Academic literature on the topic 'C. J. Cherryh'

Hampson, C., MacDonald, R., McKenzie, D.-L., Herbert, L. and Pagliocchini, C. 2014. ‘SPC136’ (Suite Note™) sweet cherry. Can. J. Plant Sci. 94: 1555–1558. ‘SPC136’ (Suite Note™) is a new early-season sweet cherry being released for commercial production by the Agriculture and Agri-Food Canada sweet cherry breeding program at Summerland, BC, Canada. Harvest timing in Summerland (Jul. 09) is similar to that of ‘Bing’ or ‘Van’ but fruit size is much larger (over 12 g). Fruit firmness, soluble solids content and susceptibility to rain splitting resemble those of other cultivars of similar harvest timing, but stem detachment force is higher. The trees are not self-fertile and bloom late in the cherry blossom season.

Understanding sorption isotherms is crucial in food science for optimizing the drying processes, enhancing the shelf-life of food, and maintaining food quality during storage. This study investigated the isotherms of sweet cherry powder (SCP) using the static gravimetric method. The experimental water sorption curves of lyophilized sweet cherry powder were determined at 30°C, 40°C, and 50°C. The curves were then fitted to six isotherm models: Modified GAB, Halsey, Smith, Oswin, Caurie, and Kühn models. To define the energy associated with the sorption process, the isosteric sorption heat, differential entropy, and spreading pressure were derived from the isotherms. Among the six models, the Smith model is the most reliable in predicting the sorption of the cherry powder with a determination coefficient (R2) of 0.9978 and a mean relative error (MRE) ≤1.61. The values of the net isosteric heat and differential entropy for the cherry increased exponentially as the moisture content decreased. The net isosteric heat values varied from 10.63 to 90.97 kJ mol−1, while the differential entropy values varied from 27.94 to 273.39 J. mol−1K−1. Overall, the enthalpy-entropy compensation theory showed that enthalpy-controlled mechanisms could be used to regulate water adsorption in cherry powders.

Little cherry disease (LChD), a virus disease of sweet (Prunus avium) and sour cherries (P. cerasus), is caused by members of the Closteroviridae family. Symptoms are especially visible on fruits and leaves. Leaves become red or bronze in late summer and fall. Fruit are small, angular, and pointed. Fruits are unmarketable due to a characteristic bitter flavor. LChD also causes reduction of yield (1). Sweet and sour cherries are the second (after apples) most often grown fruit species in the Czech Republic. Since LChD occurred in Germany (1) and Poland (2) in 2007 and 2008, sweet and sour cherry trees with LChD symptoms were surveyed in orchards in the East Bohemia Region of the Czech Republic. The presence of LChD was determined by reverse transcription (RT)-PCR and woody indicator plants, as recommended by the European and Mediterranean Plant Protection Organization (EPPO). Different parts of plants were taken from trees with suspicious symptoms to observe the dynamics of virus infection during the 2009 growing season. Total RNA was isolated from young leaves, blossoms, fruits, and fully developed leaves with a CONCERT Plant RNA Purification Reagent (Invitrogen, Carlsbad, CA) (3). RT-PCR was performed with a QIAGEN OneStep RT-PCR Kit (Qiagen, Hilden, Germany) and oligonucleotides previously described (4). Oligonucleotide LCV3EC (5′-GCTCTAGAGGCACCTTTTATTTTTTATATATGC-3′), complementary to position 16910 to 16934 (GenBankAccession No. Y10237) (with the addition of eight nonviral nucleotides to introduce an XbaI site), was used as a negative-sense primer in RT reactions and PCR. Oligonucleotide LCV16659 (5′-GTTATAGAATTCACTGCAAGTG-3′) was used as a positive-sense primer for PCR amplification. The program used for cDNA synthesis was 50°C for 30 min, followed by denaturation for 10 min at 95°C, 35 cycles of 45 s at 94°C, 45 s at 58°C, and 45 s at 72°C. A final incubation was at 72°C for 5 min (1). The finished PCR products (430 bp) were analyzed on 1% agarose gels (stained with SYBR green). According to the preliminary results, young leaves from buds (67% of samples of selected trees with LChD were positive), blossoms (67% positive), and leaves taken in autumn (67% positive) were optimal for the detection of LChD by RT-PCR. The trial with woody indicator plant species was established in the field. Indicators P. avium cv. Sam and P. avium cvs. Bing, F12/1, and Canindex (4) were inoculated with buds from LChD-infected trees and observed for 2 years. Woody indicators remained symptomless throughout the first year of observation, but the indicators showed red coloration of leaves in late summer of the second year. P. avium cv. Canindex seems to be the best woody indicator for testing of LChD in the climatic conditions of the Czech Republic. To our knowledge, this is the first report of LChD in the Czech Republic. References: (1) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (2) B. Komorowska and M. Cieślińska. Plant Dis. 92:1366, 2008. (3) J. Matoušek et al. Biol.Chem. 388:1, 2007. (4) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Zhang, J., Yang, W. R., Cheng, T. R., Pan, H. T. and Zhang, Q. X. 2013. Functional and evolutionary analysis of two CBF genes in Prunus mume . Can. J. Plant Sci. 93: 455–464. Primers based on the C-repeat (CRT)/dehydration responsive element (DRE) binding factor of peach (Prunus persica), sweet cherry (Prunus avim) and other related family member sequences found in GenBank were designed. Fragments of C-repeat binding factor (CBF) genes were isolated from Prunus mume by PCR and RT-PCR. The two CBF genes, designated PmCBFa and PmCBFb, were 821 bp and 741 bp long, encoding putative proteins of 238 and 225 amino acids, respectively, which contain all the conserved CBF protein domains. Similar to other CBF homologs, PmCBFa and PmCBFb may be constitutive and can be induced at a low temperature. Phylogenetic analysis using known CBF homologs indicated that all monocot CBF genes belong to the same group, separated from the eudicot CBF genes. The PmCBF genes are the homologs of the sweet cherry PaDREB gene. Sequencing of 16 cultivars and a wild species, ‘Zang’ Mei, characterized the intraspecific molecular evolution of the Prunus mume CBF genes, and the preliminary analysis indicates that the nucleotide diversity is low in coding area of PmCBFa.

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Purpose. To describe a clinical case of successful application of ligh t-oxygen therapy (LOT) for treating a patient with a cherry angioma. Materials and methods. The publication presents a clinical case of successful application of LOT irradiation in the absorption spectrum of endogenous oxygen with its transfer into singlet state for treating a cherry angioma. Russian-made diode laser “Super Seb” with wavelength close to 1265 nm (manufacturer LLC “New Surgical Technologies”, Moscow), laser power from 0 to 3 Wt was used as a source of laser light. In the described case, irradiation power was 2.4 Wt; power density – 0.76 W/cm2; exposure dose – 365 J/cm2; maximal surface temperature during session – 38 °C. Temperature was measured with a non–contact infrared thermometer ELARI SmartCare model YC-E13 (manufactured by Zhengyang Yuncheng Medical Technology Co. Ltd., China) to eliminate the thermal effect. Results. A complete clinical remission was achieved after one LOT session. Conclusions. Light-oxygen therapy in patients with cherry angiomas is an effective and safe curative technique.

Large eddy simulations of an asymmetric diffuser characterized by complex 3-D flow separation for which RANS models provide qualitatively wrong predictions have been performed.. An incompressible, turbulent, fully-developed flow in a rectangular duct (aspect ratio 1:3.33) expands into this diffuser. Two such diffusers were constructed by deflecting a pair of adjacent walls for the experiments in Cherry et al. [1, 2] (2006, 2008) and Buice, C. U. and Eaton, J. K. [3]. Most of our simulations consider Diffuser 1 with wall deflection angles 11.3° and 2.56°. In the experiments, flow begins to separate at the corner formed by the two deflected walls and then spreads so that flow is separated from the wall at the larger deflection angle. In simulations with RANS models, flow separates from the wall with the smaller deflection. It has been possible to obtain solutions with LES where flow separates correctly, off the wall at the larger deflection angle, as in the experiment. The LES finds a qualitatively correct separation, with characteristics in close quantitative agreement (within 5%) with the experimental values for Diffuser 1. The effects of variations in grid aspect ratio, grid refinement, inlet length, number of flow passes, and secondary flow structure upstream of the diffuser on solutions were determined. An LES was carried out for Diffuser 2 (deflection angles of 9° and 4° respectively), applying all lessons learnt in Diffuser 1 studies. It was found that the results for Diffuser 2 are not as quantitatively close to the experimental results as in case of the Diffuser 1, but the discrepancies appear to have a similar origin in some finer aspect of diffuser inflow conditions.