Log in

Relevant bibliographies by topics / Bujumbura (Burundi) Bujumbura (Burundi) / Journal articles

To see the other types of publications on this topic, follow the link: Bujumbura (Burundi) Bujumbura (Burundi).

Journal articles on the topic 'Bujumbura (Burundi) Bujumbura (Burundi)'

Author: Grafiati

Published: 4 June 2021

Last updated: 1 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Bujumbura (Burundi) Bujumbura (Burundi).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Viateur, HABARUGIRA, NKURUNZIZA Jean De Dieu, and CONGERA Anaclet. "Party Halls in African Town: Case of Economic Capital of Burundi, Bujumbura." International Journal for Innovation Education and Research 8, no. 5 (May 1, 2020): 21–28. http://dx.doi.org/10.31686/ijier.vol8.iss5.2262.

Full text

Abstract:

This paper proposes a classification of some halls very modern in Bujumbura economic capital of Burundi. A survey whose target population is the set of individuals regularly participating in the various festivals in Bujumbura, the economic capital of Burundi was put into action. An analysis of the data and interpretation of the results is made. These results conclude that there is a visible lack of well-developed halls on international measures in Bujumbura.

APA, Harvard, Vancouver, ISO, and other styles

2

Ndayisaba, Augustin. "Rwanda - Burundi: Political Dialogue as a Method of Achieving Agreement." RUDN Journal of Political Science 22, no. 1 (December 15, 2020): 105–15. http://dx.doi.org/10.22363/2313-1438-2020-22-1-105-115.

Full text

Abstract:

The article analyzes the problem associated with the deterioration of relations between Rwanda and Burundi, which, according to various resources, are due to Rwanda’s interference in the internal affairs of Burundi. Special attention is paid to the role of political dialogue in the search for agreement between the two states. Thus, relations deteriorated further after the Bujumbura regime accused Rwanda of involvement in destabilizing the Bujumbura regime as a result of an attempt to support and arm Burundian refugees fleeing Burundi after the failed coup on May 13, 2015, committed against Burundi’s President Pierre Nkurunziza. Rwanda also accuses Burundi of supporting the Democratic Forces for the Liberation of Rwanda (FDLR). This diplomatic crisis requires a regional effort to bring both countries to the negotiating table. In this way, the role of interregional organizations, especially the East African Community (EAC), is more significant in order to encourage both countries to engage in dialogue, taking into account that current diplomacy requires multilateralism to discuss and solve the problem. Political dialogue will help relieve tensions and remedy the situation. However, historical, cultural and linguistic rapprochement, are the basic prerequisites that allow both countries to come to their senses and coexist peacefully. The current situation between Burundi and Rwanda is a time bomb, which poses a threat to the security, political and socio-economic stability of the entire Great Lacs region of Africa. For this, regional communities must ensure that Member States respect the principle of good neighborliness and peaceful coexistence, all in the interest of preventing the risk of any conflict and ensuring geopolitical stability.

APA, Harvard, Vancouver, ISO, and other styles

3

Stewart, Kearsley. "A Further Note on Research in Burundi." History in Africa 16 (1989): 401–2. http://dx.doi.org/10.2307/3171797.

Full text

Abstract:

This short note updates Nancy Hunt's recent report on research in Burundi. While Hunt presented a thorough description of the situation in Burundi as of 1984, my recent month-long visit in August of 1988 shows that a few of the names, as well as some aspects of the protocol, have changed.Although Hunt adequately presented the informal process of obtaining research clearance to work in Bujumbura (attestations from the Centre de Civilisation Burundaise or CCB, mayor's office, university, etc.), the process for any area outside the city limits is more complicated, decidedly more formal, and not always guaranteed of success. Requests for research clearance in all communes except Bujumbura should be directed to Mr. le Ministre Aloys Kadoyi, Ministère de l'Intérieur, B.P. 1910, Bujumbura. The initial request should contain an introductory cover letter, a support letter from your university, and a copy of the research proposal, all in French if possible. Attestations from other sources strengthen a researcher's status in the field outside Bujumbura, but they do not replace the necessary official permission granted from the Ministry of the Interior.

APA, Harvard, Vancouver, ISO, and other styles

4

Ntiranyibagira, Constantin. "La dynamique diglossique à Bujumbura: analyse de quelques représentations." Revista Odisseia 4, no. 1 (May 28, 2019): 90–106. http://dx.doi.org/10.21680/1983-2435.2019v4n1id17232.

Full text

Abstract:

L’appréhension de la dynamique diglossique à Bujumbura à travers les représentations linguistiques s’est basée sur une analyse qualitative des données, recueillies grâce à une enquête de terrain qui a concerné 400 locuteurs répartis dans les trois communes de cette ville (Ntahangwa, Mukaza, Muha). Il a été constaté que malgré l’image de «moins utiles» qu’inspirent encore le kirundi et le kiswahili, ces langues commencent timidement à bousculer le français dans certains secteurs socioprofessionnels naturellement réservés aux variétés hautes. Depuis l’adoption en 2006 par le Burundi d’une politique de promotion du kirundi, du kiswahili et de l’anglais, la prépondérance du français est relativement mise à mal au profit de ces trois langues. Cependant, l'anglais, tout en étant érigé en langue officielle, est encore plus une langue que beaucoup de Burundais aimeraient apprendre qu’effectivement perceptible sur le marché linguistique.

APA, Harvard, Vancouver, ISO, and other styles

5

Chrétien, Jean-Pierre. "Burundi: Social Sciences Facing Ethnic Violence." Issue: A Journal of Opinion 19, no. 1 (1990): 38–40. http://dx.doi.org/10.1017/s004716070050122x.

Full text

Abstract:

The text of an analysis on Burundi presented by Mr. René Lemarchand on September 22, 1988 before the Africa Subcommittee of the United States House of Representatives was published in the 1989 winter number of ISSUE. As noted, more precise research has been published since this date on the Ntega and Marangara events by people who actually went to “revisit” the country, which is not the case of Mr. Lemarchand, since his last visit to Bujumbura was in autumn 1973.

APA, Harvard, Vancouver, ISO, and other styles

6

Kabuye and Christine Deslaurier. "« Dans la pierre » : retour d’expériences à Mpimba (Bujumbura, Burundi)." Politique africaine 155, no. 3 (2019): 165. http://dx.doi.org/10.3917/polaf.155.0165.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Swinne, D., M. Deppner, S. Maniratunga, R. Laroche, J. J. Floch, and P. Kadende. "AIDS-associated cryptococcosis in Bujumbura, Burundi: an epidemiological study." Medical Mycology 29, no. 1 (January 1991): 25–30. http://dx.doi.org/10.1080/02681219180000051.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Hunt, Nancy. "Research Protocol and Resources in Burundi." History in Africa 14 (1987): 399–411. http://dx.doi.org/10.2307/3171853.

Full text

Abstract:

Information on the existence and resources of African libraries and archives is scanty at best, and the scene changes quickly. No one has attempted to assemble a list for researchers of such institutions and resources in Burundi since 1974, when Daniel Nyambariza provided a list of documentation and research centers and other adresses intéressantes as a preface to his bibliography. No doubt once a very useful list, much of Nyambariza's information is now obsolete. The present report, based on my experiences conducting urban, social history research in Bujumbura in 1984/85, is intended to provide specific information on gaining access to and the availability of documentary sources in Burundi. Private and public libraries and archival locations are included.I have tried to describe Burundi's archival situation from my own experiences as well as from printed information, not all of which I was able to verify. Although there probably exists some small area of duplication between the colonial records held in Brussels at the Archives Africaines and those to be found in Burundi, most of Burundi's archives--particularly low-level, local governmental records--can be assumed to be unique. Although most printed sources are usually more readily available in European or American libraries, I have assumed that a descriptive list of libraries would be an aid to other researchers and have tried to indicate rare and/or locally–generated publications and documents. At the close I have also assembled a list of other potential research locations which I did not visit personally owing to time constraints and the scope of my research.

APA, Harvard, Vancouver, ISO, and other styles

9

Kamanfu, Gaspard, Najoua Mlika-Cabanne, Pierre-Marie Girard, Stanislas Nimubona, Barnabas Mpfizi, Amédée Cishako, Patricia Roux, et al. "Pulmonary Complications of Human Immunodeficiency Virus Infection in Bujumbura, Burundi." American Review of Respiratory Disease 147, no. 3 (March 1993): 658–63. http://dx.doi.org/10.1164/ajrccm/147.3.658.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

LAELY, THOMAS. "Peasants, Local Communities, and Central Power in Burundi." Journal of Modern African Studies 35, no. 4 (December 1997): 695–716. http://dx.doi.org/10.1017/s0022278x97002590.

Full text

Abstract:

Today Burundi resembles a torn-apart patchwork of Batutsi and Bahutu colonies by being divided territorially into almost isolated enclaves, ethnically purified to a high degree, and more or less closed off from their surrounding areas. Most Batutsi believe that they can only live in security if sheltered by the army in various urban agglomerations, including the capital, Bujumbura. By way of contrast, most Bahutu are to be found in the hills of the countryside in an often entrenched and hidden way, and close to economic self-sufficiency. Such an unusual situation is undoubtedly a big challenge to the relations that need to be established between state authorities and citizens in rural as well as urban areas.

APA, Harvard, Vancouver, ISO, and other styles

11

Niyongabo, Edouard, Yong-Chul Jang, Daeseok Kang, and Kijune Sung. "Current treatment and disposal practices for medical wastes in Bujumbura, Burundi." Environmental Engineering Research 24, no. 2 (July 30, 2018): 211–19. http://dx.doi.org/10.4491/eer.2018.095.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Standaert, B., P. Kocheleff, P. Kadende, N. Nitunga, T. Guerna, R. Laroche, and P. Piot. "Acquired immunodeficiency syndrome and human immunodeficiency virus infection in Bujumbura, Burundi." Transactions of the Royal Society of Tropical Medicine and Hygiene 82, no. 6 (November 1988): 902–4. http://dx.doi.org/10.1016/0035-9203(88)90035-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Bangirinama, Frédéric Bangirinama, Bonaventure Nzitwanayo, and Paul Hakizimana. "UTILISATION DU CHARBON DE BOIS COMME PRINCIPALE SOURCE D’ÉNERGIE DE LA POPULATION URBAINE : UN SÉRIEUX PROBLÈME POUR LA CONSERVATION DU COUVERT FORESTIER AU BURUNDI." BOIS & FORETS DES TROPIQUES 328, no. 328 (July 20, 2017): 45. http://dx.doi.org/10.19182/bft2016.328.a31301.

Full text

Abstract:

La question de l’énergie domestique reste une préoccupation majeure dans le monde, en particulier dans les pays en développement où la majorité de la popu- lation utilise le bois de chauffage, le char- bon de bois et les résidus agricoles pour satisfaire leurs besoins énergétiques liés à la cuisson des aliments. Au Burundi, où le bois constitue la principale source d’éner- gie domestique avec 96,6 % du bilan énergétique global, le charbon de bois est consommé à 77 % par la population urbaine. Selon une enquête menée sur les grands axes routiers, 56 548 tonnes et 13 552 tonnes de charbon de bois sont respectivement consommées par la population urbaine de Bujumbura et Gitega, soit un total de 70 100 tonnes. La consommation annuelle estimée s’élève à 104 718 tonnes de charbon de bois pour la seule population urbaine. Cette consommation par la population de Gitega et Bujumbura entraîne une perte annuelle de 3 505 à 4 673 ha de couvertforestier, soit annuellement entre 5 236 et 6 980 ha si l’on extrapole ces chiffres à l’ensemble de la population urbaine du Burundi. À ce rythme, le couvert forestier du Burundi, estimé à 171 625 ha, pourrait disparaître dans 25 à 33 ans. Pour garan- tir la durabilité du système d’approvi- sionnement énergétique de la population urbaine burundaise, de nouvelles tech- niques et pratiques doivent être adoptées, comme la plantation d’arbres le long des axes routiers, la régénération naturelle assistée, la recherche d’espèces et varié- tés mieux adaptées et plus rentables, le recours aux énergies renouvelables, la valorisation énergétique des déchets et l’amélioration de l’efficience énergétique (foyers améliorés, par exemple).

APA, Harvard, Vancouver, ISO, and other styles

14

La Revista. "Tres delegados del CICR asesinados en Burundi." Revista Internacional de la Cruz Roja 21, no. 135 (June 1996): 349–51. http://dx.doi.org/10.1017/s0250569x0002104x.

Full text

Abstract:

El 4 de junio de 1996, cuando regresaban a Bujumbura (Burundi), dos vehículos del Comité Intemacional de la Cruz Roja fueron bianco de disparos cerca de la aldea de Mugina, en el norte de la provincia de Cibitoke. Durante el ataque resultaron muertos tres delegados del CICR: Cédric Martin, Reto Neuenschwander y Juan Pastor Ruffino.En esta región particularmente afectada por el conflicto, el CICR ha prestado asistencia a miles de personas civiles, suministrándoles agua, medicamentos y artículos de primera necesidad. Como consecuencia de la dramática desaparición de sus delegados, el CICR redujo, en una primera fase, sus actividades en el terreno, con la esperanza de que más tarde podría continuar su labor humanitaria en favor de la población civil burundesa. Pero, el 11 de junio, tras recibir amenazas explícitas contra la vida de sus delegados, el CICR decidió retirar de Burundi a todo su personal expatriado.

APA, Harvard, Vancouver, ISO, and other styles

15

Kheria, Mfuranzima, Daeseok Kang, and Kijune Sung. "Rainwater Harvesting Potential in a New Residential Area in North Bujumbura, Burundi." Journal of Environmental Science International 25, no. 3 (March 31, 2016): 447–56. http://dx.doi.org/10.5322/jesi.2016.25.3.447.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Kubwarugira, Gamaliel, Mohamed Mayoussi, and Yahia El Khalki. "Assessing flood exposure in informal districts: a case study of Bujumbura, Burundi." Journal of Applied Water Engineering and Research 7, no. 3 (May 6, 2019): 207–15. http://dx.doi.org/10.1080/23249676.2019.1611494.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Nibigira, Léonidas, Hans-Balder Havenith, Pierre Archambeau, and Benjamin Dewals. "Formation, breaching and flood consequences of a landslide dam near Bujumbura, Burundi." Natural Hazards and Earth System Sciences 18, no. 7 (July 6, 2018): 1867–90. http://dx.doi.org/10.5194/nhess-18-1867-2018.

Full text

Abstract:

Abstract. This paper investigates the possible formation of a landslide dam on the Kanyosha River near Bujumbura, the capital of Burundi, as well as the interplay between the breaching of this landslide dam and the flooding along the river. We present an end-to-end analysis, ranging from the origin of the landslide up to the computation of flood waves induced by the dam breaching. The study includes three main steps. First, the mass movement site was investigated with various geophysical methods that allowed us to build a general 3-D model and detailed 2-D sections of the landslide. Second, this model was used for dynamic landslide process modelling with the Universal Distinct Element Code. The results showed that a 15 m high landslide dam may form on the river. Finally, a 2-D hydraulic model was set up to find out the consequences of the breaching of the landslide dam on flooding along the river, especially in an urban area located downstream. Based on 2-D maps of maximum water depth, flow velocity and wave propagation time, the results highlight that neglecting the influence of such landslide dams leads to substantial underestimation of flood intensity in the downstream area.

APA, Harvard, Vancouver, ISO, and other styles

18

Niyongabo, T., D. Henzel, JM Ndayishimyie, JC Melchior, A. Ndayiragije, JB Ndihokubwayo, E. Nikoyagize, T. Rwasa, P. Aubry, and B. Larouze. "Nutritional status of adult inpatients in Bujumbura, Burundi (impact of HIV infection)." European Journal of Clinical Nutrition 53, no. 7 (July 1999): 579–82. http://dx.doi.org/10.1038/sj.ejcn.1600789.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Kubwimana, Désiré, Lahsen Ait Brahim, Pascal Nkurunziza, Antoine Dille, Arthur Depicker, Louis Nahimana, Abdellah Abdelouafi, and Olivier Dewitte. "Characteristics and Distribution of Landslides in the Populated Hillslopes of Bujumbura, Burundi." Geosciences 11, no. 6 (June 17, 2021): 259. http://dx.doi.org/10.3390/geosciences11060259.

Full text

Abstract:

Accurate and detailed multitemporal inventories of landslides and their process characterization are crucial for the evaluation of landslide hazards and the implementation of disaster risk reduction strategies in densely-populated mountainous regions. Such investigations are, however, rare in many regions of the tropical African highlands, where landslide research is often in its infancy and not adapted to the local needs. Here, we have produced a comprehensive multitemporal investigation of the landslide processes in the hillslopes of Bujumbura, situated in the landslide-prone East African Rift. We inventoried more than 1200 landslides by combining careful field investigation and visual analysis of satellite images, very-high-resolution topographic data, and historical aerial photographs. More than 20% of the hillslopes of the city are affected by landslides. Recent landslides (post-1950s) are mostly shallow, triggered by rainfall, and located on the steepest slopes. The presence of roads and river quarrying can also control their occurrence. Deep-seated landslides typically concentrate in landscapes that have been rejuvenated through knickpoint retreat. The difference in size distributions between old and recent deep-seated landslides suggests the long-term influence of potentially changing slope-failure drivers. Of the deep-seated landslides, 66% are currently active, those being mostly earthflows connected to the river system. Gully systems causing landslides are commonly associated with the urbanization of the hillslopes. Our results provide a much more accurate record of landslide processes and their impacts in the region than was previously available. These insights will be useful for land management and disaster risk reduction strategies.

APA, Harvard, Vancouver, ISO, and other styles

20

Bizimana, Aaron, Bing Wu, and Aicha Abdallah Idriss. "Analysis of Adapted Sewage Sludge Treatment and Disposal Routes in Bujumbura, Burundi." OALib 08, no. 04 (2021): 1–23. http://dx.doi.org/10.4236/oalib.1107319.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Lhuilier, Dominique, Jean Ndoricimpa, Venant Hatungimana, Dominique Rolland, Théodore Niyongabo, and Bernard Larouze. "Prévention des infections en milieu hospitalier : recherche-action au CHU de Bujumbura (Burundi)." Revue internationale de psychosociologie VII, no. 16 (2001): 121. http://dx.doi.org/10.3917/rips.016.0121.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Swinne, D., E. Meeusen, M. Deppner, and J. J. Floch. "Recherche d'antigènes cryptococciques chez des patients HIV positifs/SIDA asymptomatiques à Bujumbura, Burundi." Médecine et Maladies Infectieuses 21, no. 11 (November 1991): 712–13. http://dx.doi.org/10.1016/s0399-077x(05)80239-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Sokal, David C., Thaddee Buzingo, Nestor Nitunga, Pascal Kadende, and Baudouin Standaert. "Geographic and temporal stability of HIV seroprevalence among pregnant women in Bujumbura, Burundi." AIDS 7, no. 11 (November 1993): 1481–84. http://dx.doi.org/10.1097/00002030-199311000-00012.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Niyongabire, E., and H. Rhinane. "GEOSPATIAL TECHNIQUES USE FOR ASSESSMENT OF VULNERABILITY TO URBAN FLOODING IN BUJUMBURA CITY, BURUNDI." ISPRS - International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences XLII-4/W12 (February 26, 2019): 147–54. http://dx.doi.org/10.5194/isprs-archives-xlii-4-w12-147-2019.

Full text

Abstract:

<p><strong>Abstract.</strong> The rate of urbanization growth in tropical areas, particularly in African cities, coupled with a gap in the knowledge of vulnerability and coping capacities increases the flood-related risk in diverse communities. This study aims to evaluate the factors of vulnerability to flooding and to develop a vulnerability index in Bujumbura city, Burundi. To this end, both physical and socio-economic parameters accountable for flood vulnerability have been integrated with a geospatial analysis process based on the Analytic Hierarchy Process (AHP) and Weighted Linear Combination (WLC) methods. The resulting vulnerability index shows that low-income households and their local infrastructures are the most vulnerable to flooding. Another finding reveals that higher vulnerability is due to settlements located in flood-prone areas with unplanned land use and ill-structured development planning.</p>

APA, Harvard, Vancouver, ISO, and other styles

25

Ndamanisha, Jean Chrysostome, Pierre Claver Habonimana, and Gordien Ntahimpera. "Étude de la dégradation de deux boissons industrielles consommées en mairie de Bujumbura, Burundi." Journal of Applied Biosciences 113, no. 1 (August 7, 2017): 11201. http://dx.doi.org/10.4314/jab.v113i1.9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Yu, Cheng, Shuang S. Chen, Lu Zhang, Qun Gao, Zhaode Wang, and Qiushi Shen. "Changes in water quality of the rivers discharging into Lake Tanganyika in Bujumbura, Burundi." Aquatic Ecosystem Health & Management 21, no. 2 (April 3, 2018): 201–12. http://dx.doi.org/10.1080/14634988.2017.1394772.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Swinne, Danielle, Michael Deppner, Roland Laroche, Jean-Jacques Floch, and Pierre Kadende. "Isolation of Cryptococcus neoformans from houses of AIDS-associated cryptococcosis patients in Bujumbura (Burundi)." Aids 3, no. 6 (June 1989): 389–90. http://dx.doi.org/10.1097/00002030-198906000-00009.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Van Acker, Tomas. "Exploring the Legacies of Armed Rebellion in Burundi'sMaquis par Excellence." Africa Spectrum 51, no. 2 (August 2016): 15–37. http://dx.doi.org/10.1177/000203971605100202.

Full text

Abstract:

This contribution explores the legacies of armed rebellion in post-war Burundi, where two of the main political parties, the ruling CNDD-FDD and the FNL, are former rebel movements. It aims to add a micro-political perspective to the discussion on the transformation of rebel groups into political parties, and bring some nuance to the normative underpinnings of this debate. Based on observations of the role of local leaders with an FNL past, and of retrospective popular appreciation for wartime governance by the FNL in its stronghold of Bujumbura Rural, the paper argues that beyond the symptoms of a violent political culture, this legacy should also be understood as a complex source of post-war power and legitimacy.

APA, Harvard, Vancouver, ISO, and other styles

29

Eijdenberg, Emiel L., Leonard J. Paas, and Enno Masurel. "Decision-making and small business growth in Burundi." Journal of Entrepreneurship in Emerging Economies 9, no. 1 (March 6, 2017): 35–64. http://dx.doi.org/10.1108/jeee-12-2015-0065.

Full text

Abstract:

Purpose This paper aims to investigate the effect of decision-making, in terms of the effectuation and causation orientation of small business owners, on the growth of their small businesses in an uncertain environment: Burundi. Design/methodology/approach On the basis of primary data from a pre-study of 29 expert interviews, a questionnaire was developed and was filled in by 154 small business owners in Burundi’s capital, Bujumbura. Subsequently, correlation analyses, a factor analysis and regression analyses were performed to test the hypotheses. Findings While, on the one hand, the findings show that small business owners who perceive the environment as uncertain are more effectuation-oriented than causation-oriented; on the other hand, the findings show that effectuation and causation orientations do not influence later small business growth. Therefore, other determinants for small business growth in an uncertain environment should be further explored. Originality/value This paper fills the research gap of decision-making in relation to small business growth from the entrepreneurs who are among the billion people who live in absolute poverty. On the basis of Western studies, effectuation might be more present in contexts of dealing with many uncertainties of future phenomena, and that it is often positively correlated with firm growth. In contrast, this paper shows that neither an effectuation orientation nor a causation orientation significantly affects small business growth in a context that can be assumed as highly uncertain.

APA, Harvard, Vancouver, ISO, and other styles

30

Newbury, David. "Burundi Without Peasants - Questions sur la Paysannerie au Burundi. Bujumbura: Université du Burundi and Paris: Centre de Recherches Africaines (Paris I), 1987. Pp. 452. No price given." Journal of African History 31, no. 3 (November 1990): 509–10. http://dx.doi.org/10.1017/s0021853700031327.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Koch, Nathalie, Jean-Bosco Ndihokubwayo, Nouara Yahi, Christian Tourres, Jacques Fantini, and Catherine Tamalet. "Genetic Analysis of HIV Type 1 Strains in Bujumbura (Burundi): Predominance of Subtype C Variant." AIDS Research and Human Retroviruses 17, no. 3 (February 10, 2001): 269–73. http://dx.doi.org/10.1089/088922201750063205.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Désiré, Kubwimana, Ait Brahim Lahsen, Bousta Mahfoud, Dewitte Olivier, Abdelouafi Abdellah, and Bahaj Tarik. "Landslides susceptibility assessment using AHP method in Kanyosha watershed (Bujumbura-Burundi): Urbanisation and management impacts." MATEC Web of Conferences 149 (2018): 02071. http://dx.doi.org/10.1051/matecconf/201714902071.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Désiré, Kubwimana, Ait Brahim Lahsen, Bousta Mahfoud, Dewitte Olivier, Abdelouafi Abdellah, and Bahaj Tarik. "Landslides susceptibility assessment using AHP method in Kanyosha watershed (Bujumbura-Burundi): Urbanisation and management impacts." MATEC Web of Conferences 149 (2018): 02071. http://dx.doi.org/10.1051/matecconf/201814902071.

Full text

Abstract:

The Kanyosha watershed is unstable due to the presence of several landslides, which occupy about 3% of the study area. They are causing major damage which costs expensive to the Government of Burundi as well as to the population residing there and their properties. Roads, schools, irrigation canals, houses, crop fields, etc., are in danger of collapse. These landslides are mostly naturally occurring but can sometimes be reactivated by heavy rains or human activities during the excavation of building materials from the river bed.In order to carry out this study, we used the multivariate statistical classification with weighting of the responsible parameters of landslides risk to reach the susceptibility map of mass movements in the Kanyosha watershed. Remote sensing, geology, morphometry and bibliography were the data sources for the different parameters. Google Earth images, ortho-photos and field prospecting helped us to identify the landslides needed to validate the susceptibility map.During the fieldwork, we observed 34 landslides of different types, which were superimposed on the mass movements susceptibility map obtained using the Analytic Hierarchy Process (AHP) and compared to previous studies in which the matrix indexing method was used. We found approximately similar results with the consideration of different scales of work. These reasons confirm the validity of the susceptibility map at the level of the Kanyosha watershed, a map which is an essential document for urban planning and land management.

APA, Harvard, Vancouver, ISO, and other styles

34

Kubwimana, Desire, Lahsen Ait Brahim, and Abdellah Abdelouafi. "A new approach in the development and analysis of the landslide susceptibility map of the hillslopes of Bujumbura, Burundi." EUREKA: Physics and Engineering, no. 3 (May 27, 2021): 26–34. http://dx.doi.org/10.21303/2461-4262.2021.001724.

Full text

Abstract:

As in other hilly and mountainous regions of the world, the hillslopes of Bujumbura are prone to landslides. In this area, landslides impact human lives and infrastructures. Despite the high landslide-induced damages, slope instabilities are less investigated. The aim of this research is to assess the landslide susceptibility using a probabilistic/statistical data modeling approach for predicting the initiation of future landslides. A spatial landslide inventory with their physical characteristics through interpretation of high-resolution optic imageries/aerial photos and intensive fieldwork are carried out. Base on in-depth field knowledge and green literature, let’s select potential landslide conditioning factors. A landslide inventory map with 568 landslides is produced. Out of the total of 568 landslide sites, 50 % of the data taken before the 2000s is used for training and the remaining 50 % (post-2000 events) were used for validation purposes. A landslide susceptibility map with an efficiency of 76 % to predict future slope failures is generated. The main landslides controlling factors in ascendant order are the density of drainage networks, the land use/cover, the lithology, the fault density, the slope angle, the curvature, the elevation, and the slope aspect. The causes of landslides support former regional studies which state that in the region, landslides are related to the geology with the high rapid weathering process in tropical environments, topography, and geodynamics. The susceptibility map will be a powerful decision-making tool for drawing up appropriate development plans in the hillslopes of Bujumbura with high demographic exposure. Such an approach will make it possible to mitigate the socio-economic impacts due to these land instabilities

APA, Harvard, Vancouver, ISO, and other styles

35

Ntiranyibagira, Constantin, and Alice Rwamo. "L'insécurité linguistique chez les locuteurs du kirundi." Revista Odisseia 4, no. 2 (July 24, 2019): 1–15. http://dx.doi.org/10.21680/1983-2435.2019v4n2id17851.

Full text

Abstract:

Dans cet article, nous analysons, à l’aide de la méthode qualitative et sur base des alternances intranominales et intraverbales, les effets linguistiques et sociolinguistiques de l’insécurité linguistique (en français, en kiswahili, et en anglais) chez les locuteurs du kirundi (langue Bantu synthétique à tons et à quantité vocalique appartenant au Groupe D. 62 de la Zone centrale). Les données ont été recueillies dans les trois communes que compte la ville de Bujumbura, capitale du Burundi (Ntahangwa, Mukaza, Muha). Il s’agit d’un corpus constitué de dix (10) sortes de conversations, enregistrées discrètement auprès des kirundiphones issus des milieux socioprofessionnels différents et variés. Il a été remarqué que la sauvegarde ou la modification partielle des éléments empruntés donnent lieu à une adaptation limitée, une hypoadaptation, et une hyperadaptation. En plus, l’usage des hybrides langagiers en question est forcé ou prestigieux, parfois abusif et/ou erroné.

APA, Harvard, Vancouver, ISO, and other styles

36

Nyandwi, Joseph, Sébastien Manirakiza, Eugène Ndirahisha, Jean Baptiste Ngomirakiza, Désiré Nisubire, Emmanuel Nduwayo, and Hélène Bukuru. "Frequency of Uropathogens and Antimicrobial Susceptibility in Childhood Urinary Tract Infection at Kamenge University Hospital, Bujumbura, Burundi." East African Health Research Journal 1, no. 1 (March 2017): 47–52. http://dx.doi.org/10.24248/eahrj-d-16-00331.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Nyandwi, Joseph, Sébastien Manirakiza, Eugène Ndirahisha, Jean Baptiste Ngomirakiza, Désiré Nisubire, Emmanuel Nduwayo, and Hélène Bukuru. "Frequency of Uropathogens and Antimicrobial Susceptibility in Childhood Urinary Tract Infection at Kamenge University Hospital, Bujumbura, Burundi." East African Health Research Journal 1, no. 1 (March 1, 2017): 47–52. http://dx.doi.org/10.24248/eahrj.v1i1.387.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Sibomana, Claver, and Joselyne Nduwayezu. "Pollution and Foraging Behavior of Pied Kingfisher Ceryle rudis in Bujumbura Bay of Lake Tanganyika, Burundi: Conservation Implications." International Journal of Environment, Agriculture and Biotechnology 3, no. 2 (2018): 332–37. http://dx.doi.org/10.22161/ijeab/3.2.3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Ntagirabiri, Rénovat, Richard Karayuba, Gabriel Ndayisaba, Aline Nduwimana, and Jean Claude Niyondiko. "Esophageal Cancer: Epidemiological, Clinical and Histopathological Aspects over a 24-Years Period at Kamenge University Hospital, Bujumbura, Burundi." Open Journal of Gastroenterology 06, no. 04 (2016): 106–10. http://dx.doi.org/10.4236/ojgas.2016.64014.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Van der Knaap, Martin, and Mohiuddin Munawar. "GLOW VII Symposium in Bujumbura, Burundi Protecting Great Lakes of the World: Managing Exploitation with Ecosystem-Based Science." Aquatic Ecosystem Health & Management 17, no. 1 (January 2, 2014): 103–5. http://dx.doi.org/10.1080/14634988.2014.881239.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

DeBeaudrap, Pierre, Gervais Beninguisse, Charles Mouté, Carolle Dongmo Temgoua, Pierre Claver Kayiro, Vénérand Nizigiyimana, Estelle Pasquier, et al. "The multidimensional vulnerability of people with disability to HIV infection: Results from the handiSSR study in Bujumbura, Burundi." EClinicalMedicine 25 (August 2020): 100477. http://dx.doi.org/10.1016/j.eclinm.2020.100477.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Ndikumana, I., A. Pinel-Galzi, Z. Negussie, S. N'chimbi Msolla, P. Njau, R. K. Singh, I. R. Choi, J. Bigirimana, D. Fargette, and E. Hébrard. "First Report of Rice yellow mottle virus on Rice in Burundi." Plant Disease 96, no. 8 (August 2012): 1230. http://dx.doi.org/10.1094/pdis-03-12-0293-pdn.

Full text

Abstract:

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

APA, Harvard, Vancouver, ISO, and other styles

43

Mlika-Cabanne, N., M. Brauner, G. Kamanfu, P. Grenier, E. Nikoyagize, P. Aubry, B. Larouzé, and J. F. Murray. "Radiographic abnormalities in tuberculosis and risk of coexisting human immunodeficiency virus infection. Methods and preliminary results from Bujumbura, Burundi." American Journal of Respiratory and Critical Care Medicine 152, no. 2 (August 1995): 794–99. http://dx.doi.org/10.1164/ajrccm.152.2.7633744.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

Engels, D., J. Ndoricimpa, S. Nahimana, and B. Gryseels. "Control of Schistosoma mansoni and intestinal helminths: 8-year follow-up of an urban school programme in Bujumbura, Burundi." Acta Tropica 58, no. 2 (November 1994): 127–40. http://dx.doi.org/10.1016/0001-706x(94)90052-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Bigirimana, Joseph, Jan Bogaert, Charles De Cannière, Marie-José Bigendako, and Ingrid Parmentier. "Domestic garden plant diversity in Bujumbura, Burundi: Role of the socio-economical status of the neighborhood and alien species invasion risk." Landscape and Urban Planning 107, no. 2 (August 2012): 118–26. http://dx.doi.org/10.1016/j.landurbplan.2012.05.008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Nyandwi, Joseph, Sylvestre Bazikamwe, Désiré Nisubire, Pontien Ndabashinze, Mohamed Shaker, and Eman Said. "Prevention of Mother-to-Child Transmission and Early Real-Time DNA Polymerase Chain Reaction Results Among HIV-Exposed Infants in Bujumbura, Burundi." East African Health Research Journal 2, no. 2 (November 23, 2018): 112–17. http://dx.doi.org/10.24248/eahrj.v2i2.573.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Coulaud, Pierre-julien, Gabriel Mujimbere, Arsène Nitunga, Candide Kayonde, Emmanuel Trenado, Bruno Spire, and Adeline Bernier. "An Assessment of Health Interventions Required to Prevent the Transmission of HIV Infection Among Men Having Sex with Men in Bujumbura, Burundi." Journal of Community Health 41, no. 5 (March 28, 2016): 1033–43. http://dx.doi.org/10.1007/s10900-016-0187-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Renaud, A., O. Basenya, N. de Borman, I. Greindl, and G. Meyer-Rath. "The cost effectiveness of integrated care for people living with HIV including antiretroviral treatment in a primary health care centre in Bujumbura, Burundi." AIDS Care 21, no. 11 (October 28, 2009): 1388–94. http://dx.doi.org/10.1080/09540120902884042.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Ndizeye, Zacharie, Sonia Menon, Jean-Pierre Van Geertruyden, Catherine Sauvaget, Y. Jacquemyn, John-Paul Bogers, Ina Benoy, and Davy Vanden Broeck. "Performance of OncoE6TMCervical Test in detecting cervical precancer lesions in HIV-positive women attending an HIV clinic in Bujumbura, Burundi: a cross-sectional study." BMJ Open 9, no. 9 (September 2019): e029088. http://dx.doi.org/10.1136/bmjopen-2019-029088.

Full text

Abstract:

ObjectiveNew rapid and low-cost molecular tests for cervical cancer screening, such as the OncoE6 Cervical Test, are emerging and could be alternatives for low-income and middle-income countries. To this end, we evaluated the clinical performance of the OncoE6 Cervical Test in detecting cervical intraepithelial neoplasia (CIN) among HIV-infected women in Bujumbura, Burundi.MethodsFrom June to December 2017, a cross-sectional study was conducted in 680 HIV-positive women at the University Hospital. Women aged 25–65 years who declared having had vaginal intercourse were consecutively recruited, and cervical specimens for OncoE6, liquid-based cytology and human papillomavirus (HPV) genotyping were obtained and visual inspection with acetic acid performed. Thereafter, participants underwent a colposcopic examination. The sensitivity, specificity, and positive and negative predictive values of the different tests were calculated with reference to ‘colposcopic-histological’ diagnoses, and areas under the receiver operating curves of OncoE6 and cytology tests were compared.ResultsThe prevalence of CIN was 4.9%, and OncoE6 positivity was 3.1%. OncoE6 sensitivity varied from poor to low with increasing disease severity (42.1%, 95% CI 19.9% to 64.3% at CIN2+ threshold; and 58.3%, 95% CI 30.4% to 86.2% at CIN3+ threshold). OncoE6 had the highest specificity compared with all other tests used together. The performance of the OncoE6 test was significantly lower compared with cytology at atypical squamous cell of undetermined significance (ASCUS+) cut-off (AUC=0.68 vs 0.85, p=0.03) and low-grade squamous intraepithelial lesion (LSIL+) cut-off (AUC=0.68 vs 0.83, p=0.04) for CIN2+ diagnoses. However, the performance of the OncoE6 test was similar to that of cytology at high-grade squamous intraepithelial lesion (HSIL+) cut-off (AUC=0.68 vs 0.76; p=0.30) for CIN2+ diagnoses and was also similar to that of cytology at all cut-offs (ASCUS+, LSIL+ and HSIL+) for CIN3+ diagnoses (p1=0.76, p2=0.95 and p3=0.50, respectively).ConclusionThe current OncoE6 test proved to be a point-of-care test. However, given its poor performance for CIN2+ diagnoses, we do not recommend it for primary screening. We recommend to enrich it with more oncogenic HPV types, which may improve the performance of the test akin to that of cytology.

APA, Harvard, Vancouver, ISO, and other styles

50

Castryck, Geert. "Living Islam in Colonial Bujumbura – The Historical Translocality of Muslim Life between East and Central Africa." History in Africa 46 (March 18, 2019): 263–98. http://dx.doi.org/10.1017/hia.2019.2.

Full text

Abstract:

Abstract:This article applies a translocal approach in order to make sense of the internal dynamics in the Muslim community of colonial Bujumbura. The establishment of the community and its religious evolutions – from a practical living of Islam to Qadiriyya Sufism to Islamic Reform – are interpreted in regard to, on the one hand, religious tendencies in East African Islam and, on the other hand, processes of integration, marginalization, and exclusion in an urban, colonial and Burundian context. An answer to the social needs and challenges on the local level was found in religious intensification and a widening of the geographical scope, drawing on age-old connections across East and Central Africa.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!