompatible NaxK1-xNbO3 (x = 0.2–0.8)." Materials Today Communications 27 (June 2021): 102317. http://dx.doi.org/10.1016/j.mtcomm.2021.102317.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Zhang, Linna, Shengmao Zhang, Benfang He, Zhishen Wu, and Zhijun Zhang. "TiO2 Nanoparticles Functionalized by a Temperature-sensitive Poly(N-isopropylacrylamide) (PNIPAM): Synthesis and Characterization." Zeitschrift für Naturforschung B 63, no. 8 (August 1, 2008): 973–76. http://dx.doi.org/10.1515/znb-2008-0809.

Full text

Abstract:

TiO2 nanoparticles functionalized by poly(N-isopropylacrylamide), PNIPAM in short, were prepared via seeded emulsion polymerization of N-isopropylacrylamide (NIPAM) in the presence of N,N´-methylene-bis(acrylamide) (MBAA) as the crosslinking monomer. The morphology and structure of the TiO2/PNIPAM hybrid hydrogel were characterized by means of transmission electron microscopy, X-ray powder diffraction, and FT infrared spectroscopy. The response of the composite to temperature variations was also investigated. The results indicate that the title inorganic/organic hybrid has a sphere-like shape and is composed of inorganic TiO2 nanoparticles and a biocompatible polymer matrix, showing excellent thermosensitivity, as evident from relevant optical photographs at different temperatures. The thermosensitive TiO2 nanoparticles doped in PNIPAM matrix may have potential application in the remediation of wastewater streams.

APA, Harvard, Vancouver, ISO, and other styles

18

Guedj, C., B. Pucci, L. Zarif, C. Coulomb, J. G. Riess, and A. A. Pavia. "Vesicles and other supramolecular systems from biocompatible synthetic glycolipids with hydrocarbon and/or fluorocarbon chains." Chemistry and Physics of Lipids 72, no. 2 (August 1994): 153–73. http://dx.doi.org/10.1016/0009-3084(94)90099-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Zhang, Xiaoyan, Yihan Ma, Sheng Fu, and Aiqing Zhang. "Facile Synthesis of Water-Soluble Fullerene (C60) Nanoparticles via Mussel-Inspired Chemistry as Efficient Antioxidants." Nanomaterials 9, no. 12 (November 20, 2019): 1647. http://dx.doi.org/10.3390/nano9121647.

Full text

Abstract:

Rational design and modification of the all-carbon fullerene cages to meliorate their nature of hydrophobicity is critical for biomedical applications. The outstanding electron affinity of fullerenes enables them to effectively eliminate reactive oxygen species (ROS), the excess of which may lead to health hazards or biological dysfunction. Herein reported is a facile, mild, and green approach to synthesizing the favorable water-soluble C60 nanoparticles capable of ROS-scavenging by combining the mussel-inspired chemistry with the Michael addition reaction. Various characterization techniques, including Fourier-transform infrared spectroscopy (FTIR), X-ray photoelectron spectra (XPS), thermogravimetric analysis (TGA), transmission electron cryomicroscopy (Cryo-TEM), and dynamic laser scattering (DLS) were carried out to confirm the satisfactory preparation of the hybrid C60-PDA-GSH nanoparticles, which exhibited apparent scavenging capacity of DPPH and hydroxyl radicals in vitro. Additionally, the biocompatible C60-PDA-GSH nanoparticles entered into cells and displayed a universal cytoprotective effect against oxidative press induced by H2O2 in four kinds of human cells at a low concentration of 2 μg/mL. The ease and versatility of the strategy present in this work will not only trigger more fullerene-based materials by the immobilization of diverse functional molecules, but will also extend their possible applications.

APA, Harvard, Vancouver, ISO, and other styles

20

Sridevi, C., P. Karthikeyan, D. Dhivyapriya, L. Mitu, P. Maheswaran, and S. Sathishkumar. "Microflower like Zinc Oxide/Cerium, Lanthanum Substituted Hydroxyapatite Bilayer Coating on Surgical Grade Stainless Steel for Corrosion Resistance, Antibacterial and Bioactive Properties." Asian Journal of Chemistry 32, no. 4 (February 25, 2020): 815–21. http://dx.doi.org/10.14233/ajchem.2020.22422.

Full text

Abstract:

The growing evidence of beneficial role of zinc in bone has increased the interest of developing zinc-containing biomaterials for medical applications and specifically biocompatible coatings that can be deposited on metallic implants to benefit from their load-bearing capabilities. In present work, zinc oxide/cerium, lanthanum substituted (ZnO/Ce,La-HAP) hydroxyapatite bilayer coatings have been fabricated by electrodeposition technique. As developed, ZnO/Ce,La-HAP bilayer coatings were then structurally, morphologically and chemically characterized using Fourier-transform infrared spectroscopy(FT-IR), X-ray diffraction (XRD), higher resolution scanning electron microscopy (HRSEM) and energy dispersive X-ray spectroscopy (EDAX). The properties of corrosion performance of 316L SS were explored in Ringers solution using electrochemical analysis. The potentiodynamic polarization and impedance analysis demonstrated that the anticorrosion behavior of 316L SS was significantly increased by the bilayer coating. Cell viability in vitro, antibacterial activity and live/dead assay of ZnO/Ce,La-HAP bilayer coating were investigated. Hence, development of ZnO/Ce,La-HAP bilayer coating on 316L SS to make it suitable for biomedical applications.

APA, Harvard, Vancouver, ISO, and other styles

21

Sadaba, Naroa, Aitor Larrañaga, Gemma Orpella-Aceret, Ana F. Bettencourt, Victor Martin, Manus Biggs, Isabel A. C. Ribeiro, Jone M. Ugartemendia, Jose-Ramon Sarasua, and Ester Zuza. "Benefits of Polydopamine as Particle/Matrix Interface in Polylactide/PD-BaSO4 Scaffolds." International Journal of Molecular Sciences 21, no. 15 (July 31, 2020): 5480. http://dx.doi.org/10.3390/ijms21155480.

Full text

Abstract:

This work reports the versatility of polydopamine (PD) when applied as a particle coating in a composite of polylactide (PLA). Polydopamine was observed to increase the particle–matrix interface strength and facilitate the adsorption of drugs to the material surface. Here, barium sulfate radiopaque particles were functionalized with polydopamine and integrated into a polylactide matrix, leading to the formulation of a biodegradable and X-ray opaque material with enhanced mechanical properties. Polydopamine functionalized barium sulfate particles also facilitated the adsorption and release of the antibiotic levofloxacin. Analysis of the antibacterial capacity of these composites and the metabolic activity and proliferation of human dermal fibroblasts in vitro demonstrated that these materials are non-cytotoxic and can be 3D printed to formulate complex biocompatible materials for bone fixation devices.

APA, Harvard, Vancouver, ISO, and other styles

22

Ghutepatil, P. R., A. B. Salunkhe, V. M. Khot, B. R. Thombare, and S. H. Pawar. "Surface Functionalization of MnFe2O4 Nanoparticles with Ethylenediamine for Hyperthermia Application." Asian Journal of Chemistry 31, no. 5 (March 28, 2019): 1081–86. http://dx.doi.org/10.14233/ajchem.2019.21815.

Full text

Abstract:

Biocompatible magnetic nanoparticles with enhanced heating proficiency are required for magnetic hyperthermia in order to use it efficiently in cancer treatment. In this paper, ethylenediamine functionalized monodispersed manganese iron oxide (MnFe2O4) nanoparticles were synthesized by using polyol method and functionalized nanoparticles were characterized by using X-ray diffraction, scanning electron microscope, transmission electron microscopy, vibrating sample magnetometry, fourier transform infrared spectroscopy and thermogravimetric analysis techniques for structural, morphological and magnetic analysis. Hyperthermia characteristics of functionalized MnFe2O4 nanoparticles were studied at 167.6, 251.4 and 335.2 Oe to assess the feasibility magnetic hyperthermia anticancer therapy. Outcome revealed that nanoparticles the self-heating temperature rise up to 48.76 to 56.34 °C at 5 and 10 mg mL-1 concentrations in water respectively. Specific absorption rate 94.65 W g-1 was observed at 5 mg mL-1 concentration. Biocompatibility study of functionalized nanoparticles has divulged almost no toxicity for nanoparticles.

APA, Harvard, Vancouver, ISO, and other styles

23

Farrakhov, Ruzil, Olga Melnichuk, Evgeny Parfenov, Veta Mukaeva, Arseniy Raab, Vadim Sheremetyev, Yulia Zhukova, and Sergey Prokoshkin. "Comparison of Biocompatible Coatings Produced by Plasma Electrolytic Oxidation on cp-Ti and Ti-Zr-Nb Superelastic Alloy." Coatings 11, no. 4 (March 31, 2021): 401. http://dx.doi.org/10.3390/coatings11040401.

Full text

Abstract:

The paper compares the coatings produced by plasma electrolytic oxidation (PEO) on commercially pure titanium and a novel superelastic alloy Ti-18Zr-15Nb (at. %) for implant applications. The PEO coatings were produced on both alloys in the identical pulsed bipolar regime. The properties of the coatings were examined using scanning electron microscopy (SEM), X-ray diffraction (XRD), and energy-dispersive X-ray spectroscopy (EDX), potentiodynamic polarization (PDP), and electrochemical impedance spectroscopy (EIS). The PEO process kinetics was modeled based on the Avrami theorem and Cottrell equation using a relaxation method. The resultant coatings contain TiO2, for both alloys, and NbO2, Nb2O5, ZrO2 for Ti-18Zr-15Nb alloy. The coating on the Ti-18Zr-15Nb alloy has a higher thickness, porosity, and roughness compared to that on cp-Ti. The values of the kinetic coefficients of the PEO process—higher diffusion coefficient and lower time constant for the processing of Ti-18Zr-15Nb—explain this effect. According to the electrochemical studies, PEO coatings on Ti-18Zr-15Nb alloy provide better corrosion protection. Higher corrosion resistance, porosity, and roughness contribute to better biocompatibility of the PEO coating on Ti-18Zr-15Nb alloy compared to cp-Ti.

APA, Harvard, Vancouver, ISO, and other styles

24

Safronova, T. V., V. I. Putlyaev, V. K. Ivanov, A. V. Knot’ko, and T. B. Shatalova. "Powders Mixtures Based on Ammonium Pyrophosphate and Calcium Carbonate for Preparation of Biocompatible Porous Ceramic in the CaO–P2O5 System." Refractories and Industrial Ceramics 56, no. 5 (January 2016): 502–9. http://dx.doi.org/10.1007/s11148-016-9877-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Ene, Vladimir Lucian, Ionela Andreea Neacsu, Ovidiu Oprea, Vasile Adrian Surdu, Roxana Doina Trusca, Anton Ficai, and Ecaterina Andronescu. "Single Step Synthesis of Glutamic/tartaric Acid-stabilised Fe3O4 Nanoparticles for Targeted Delivery Systems." Revista de Chimie 71, no. 2 (March 3, 2020): 230–38. http://dx.doi.org/10.37358/rc.20.2.7920.

Full text

Abstract:

This paper aims to improve medical strategies regarding cancer treatment, by developing new targeted cancer therapy nanostructured systems, based on magnetite and natural catabolism products as coating agents (glutamic acid, tartaric acid), with induced cellular internalization. In order to create hydrophilic, biocompatible systems, suitable for targeted cancer therapy, and minimize the negative side effects of current approaches, a one-pot synthesis by co-precipitation technique, starting from Fe2+ and Fe3+ inorganic precursors and multifunctional organic compounds, carefully controlling the reaction parameters (concentration of precursors, pH, temperature etc.) was performed. The obtained Fe3O4 stabilised nanoparticles were subjected to morphological and structural characterization. The formation of inorganic-organic hybrid systems was evaluated using FTIR spectroscopy and complex thermal analysis (TG / DSC) for determining the content of the organic component, while X-ray Diffractometry and Scanning and Transmission Electron Microscopy were used to characterize the crystallinity and particle dimensions and distribution. The magnetic properties at room temperature were also evaluated, recording the magnetic susceptibility relative to the applied magnetic field.

APA, Harvard, Vancouver, ISO, and other styles

26

Diem, Phan Ha Nu, Doan Thi Thu Thao, Dang Van Phu, Nguyen Ngoc Duy, Hoang Thi Dong Quy, Tran Thai Hoa, and Nguyen Quoc Hien. "Synthesis of Gold Nanoparticles Stabilized in Dextran Solution by Gamma Co-60 Ray Irradiation and Preparation of Gold Nanoparticles/Dextran Powder." Journal of Chemistry 2017 (2017): 1–8. http://dx.doi.org/10.1155/2017/6836375.

Full text

Abstract:

Gold nanoparticles (AuNPs) in spherical shape with diameter of 6–35 nm stabilized by dextran were synthesized by γ-irradiation method. The AuNPs were characterized by UV-Vis spectroscopy and transmission electron microscopy. The influence of pH, Au3+ concentration, and dextran concentration on the size of AuNPs was investigated. Results indicated that the smallest AuNPs size (6 nm) and the largest AuNPs size (35 nm) were obtained for pH of 1 mM Au3+/1% dextran solution of 5.5 and 7.5, respectively. The smaller Au3+ concentration favored smaller size and conversely the smaller dextran concentration favored bigger size of AuNPs. AuNPs powders were prepared by spay drying, coagulation, and centrifugation and their sizes were also evaluated. The purity of prepared AuNPs powders was also examined by energy dispersive X-ray (EDX) analysis. Thus, the as-prepared AuNPs stabilized by biocompatible dextran in solution and/or in powder form can be potentially applied in biomedicine and pharmaceutics.

APA, Harvard, Vancouver, ISO, and other styles

27

Krūkle-Bērziņa, Belyakov, Mishnev, and Shubin. "Stability and Phase Transitions of Nontoxic γ-Cyclodextrin-K+ Metal-Organic Framework in Various Solvents." Crystals 10, no. 1 (January 15, 2020): 37. http://dx.doi.org/10.3390/cryst10010037.

Full text

Abstract:

Cyclodextrin (CD) has been used to prepare biocompatible and nontoxic metal-organic frameworks (MOFs) suitable for biomedical applications as drug carriers. In this study, γ-CD/K-based MOF (γ-CD-MOF-1-α) was synthesized and its stability in various solvents was explored by single-crystal X-ray diffractometry (SCXRD) and powder X-ray diffractometry (PXRD). As a result of solvent-induced phase transformations, two novel crystalline phases of γ-CD-MOF-1 were discovered. The newly formed ε- and δ-phases crystallize in orthorhombic and tetragonal symmetry, respectively. In ε-phase, toluene was determined as a guest molecule by SCXRD. Interactions between γ-cyclodextrin and solvent molecules in ε-phase were evaluated using Hirshfeld surface analysis. The thermal stability of the new crystal forms of γ-CD-MOF-1 was analyzed by differential scanning calorimetry and thermogravimetric analysis.

APA, Harvard, Vancouver, ISO, and other styles

28

Kwon, Younghoon, and Jongsung Kim. "Temperature Effects on Fluorescence Intensity of Mn-Doped ZnO Quantum Dots Derived from a Sol–Gel Method." Journal of Nanoscience and Nanotechnology 15, no. 10 (October 1, 2015): 8023–27. http://dx.doi.org/10.1166/jnn.2015.11264.

Full text

Abstract:

Recently, various quantum dots (QDs) have been prepared and studied extensively due to their unique electrical and optical properties. Among them, ZnO has attracted much attention because it contains no heavy metals, is biocompatible, and can be easily prepared. In addition, doping QDs with transition metals such as Mn allows for their photo-physical properties to be modified. In this study, Mn-doped ZnO QDs were synthesized by a sol–gel technique, after which the effect of temperature on their fluorescence properties was investigated. The prepared QDs were characterized by X-ray diffraction, transmission electron microscopy, and energy dispersive X-ray spectroscopy. In addition, their photoluminescence (PL) intensities decreased linearly with temperature between 30 and 70 °C. Intensity also decreased as the amount of Mn increased. Finally, the slope of the PL temperature dependence decreased as the amount of Mn present increased.

APA, Harvard, Vancouver, ISO, and other styles

29

Grande Tovar, Carlos David, Jorge Iván Castro, Carlos Humberto Valencia Llano, Diana Paola Navia Porras, Johannes Delgado Ospina, Mayra Eliana Valencia Zapata, José Herminsul Mina Hernandez, and Manuel N. Chaur. "Synthesis, Characterization, and Histological Evaluation of Chitosan-Ruta Graveolens Essential Oil Films." Molecules 25, no. 7 (April 7, 2020): 1688. http://dx.doi.org/10.3390/molecules25071688.

Full text

Abstract:

The development of new biocompatible materials for application in the replacement of deteriorated tissues (due to accidents and diseases) has gained a lot of attention due to the high demand around the world. Tissue engineering offers multiple options from biocompatible materials with easy resorption. Chitosan (CS) is a biopolymer derived from chitin, the second most abundant polysaccharide in nature, which has been highly used for cell regeneration applications. In this work, CS films and Ruta graveolens essential oil (RGEO) were incorporated to obtain porous and resorbable materials, which did not generate allergic reactions. An oil-free formulation (F1: CS) and three different formulations containing R. graveolens essential oil were prepared (F2: CS-RGEO 0.5%; F3: CS+RGEO 1.0%; and F4: CS+RGEO 1.5%) to evaluate the effect of the RGEO incorporation in the mechanical and thermal stability of the films. Infrared spectroscopy (FTIR) analyses demonstrated the presence of RGEO. In contrast, X-ray diffraction (XRD) and differential scanning calorimetry (DSC) analysis showed that the crystalline structure and percentage of CS were slightly affected by the RGEO incorporation. Interesting saturation phenomena were observed for mechanical and water permeability tests when RGEO was incorporated at higher than 0.5% (v/v). The results of subdermal implantation after 30 days in Wistar rats showed that increasing the amount of RGEO resulted in greater resorption of the material, but also more significant inflammation of the tissue surrounding the materials. On the other hand, the thermal analysis showed that the RGEO incorporation almost did not affect thermal degradation. However, mechanical properties demonstrated an understandable loss of tensile strength and Young’s modulus for F3 and F4. However, given the volatility of the RGEO, it was possible to generate a slightly porous structure, as can be seen in the microstructure analysis of the surface and the cross-section of the films. The cytotoxicity analysis of the CS+RGEO compositions by the hemolysis technique agreed with in vivo results of the low toxicity observed. All these results demonstrate that films including crude essential oil have great application potential in the biomedical field.

APA, Harvard, Vancouver, ISO, and other styles

30

Kadina, Yulia A., Ekaterina V. Razuvaeva, Dmitry R. Streltsov, Nikita G. Sedush, Eleonora V. Shtykova, Alevtina I. Kulebyakina, Alexander A. Puchkov, Dmitry S. Volkov, Alexey A. Nazarov, and Sergei N. Chvalun. "Poly(Ethylene Glycol)-b-Poly(D,L-Lactide) Nanoparticles as Potential Carriers for Anticancer Drug Oxaliplatin." Molecules 26, no. 3 (January 24, 2021): 602. http://dx.doi.org/10.3390/molecules26030602.

Full text

Abstract:

Nanoparticles based on biocompatible methoxy poly(ethylene glycol)-b-poly(D,L-lactide) (mPEG113-b-P(D,L)LAn) copolymers as potential vehicles for the anticancer agent oxaliplatin were prepared by a nanoprecipitation technique. It was demonstrated that an increase in the hydrophobic PLA block length from 62 to 173 monomer units leads to an increase of the size of nanoparticles from 32 to 56 nm. Small-angle X-ray scattering studies confirmed the “core-corona” structure of mPEG113-b-P(D,L)LAn nanoparticles and oxaliplatin loading. It was suggested that hydrophilic oxaliplatin is adsorbed on the core-corona interface of the nanoparticles during the nanoprecipitation process. The oxaliplatin loading content decreased from 3.8 to 1.5% wt./wt. (with initial loading of 5% wt./wt.) with increasing PLA block length. Thus, the highest loading content of the anticancer drug oxaliplatin with its encapsulation efficiency of 76% in mPEG113-b-P(D,L)LAn nanoparticles can be achieved for block copolymer with short hydrophobic block.

APA, Harvard, Vancouver, ISO, and other styles

31

Aisawa, Sumio, Aiko Yasutake, Satoshi Takahashi, Hidetoshi Hirahara, and Eiichi Narita. "Intercalation of Collagen and Soybean Peptides into Zn–Al Layered Double Hydroxide." Journal of Nanoscience and Nanotechnology 8, no. 1 (January 1, 2008): 428–31. http://dx.doi.org/10.1166/jnn.2008.18147.

Full text

Abstract:

In order to develop a new type biocompatible organic/inorganic nanohybrid material, an intercalation of collagen peptides (CP) and soybean peptide (SP) into Zn–Al layered double hydroxide (LDH) by the coprecipitation reaction has been investigated. The peptide/LDH has been characterized by chemical analysis, powder X-ray diffraction (XRD), Raman spectroscopy, thermal gravimetric analysis (TG) and transmission electron microscopy (TEM). According to the XRD patterns and Raman spectra, the solid products were found to contain peptide and to show broad diffraction peaks with LDH structures. The CP/LDH and SP/LDH possess the expanding LDH structure, d00l = 2–3 nm, confirming that both peptides were intercalated into the LDH interlayer space with low organized stacking arrangement.

APA, Harvard, Vancouver, ISO, and other styles

32

Aswathy, B., S. Suji, G. S. Avadhani, R. Aswathy, S. Suganthi, and G. Sony. "Microwave assisted one pot synthesis of biocompatible gold nanoparticles in Triton X-100 aqueous micellar medium using tryptophan as reducing agent." Journal of Molecular Liquids 162, no. 3 (August 2011): 155–58. http://dx.doi.org/10.1016/j.molliq.2011.06.019.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Manohar, Chelli Sai, B. Siva Kumar, Sai Pavan Prashanth Sadhu, Sai Krishna Srimadh, V. Sai Muthukumar, S. Venketesh, and K. B. R. Varma. "Novel Lead-free biocompatible piezoelectric Hydroxyapatite (HA) – BCZT (Ba0.85Ca0.15Zr0.1Ti0.9O3) nanocrystal composites for bone regeneration." Nanotechnology Reviews 8, no. 1 (May 31, 2019): 61–78. http://dx.doi.org/10.1515/ntrev-2019-0006.

Full text

Abstract:

Abstract BCZT (Ba0.85Ca0.15Zr0.1Ti0.9O3) is a recent class of lead-free ferroelectric material associated with high piezoelectric coefficient, making it suitable to inspire hydroxyapatite (HA)-BCZT ceramics for bone materials. Nano-crystalline hydroxyapatite (HA) synthesized using the hydrothermal route was characterized via FT-IR, Raman spectroscopy, X-ray powder diffraction (XRD), and Scanning Electron Microscopy (SEM). We also rationalized its formation as a function of operating conditions such as dwell time and temperature in this route. The nano-crystalline BCZT powder was synthesized via a sol-gel technique and its structural and morphological characterization were carried out using Raman Spectroscopy, XRD and Transmission Electron Microscopy (TEM). These investigations facilitated the optimization of HA-BCZT compositions and their electrical poling conditions to achieve enhanced piezoelectric effect. The composites (HA-BCZT) sintered at 1350∘C exhibited promising piezoelectric properties. We report the enhanced piezoelectric coefficient (d33) of 7±1 pC/N for 50% HA-BCZT which is significant as compared to that reported in the literature for ~98% BT (barium titanate) -HA composites. We highlight the role of Simulated Body Fluid (SBF) on the intriguing phase-change of Tricalcium Phosphate (TCP) obtained at this sintering temperature, to hydroxyapatite for its essential contribution to promote bone growth. We theoretically support the confirmed in vitro biocompatibility of these composites. Graphical abstract: Novel lead-free biocompatible piezoelectric HA-BCZT nanocrystal composites for accelerated Bone regeneration

APA, Harvard, Vancouver, ISO, and other styles

34

Kulkarni, Akshay S., Ashok M. Sajjan, T. M. Yunus Khan, Irfan Anjum Badruddin, Sarfaraz Kamangar, Nagaraj R. Banapurmath, Narasimha H. Ayachit, M. Ashwini, and A. Sharanappa. "Development and Characterization of Biocompatible Membranes from Natural Chitosan and Gelatin for Pervaporative Separation of Water–Isopropanol Mixture." Polymers 13, no. 17 (August 26, 2021): 2868. http://dx.doi.org/10.3390/polym13172868.

Full text

Abstract:

Natural polymers have attracted a lot of interest in researchers of late as they are environmentally friendly, biocompatible, and possess excellent characters. Membranes forming natural polymers have provided a whole new dimension to the separation technology. In this work, chitosan-gelatin blend membranes were fabricated using chitosan as the base and varying the amount of gelatin. Transport, mechanical, and surface characteristics of the fabricated membranes were examined in detail by means of the characterizing techniques such as Fourier transform infrared spectroscopy, differential scanning colorimetry, wide angle X-ray diffraction, scanning electron microscope, and thermogravimetric analysis. In order to analyze the water affinity of the developed blend chitosan-gelatin membranes, the percentage degree of swelling was examined. Out of the fabricated membranes, the membrane loaded with 15 mass% of gelatin exhibited the better pervaporation performance with a pervaporation separation index value of 266 at 30 °C for the solution containing 10% in terms of the mass of water, which is the highest among the contemporary membranes. All the fabricated membranes were stable during the pervaporation experiments, and permeation flux of water for the fabricated membranes was dominant in the overall total permeation flux, signifying that the developed membranes could be chosen for efficient separation of water–isopropanol mixture on a larger scale.

APA, Harvard, Vancouver, ISO, and other styles

35

Fatiqin, A., H. Amrulloh, and W. Simanjuntak. "Green synthesis of MgO nanoparticles using Moringa oleifera leaf aqueous extract for antibacterial activity." Bulletin of the Chemical Society of Ethiopia 35, no. 1 (May 7, 2021): 161–70. http://dx.doi.org/10.4314/bcse.v35i1.14.

Full text

Abstract:

Nanoparticle fabrication using plant extracts is an important alternative method because it is non-toxic, biocompatible, and environmentally friendly. In this study, green synthesis of MgO nanoparticles using Moringa oleifera leaf water extracts was conducted by mixing the extract and a solution of magnesium chloride. The product was characterized using different techniques, i.e. UV-Visible (UV-Vis) spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM) and Fourier transform infrared spectroscopy (FTIR). The UV-Vis spectrum of MgO nanoparticles shows an absorption at 280 nm. The size of the synthesized MgO nanoparticles ranges from 20-50 nm. The antibacterial activity of MgO nanoparticles was seen from the zone of inhibition against Staphylococcus aureus (6.3 mm) and against Escherichia coli (6 mm). MgO nanoparticles have been successfully fabricated using Moringa oleifera leaf aqueous extracts, providing an alternative method for synthesizing MgO nanoparticles. KEY WORDS: Antibacterial activity, Escherchia coli, MgO nanoparticles, Moringa oleifera, Staphylococcus aureus Bull. Chem. Soc. Ethiop. 2021, 35(1), 161-170. DOI: https://dx.doi.org/10.4314/bcse.v35i1.14

APA, Harvard, Vancouver, ISO, and other styles

36

Baatarsukh, Munkhbayar, Joohyeon Bae, Sunchul Huh, Hyomin Jeong, Byeongkeun Choi, Gyubong Cho, Taehyun Nam, and Jungpil Noh. "Composition Dependence of the β Phase Stability and Mechanical Properties of Ti–Nb Thin Films." Journal of Nanoscience and Nanotechnology 19, no. 6 (June 1, 2019): 3627–30. http://dx.doi.org/10.1166/jnn.2019.16134.

Full text

Abstract:

Shape memory alloys (SMAs) are commonly used for various applications, e.g., in the aerospace and automotive industries, robotics, and biomedical sciences. Although Ti–Ni SMAs are commercially available, the low biocompatibility of Ni has stimulated research into the development of Ti–Nb based SMAs as potential replacements of Ti–Ni alloys in biomedical applications. Ti–Nb alloys have attracted attention because of their low stiffness and superelasticity. Superelastic thin films can be used in medical applications, including the fabrication of stents for neurovascular blood vessels, which relies on a thin film and on the use of a Ti–Nb alloy coating for less biocompatible alloys. In this study, Ti–Nb thin films were prepared using magnetron sputtering. A Nb content in the range 12.2–35.9 at.% was used in the films, which was determined using energy-dispersive X-ray spectroscopy. X-ray diffraction measurement was used to analyze the crystal structure of the thin films, and their mechanical properties were investigated using nanoindentation.

APA, Harvard, Vancouver, ISO, and other styles

37

Kang, Jung-In, Han-Cheol Choe, and Mee-Kyoung Son. "Nano/Micro-Sized Morphologies of Hydroxyapatite Coatings Containing Mn and Si on an Oxidized Ti–6Al–4V Alloy Surface for Dental Implants." Journal of Nanoscience and Nanotechnology 21, no. 7 (July 1, 2021): 3701–6. http://dx.doi.org/10.1166/jnn.2021.19169.

Full text

Abstract:

To improve the surface characteristics of Ti–6Al–4V dental implants and the binding between the bone and implant surface, biocompatible oxide films were formed by plasma electrolytic oxidation (PEO). The PEO treatment was performed using electrolyte solutions containing Ca (calcium acetate monohydrate), P(calcium glycerophosphate), Mn (manganese(II) acetate tetrahydrate), and Si (sodium metasilicate nonahydrate), which are the major constituents of bone, for 3 min at 280 V. The morphology and crystalline phase of the PEO-treated surfaces were characterized using field-emission scanning electron microscopy, energy-dispersive X-ray spectrometry, X-ray diffraction, and Fourier transform infrared spectroscopy. All the obtained PEO-treated samples exhibited a morphology comprising porous structures. Oval and irregular pore structures were observed as the Mn content increased. As the Si content increased, the areas occupied by the pores increased. When both, Si and Mn were used for the PEO treatment, the number of nano- to micro-sized pores gradually decreased with the increasing ratios of the constituents.

APA, Harvard, Vancouver, ISO, and other styles

38

Barabás, Réka, Carmen Ioana Fort, Graziella Liana Turdean, and Liliana Bizo. "Influence of HAP on the Morpho-Structural Properties and Corrosion Resistance of ZrO2-Based Composites for Biomedical Applications." Crystals 11, no. 2 (February 19, 2021): 202. http://dx.doi.org/10.3390/cryst11020202.

Full text

Abstract:

In the present work, ZrO2-based composites were prepared by adding different amounts of antibacterial magnesium oxide and bioactive and biocompatible hydroxyapatite (HAP) to the inert zirconia. The composites were synthesized by the conventional ceramic processing route and morpho-structurally analyzed by X-ray powder diffraction (XRPD) and scanning electron microscopy/energy dispersive X-ray spectroscopy (SEM/EDS). Two metallic dental alloys (i.e., Ni–Cr and Co–Cr) coated with a chitosan (Chit) membrane containing the prepared composites were exposed to aerated artificial saliva solutions of different pHs (i.e., 4.3, 5, 6) and the corrosion resistances were investigated by electrochemical impedance spectroscopy technique. The obtained results using the two investigated metallic dental alloys shown quasi-similar anticorrosive properties, having quasi-similar charge transfer resistance, when coated with different ZrO2-based composites. This behavior could be explained by the synergetic effect between the diffusion process through the Chit-composite layer and the roughness of the metallic electrode surface.

APA, Harvard, Vancouver, ISO, and other styles

39

Alex John Thangapaul, A., V. Sherly Arpuda Kiruba, R. Nivea, T. Viji, K. Thiyagarajan, Alphonse Dhayal Raj, and S. Vasanth Kumar. "Nanorods of Cobalt Oxide: Study on its Morphology with Varied Sonication Time." Advanced Materials Research 678 (March 2013): 203–6. http://dx.doi.org/10.4028/www.scientific.net/amr.678.203.

Full text

Abstract:

Nanomaterials research has become a major attraction in the field of advanced materials research in the area of Physics, Chemistry, and Materials Science. Biocompatible and chemically stable magnetic metal oxide nanoparticles have biomedical applications that includes drug delivery, cell and DNA separation, gene cloning, magnetic resonance imaging (MRI). This research is aimed at the fabrication of magnetic cobalt oxide nanoparticles using a safe, cost effective, and easy to handle technique that is capable of producing nanoparticles free of any contamination. Nanostructured Cobalt oxide powder was prepared by sonication method using ultrasonicator. Effect of sonication for different time intervals, on the morphology of cobalt oxide nanostructures was extensively studied. The morphology of the nanorods were very much affected by the sonication time, it was found that with an increase in sonication time, the length of the nanorods seem to considerably increase at the same time an agglomeration effect comes in to action and the rods form bundle like structures. These cobalt oxide nanorods were characterized using X-ray Diffraction characterization (XRD) and it revealed a cubic structure. Weight percentage of cobalt oxide was confirmed by thermo gravimetric analysis (TGA).

APA, Harvard, Vancouver, ISO, and other styles

40

Bilibana, Mawethu Pascoe, Usisipho Feleni, Avril Rae Williams, and Emmanuel Iwuoha. "Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite." Processes 9, no. 1 (January 19, 2021): 179. http://dx.doi.org/10.3390/pr9010179.

Full text

Abstract:

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.

APA, Harvard, Vancouver, ISO, and other styles

41

Guascito, Maria, Daniela Chirizzi, Emanuela Filippo, Francesco Milano, and Antonio Tepore. "Synthesis and Characterization of Te Nanotubes Decorated with Pt Nanoparticles for a Fuel Cell Anode/Cathode Working at a Neutral pH." Catalysts 9, no. 4 (April 3, 2019): 328. http://dx.doi.org/10.3390/catal9040328.

Full text

Abstract:

In fuel-cell technology development, one of the most important objectives is to minimize the amount of Pt, the most employed material as an oxygen reduction and methanol oxidation electro-catalyst. In this paper, we report the synthesis and characterization of Te nanotubes (TeNTs) decorated with Pt nanoparticles, readily prepared from stirred aqueous solutions of PtCl2 containing a suspension of TeNTs, and ethanol acting as a reducing agent, avoiding the use of any hydrophobic surfactants such as capping stabilizing substance. The obtained TeNTs decorated with Pt nanoparticles (TeNTs/PtNPs) have been fully characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), selected area diffraction patterns (SAD), X-ray photoelectron spectroscopy (XPS), and cyclic voltammetry (CV). We demonstrated that the new material can be successfully employed in fuel cells, either as an anodic (for methanol oxidation reaction) or a cathodic (for oxygen reduction reaction) electrode, with high efficiency in terms of related mass activities and on-set improvement. Remarkably, the cell operates in aqueous electrolyte buffered at pH 7.0, thus, avoiding acidic or alkaline conditions that might lead to, for example, Pt dissolution (at low pH), and paving the way for the development of biocompatible devices and on-chip fuel cells.

APA, Harvard, Vancouver, ISO, and other styles

42

Miranda-Meléndez, Paulina-Guadalupe, Gabriel-Alejandro Martínez-Castañón, Nereyda Niño-Martínez, Nuria Patiño-Marín, Miguel-Ángel Casillas-Santana, Brenda-Erendida Castillo-Silva, and Facundo Ruiz. "Facile Synthesis, Characterization, and Cytotoxic Activity of Europium-Doped Nanohydroxyapatite." Bioinorganic Chemistry and Applications 2016 (2016): 1–10. http://dx.doi.org/10.1155/2016/1057260.

Full text

Abstract:

The objective of this study was to synthetize europium-doped nanohydroxyapatite using a simple aqueous precipitation method and, thereafter, characterize and impregnate selected samples with 5-fluorouracil in order to explore the properties and the releasing capacity of this material. The nanohydroxyapatite was doped with 3, 5, 10, and 20 wt% of europium. The obtained samples were characterized after they were dried at 80°C and hydrothermal treated at 120°C by 2 hours. The samples were analyzed by transmission electron microscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, and photoluminescence. Also, impregnation and release of 5-fluorouracil were assessed in PBS. The toxicity effects of all samples were studied using viability assays on human fibroblasts cells (HGF-1)in vitro. The sizes of the crystallites were about 10–70 nm with irregular morphology and present the phase corresponding to the JCPDS card 9–0432 for hydroxyapatite. The results of the toxicity experiments indicated that doped and undoped powders are biocompatible with fibroblasts cells. Hydroxyapatite samples doped with 5% of europium and loaded with 5-fluorouracil release almost 7 mg/L of the drug after 60 minutes in PBS and decrease the viability of HeLa cells after 24 hours.

APA, Harvard, Vancouver, ISO, and other styles

43

Lee, Wei-Fang, Hsi-Jen Chiang, Che-Tong Lin, Keng-Liang Ou, and Pei-Wen Peng. "Research of biocompatibility on bioactive films fabricated using oxygen plasma immersion ion implantation." Journal of Polymer Engineering 34, no. 3 (May 1, 2014): 247–52. http://dx.doi.org/10.1515/polyeng-2013-0221.

Full text

Abstract:

Abstract In the present study, a nanoporous, biocompatible titanium dioxide (TiO2) film was formed on the surface of titanium, using oxygen plasma immersion ion implantation (OPIII), and the influence of this film on the bio-functionalization, including the proliferation and differentiation properties of MG-63 osteoblast-like cells, was analyzed and investigated. The OPIII-treated surface was characterized by X-ray photoelectron, which showed that a TiOx layer was formed on Ti substrates. This TiOx surface exhibited nanoscale surface roughness in the form of nanoporous structures. The results also revealed that MG-63 cells expressed increased proliferation on the OPIII-treated surface as compared with the untreated Ti substrate. The Ti specimens treated with plasma energy of 1 kW revealed better expression of alkaline phosphatase (ALP) activity and showed higher average surface roughness than untreated specimens. Thus, it can be concluded that bioactivity of Ti implants can potentially be improved by OPIII.

APA, Harvard, Vancouver, ISO, and other styles

44

Kato, Katsuya, Sungho Lee, and Fukue Nagata. "Preparation of Protein–Peptide–Calcium Phosphate Composites for Controlled Protein Release." Molecules 25, no. 10 (May 14, 2020): 2312. http://dx.doi.org/10.3390/molecules25102312.

Full text

Abstract:

Protein–peptide–calcium phosphate composites were developed for achieving sustainable and controlled protein release. Bovine serum albumin (BSA) as a model acidic protein was efficiently encapsulated with basic polypeptides such as polylysine and polyarginine during the precipitation of calcium phosphate (CaP). The prepared composites were fully characterized in terms of their morphologies, crystallinities, and the porosity of their structures, and from these analyses, it was observed that there are no significant differences between the composites. Scanning transmission electron microscopy and energy dispersive X-ray spectroscopy analysis indicated a homogeneous distribution of nitrogen and sulfur, confirming the uniform distribution of BSA and polypeptide in the CaP composite. In vitro release studies demonstrated that the composite prepared with the peptides α-polylysine and polyarginine were suitable for the gradual release of the protein BSA, while those containing ε-polylysine and no peptide were unsuitable for protein release. Additionally, these composites showed high hemocompatibility for mouse red blood cells, and the osteoblast-like cell proliferation and spread in media with the composites prepared using BSA and α-polylysine showed similar tendencies to medium with no composite. From these results, protein–peptide–CaP composites are expected to be useful as highly biocompatible protein delivery agents.

APA, Harvard, Vancouver, ISO, and other styles

45

Pedrosa, Maria Clara Guimaraes, Susana Azevedo dos Anjos, Elena Mavropoulos, Pablo Leite Bernardo, José Mauro Granjeiro, Alexandre Malta Rossi, and Marcos Lopes Dias. "Structure and biological compatibility of polycaprolactone/zinc-hydroxyapatite electrospun nanofibers for tissue regeneration." Journal of Bioactive and Compatible Polymers 36, no. 4 (June 12, 2021): 314–33. http://dx.doi.org/10.1177/08839115211022448.

Full text

Abstract:

Although guided tissue regeneration (GTR) is a useful tool for regenerating lost tissue as bone and periodontal tissue, a biocompatible membrane capable of regenerating large defects has yet to be discovered. This study aimed to characterize the physicochemical properties and biological compatibility of polycaprolactone (PCL) membranes associated with or without nanostructured hydroxyapatite (HA) (PCL/HA) and Zn-doped HA (PCL/ZnHA), produced by electrospinning. PCL, PCL/HA, and PCL/ZnHA were characterized by field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDS), X-ray diffraction (XRD), thermal gravimetric analysis (TGA), and differential scanning calorimetry (DSC). Nanoparticles of HA or ZnHA were homogeneously distributed and dispersed inside the PCL fibers, which decreased the fiber thickness. At 1 wt% of HA or ZnHA, these nanoparticles acted as nucleating agents. Moreover, HA and ZnHA increased the onset of the degradation temperature and thermal stability of the electrospun membrane. All tested membranes showed no cytotoxicity and allowed murine pre-osteoblast adhesion and spreading; however, higher concentrations of PCL/ZnHA showed less cells and an irregular cell morphology compared to PCL and PCL/HA. This article presents a cytocompatible, electrospun, nanocomposite membrane with a novel morphology and physicochemical properties that make it eligible as a scaffold for GTR.

APA, Harvard, Vancouver, ISO, and other styles

46

Sánchez-Hernández, A. K., J. Martínez-Juárez, J. J. Gervacio-Arciniega, R. Silva-González, and M. J. Robles-Águila. "Effect of Ultrasound Irradiation on the Synthesis of Hydroxyapatite/Titanium Oxide Nanocomposites." Crystals 10, no. 11 (October 22, 2020): 959. http://dx.doi.org/10.3390/cryst10110959.

Full text

Abstract:

Bioceramic materials, such as hydroxyapatite, Ca10(PO4)6(OH)2, (HAp), can be chemically bound to bone tissue; since they are bioactive and biocompatible. HAp, titanium oxide (TiO2), and hydroxyapatite/titanium oxide (HAp/TiO2) nanocomposite nanoparticles were obtained by ultrasound irradiation assisted by sol-gel and co-precipitation methods at different time intervals, using Ca(NO3)2•4H2O, (NH4)2HPO4, and TiOSO4•xH2O as calcium, phosphorus, and titanium sources, respectively. HAp, TiO2, and HAp/TiO2 nanocomposite powders were characterized by X-ray Diffraction (XRD) and Raman Spectroscopy. The percentages of anatase phase for TiO2 and of monoclinic and hexagonal phases for HAp were quantified by Rietveld refinement. Furthermore, sample crystallinity in each material was enhanced by increasing the ultrasound irradiation time. The nanoparticle shape was semi-spherical, agglomerated, and between 17 and 20 nm in size. The agglomeration of particles in the samples was corroborated with a Field Emission Scanning Electron Microscope (FESEM).

APA, Harvard, Vancouver, ISO, and other styles

47

Inam, Muhammad, Lu Liu, Jian-Wei Wang, Ka-Xi Yu, Chi-Uyen Phan, Jie Shen, Wen-Hua Zhang, Guping Tang, and Xiurong Hu. "Enhancing the Physiochemical Properties of Puerarin via L-Proline Co-Crystallization: Synthesis, Characterization, and Dissolution Studies of Two Phases of Pharmaceutical Co-Crystals." International Journal of Molecular Sciences 22, no. 2 (January 18, 2021): 928. http://dx.doi.org/10.3390/ijms22020928.

Full text

Abstract:

Puerarin (PUE) is a Chinese traditional medicine known to enhance glucose uptake into the insulin cells to downregulate the blood glucose levels in the treatment of type II diabetes. Nevertheless, the bioavailability of pristine PUE is limited due to its poor solubility and low intestinal permeability. In this work, we demonstrate that the solubility of PUE can be significantly enhanced via its co-crystallization with L-Proline (PRO). Two crystalline phases, namely, the solvate-free form [PUE][PRO] (I) and the solvated form [PUE]2[PRO]∙EtOH∙(H2O)2 (II) are isolated. These two phases are characterized by single-crystal X-ray diffraction (SCXRD), powder X-ray diffraction (PXRD), Fourier-transformed infrared (FT-IR) spectra, nuclear magnetic resonance (NMR), and thermogravimetric analysis in association with differential scanning calorimetry (TGA-DSC). The solubility and dissolution rate of both I and II in water, gastrointestinal tract at pH 1.2, and phosphate buffer at pH 6.8 indicates a nearly doubled increase as compared to the pristine PUE. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay of pristine PUE, I and II against murine colon cancer cell lines CT-26 and human kidney cell lines HEK-293 indicated that neither compound exhibits obvious cytotoxicity after 24 h. This work showcases that the readily available and biocompatible PRO can be a promising adjuvant to enhance the physicochemical properties of PUE toward orally administered drug formulation with improved pharmacokinetics.

APA, Harvard, Vancouver, ISO, and other styles

48

Gouveia, Ana C. C., Michele Munk, Virgínia Oliveira, Ana P. Ferreira, Humberto M. Brandão, Juliana C. Gern, Roberta Brayner, Maria A. Martins, and Nádia R. B. Raposo. "Preparation, Characterization and In Vivo Biocompatibility Studies of Cotton Cellulose Nanofibers." Journal of Nanoscience and Nanotechnology 20, no. 10 (October 1, 2020): 6532–41. http://dx.doi.org/10.1166/jnn.2020.18571.

Full text

Abstract:

Cellulose nanofibers have mechanical properties that make them very attractive in a myriad of fields such as biomedicine, tissue engineering, biosensors, cosmetics and food packet products. To evaluate the potential health risks of airborne cellulose nanofibers, the cellulose nanofiber was prepared and characterized and then its pulmonary potential toxicity to a mouse model was studied. Cellulose nanofiber has been prepared by acid hydrolysis of cotton cellulose and characterized by transmission electron microscopy, zeta potential and X-ray diffraction analysis. Then, using a short-term inhalation test, the pulmonary biocompatibility of cotton cellulose nanofibers at different concentrations (0.5 mg/mL, 1 mg/mL and 2 mg/mL) were evaluated. Transmission electron images showed needle-shaped particle with a diameter of about 6–18 nm and a length of 85–225 μm. Zeta potential was −25.3±7.80 mV and the X-ray diffraction patterns indicate that cotton cellulose nanofiber has pure structural characteristics. The In Vivo results revealed that the exposure to cotton cellulose nanofiber did not alter the number of inflammatory cells or cytokine secretion by lung cells (p > 0.05). The results demonstrate that the cotton cellulose nanofiber is biocompatible and it is an environment-friendly nanomaterial with promise in various industrial sectors.

APA, Harvard, Vancouver, ISO, and other styles

49

Rahman, Gul, Mansoor Khan, Zahid Khan, Anwar-ul-Haq Ali Shah, Muhammad Saleem Khan, and Luqman Ali Shah. "Nickel Oxide-incorporated Polyaniline/Polyvinyl Alcohol Composite for Enhanced Antibacterial Activity." Zeitschrift für Physikalische Chemie 233, no. 9 (August 27, 2019): 1261–74. http://dx.doi.org/10.1515/zpch-2018-1303.

Full text

Abstract:

Abstract The development of biocompatible, cost effective and more efficient materials to control or inhibit the growth of microorganisms in necessary to fight against resistant microbes. Here, we demonstrate the synthesis of nickel oxide-incorporated polyaniline/polyvinyl alcohol (PANI/PVA/NiOx) composite material by single-step polymerization and its application as antibacterial agent. The composite films were characterized using UV-visible spectroscopy (UV-Vis), Thermogravimetric analysis (TGA), Fourier Transform Infrared spectroscopy (FTIR), X-ray Diffraction (XRD) and Scanning Electron Microscopy (SEM). UV-Vis spectra revealed the enhancement in absorption properties of PANI/PVA/NiOx with optimum 5% incorporation of NiOx. TGA results indicated slightly enhanced thermal stability of the PANI/PVA/NiOx composite film as compared to PANI/PVA. FTIR spectra for composites revealed the existence of NiOx in polymers. However the crystallinity of PANI/PVA was not much affected. The antibacterial activity of the prepared composites was examined against four different gram negative bacteria, Salmonella, Shigella, Pseudomonas and Escherichia coli (E. coli). The composite exhibited excellent antibacterial activity against E. coli, Salmonella and Shigella while pseudomonas showed some resistance. Based on the results, PANI/PVA/ NiOx (5%) composite showed the highest activity against the tested bacterial strains, thus showing its potential to be used as an effective antibacterial agent.

APA, Harvard, Vancouver, ISO, and other styles

50

Zafar, Naheed, Bushra Uzair, Muhammad Bilal Khan Niazi, Shamaila Sajjad, Ghufrana Samin, Muhammad Javed Arshed, and Sikander Rafiq. "Fabrication & Characterization of Chitosan Coated Biologically Synthesized TiO2 Nanoparticles against PDR E. coli of Veterinary Origin." Advances in Polymer Technology 2020 (January 20, 2020): 1–13. http://dx.doi.org/10.1155/2020/8456024.

Full text

Abstract:

Treatment of pandrug resistant (PDR) Escherichia coli strain is the leading causative agent of bovine mastitis worldwide. Hence, becoming a potential threat to veterinary and public health. Therefore, to control the infection new nontoxic, biocompatible antimicrobial formulation with enhanced antibacterial activity is massively required. Current study was planned to synthesize chitosan coated titanium dioxide nanoparticles (CS-NPs coated TiO2). Coating was being done by chitosan nanoparticles (CS-NPs) using ionic gelation method. Aqueous solution of Moringa concanensis leaf extract was used to synthesize titanium dioxide nanoparticles (TiO2 NPs). The synthesized nanoformulations were characterized by using XRD, SEM, and FTIR. X-ray diffraction (XRD) analysis indicated the crystalline phase of TiO2 NPs and CS-NPs coated TiO2 NPs. Scanning Electron Microscopy (SEM) confirmed spherical shaped nanoparticles size of chitosan NPs ranging from 19–25 nm and TiO2 NPs 35–50 nm. Thesize of CS-NPs coated TiO2 NPs was in the range of 65–75 nm. The UV-Vis Spectra and band gap values illustrated the red shift in CS-NPs coated TiO2 NPs. Fourier transform infrared (FTIR) spectroscopy confirmed the linkages between TiO2 NPs and chitosan biopolymer, Zeta potential confirmed the stability of CS-NPs coated TiO2 NPs by showing 95 mV peak value. In-vitro antibacterial activity of CS-NPs coated TiO2 NPs and Uncoated TiO2 NPs was evaluated by disc diffusion method against PDR strain of E. coli isolated from mastitic milk samples. The antibacterial activity of all the synthesized nanoformulations were noted and highest antibacterial activity was shown by CS-NPs coated TiO2-NPs against pandrug resistant (PDR) E. coli strain with the prominent zone of inhibition of 23 mm. Morphological changes of E. coli cells after the treatment with MIC concentration (0.78 μg/ml) of CS-NPs coated TiO2 NPs were studied by transmission electron microscopy TEM showedrigorous morphological defectand has distorted the general appearance of the E. coli cells. Cytotoxicity (HepG2 cell line) and hemolytic (human blood) studies confirmed nontoxic/biocompatible nature of CS-NPs coated biologically synthesized TiO2 NPs. The results suggested that biologically synthesized and surface modified TiO2 NPs by mucoadhesive polysaccharides (e.g. chitosan) coating would be an effective and non-toxic alternative therapeutic agent to be used in livestock industry to control drug resistant veterinary pathogens.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Biocompatible $$x chemistry'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles