Relevant bibliographies by topics / Bronzes canadiens

Contents

  1. Journal articles
  2. Books
  3. Book chapters

Academic literature on the topic 'Bronzes canadiens'

Author: Grafiati
Published: 4 June 2021
Last updated: 1 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Bronzes canadiens.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Bronzes canadiens"

1

Donald, Moss, and Penny Werthner. "Special Issue: Evidence-Based Applications of Biofeedback and Neurofeedback in Sport." Biofeedback 43, no. 2 (June 1, 2015): 51–53. http://dx.doi.org/10.5298/1081-5937-43.2.08.

Full text
Abstract:
The cover of this issue of Biofeedback shows Canadian Mark de Jonge, K1 200-m bronze medalist at the summer 2012 Olympic Games in London and World Champion in 2015 in the sport of CanoeKayak (credit to Jeff Cooke for the photo).
APA, Harvard, Vancouver, ISO, and other styles
2

Doern, F. E., and D. L. Wotton. "Microanalysis of Airborne Lead Particulates in an Urban Industrial Environment." Proceedings, annual meeting, Electron Microscopy Society of America 43 (August 1985): 112–15. http://dx.doi.org/10.1017/s0424820100117583.

Full text
Abstract:
IntroductionWeston is a small residential neighborhood in the northwest quadrant of the City of Winnipeg (see Figure 1). The community, in addition to being surrounded by industrial activity, is also unusual in having a secondary lead smelter (Canadian Bronze Co. Ltd.) located within its residential area. There are two other secondary lead smelters in Winnipeg, both of which are also located in the northwest of the city. Concern about high levels of lead found in blood of children from Weston School, located some two blocks from Canadian Bronze and adjacent to moderately heavy traffic, prompted a rigorous air- and soil-sampling program. Following this there was considerable public/political debate and ultimately a sod/soil removal program at the school, and from a number of residential properties in the Weston area. The need to identify the lead source(s) came to the forefront again when lead-in-soil at Weston School was found to be approaching the maximum acceptable level (2600 μg/g for lead in urban soil) within twelve months following the “clean-up” operation.
APA, Harvard, Vancouver, ISO, and other styles
3

Rothman, Mitchell S., and Gülriz Kozbe. "Muş in the Early Bronze Age." Anatolian Studies 47 (December 1997): 105–26. http://dx.doi.org/10.2307/3642902.

Full text
Abstract:
In 1991 a crew of American, Canadian, and Turkish researchers began a new and comprehensive survey in the Muş Province of Eastern Turkey. The goal of the survey was to study the evolution of settlement and landuse in a marginal zone at the intersection of four great culture areas of the Middle East: Central Anatolia, Western Iran, the Transcaucasus, and Mesopotamia.This area of Eastern Turkey had been visited previously by I. K. Kökten in 1940s (1947) and Charles Burney in 1950s (1958). Given the large area these surveyors covered and their limited means of transportation, and given the newly excavated material coming from north of the great Taurus mountain massif and from Van (e.g., Sagona 1994, Sagona et al 1992, Çilingiroğlu 1987, 1988), a more comprehensive effort appeared warranted. The first season was six weeks in duration. During that time we re-visited 17 of the sites found by Kökten and Burney, and located 11 new sites. A second season was launched in 1993 with the aim of covering areas not surveyed previously (see Figure 1), mostly in the northern foothills and higher elevations near Hamurpet Lake. Unfortunately, conditions did not permit us to do a second season, nor is a season in the very near future likely. We, therefore, will be publishing the results we have already arrived at, aware that our sample is not complete.
APA, Harvard, Vancouver, ISO, and other styles
4

Northover, P. R., and M. Desjardins. "First Report of Bronze Leaf Disease on Hybrid Poplar (Populus × canescens ‘Tower’) Caused by Apioplagiostoma populi in Manitoba, Canada." Plant Disease 87, no. 12 (December 2003): 1538. http://dx.doi.org/10.1094/pdis.2003.87.12.1538c.

Full text
Abstract:
Poplars (Populus alba × P. tremula (P. × canescens) (Aiton) Smith cv. Tower) are common ornamental and windbreak trees in Manitoba and across the Canadian prairie provinces because of their rapid growth and columnar growth habit. Bronze leaf disease symptoms have been reported on five poplar species (P. alba, P. canescens, P. grandidentata, P. tremula, and P. tremuloides) (2), and the disease presents a significant barrier to the development and continued use of poplars (1). Elimination of tower poplars would represent a significant loss to the Canadian horticultural industry, and the costs incurred in the replacement of existing windbreaks would be high. In August 2002, we observed symptoms of bronze leaf disease on approximately 20-year-old tower poplars, ranging in height from 8 to 12 m at a tree nursery and golf course near Carman, Manitoba (49°30′N, 98°0′W). The leaf laminae of affected plants were chocolate brown, and the petioles and veins were yellow to light green. In the nursery windbreak, 70 trees had foliar symptoms on 30 to 80% of the canopy. At the golf course, eight trees had foliar symptoms on approximately 5 to 20% of the canopy. No fruiting structures were visible on leaf or shoot tissue, and no staining of vascular tissues was observed. Attempts to isolate the causal fungus of bronze leaf disease on artificial media have been unsuccessful (2). In October 2002, branches with symptomatic leaves were covered with netting, and the trapped leaves were left to overwinter. In March 2003, symptomatic leaves were brought to the laboratory and surface sterilized in 1% NaOCl for 1 min, rinsed with sterile water, and incubated at 18°C in moist chambers. After 2 weeks, dark brown, beaked, single perithecia that were 150 to 200 μm long × 150 μm wide emerged from the upper and lower leaf surfaces. Asci were fusoid clavate with a conspicuous apical ring and contained 4 or 6 spores. The two-celled, hyaline ascospores varied from 10.5 to 14.5 × 2 to 3 μm, the basal cell shorter than the apical cell. Leaf symptoms and microscopic fungal features matched those of Apioplagiostoma populi (Cash & A.M. Waterman) Barr, the cause of bronze leaf disease (1,2). Voucher specimens have been deposited in the U.S. National Fungus Collections (BPI 843385). To our knowledge, this is the first report of this fungus in western Canada, and the first confirmed report of this pathogen on tower poplar in Canada. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) J. A. Smith et al. Plant Dis. 86:462, 2002.
APA, Harvard, Vancouver, ISO, and other styles
5

Kennedy, Liam, Derek Silva, Madelaine Coelho, and William Cipolli. "“We Are All Broncos”: Hockey, Tragedy, and the Formation of Canadian Identity." Sociology of Sport Journal 36, no. 3 (September 1, 2019): 189–202. http://dx.doi.org/10.1123/ssj.2019-0006.

Full text
Abstract:
There exists a broad body of scholarly work that focuses on how communities, and individuals therein, mobilize, respond, and harvest collective action in response to tragedy. Despite this interest, there remains a dearth of empirical investigation into the complex intersections of tragedy, sport, and community. Utilizing qualitative approaches to discourse analysis and quantitative measures of sentiment, semantic, and content analysis of news media articles (n = 151) and public tweets (n = 126,393), this paper explores the ways in which public responses to the 2018 Humboldt Broncos bus crash present a relatively narrow representation of both Canadian and local Prairie identity. We conclude with a discussion of some of the implications of collective action in response to specific forms of tragedy.
APA, Harvard, Vancouver, ISO, and other styles
6

Kawchuk, L. M., R. J. Howard, M. L. Kalischuk, P. R. Northover, M. Desjardins, and R. C. J. Spencer. "First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi." Plant Disease 94, no. 3 (March 2010): 377. http://dx.doi.org/10.1094/pdis-94-3-0377a.

Full text
Abstract:
Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 μm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 μm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 μm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5′GCATCGATGAAGAACGCAGC3′ and 5′TCCTCCGCTTATTGATATGC3′ specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.
APA, Harvard, Vancouver, ISO, and other styles
7

Dupee, Margaret, Tanya Forneris, and Penny Werthner. "Perceived Outcomes of a Biofeedback and Neurofeedback Training Intervention for Optimal Performance: Learning to Enhance Self-Awareness and Self-Regulation With Olympic Athletes." Sport Psychologist 30, no. 4 (December 2016): 339–49. http://dx.doi.org/10.1123/tsp.2016-0028.

Full text
Abstract:
The purpose of this study was to explore the perceived outcomes of a biofeedback and neurofeedback training intervention with high performance athletes. Five Olympic level athletes preparing for world championships and the 2012 Olympic Games took part in a 20 session intervention over the period of one year. At the completion of the intervention, a semistructured interview was conducted with each athlete. The athletes indicated that they became more self-aware, were better able to self-regulate both their physiological and psychological states, developed a greater sense of personal control, and a greater understanding of skills inherent in the field of sport psychology. Three of the athletes made the Canadian Olympic team for the 2012 Olympic Games and two of those athletes won bronze medals. The present study suggests that biofeedback and neurofeedback training may be useful in enabling athletes to perform optimally, in both training and competition, on a consistent basis.
APA, Harvard, Vancouver, ISO, and other styles
8

Fortin, Michel. "La vallée du Ghab du Bronze ancien à l’époque ottomane : résultats sommaires de la prospection syro-canadienne (2004-2006)." Syria, no. IV (December 1, 2016): 281–301. http://dx.doi.org/10.4000/syria.5214.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Silverman, Earl D. "Canadian Rheumatology Association Meeting, February 17-20, 2016. Introduction, Abstracts, Author Index." Journal of Rheumatology 43, no. 6 (April 15, 2016): 1149–250. http://dx.doi.org/10.3899/jrheum.160272.

Full text
Abstract:
The 71st Annual Meeting of The Canadian Rheumatology Association (CRA) was held at the Fairmont Chateau Lake Louise, Lake Louise, Alberta, Canada, February 17–20, 2016. The program consisted of presentations covering original research, symposia, awards, and lectures. Highlights of the meeting include the following 2016 Award Winners: Distinguished Rheumatologist, Ronald Laxer; Distinguished Investigator, Proton Rahman; Teacher-Educator, Lori Albert; Young Investigator, Nigil Haroon; Best Abstract on Basic Science Research by a Trainee, Liam O’Neil; Best Abstract on Research by a Rheumatology Resident, Valérie Leclair; Best Abstract by a Medical Student, Matthew Jessome; Best Abstract by a Post-Graduate Resident, Hyein Kim; CRA/Arthritis Research Foundation (ARF) Best Epidemiology/Health Services Research Award, Cheryl Barnabe; Summer Studentship Mentor Award, Ines Colmegna; CRA/ARF Best Paediatric Research Award, Lily Lim; CRA/ARF Best Clinical Research Award, Zahi Touma; CRA/ARF Best Basic Science Research Award, Nigil Haroon; Best Abstract on SLE Research by a Trainee — Ian Watson Award, Stephanie Nantes; Best Abstract on Clinical or Epidemiology Research by a Trainee — Phil Rosen Award, Nicolas Richard; Practice Reflection Award — Gold/Silver/Bronze, Henry Averns/Philip Baer and Jean-Pierre Raynauld/Robert Ferrari. Lectures and other events included the Dunlop-Dottridge Lecture: New Paradigms for Inflammatory Arthritis, by Berent Prakken; Keynote Address by Distinguished Investigator Awardee 2016 Proton Rahman: Role of Precision Medicine in Optimizing Quality in Rheumatology Care; State of the Art Lecture: Everything You Must Know About Sleep but are Too Tired to Ask! by James Maas; and the Great Debate: Be it Resolved that Rheumatologists Get with the Times and Use Social Media for Communication with Patients and Research; arguing for: Jason Kur and Michelle Teo; against: Nadia Luca and Sherry Rohekar. Topics such as rheumatoid arthritis, systemic lupus erythematosus, systemic sclerosis, Sjögren syndrome, psoriatic arthritis, spondyloarthritis, vasculitis, osteoarthritis, fibromyalgia, and their respective diagnoses, treatments, and outcomes are reflected in the abstracts, which we are pleased to publish in this issue of The Journal.
APA, Harvard, Vancouver, ISO, and other styles
10

Diacopoulos, Lita. "Investigating Social Complexity through Regional Survey: ?Second-Generation? Analysis of Bronze Age Data from the Canadian Palaipaphos Survey Project, Southwestern Cyprus." Journal of Mediterranean Archaeology 17, no. 1 (June 2004): 59–85. http://dx.doi.org/10.1558/jmea.17.1.59.56077.

Full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Books on the topic "Bronzes canadiens"

1

Jacques, Morin. Khóstia II: The bronze age : results of Canadian explorations and excavations at Khóstia, Boiotia, Central Greece. Chicago: Ares, 2004.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Warder, Marie. The bronze killer: The story of a family's fight against a very common enemy. Victoria, B.C: Imperani Publishers, 1988.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Rowe, Robert Arthur Grey. "Pappy": The life story of Hall of Fame great Paul Rowe. Calgary, Alta: The author, 2012.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Warder, Marie. The Bronze Killer : New Edition. DROMEDARIS BOOKS, 2000.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Garnet, Eldon. The Narrative Body. Autonomedia, 1992.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Warder, Marie. The Bronze Killer: The Story of a Family's Fight Against a Very Common Enemy - Hemochromatosis. 2nd ed. D.W. Friesen & Sons, 1989.

Find full text
APA, Harvard, Vancouver, ISO, and other styles

Book chapters on the topic "Bronzes canadiens"

1

Smith, R. Angus K., Mary K. Dabney, and James C. Wright. "The Mycenaean Cemetery at Ayia Sotira, Nemea." In Death in Late Bronze Age Greece, 89–106. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780190926069.003.0005.

Full text
Abstract:
From 2006 to 2008 The Canadian Institute in Greece sponsored the excavation of a Mycenaean chamber tomb cemetery at Ayia Sotira near Koutsomodi in the Nemea Valley. The five modest tombs excavated by the project were undoubtedly associated with the nearby settlement of Tsoungiza, and offer a picture of the mortuary practices associated with this settlement. The practices at Ayia Sotira describe both local funerary customs and more generally “Mycenaean” ones observable throughout Mainland Greece and the Aegean. Explanations for the local character are found in the economic conditions of the nearby settlement, in the local geology, and presumably local customs. These were documented through careful recovery of the stratigraphy and contents of the tombs, including paleobotanical, phytolith, organic residue, and micromorphological analysis. The remarkable similarity of these tombs and their contents to those excavated at neighboring Zygouries confirm the local character of chamber tomb inhumation. Yet comparison with other chamber tomb cemeteries, notably nearby Aidonia, but also with examples in the Corinthia, Argolid, and elsewhere, demonstrate the general features of a common “Mycenaean” practice. Overall, burial practices in the chamber tombs at Ayia Sotira fits our reconstruction of the inhabitants of Tsoungiza being incorporated into a social and political system dominated by the inhabitants of Mycenae during the LH IIIA2–B periods.
APA, Harvard, Vancouver, ISO, and other styles
2

Dickson, J. I., L. Handfield, J. Hallen-Lopez, Y. Blanchette, and M. Sahoo. "THE INFLUENCE OF MICROSTRUCTURE ON THE FRACTURE TOUGHNESS AND YIELD STRENGTH OF Mn-Ni-AI SHIP PROPELLER BRONZES." In Proceedings of the Metallurgical Society of the Canadian Institute of Mining and Metallurgy, 327–36. Elsevier, 1988. http://dx.doi.org/10.1016/b978-0-08-035764-5.50031-6.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Meurer, Ulrich. "The Shards of Zadar." In Classics and Media Theory, 187–210. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780198846024.003.0008.

Full text
Abstract:
By ‘unearthing’ artefacts from folded layers of time, media archaeology undermines linear historical discourse: in this regard, this chapter addresses an exemplary art-based project on the origins of cinema that takes the epistemological metaphor of ‘excavation’ at its word. In 2011, the Canadian artist Henry Jesionka discovers several ancient bronze and glass objects on a Croatian beach, dates the pieces to the first century CE, and identifies them as components of an intricate Graeco-Roman mechanism for the projection of moving images. This rewriting of media history not only illustrates how traits of materiality and contingency interfere with teleological history; it also reflects on industrial capitalism’s paradox claims of ‘reason’ and the ideological presuppositions of progress: Cornelius Castoriadis’s notion of a merely simulated Rationality of Capitalism (1997) suggests that traditional narratives of technological invention are invariably organized around a clandestine and insufficiently repressed nucleus of the unforeseen, unpredictable, and irrational. By admitting to a similar element of chance or lost control, Jesionka’s Ancient Cinema project and new founding myth of cinema comment on the logic of media archaeology as an expression of late capitalism’s waning belief in its own rationale.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'Bronzes canadiens' for particular source types:
Journal articles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography