Journal articles on the topic 'Bronzes canadiens'

The cover of this issue of Biofeedback shows Canadian Mark de Jonge, K1 200-m bronze medalist at the summer 2012 Olympic Games in London and World Champion in 2015 in the sport of CanoeKayak (credit to Jeff Cooke for the photo).

IntroductionWeston is a small residential neighborhood in the northwest quadrant of the City of Winnipeg (see Figure 1). The community, in addition to being surrounded by industrial activity, is also unusual in having a secondary lead smelter (Canadian Bronze Co. Ltd.) located within its residential area. There are two other secondary lead smelters in Winnipeg, both of which are also located in the northwest of the city. Concern about high levels of lead found in blood of children from Weston School, located some two blocks from Canadian Bronze and adjacent to moderately heavy traffic, prompted a rigorous air- and soil-sampling program. Following this there was considerable public/political debate and ultimately a sod/soil removal program at the school, and from a number of residential properties in the Weston area. The need to identify the lead source(s) came to the forefront again when lead-in-soil at Weston School was found to be approaching the maximum acceptable level (2600 μg/g for lead in urban soil) within twelve months following the “clean-up” operation.

In 1991 a crew of American, Canadian, and Turkish researchers began a new and comprehensive survey in the Muş Province of Eastern Turkey. The goal of the survey was to study the evolution of settlement and landuse in a marginal zone at the intersection of four great culture areas of the Middle East: Central Anatolia, Western Iran, the Transcaucasus, and Mesopotamia.This area of Eastern Turkey had been visited previously by I. K. Kökten in 1940s (1947) and Charles Burney in 1950s (1958). Given the large area these surveyors covered and their limited means of transportation, and given the newly excavated material coming from north of the great Taurus mountain massif and from Van (e.g., Sagona 1994, Sagona et al 1992, Çilingiroğlu 1987, 1988), a more comprehensive effort appeared warranted. The first season was six weeks in duration. During that time we re-visited 17 of the sites found by Kökten and Burney, and located 11 new sites. A second season was launched in 1993 with the aim of covering areas not surveyed previously (see Figure 1), mostly in the northern foothills and higher elevations near Hamurpet Lake. Unfortunately, conditions did not permit us to do a second season, nor is a season in the very near future likely. We, therefore, will be publishing the results we have already arrived at, aware that our sample is not complete.

Poplars (Populus alba × P. tremula (P. × canescens) (Aiton) Smith cv. Tower) are common ornamental and windbreak trees in Manitoba and across the Canadian prairie provinces because of their rapid growth and columnar growth habit. Bronze leaf disease symptoms have been reported on five poplar species (P. alba, P. canescens, P. grandidentata, P. tremula, and P. tremuloides) (2), and the disease presents a significant barrier to the development and continued use of poplars (1). Elimination of tower poplars would represent a significant loss to the Canadian horticultural industry, and the costs incurred in the replacement of existing windbreaks would be high. In August 2002, we observed symptoms of bronze leaf disease on approximately 20-year-old tower poplars, ranging in height from 8 to 12 m at a tree nursery and golf course near Carman, Manitoba (49°30′N, 98°0′W). The leaf laminae of affected plants were chocolate brown, and the petioles and veins were yellow to light green. In the nursery windbreak, 70 trees had foliar symptoms on 30 to 80% of the canopy. At the golf course, eight trees had foliar symptoms on approximately 5 to 20% of the canopy. No fruiting structures were visible on leaf or shoot tissue, and no staining of vascular tissues was observed. Attempts to isolate the causal fungus of bronze leaf disease on artificial media have been unsuccessful (2). In October 2002, branches with symptomatic leaves were covered with netting, and the trapped leaves were left to overwinter. In March 2003, symptomatic leaves were brought to the laboratory and surface sterilized in 1% NaOCl for 1 min, rinsed with sterile water, and incubated at 18°C in moist chambers. After 2 weeks, dark brown, beaked, single perithecia that were 150 to 200 μm long × 150 μm wide emerged from the upper and lower leaf surfaces. Asci were fusoid clavate with a conspicuous apical ring and contained 4 or 6 spores. The two-celled, hyaline ascospores varied from 10.5 to 14.5 × 2 to 3 μm, the basal cell shorter than the apical cell. Leaf symptoms and microscopic fungal features matched those of Apioplagiostoma populi (Cash & A.M. Waterman) Barr, the cause of bronze leaf disease (1,2). Voucher specimens have been deposited in the U.S. National Fungus Collections (BPI 843385). To our knowledge, this is the first report of this fungus in western Canada, and the first confirmed report of this pathogen on tower poplar in Canada. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) J. A. Smith et al. Plant Dis. 86:462, 2002.

There exists a broad body of scholarly work that focuses on how communities, and individuals therein, mobilize, respond, and harvest collective action in response to tragedy. Despite this interest, there remains a dearth of empirical investigation into the complex intersections of tragedy, sport, and community. Utilizing qualitative approaches to discourse analysis and quantitative measures of sentiment, semantic, and content analysis of news media articles (n = 151) and public tweets (n = 126,393), this paper explores the ways in which public responses to the 2018 Humboldt Broncos bus crash present a relatively narrow representation of both Canadian and local Prairie identity. We conclude with a discussion of some of the implications of collective action in response to specific forms of tragedy.

Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 μm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 μm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 μm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5′GCATCGATGAAGAACGCAGC3′ and 5′TCCTCCGCTTATTGATATGC3′ specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.

The purpose of this study was to explore the perceived outcomes of a biofeedback and neurofeedback training intervention with high performance athletes. Five Olympic level athletes preparing for world championships and the 2012 Olympic Games took part in a 20 session intervention over the period of one year. At the completion of the intervention, a semistructured interview was conducted with each athlete. The athletes indicated that they became more self-aware, were better able to self-regulate both their physiological and psychological states, developed a greater sense of personal control, and a greater understanding of skills inherent in the field of sport psychology. Three of the athletes made the Canadian Olympic team for the 2012 Olympic Games and two of those athletes won bronze medals. The present study suggests that biofeedback and neurofeedback training may be useful in enabling athletes to perform optimally, in both training and competition, on a consistent basis.

The 71st Annual Meeting of The Canadian Rheumatology Association (CRA) was held at the Fairmont Chateau Lake Louise, Lake Louise, Alberta, Canada, February 17–20, 2016. The program consisted of presentations covering original research, symposia, awards, and lectures. Highlights of the meeting include the following 2016 Award Winners: Distinguished Rheumatologist, Ronald Laxer; Distinguished Investigator, Proton Rahman; Teacher-Educator, Lori Albert; Young Investigator, Nigil Haroon; Best Abstract on Basic Science Research by a Trainee, Liam O’Neil; Best Abstract on Research by a Rheumatology Resident, Valérie Leclair; Best Abstract by a Medical Student, Matthew Jessome; Best Abstract by a Post-Graduate Resident, Hyein Kim; CRA/Arthritis Research Foundation (ARF) Best Epidemiology/Health Services Research Award, Cheryl Barnabe; Summer Studentship Mentor Award, Ines Colmegna; CRA/ARF Best Paediatric Research Award, Lily Lim; CRA/ARF Best Clinical Research Award, Zahi Touma; CRA/ARF Best Basic Science Research Award, Nigil Haroon; Best Abstract on SLE Research by a Trainee — Ian Watson Award, Stephanie Nantes; Best Abstract on Clinical or Epidemiology Research by a Trainee — Phil Rosen Award, Nicolas Richard; Practice Reflection Award — Gold/Silver/Bronze, Henry Averns/Philip Baer and Jean-Pierre Raynauld/Robert Ferrari. Lectures and other events included the Dunlop-Dottridge Lecture: New Paradigms for Inflammatory Arthritis, by Berent Prakken; Keynote Address by Distinguished Investigator Awardee 2016 Proton Rahman: Role of Precision Medicine in Optimizing Quality in Rheumatology Care; State of the Art Lecture: Everything You Must Know About Sleep but are Too Tired to Ask! by James Maas; and the Great Debate: Be it Resolved that Rheumatologists Get with the Times and Use Social Media for Communication with Patients and Research; arguing for: Jason Kur and Michelle Teo; against: Nadia Luca and Sherry Rohekar. Topics such as rheumatoid arthritis, systemic lupus erythematosus, systemic sclerosis, Sjögren syndrome, psoriatic arthritis, spondyloarthritis, vasculitis, osteoarthritis, fibromyalgia, and their respective diagnoses, treatments, and outcomes are reflected in the abstracts, which we are pleased to publish in this issue of The Journal.

AbstractMeligethes viridescens (Fabricius), bronzed or rape blossom beetle, is a widespread and common pest of oilseed rape [Brassica napus L. and Brassica rapa L. (Brassicaceae)] in the western Palaearctic subregion. The establishment of M. viridescens in eastern North America has raised concern that its presence is a potential risk to the Canadian canola industry, especially to the prairie ecozone of western Canada where up to 4 million ha of summer canola (B. napus and B. rapa) are grown annually. Study of museum specimens indicated that M. viridescens was first recorded in Nova Scotia in 1947. Field surveys indicated that, as of 2001, M. viridescens was established as far west as Saint-Hyacinthe, Quebec. A CLIMEXTM model for M. viridescens in Europe was developed and validated with actual distribution records. In Canada the model predicted that once introduced, M. viridescens would readily survive in the canola-growing areas. The actual distribution of M. viridescens in eastern Canada matched the predicted distribution well. The westward dispersal to and establishment of M. viridescens in canola-growing areas of Ontario and western Canada, particularly southern Manitoba, appear to be inevitable. Establishment in these areas presents the risk of substantial production losses to canola producers.

While writing his memoir, the author highlights the root causes of Collaboration University of Saskatchewan and State University of Chernivtsi Agreement. In June, 1977 on behalf of Professor Konstiantyn Chervinskyi – the-then Rector of State University of Chernivtsi, the author had the honour to meet in Kyiv Robert Begg – the President of University of Saskatchewan. What is more, during this crucial meeting the author initiated the talks concerning further fruitful collaboration between universities. Interestingly, the actual inter-university collaboration has started taking its shape since 1976, when a bronze statue of Lesya Ukrayinka, made in Kyiv (Ukraine in former USSR) by sculptor Halyna Kalchenko and architect Anatoliy Ihnashchenko, was unveiled at the University of Saskatchewan (Sascatoon). The monument was presented to the University by the Association for Cultural Relations with Ukrainians Abroad. Significantly, it was the Association that invited the Rector of University of Saskatchewan and his wife to pay an official visit to Ukraine. The Rector himself suggested signing the agreement with one of the universities of West Ukraine. Symbolically, State University of Chernivtsi was targeted by the Ministry of Higher and Secondary Specialized Education of the Ukrainian Soviet Socialist Republic. Of particular value were the provisions of University of Saskatchewan agreement. They supported the study of the language, culture and history of Ukraine. Furthermore, the agreement aimed at academic and cultural exchanges of faculty, scholars and students at the post-secondary level. This was unprecedented formal agreement between a North American university and a university in Ukraine. Noteworthy, Collaboration agreement was solemnly concluded by both Rectors on June 5, 1977 in compliance with the sticking points of the Canadian part. Regrettably, the former USSR’s (Mocsow) authorities amended the agreement, excluding the point of students’ exchange program. In terms of the Canadian students, they were able to come and study at State University of Chernivtsi; our students, however, were forbidden to cross the borders of the USSR. Instead, the faculty of our university enjoyed the right to go on their sabbatical to Saskatoon. Paying the tribute to University of Saskatchewan, the author extends his gratitude to its authorities. Nevertheless, after the USSR collapse, the students of State University of Chernivtsi got an excellent opportunity to study in Canada. To conclude, the Agreement prolongs its validity. To be more precise, the Chernivtsi-Saskatoon Universities’ Collaboration Agreement will celebrate its 40th anniversary in 2017. According to the author, the agreement has quite a reasonable right to be extended. Keywords: Lesya Ukrayinka, University of Saskatchewan, State University of Chernivtsi, Collaboration Agreement

C’est à l’initiative de Louvigny de Montigny (1876-1955) que le roman de Louis Hémon, Maria Chapdelaine, est publié pour la première fois à Montréal en 1916. Le texte passe alors de la forme feuilleton à celle de livre. L’édition est confiée à J.-A. Lefebvre qui mandate le soin de l’illustrer à Suzor-Coté (1867-1939). Les vingt-cinq dessins au fusain reproduits maladroitement par les presses de la firme Godin & Ménard sont d’un intérêt inégal. L’artiste reprend et adapte certaines de ses compositions auxquelles il ajoute quelques scènes caractéristiques du roman, traitées de manière sommaire. La parution en 1921 à Paris du roman lance la carrière internationale du livre qui connaît la célébrité. Fort de sa connaissance de cette oeuvre, Suzor-Coté réalise alors un ensemble de sculptures inspirées de personnages dépeints et de situations décrites. C’est ainsi que les époux Chapdelaine, Maria elle-même, le remmancheur, le médecin de campagne, mais également des scènes montrant le défricheur, l’essoucheur, le portageur et le fumeur prennent forme et seront diffusés dans leur version en bronze. La veine rurale de l’artiste qui était jusqu’alors centrée sur la région d’Arthabaska et certains de ses habitants connaît un renouveau. Le roman permet à Suzor-Coté de combiner sa propre fiction de la vie à la campagne à celle de Hémon. Certaines de ces sculptures, L’essoucheur et Le portageur, par exemple, sont parmi ses meilleures réussites dans ce domaine et contribuent à maintenir sa réputation comme artiste polyvalent sensible à la représentation de la réalité canadienne. À leur tour, les dessins originaux, glorifiés par le succès du roman et débarrassés du traitement que leur avait fait subir l’imprimeur, connaissent une nouvelle vie, une fois acquis par le Musée de la province en 1934. Suzor-Coté peut alors s’appuyer sur l’impact du livre pour faire oublier l’échec de 1916 et ajouter sa contribution à la représentation des personnages de Hémon dans l’imaginaire collectif.

Past warm intervals lasting from decades to centuries can be observed throughout the late Holocene geologic record using various proxy physical, chemical and fossil indices, in conjunction with seasonal information such as the timing of the first flowers of the spring season, or by the dates of first freezing and thaws of fresh water bodies, that have been recorded in various journals. Three important warm intervals that have been identified over the past 3500 years include the Late Bronze Age Optimum (BAO)(~1350 to ~1200 BC), the Iron/Roman Age Optimum (I/RAO)(~250 BC to ~400 AD) and the Medieval Warm Period (MWP)(~950 to ~1250 AD). The early phase of the BAO featured maximum development of the Hittite Empire and the evolution of the palace economy. The timing and duration of the later I/RAO show considerable variation from place to place in the Northern Hemisphere. MWP proxy records from several regions indicate that, like the I/RAO pattern, peak warmth occurred at different times in different places included in the Period’s overall footprint. Paleo-temperatures, both slightly cooler and warmer than present, have been reported. The WMP occurred during the Middle Ages at a time of the expansion of major commercial routes along the Mediterranean Sea coast and during an interval when Vikings explored and settled in some areas of the North Atlantic region.Sea level rise is among the suite of important ocean-related negative impacts that are often associated with contemporary global warming scenarios. Both early and modern societies have developed effective adaptation strategies and mitigation techniques to resist rising sea levels and flooding. Many of these have utility for Canada in both inland and especially in coastal areas of the Maritime Provinces. Early sea level rise and tidal flow mitigation measures include the construction of dykes around low-lying areas, sand dune stabilization and shoreline armoring using large boulders in concert with breakwaters and groynes. Today, there is also opportunity for the application of beach nourishment and artificial dune construction to resist erosion by storm waves and alongshore currents but these typically require annual maintenance to remain effective. Last resort mechanisms range from stilt home construction to abandonment (managed retreat) of previously impacted coastal areas. It is very likely that, when needed, Canadians will be able to apply a broad range of modern and ancient effective technologies and to engage engineering expertise to develop new (e.g., hybrid) approaches for combating specific negative coastal impacts than were available to BAO, I/RAO and MWP societies.

Reviewing Melissa Lucashenko’s Mullumbimby (2013), Eve Vincent notes that it shares with Keri Hulme’s The Bone People (1984) one significant feature: “a glossary of Indigenous words.” Working with various forms of the term “abroad”, this article surveys the debate The Bone People ignited around the relative merits of such a glossary in texts written predominantly in English, the colonizing language. At stake here is the development of a post-colonial community that incorporates Indigenous identity and otherness (Maori or Aboriginal) with the historical legacy of the English/Indigenous-language multi-lingualism of multi-cultural Australia and New Zealand. I argue that the terms of this debate have remained static since 1984 and that this creates a problem for post-colonial theory. Specifically, the debate has favoured a binary either/or approach, whereby either the Indigenous language or English has been empowered with authority over the text’s linguistic, historical, cultural and political territory. Given that the significations of “abroad” include a travelling encounter with overseas places and the notion of being widely scattered or dispersed, the term has value for an investigation into how post-colonialism as a historical circumstance is mediated and transformed within literature. Post-colonial literature is a response to the “homeland” encounter with a foreign “abroad” that creates particular wide scatterings or dispersals of writing within literary texts.In 1989, Maryanne Dever wrote that “some critics have viewed [The Bone People’s] glossary as a direct denial of otherness. … It can be argued, however, that the glossary is in fact a further way of asserting that otherness” (24). Dever is responding to Simon During, who wrote in 1985 that “by translating the Maori words into English [the glossary allows] them no otherness within its Europeanising apparatus” (During 374). Dever continues: “[The glossary] is a considered statement of the very separateness of the Maori language. In this way, the text inverts the conventional sense of privileging, the glossary forming the key into a restricted or privileged form of knowledge” (24). Dever’s language is telling: “direct denial of otherness,” “asserting that otherness,” and “the very separateness of the Maori language,” reinforce a binary way of thinking that is reproduced by Vincent in 2013 (24).This binary hinders a considered engagement with post-colonial difference because it produces hierarchal outcomes. For Toril Moi, “binary oppositions are heavily imbricated in the patriarchal value system: each opposition can be analysed as a hierarchy where the ‘feminine’ side is always seen as the negative, powerless instance” (104). Inspired by Elizabeth M. DeLoughrey’s concept of “tidalectics”, my article argues that the neologism “glossary islands” provides a more productive way of thinking about the power relations of the relationship of glossaries of Indigenous words to Hulme’s and Lucashenko’s mainly English-language, post-colonial novels. Resisting a binary either/or approach, “glossary islands” engages with the inevitable intermingling of languages of post-colonial and multi-cultural nations and holds value for a new methodological approach to the glossary as an element of post-colonial (islandic) literature.Both The Bone People and Mullumbimby employ female protagonists (Kerewin Holmes and Jo Breen respectively) to explore how family issues resolve into an assertion of place-based community for people othered by enduring colonial forces. Difficult loves and difficult children provide opportunities for tension and uneasy resolution in each text. In Hulme’s novel, Kerewin resists the romantic advances of Joe Gillayley to the end, without ever entirely rejecting him. Similarly, in Mullumbimby, Jo and Twoboy Jackson conduct a vacillating relationship, though one that ultimately steadies. The Bone People tells of an autistic child, Simon P. Gillayley, while Mullumbimby thematises a difficult mother-daughter relationship in its narration of single-mother Jo’s struggles with Ellen. Furthermore, employing realist and magic realist techniques, both novels present family and love as allegories of post-colonial community, thereby exemplifying Stephen Slemon’s thesis that “the real social relations of post-colonial cultures appear, through the mediation of the text’s language of narration, in the thematic dimension of the post-colonial magic realist work” (12).Each text also shows how post-colonial literature always engages with the “abroad” by virtue of the post-colonial relationship of the indigenous “homeland” to the colonial “imported abroad”. DeLoughrey characterises this post-colonial relationship to the “abroad” by a “homeland” as a “tidalectics”, meaning “a dynamic and shifting relationship between land and sea that allows island literatures to be engaged in their spatial and historical complexity” (2-3). The Bone People and Mullumbimby are examples of island literatures for their geographic setting. But DeLoughrey does not compress “tidalectics” to such a reductionist definition. The term itself is as “dynamic and shifting” as what it signifies, and available for diverse post-colonial redeployments (DeLoughrey 2).The margin of land and sea that DeLoughrey foregrounds as constitutive of “tidalectics” is imaginatively re-expressed in both The Bone People and Mullumbimby. Lucashenko’s novel is set in the Byron Bay hinterland, and the text is replete with teasing references to “tidalectics”. For example, “Jo knew that the water she watched was endlessly cycling upriver and down, travelling constantly between the saltwater and the fresh” (Lucashenko 260-61). The writing, however, frequently exceeds a literal “tidalectics”: “Everything in the world was shapeshifting around her, every moment of every day. Nothing remained as it was” (Lucashenko 261).Significantly, Jo is no passive figure at the centre of such “shapeshifting”. She actively takes advantage of the “dynamic and shifting” interplay between elemental presences of her geographical circumstances (DeLoughrey 2). It is while “resting her back against the granite and bronze directional marker that was the last material evidence of humanity between Ocean Shores and New Zealand,” that Jo achieves her major epiphany as a character (Lucashenko 261). “Her eyelids sagged wearily. … Jo groaned aloud, exhausted by her ignorance and the unending demands being made on her to exceed it. The temptation to fall asleep in the sun, and leave these demands far behind, began to take her over. … No. We need answers” (Lucashenko 263). The “tidalectics” of her epiphany is telling: the “silence then splintered” (262) and “momentarily the wrens became, not birds, but mere dark movement” (263). The effect is dramatic: “The hairs on Jo’s arms goosepimpled. Her breathing grew fast” (263). “With an unspoken curse for her own obtuseness”, Jo becomes freshly decisive (264). Thus, a “tidalectics” is not a mere geographic backdrop. Rather, a “dynamic and shifting” landscape—a metamorphosis—energizes Jo’s identity in Mullumbimby. In the “homeland”/“abroad” flux of “tidalectics”, post-colonial community germinates.The geography of The Bone People is also a “tidalectics”, as demonstrated, for instance, by chapter five’s title: “Spring Tide, Neap Tide, Ebb Tide, Flood” (Hulme 202). Hulme’s novel contains literally hundreds of such passages that dramatise the margin of land and sea as “dynamic and shifting” (DeLoughrey 2). Again: “She’s standing on the orangegold shingle, arms akimbo, drinking the beach in, absorbing sea and spindrift, breathing it into her dusty memory. It’s all here, alive and salt and roaring and real. The vast cold ocean and the surf breaking five yards away and the warm knowledge of home just up the shore” (163). Like the protagonist of Mullumbimby, Kerewin Holmes is an energised subject at the margin of land and sea. Geography as “tidalectics” is activated in the construction of character identity. Kerewin involves her surroundings with her sense of self, as constituted through memory, in a fashion that enfolds the literal with the metaphorical: memory is “dusty” in the midst of “vast” waters (163).Thus, at least three senses of “abroad” filter through these novels. Firstly, the “abroad” exists in the sense of an abroad-colonizing power retaining influence even in post-colonial times, as elaborated in Simon During’s distinction between the “post-colonised” and the “post-colonisers” (Simon 460). Secondly, the “abroad” reveals itself in DeLoughrey’s related conceptualisation of “tidalectics” as a specific expression of the “abroad”/“homeland” relationship. Thirdly, the “abroad” is present by virtue of the more general definition it shares with “tidalectics”; for “abroad”, like “tidalectics”, also signifies being widely scattered, at large, ranging freely. There is both denotation and connotation in “tidalectics”, which Lucashenko expresses here: “the world was nothing but water in the air and water in the streams” (82). That is, beyond any “literal littoral” geography, “abroad” is linked to “tidalectics” in this more general sense of being widely scattered, dispersed, ranging freely.The “tidalectics” of Lucashenko’s and Hulme’s novels is also shared across their form because each novel is a complex interweaving of English and the Indigenous language. Here though, we encounter a clear difference between the two novels, which seems related to the predominant genres of the respective texts. In Lucashenko’s largely realist mode of writing, the use of Indigenous words is more transparent to a monolingual English speaker than is Hulme’s use of Maori in her novel, which tends more towards magic realism. A monolingual English speaker can often translate Lucashenko almost automatically, through context, or through an in-text translation of the words worked into the prose. With Hulme, context usually withholds adequate clues to the meaning of the Maori words, nor are any in-text translations of the Maori commonly offered.Leaving aside for now any consideration of their glossaries, each novel presents a different representation of the post-colonial/“abroad” relationship of an Indigenous language to English. Mullumbimby is the more conservative text in this respect. The note prefacing Mullumbimby’s Glossary reads: “In this novel, Jo speaks a mixture of Bundjalung and Yugambeh languages, interspersed with a variety of Aboriginal English terms” (283). However, the Indigenous words often shade quite seamlessly into their English translation, and the “Aboriginal English” Jo speaks is actually not that different from standard English dialogue as found in many contemporary Australian novels. If anything, there is only a slight, distinguishing American flavour to Jo’s dialogue. In Mullumbimby, the Indigenous tongue tends to disappear into the text’s dominant language: English.By contrast, The Bone People contains many instances where Maori presents in all its bold strangeness to a monolingual English speaker. My reading experience consisted in running my eyes over the words but not really taking them in, except insofar as they represented a portion of Maori of unknown meaning. I could look up the recondite English words (of which there were many) in my dictionary or online, but it was much harder to conveniently source definitions of the Maori words, especially when they formed larger syntactic units.The situation is reversed, however, when one considers the two glossaries. Mullumbimby’s glossary asserts the difference of the Indigenous language(s) by having no page numbers alongside its Indigenous words (contrast The Bone People’s glossary) and because, despite being titled Glossary as a self-sufficient part of the book, it is not mentioned in any Contents page. One comes across Lucashenko’s glossary, at the end of her novel, quite unexpectedly. Conversely, Hulme’s glossary is clearly referenced on its Contents page, where it is directly described as a “Translation of Maori Words and Phrases” commencing on page 446. Hulme’s glossary appears predictably, and contains page references to all its Maori words or phrases. This contrasts with Lucashenko’s glossary, which follows alphabetical order, rather than the novel’s order. Mullumbimby’s glossary is thus a more assertive textual element than The Bone People’s glossary, which from the Contents page on is more homogenised with the prevailing English text.Surely the various complexities of these two glossaries show the need for a better way of critically engaging with them that does not lead to the re-accentuation of the binary terms in which the scholarly discussion about their genre has been couched so far. Such a methodology needs to be sensitive to the different forms of these glossaries and of others like them in other texts. But some terminological minesweeping is required in order to develop this methodology, for a novel and a glossary are different textual forms and should not be compared like for like. A novel is a work of the imagination in fictional form whereas a glossary is a meta-text that, according to The New Shorter Oxford English Dictionary, comprises “a list with explanations, often accompanying a text, of abstruse, obsolete, dialectal, or technical terms.” The failure to take this difference substantially into account explains why the debate around Hulme’s and Lucashenko’s glossaries as instruments of post-colonial language relationships has defaulted, thus far, to a binary approach insensitive to the complexities of linguistic relations in post-colonial and multi-cultural nations. Ignoring the formal difference between novel and glossary patronises a reading that proceeds by reference to binary opposition, and thus hierarchy.By contrast, my approach is to read these glossaries as texts that can be read and interpreted as one might read and interpret the novels they adjoin, and also with close attention to the architecture of their relationship to the novels they accompany. This close reading methodology enables attention to the differences amongst glossaries, as much as to the differences between them and the texts they gloss. One consequence of this is that, as I have shown above, a text might be conservative so far as its novel segment is concerned, yet radical so far as its glossary is concerned (Mullumbimby), or vice versa (The Bone People).To recap, “tidalectics” provides a way of engaging with the post-colonial/“abroad” (linguistic) complexities of island nations and literatures. It denotes “a dynamic and shifting relationship between land and sea that allows island literatures to be engaged in their spatial and historical complexity” (DeLoughrey 2-3). The methodological challenge for my article is to show how “tidalectics” is useful to a consideration of that sub-genre of post-colonial novels containing glossaries. Elizabeth M. DeLoughrey’s unpacking of “tidalectics” considers not just islands but also the colonial relationships of (archetypally mainland European) colonial forces to islands. Referring to the popularity of “desert-island stories” (12), DeLoughrey notes how “Since the colonial expansion of Europe, its literature has increasingly inscribed the island as a reflection of various political, sociological, and colonial practices” (13). Further, “European inscriptions of island topoi have often upheld imperial logic and must be recognized as ideological tools that helped make colonial expansion possible” (13). DeLoughrey also underscores the characteristics of such “desert-island stories” (12), including how accidental colonization of “a desert isle has been a powerful and repeated trope of empire building and of British literature of the eighteenth and nineteenth centuries” (13). Shipwrecks are the most common narrative device of such “accidents”.Drawing on the broad continuum of the several significations of “abroad”, one can draw a parallel between the novel-glossary relationship and the mainland-island relationship DeLoughrey outlines. I recall here Stephen Slemon’s suggestion that “the real social relations of post-colonial cultures appear, through the mediation of the text’s language of narration, in the thematic dimension of the post-colonial magic realist work” (12). Adapting Slemon’s approach, one might read the formal (as opposed to thematic) dimension of the glossary in a post-colonial narrative like The Bone People or Mullumbimby as another literary appearance of “the real social relations of post-colonial cultures” (Slemon 12). What’s appearing is the figure of the island in the form of the glossary: hence, my neologism “glossary islands”. These novels are thus not only examples of island novels to be read via “tidalectics”, but of novels with their own islands appended to them, as glossaries, in the “abroad” of their textuality.Thus, rather than seeing a glossary in a binary either/or way as a sign of the (artificial) supremacy of either English or the Indigenous language, one could use the notion of “glossary islands” to more fully engage with the complexities of post-colonialism as expressed in literature. Seen in this light, a glossary (as to The Bone People or Mullumbimby) can be read as an “abroad” through which the novel circulates its own ideas or inventions of post-colonial community. In this view, islands and glossaries are linked through being intensified sites of knowledge, as described by DeLoughrey. Crucially, the entire, complex, novel-glossary relationship needs to be analysed, and it is possible (though space considerations mediate against pursuing this here) that a post-colonial novel’s glossary expresses the (Freudian) unconscious knowledge of the novel itself.Clearly then, there is a deep irony in how what Simon During calls the “Europeanising apparatus” of the glossary itself becomes, in Mullumbimby, an object of colonisation (During 374). (Recall how one comes across the glossary at the end of Lucashenko’s novel unexpectedly—accidentally—as a European might be cast up upon a desert island.) I hazard the suggestion that a post-colonial novel is more radical in its post-colonial politics the more “island-like” its glossary is, because this implies that the “glossary island” is being used to better work out the nature of post-colonial community as expressed and proposed in the novel itself. Here then, again, the seemingly more radical novel linguistically, The Bone People, seems in fact to be less radical than Mullumbimby, given the latter’s more “island-like” glossary. Certainly their prospects for post-colonial community are being worked out on different levels.Working with the various significations of “abroad” that span the macro level of historical circumstances and the micro levels of post-colonial literature, this article has introduced a new methodological approach to engaging with Indigenous language glossaries at the end of post-colonial texts written largely in English. This methodology responds to the need to go beyond the binary either/or approach that has characterised the debate in this patch of post-colonial studies so far. A binary view of language relations, I suggest, is debilitating to prospects for post-colonial community in post-colonial, multi-cultural and island nations like Australia and New Zealand, where language flows are multifarious and complex. My proposed methodology, as highlighted in the neologism “glossary islands”, seems to show promise for the (re-)interpretation of Mullumbimby and The Bone People as texts that deal, albeit in different ways, with similar issues of language relations and of community. An “abroad” methodology provides a powerful infrastructure for engagement with domains such as post-colonialism that, as Stephen Slemon indicates, involve the intensive intermingling of the largest geo-historical circumstances with the detail, even minutiae, of the textual expression of those circumstances, as in literature.ReferencesDeLoughrey, Elizabeth M. Routes and Roots: Navigating Caribbean and Pacific Island Literatures. Honolulu: U of Hawai’i P, 2007.Dever, Maryanne. “Violence as Lingua Franca: Keri Hulme’s The Bone People.” World Literature Written in English 29.2 (1989): 23-35.During, Simon. “Postmodernism or Postcolonialism?” Landfall 39.3 (1985): 366-80.———. “Postmodernism or Post-Colonialism Today.” Postmodernism: A Reader. Ed. Thomas Docherty. New York: Harvester Wheatsheaf, 1993. 448-62.Hulme, Keri. The Bone People. London: Pan-Picador, 1986.Lucashenko, Melissa. Mullumbimby. St Lucia, Queensland: U of Queensland P, 2013.Moi, Toril. Sexual/Textual Politics: Feminist Literary Theory. London: Routledge, 1985.Slemon, Stephen. “Magic Realism as Post-Colonial Discourse.” Canadian Literature 116 (Spring 1988): 9-24.The New Shorter Oxford English Dictionary. Ed. Lesley Brown. Oxford: Clarendon P, 1993.Vincent, Eve. “Country Matters.” Sydney Review of Books. Sydney: The Writing and Society Research Centre at the University of Western Sydney, 2013. 8 Aug. 2016 <http://sydneyreviewofbooks.com/country-matters/>.