Journal articles on the topic 'C. J. Cherryh'

Hampson, C., MacDonald, R., McKenzie, D.-L., Herbert, L. and Pagliocchini, C. 2014. ‘SPC136’ (Suite Note™) sweet cherry. Can. J. Plant Sci. 94: 1555–1558. ‘SPC136’ (Suite Note™) is a new early-season sweet cherry being released for commercial production by the Agriculture and Agri-Food Canada sweet cherry breeding program at Summerland, BC, Canada. Harvest timing in Summerland (Jul. 09) is similar to that of ‘Bing’ or ‘Van’ but fruit size is much larger (over 12 g). Fruit firmness, soluble solids content and susceptibility to rain splitting resemble those of other cultivars of similar harvest timing, but stem detachment force is higher. The trees are not self-fertile and bloom late in the cherry blossom season.

Understanding sorption isotherms is crucial in food science for optimizing the drying processes, enhancing the shelf-life of food, and maintaining food quality during storage. This study investigated the isotherms of sweet cherry powder (SCP) using the static gravimetric method. The experimental water sorption curves of lyophilized sweet cherry powder were determined at 30°C, 40°C, and 50°C. The curves were then fitted to six isotherm models: Modified GAB, Halsey, Smith, Oswin, Caurie, and Kühn models. To define the energy associated with the sorption process, the isosteric sorption heat, differential entropy, and spreading pressure were derived from the isotherms. Among the six models, the Smith model is the most reliable in predicting the sorption of the cherry powder with a determination coefficient (R2) of 0.9978 and a mean relative error (MRE) ≤1.61. The values of the net isosteric heat and differential entropy for the cherry increased exponentially as the moisture content decreased. The net isosteric heat values varied from 10.63 to 90.97 kJ mol−1, while the differential entropy values varied from 27.94 to 273.39 J. mol−1K−1. Overall, the enthalpy-entropy compensation theory showed that enthalpy-controlled mechanisms could be used to regulate water adsorption in cherry powders.

Little cherry disease (LChD), a virus disease of sweet (Prunus avium) and sour cherries (P. cerasus), is caused by members of the Closteroviridae family. Symptoms are especially visible on fruits and leaves. Leaves become red or bronze in late summer and fall. Fruit are small, angular, and pointed. Fruits are unmarketable due to a characteristic bitter flavor. LChD also causes reduction of yield (1). Sweet and sour cherries are the second (after apples) most often grown fruit species in the Czech Republic. Since LChD occurred in Germany (1) and Poland (2) in 2007 and 2008, sweet and sour cherry trees with LChD symptoms were surveyed in orchards in the East Bohemia Region of the Czech Republic. The presence of LChD was determined by reverse transcription (RT)-PCR and woody indicator plants, as recommended by the European and Mediterranean Plant Protection Organization (EPPO). Different parts of plants were taken from trees with suspicious symptoms to observe the dynamics of virus infection during the 2009 growing season. Total RNA was isolated from young leaves, blossoms, fruits, and fully developed leaves with a CONCERT Plant RNA Purification Reagent (Invitrogen, Carlsbad, CA) (3). RT-PCR was performed with a QIAGEN OneStep RT-PCR Kit (Qiagen, Hilden, Germany) and oligonucleotides previously described (4). Oligonucleotide LCV3EC (5′-GCTCTAGAGGCACCTTTTATTTTTTATATATGC-3′), complementary to position 16910 to 16934 (GenBankAccession No. Y10237) (with the addition of eight nonviral nucleotides to introduce an XbaI site), was used as a negative-sense primer in RT reactions and PCR. Oligonucleotide LCV16659 (5′-GTTATAGAATTCACTGCAAGTG-3′) was used as a positive-sense primer for PCR amplification. The program used for cDNA synthesis was 50°C for 30 min, followed by denaturation for 10 min at 95°C, 35 cycles of 45 s at 94°C, 45 s at 58°C, and 45 s at 72°C. A final incubation was at 72°C for 5 min (1). The finished PCR products (430 bp) were analyzed on 1% agarose gels (stained with SYBR green). According to the preliminary results, young leaves from buds (67% of samples of selected trees with LChD were positive), blossoms (67% positive), and leaves taken in autumn (67% positive) were optimal for the detection of LChD by RT-PCR. The trial with woody indicator plant species was established in the field. Indicators P. avium cv. Sam and P. avium cvs. Bing, F12/1, and Canindex (4) were inoculated with buds from LChD-infected trees and observed for 2 years. Woody indicators remained symptomless throughout the first year of observation, but the indicators showed red coloration of leaves in late summer of the second year. P. avium cv. Canindex seems to be the best woody indicator for testing of LChD in the climatic conditions of the Czech Republic. To our knowledge, this is the first report of LChD in the Czech Republic. References: (1) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (2) B. Komorowska and M. Cieślińska. Plant Dis. 92:1366, 2008. (3) J. Matoušek et al. Biol.Chem. 388:1, 2007. (4) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Zhang, J., Yang, W. R., Cheng, T. R., Pan, H. T. and Zhang, Q. X. 2013. Functional and evolutionary analysis of two CBF genes in Prunus mume . Can. J. Plant Sci. 93: 455–464. Primers based on the C-repeat (CRT)/dehydration responsive element (DRE) binding factor of peach (Prunus persica), sweet cherry (Prunus avim) and other related family member sequences found in GenBank were designed. Fragments of C-repeat binding factor (CBF) genes were isolated from Prunus mume by PCR and RT-PCR. The two CBF genes, designated PmCBFa and PmCBFb, were 821 bp and 741 bp long, encoding putative proteins of 238 and 225 amino acids, respectively, which contain all the conserved CBF protein domains. Similar to other CBF homologs, PmCBFa and PmCBFb may be constitutive and can be induced at a low temperature. Phylogenetic analysis using known CBF homologs indicated that all monocot CBF genes belong to the same group, separated from the eudicot CBF genes. The PmCBF genes are the homologs of the sweet cherry PaDREB gene. Sequencing of 16 cultivars and a wild species, ‘Zang’ Mei, characterized the intraspecific molecular evolution of the Prunus mume CBF genes, and the preliminary analysis indicates that the nucleotide diversity is low in coding area of PmCBFa.

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Purpose. To describe a clinical case of successful application of ligh t-oxygen therapy (LOT) for treating a patient with a cherry angioma. Materials and methods. The publication presents a clinical case of successful application of LOT irradiation in the absorption spectrum of endogenous oxygen with its transfer into singlet state for treating a cherry angioma. Russian-made diode laser “Super Seb” with wavelength close to 1265 nm (manufacturer LLC “New Surgical Technologies”, Moscow), laser power from 0 to 3 Wt was used as a source of laser light. In the described case, irradiation power was 2.4 Wt; power density – 0.76 W/cm2; exposure dose – 365 J/cm2; maximal surface temperature during session – 38 °C. Temperature was measured with a non–contact infrared thermometer ELARI SmartCare model YC-E13 (manufactured by Zhengyang Yuncheng Medical Technology Co. Ltd., China) to eliminate the thermal effect. Results. A complete clinical remission was achieved after one LOT session. Conclusions. Light-oxygen therapy in patients with cherry angiomas is an effective and safe curative technique.

Cherry is widely planted in China, from Liaoning, Beijing, Hebei, Shandong, Zhejiang, Jiangsu, and Anhui provinces (eastern China), to Shaanxi, Sichuan, Chongqing, and Guizhou provinces (western China). The brown rot fungus Monilinia fructigena causes considerable production losses in cherry production in Liaoning Province (3). In May 2013, Chinese sour cherry (Prunus pseudocerasus) cv. Wupi displaying symptoms of brown rot was found in an orchard in Chongqing municipality. Diseased cherry fruit had a brown rot sporulating with grayish, conidial tufts. The fruit later succumbed to the soft rot or shivered and became a mummy. Single-spore isolations on PDA resulted in colonies with concentric rings of pigmented mycelium with lobbed margins. Conidia were broadly ellipsoid to subglobose, occasionally even globose, with an average size of 16 × 12.7 μm. Multiple germ tubes were produced from each conidium, a germination pattern unique to Monilia mumecola (1,2,4). The pathogen identity was confirmed by multiplex PCR as described by Hu et al. (2). The PCR resulted in a 712-bp amplicon, which is diagnostic of M. mumecola. Further sequencing of the internal transcribed spacer (ITS) region 1 and 2 and 5.8S gene further indicated 100% identity with that of M. mumecola isolates from China (Accession No. HQ908786) and from Japan (AB125613, AB125614, and AB125620). Koch's postulates were confirmed by inoculating mature cherry fruit with mycelia plugs. Inoculated fruit were placed in a sterilized moist chamber, and incubated at 22°C with 12 h light/dark cycle. Inoculated fruit developed typical brown rot symptoms only 2 days after inoculation, while the control fruit, inoculated with a sterile PDA plug, remained healthy. The pathogen isolated from inoculated symptomatic fruit was confirmed to be M. mumecola based on morphological characteristics and germination pattern. It should be noted that the conidia on inoculated fruit showed an average size of 20 × 15.3 μm, significantly bigger than that of from PDA, and most produced more than three germ tubes. The inoculation experiments were performed in triplicates. M. mumecola was first reported as the causal agent of brown rot of mume in Japan in 2004 (1). Later studies demonstrated that it is also pathogen on other stone fruits, e.g., peach, nectarine (2), and apricot (4). To our knowledge, this is the first report of cherry brown fruit rot caused by M. mumecola, and the first report of M. mumecola in Chongqing municipality. References: (1) Y. Harada et al. J. Gen. Plant Pathol. 70:297, 2004. (2) M. J. Hu et al. Plos One 6(9): e24990, 2011. (3) Z. H. Liu et al. J. Fruit Sci. 29:423, 2012. (4) L. F. Yin et al. Plant Dis. 98:694, 2014.

Jerusalem cherry (Solanum pseudocapsicum) has recently become popular as a potted ornamental plant in Italy. During the summer of 1999, a sudden wilt of 60-day-old plants was observed in the Albenga region (Northern Italy), an area of intensive floriculture. Initial symptoms included stem necrosis at the soil line and yellowing and tan discoloration of leaves. As stem necrosis progressed, infected plants wilted and died. Necrotic tissues were covered with whitish mycelium that differentiated into reddish brown, spherical (1 to 2 mm diameter) sclerotia. Sclerotium rolfsii was consistently recovered from the surface of symptomatic stem sections that were disinfected for 1 min in 1% NaOCl and then plated on potato-dextrose agar (PDA) amended with 100 ppm streptomycin sulfate. Pathogenicity of three S. rolfsii isolates was confirmed by inoculating 90-day-old S. pseudocapsicum plants grown in pots. Inoculum consisted of mycelium and sclerotia of the pathogen placed on the soil surface around the base of each plant. Noninoculated plants served as controls. All plants were kept in a growth chamber at 18 to 28°C and RH > 85%. Inoculated plants developed symptoms within 7 days, while control plants remained symptomless. Sclerotia developed on infected tissues and S. rolfsii was reisolated from symptomatic tissues. The disease has been observed in the United States (1), but this is the first report of stem blight of S. pseudocapsicum caused by S. rolfsii in Europe. Reference: (1) S. A. Alfieri, Jr., K. R. Langdon, C. Wehlburg, and J. W. Kimbrough, J. W. Index Plant Dis. Florida Bull. 11:215, 1984.

Little cherry disease (LChD) occurs in most cherry growing areas in the world. Infection of sensitive cultivars results in small fruit with poor color, angular shape, and insipid flavor. Three viruses associated with LCD have been described: (i) Little cherry virus-1 (LChV-1) first found and described in Germany (4); (ii) LChV-2 an isolate obtained from the United States (2); and (iii) LChV-3 first found and described in British Columbia (1). Despite similarities in symptom development in orchard trees and woody indexing, the three viruses have distinct molecular sequences (3). LChV-2 and -3 share greater homology with each other than either does with LChV-1. For many years, the British Columbia Ministry of Agriculture, Fisheries and Food (BCMAFF) in conjunction with Agriculture and Agri-Food Canada, Pacific Agri-Food Research Centre (AAFC-PARC) has conducted a survey to monitor the incidence and spread of LChD in the Okanagan and Kootenay valleys of British Columbia, Canada. Until recently, testing for LChD used woody indexing on indicator trees, Prunus avium cv. Lambert (fruit symptoms) and cvs. Canindex1 and Sam (foliar symptoms). Recently, incidence of LChD has been evaluated using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) developed at AAFC-PARC (3), and reverse transcription-polymerase chain reaction (RT-PCR) tests based on sequence data from LChV-3 (1). During the 1999 survey, orchard trees displaying symptoms typical of LChD tested negative for LChV-3 using ELISA and RT-PCR. Also, trees that formerly tested positive for LChD by woody indexing also tested negative for LChV-3 using RT-PCR and ELISA. Two hundred ninety-three trees were subsequently tested for LChV-1 by RT-PCR using the primer set LCV3EC/LCV16659 (4). A 276-bp fragment corresponding to the extreme 3′ untranslated region (3′ UTR) of the LChV-1 genome was amplified by RT-PCR from 140 of the trees. The RT-PCR amplicon from one sample (#99-68B from Peachland) was sequenced and using a BLASTn search, LChV-1 was identified as the most probable match (E value 4e-59). Sequence alignment using ClustalX identified two regions of high sequence homology; bases 2 to 70 (92%) and bases 99 to 239 (95%). The intervening region displayed much lower homology (61%). The overall homology of the amplicon was 88% compared to the corresponding region in LChV-1. Divergence between the published sequence of LChV-1 and the sequence of the new LChV isolate (tentatively named LChV-4) was investigated. Seven sets of primers constructed on the basis of sequence data from various regions of the LChV-1 genome (two sets from each of the RNA-dependent RNA polymerase, heat shock 70 protein homologue, and coat protein) failed to yield RT-PCR products when tested with the LChV-4 isolate. LChV-4 is clearly related to LChV-1 within the 3′-UTR but complete sequencing is required to determine the overall relationship with other viruses causing LChD. The discovery of a new isolate of LChV in British Columbia may require a reevaluation of the epidemiology of LChD and disease management strategy. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) M. E. Rott, and W. Jelkmann. Phytopathology 91:261, 2001. (3) J. Theilmann et al. Phytopathology 92:87, 2002. (4) M. Vitushkina et al. Eur. J. Plant Pathol. 103;803, 1997.

Following frequent rains during May and June of 1999, a high incidence of an unknown disease on sour cherry (Prunus cerasus) fruits was observed in western Serbia (Šabac). Initially, small, water-soaked, dark green spots appeared on the fruit tissue similar to infections caused by Pseudomonas syringae or a Colletotrichum sp. (1,2). Later, spots enlarged, coalesced, and became necrotic and covered most of the fruit surface. The diseased tissue was slightly depressed and fruit shriveled and dried. Approximately 60 to 80% of the total yield was affected. Numerous hyaline, unicellular, and ellipsoidal conidia were observed with a microscope. Orange spore masses often occurred on the necrotic tissue following rain. Symptoms of the disease were not expressed during the dry spring of 2000, but were observed in rainy 2001. The most susceptible cultivar was Haiman's Rubin. Disease symptoms were absent on the domestic cultivar Oblačinska. Placing small necrotic fragments on potato dextrose agar (PDA) resulted in grayish fungal colonies that produced black, globose pycnidia with hyaline, unicellular, and ellipsoidal conidia under daylight conditions that were similar to those formed on necrotic sour cherry fruit in the orchard. At 25°C, colonies covered the entire 9-cm diameter surface of PDA after 5 to 6 days. No teleomorph was observed. Bacterial isolations on nutrient agar were unsuccessful. Unripe sour cherry fruits were punctured with a sterile needle and small colony fragments of the fungus were placed over the wound. Symptoms typical of those on fruit found in orchards were observed after 7 days of incubation at 25°C. No symptoms developed on control fruits punctured with a sterile needle. The fungus was reisolated from the inoculated fruits and shown to be identical to the original strains. On the basis of pathogenicity and morphological characteristics of the strains investigated, the fungus was determined to be a Phoma sp. (3), also known as sour cherry necrosis in other fruit-tree-growing regions. To our knowledge, this is the first report of the fungus on sour cherry fruit in Serbia. References: (1) J. Balaž and M. Arsenijević. Proc.Int. Conf. Plant. Path. Bact. 7:515, 1990. (2) M. Ivanović and D. Ivanović. Zašt. Bilja 201:211, 1992. (3) B. C. Sutton. Pages 379–391 in: Coelomycetes. CMI, Kew, Surrey, England, 1980.

Sweet cherry (Prunus avium L.) cultivation has increased in Italy and ≈30,000 ha are now in production. In the spring of 2006, a disease survey was conducted in orchards of central Italy. Decline symptoms of Prunus avium ‘Durone’ grafted on wild rootstocks of Prunus avium consisted of reduced tree vigor, yellowing of leaves, and development of root and collar rot. A reddish brown discoloration of the inner bark and wood was observed on symptomatic trees. Symptoms were recorded in three cherry orchards seasonally submitted to soil saturation conditions. In one orchard, symptoms were observed on approximately 30% of 170 surveyed trees. A Phytophthora species was consistently isolated on PARPH-V8 medium (2) from collar lesions of five cherry trees over nine trees randomly chosen among symptomatic trees in the three orchards. Colonies (20) were isolated and all appeared fluffy on potato dextrose agar and did not grow at 35°C. The morphological characteristics fit the descriptions of Phytophthora cryptogea Pethybr. & Lafferty (1). Sequence analysis of the internal transcribed spacers region of isolates shared 100% homology with P. cryptogea (GenBank Accession Nos. EF418948.1, EF418943.1, and EF153671.1). Pathogenicity of two P. cryptogea isolates (AN1 and AN2, Accession Nos. EF661576 and EF661577, respectively) was tested by soil infestation in a growth chamber at 22°C using 15 1-year-old rooted seedlings of wild rootstock of Prunus avium for each isolate. Noninoculated seedlings (15) were used as negative controls. The inoculum was produced by growing isolates on autoclaved millet grains moistened with V8 juice for 4 weeks. Each plant was inoculated with 30 cm3 of inoculum per liter of soil. Each seedling was randomly assigned to isolates AN1, AN2, or the noninoculated control and arranged in a complete random design. All plants were flooded for 24 h every 2 weeks for 8 weeks. At the end of the experiment, all inoculated seedlings showed crown wilting and root rot. Control plants showed no symptoms. Percentage of necrotic lateral roots expressed as dry weight (±SE) was 19.9 ± 0.6, 17.5 ± 0.2, and 4.4 ± 0.5, respectively, for seedlings inoculated with isolates AN1, AN2, and controls (analysis of variance F = 7.48, P < 0.01). Values of inoculated seedlings were significantly different from the control plants with the Tukey Post-Hoc test. No difference in virulence was observed between the two isolates. P. cryptogea was always reisolated from the roots of inoculated plants. Although pathogenicity of P. cryptogea on sweet cherry has been reported in the United States and other European countries (3,4), to our knowledge, this is the first record of P. cryptogea on sweet cherry orchards in Italy. The presence of P. cryptogea in cherry orchards is of significant concern because of its aggressiveness to this host and woody hosts such as apple, apricot, peach, walnut, and kiwi. References: (1) D. C Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) A. J. Ferguson and S. N. Jeffers. Plant Dis. 83:1129, 1999. (3) T. Tomidis and T. Sotiropoulos. N. Z. J. Crop Hortic. Sci. 31:355, 2003. (4) W. F. Wilcox and S. M. Mircetich. Phytopathology 75:1451, 1985.

Conductance of CO2 across the mesophyll (Gm) frequently constrains photosynthesis (PN) but cannot be measured directly. We examined Gm of cherry (Prunus avium L.) subjected to severe drought using the variable J method and carbon-isotopic composition (δ13C) of sugars from the centre of the leaf, the leaf petiole sap, and sap from the largest branch. Depending upon the location of the plant from which sugars are sampled, Gm may be estimated over scales ranging from a portion of the leaf to a canopy of leaves. Both the variable J and δ13C of sugars methods showed a reduction in Gm as soil water availability declined. The δ13C of sugars further from the source of their synthesis within the leaf did not correspond as closely to the diffusive and C-isotopic discrimination conditions reflected in the instantaneous measurement of gas exchange and chlorophyll-fluorescence utilised by the variable J approach. Post-photosynthetic fractionation processes and/or the release of sugars from stored carbohydrates (previously fixed under different environmental and C-isotopic discrimination conditions) may reduce the efficacy of the δ13C of sugars from leaf petiole and branch sap in estimating Gm in a short-term study. Consideration should be given to the spatial and temporal scales at which Gm is under observation in any experimental analysis.

In autumn 2012, severe branch cankers and diebacks of sweet cherry trees (Prunus avium L.) were observed in orchards located in two different growing areas in Alicante Province (eastern Spain). In affected trees, leaves become dried without defoliation. Sectorial wood necrosis was also observed, occasionally associated with swollen bark and gum exudates. Isolations were made from diseased branches by surface-disinfecting small fragments of symptomatic tissue in 0.5% NaOCl, double-rinsing in sterile water, and plating them onto potato dextrose agar (PDA) amended with 0.5 g liter−1 of streptomycin sulfate. Plates were incubated at 25°C in the dark for 10 days, and all colonies were transferred to PDA. Pink to red colonies with white margins were consistently isolated. All isolates produced hyaline, allantoid to oblong-ellipsoidal conidia, 4 to 6 × 1.5 to 2 μm. The fungus was identified as Calosphaeria pulchella (Pers.: Fr.) J. Schröt (anamorph Calosphaeriophora pulchella Réblová, L. Mostert, W. Gams & Crous) based on morphology (1). Identification of C. pulchella isolates was confirmed by sequence comparison in GenBank database using the internal transcribed spacer region (ITS1-5.8S-ITS2) of the rDNA. Sequences showed 100% identity and 100% query coverage with C. pulchella reference isolate CBS 115999 (EU367451) (2). The ITS sequence of one of the isolates obtained in this study was deposited into GenBank (KJ396346). Two-year-old sweet cherry trees cv. Burlat were inoculated with two representative C. pulchella isolates from different orchards (1701 and 1702). A 5-mm cork borer was used to remove bark, and an agar plug from the growing margin of 20-day-old colonies was placed directly into the fresh wound, mycelium side down. Five trees were inoculated per isolate (five branches per tree) and 25 control branches were inoculated with non-colonized agar plugs. Inoculated tissue was covered with Vaseline and Parafilm to avoid the loss of water. Branches were taken to the laboratory 9 months after inoculation and thoroughly examined for canker development. The length of vascular discoloration was evaluated in each branch and resulting data were statistically analyzed. Length of vascular discoloration on the inoculated branches (6.6 ± 0.7) was significantly longer than in control plants (2.3 ± 0.3) at P < 0.001. Perithecia were neither observed on the artificially inoculated branches nor in the diseased sweet cherry trees from the sampled orchards. C. pulchella was re-isolated from the inoculated branches and no fungi were isolated from discolored tissue of the controls, confirming Koch's postulates. Canker of sweet cherry caused by C. pulchella is responsible for reducing yields and tree longevity in California and South Australia (3). Cultivated area of sweet cherry in Spain is around 25,000 ha. Hence, the potential economic loss from this pathogen could be substantial if left unchecked. To our knowledge, this is the first report of C. pulchella as a pathogen of sweet cherry trees in Spain. References: (1) M. E. Barr. Mycologia 77:549, 1985. (2) U. Damm et al. Persoonia 20:39, 2008. (3) F. P. Trouillas et al. Plant Dis. 96:648, 2012.

Blossom blight of Japanese plum (Prunus salicina), nectarine (P. persica var. nectarina), and sweet cherry (P. avium) was observed in commercial orchards in central Chile in 2012. Disease prevalence of 8% and 1% were estimated in 2012 and 2013, respectively. Early symptoms appeared as small pale-brown necrotic lesions on the petals that eventually affected the entire flowers. White and cottony fungal colonies were consistently isolated on potato dextrose agar acidified with 0.5 ml/liter of 92% lactic acid (APDA), incubated for 5 days at 20°C. Black spherical to elongated sclerotia of 2.5 to 4.2 × 2.8 to 5.3 mm (n = 60) were formed on APDA. This fungus was tentatively identified as Sclerotinia sclerotiorum (Lib.) de Bary. The identity of the fungus was confirmed by BLAST analysis of the internal transcribed spacer (ITS) region (GenBank Accession Nos. KF148604 to KF148609) of rDNA, amplified with PCR primers ITS1/ITS4 (3), demonstrating a 99 to 100% similarity with the reference S. sclerotiorum strains (EU082466 and JX307092). The pathogenicity was studied in detached flowers of ‘Larry Ann’ Japanese plum, ‘Summer Bright’ nectarine, and ‘Bing’ sweet cherry that were inoculated with a mycelial suspension (106 fragments/ml) of six isolates of S. sclerotiorum and incubated for 5 days at 20°C in humid chambers (>80% relative humidity). Inoculated flowers developed a light brown petal necrosis that eventually comprised the entire flower. The same S. sclerotiorum isolates were inoculated in mature fruits of ‘Larry Ann’ Japanese plum, ‘Summer Bright’ nectarine, and ‘Staccato’ sweet cherry. Surface disinfected (1% NaOCl for 1 min) fruits were inoculated by placing a mycelium plug (4 mm in diameter) into a wound made with a sterile scalpel and incubated for 3 days at 20°C in humid chambers. Symptoms consisted on light brown soft lesions that varied from 8.7 to 46.5 mm in diameter. A superficial white and cottony septated mycelium was also obtained. An equal number of non-inoculated flowers and wounded but non-inoculated fruits remained healthy. S. sclerotiorum was re-isolated from 100% of the artificially inoculated flowers and fruits, completing Koch's postulates. S. sclerotiorum was reported causing shoot blight on apricot (P. armeniaca), lemon tree (Citrus limon), and table grapes (Vitis vinifera) in Chile (1,2), and to our knowledge, this is the first report of S. sclerotiorum associated with blossom blight in Japanese plum, nectarine, and sweet cherry in Chile. References: (1) R. Acuña. Compendio de Bacterias y Hongos de Frutales y Vides en Chile. Servicio Agrícola y Ganadero, Santiago, Chile, 2010. (2) B. A. Latorre and M. J. Guerrero. Plant Dis. 85:1122, 2001. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, CA, 1990.

Taiwan cherry or Formosan cherry (Prunus campanulata Maxim.) is a beautiful ornamental tree that is native to Taiwan. In spring 2005, a severe disease was observed on 1- to 3-year-old seedlings of Taiwan cherry in a garden in Tungshih, Taichung, Taiwan. Infected plants showed symptoms of greenish water-soaked spots on leaves that became dark brown, 2 to 3 cm in diameter. Infected leaves withered and fell to the ground in 3 to 5 days and young shoots showed symptoms of withering and drooping. Infected roots showed symptoms of necrosis. Severely infected plants eventually died. A Phytophthora sp. was isolated consistently from diseased samples of Taiwan cherry and associated soil. Six isolates of Phytophthora, of the A1 mating type (1), were isolated from single zoospores. Two of these isolates, Tari 25141 (deposited as BCRC34932 in Bioresource Collection and Research Center, Shinchu, Taiwan) and Tari 25144 (BCRC34933), were used for pathogenicity tests on 1-year-old seedlings of Taiwan cherry to fulfill Koch's postulates. Inoculation was done by placing a cotton swab containing zoospore suspension on leaves or stem, or by soaking seedlings in the zoospore suspension. Inoculated seedlings were kept in a greenhouse at 20 to 25°C for 30 days and examined for appearance of symptoms. Results showed that both isolates were pathogenic on seedlings of Taiwan cherry, causing symptoms similar to those observed on naturally infected seedlings. The temperature range for growth of the six isolates of Phytophthora was 8 to 32°C with optimum temperature at 24°C. The linear growth rate was 72 mm per day on V8A culture (5% V8 vegetable juice, 0.02% CaCO3, and 2% Bacto agar) at 24°C. The colonies on potato dextrose agar produced sparse aerial mycelia with conspicuous radiate patterns. Sporangia were sparse on V8A agar blocks, but abundant when the agar blocks were placed in water under continuous white fluorescent light (average 2,000 lux) for 2 days. Sporangiophores branched sympodially. Sporangia were pear shaped, nonpapillate and nondeciduous, 50 to 75 (62) × 30 to 48 (40) μm, with a length/width ratio of 1.2 to 2.2 (1.6). New internal nested proliferate sporangia were formed inside the empty sac of old matured sporangia after releasing zoospores. No chlamydospores were formed on V8A. Hyphal swellings with distinctive irregular catenulation were produced on V8A and in water. The pathogen was stimulated to form its own oospores by the A2 tester using the method described by Ko (1). Oogonia were 28 to 50 (40) μm in diameter with smooth or irregularly protuberant walls. Oospores were mostly aplerotic and 18 to 42 (31) μm in diameter. Antheridia were amphigynous, mostly two-celled, and 10 to 42 (29) × 12 to 24 (19) μm. The sequence of the internal transcribed spacers (ITS) region of nuclear ribosomal DNA of isolate Tari 25141 (GenBank Accession No. GU111589) was 831 bp and had 99% sequence identity with a number of Phytophthora cambivora isolates such as GenBank Accession Nos. HM004220 (2), AY787030, and EF486692. Based on the morphological characteristics of sporangia and sexual structures and the molecular analysis of ITS sequences, the pathogen from Taiwan cherry was identified as P. cambivora (Petri) Buis. To our knowledge, this is the first report of P. cambivora on native Taiwan cherry in Taiwan and, so far, no other natural hosts have been reported. References: (1) W. H. Ko. J. Gen. Microbiol. 116:459, 1980. (2) P. W. Reeser et al. Mycologia 103:225, 2011.

Significant differences (p ? 0.05) were observed among the cherry tomato lines for the principal antioxidants, viz. total carotenoids, lycopene and vitamin-C. Vitamin-C content ranged from 17.62 - 46.16 mg/100 g, the total carotenoid content ranged from 3.86 - 6.66 mg/100 g and lycopene content ranged from 2.83 - 5.26 mg/100 g on fresh weight basis. The total phenolics, another important class of antioxidants, also differed significantly amongst the cherry tomato line (12.41-31.17 mg gallic acid equivalent/100 g). Significant variation (p ? 0.05) was also observed for pH and titrable acidity. The pH varied from 4.15 - 4.52 and anhydrous citric acid ranged from 0.050 up to 0.323%. The total soluble solids were 3.41 - 5.16%. The maximum vitamin-C content was recorded in VRCT-6 (46.16 mg/100 g) closely followed by VRCT-7 (45.51 mg/100 g) and VRCT-15 (44.71 mg/100 g), whereas maximum total carotenoid content were recorded in VRCT-16 (6.66 mg/100 g) followed by VRCT-7 (6.48 mg/100 g) and VRCT-1(6.36 mg/100 g), respectively. On the other hand, maximum lycopene content was estimated in VRCT-16 (5.26 mg/100 g) followed by VRCT-3 (5.23 mg/100 g) and VRCT-14 (4.73 mg/100 g). Maximum acidity and total water soluble solids were recorded in VRCT-9 (0.323%) and VRCT-7 (5.16%), respectively. DOI: http://dx.doi.org/10.3329/bjb.v43i3.21591 Bangladesh J. Bot. 43(3): 255-260, 2014 (December)

Cherry leaf spot disease caused by Alternaria spp. has been reported in China (1) but never in Greece. The fungus Alternaria alternata (Fr.:Fr.) Keissler (CBS 119115) was isolated on acidified potato dextrose agar (2.5 ml of 85% lactic acid per liter of nutrient medium) from the leaves of cherry cv. A1/5 (hybrid of Prunus avium (L.) L.) at the Pomology Institute Naoussa, Greece in 2005. Microscopic morphology showed acropetal chains of multicellular conidia (dictyoconidia) produced sympodially from simple, sometimes branched, short or elongate conidiophores. Conidia are obclavate, obpyriform, sometimes ovoid or ellipsoidal, often with a short conical or cylindrical beak, pale brown, smooth-walled or verrucose. The percentage of diseased leaves was approximately 30 to 40%. Lesions first appeared on leaves in late spring as small, round, blackish spots and gradually enlarged to 2 to 5 mm in diameter with a brownish purple border. Some spots turned grayish brown, but most underwent a secondary enlargement and become irregular and much darker, acquiring a frogeye appearance. Similar symptoms were also observed on the leaves of cherry hybrids A1/3 and A5 established in the same cherry orchard. Zhu and Chang (1) reported that infected leaves of cherry trees by Alternaria seraci showed holes and resulted in early leaf fall. Symptoms were reproduced in the laboratory by spraying 2-year-old plants (20 plants) at the stage of fullleaf development, planted in pots, of the same cherry hybrid with conidia of the fungus. Aqueous suspension was adjusted to 3 × 10-6 conidia per ml (approximately 100 ml per plant) collected from an isolation of the fungus. Control plants were sprayed with distilled water without conidia. Plants were then placed in a growth chamber at 25°C for 3 months. After the incubation period, some leaves of the inoculated plants developed similar to those previously observed. No disease symptoms were observed in control leaves. Koch's postulates were satisfied after reisolating the fungus. To our knowledge, this is the first report of the occurrence Alternaria leaf spot on cherry trees in Greece. Reference: (1) J. Zhu and Y. Chang. China Fruits 3:9, 2004.

Plum (Prunus domestica) and peach (P. persica) are widely grown, often in alternate rows with citrus, in the Mazandaran Province of Iran. In June 2011, a dry fruit rot of plum was observed in several production regions in Mazandaran Province (35°47′N, 50°34′E). Initial symptoms at pit-hardening stage appeared as dark brown, circular, necrotic spots from 2 to 5 cm in diameter. They later developed into a dry fruit rot. Severe symptoms occurred during June and July when warm weather (temperature around 28°C) and high relative humidity (RH) (>85%) were present. Marketable yield losses reached 50% to almost 100% in many orchards. To isolate the causal organism, symptomatic fruits were surface disinfested for 1 min in 0.5% active chlorine, washed thoroughly with sterile distilled water, and segments were plated on potato dextrose agar (PDA) amended with 50 mg/liter of streptomycin sulfate and incubated at 25°C for 3 days. The fungus Hyphodermella rosae (Bresadola) Nakasone was consistently isolated (37 isolates from 79 samples) and identified on the basis of morphological characteristics on PDA. Basidiomata were effuse, resupinate, 15 × 10 mm, crustaceous, tubercules small with apical bristles, and light orange to grayish orange. Subhymenium was up to 30 μm thick, composed of vertically arranged, short-celled, nonagglutinated hyphae; subhymenial hyphae were 3 to 4 μm in diameter. Basidiospores were ellipsoid, 7.5 to 8.5 × 4.5 to 5.5 μm (100 determination), and their cell walls were thin, hyaline, and smooth (1). Genomic DNA was extracted from mycelium with a DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer's directions and grown on potato dextrose broth for 4 days at 28°C. The rDNA region was amplified with the primers ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) and ITS5 (5′- GGAAGTAAAAGTCGTAACAA-3′) (4) and the PCR product was sequenced. Nucleotide BLAST analysis of the amplified 627-bp fragment confirmed a 99% similarity with the sequence of H. rosae (GenBank Accession No. JN593086). A pathogenicity test was conducted with isolate MA4099 by placing 5-day-old mycelial plugs grown on PDA at the surface of healthy fruit (n = 6) incubated under >85% RH at 25°C for at least 4 days until the appearance of symptoms, which were similar to those displayed under orchard conditions. Control fruits, inoculated with blocks of PDA plugs, remained intact and symptomless. Reisolation from inoculated fruit samples consistently yielded the inoculated fungus, completing Koch's postulates. The genus Hyphodermella has been reported to be causing wood rot on apricot (2) and sweet and sour cherry (3). To our knowledge, this is the first report of H. rosae causing dry fruit rot on a stone fruit species in the world. References: (1) K. K. Nakasone. Mycologie, 29:231, 2008. (2) J. M. Ogawa et al. Diseases of Apricot (Prunus armeniaca L.). The American Phytopathological Society, St. Paul, MN, 2003. (3) J. K. Uyemoto et al. Diseases of Sweet Cherry (Prunus avium L.) and Sour Cherry (P. cerasus L.). IS-MPMInet, http://www.ismpminet.org/resources/common/comment/cherry.asp , accessed June 2012. (4) T. J. White et al. Page: 315 in: PCR Protocols: A Guide to Methods and Application. M.A. Innis et al., eds. Academic Press, San Diego, CA, 1990.

Monilinia fructicola (G. Wint.) Honey is the most important causal agent of brown rot of stone fruits in North America. In July 2010, 20 sweet cherry fruit (Prunus avium) of unknown variety with symptoms resembling brown rot were collected from one commercial orchard in Maryland. Each cherry fruit came from a different tree. Symptoms included necrotic areas up to 10 mm in diameter with brown conidia and conidiophores developing from the infection center. Spores from nine symptomatic fruit collected each from different trees of a single orchard were suspended in sterile water, spread onto the surface of 1% agar plates, and incubated at 22°C. After 12 h, single, germinated spores were transferred onto 9-cm petri dishes with potato dextrose agar (PDA). Nine fungal colonies, each from a different fruit, were investigated in three replicates for cultural characteristics on separate petri dishes containing PDA. They were very similar in morphology and grew 12.4 mm per day on average at 22°C, forming branched, monilioid chains of grayish colonies with concentric rings and little sporulation. Rich sporulation was observed on tomato sauce medium (250 ml tomato sauce and 20 g agar in 750 ml water). The lemon-shaped spores had an average size of 15 × 10 μm, which is consistent with M. fructicola. Two colonies were randomly selected to identify the pathogen to the species level using a PCR technique based on cytochrome b sequence amplifications (2). Resulting gel electrophoresis patterns were consistent with M. fructicola. Koch's postulates were fulfilled by inoculating 15 mature sweet cherry fruits of cv. Bing with a conidial suspension (105 spores/ml) of one of the single-spore isolates from cherry. Fruit were stab-inoculated at a point to a depth of 2 mm using a sterile needle. A 10-μl droplet was placed on each wound; control fruit received sterile water without conidia. After 3 days of incubation at room temperature in airtight plastic bags, the inoculated fruit developed typical brown rot symptoms with lesions that were 20.6 mm in diameter. The developing spores on inoculated fruit were confirmed to be M. fructicola. All control fruit remained healthy. The entire detached fruit experiment was repeated 1 week later. M. fructicola is assumed to be the main causal agent of brown rot of sweet cherry in the northeastern United States, but recent studies show that M. laxa is also causing the disease on sweet cherry in many northeastern states (1). For this reason, it is important to delineate species for accurate disease assessments. This study confirms assumptions that M. fructicola is a causal agent of sweet cherry in Maryland. References: (1) K. D. Cox et al. Plant Dis. 12:1584. 2011. (2) J.-M. Hily et al. Pest Manag. Sci. 67:385, 2011.

Dagger nematode, Xiphinema rivesi Dalmaso, 1969 reportedly transmits several viruses in North America and Europe (2) leading to severe yield reduction in crops. Soil samples were collected in March 2013 during a survey of cherry orchards in Chelan County, WA; these historically suffer from cherry rasp leaf disease, caused by Cherry rasp leaf virus (CRLV) (genus Cheravirus). Soil samples were transported to the WSDA nematology laboratory in Prosser, WA, where 250-cc subsamples were processed using sucrose centrifugal flotation (1). Dagger nematodes were hand-picked and stored in 0.1% sodium chloride before being sent to the USDA-ARS Nematology Laboratory in Beltsville, MD, for morphological and molecular identification. The morphological and molecular analysis of adult females identified the dagger nematode species as Xiphinema rivesi Dalmaso, 1969 (4). Morphological characters used for identification included female body, and total stylet length (odontostyle and odontophore), location of guiding ring from oral aperture, head and tail shape, various tail measurements, and vulva percentage in relation to body length. Measurements of females (n = 10) include a mean body length of 1,902 ± 162.4 (1,832 to 2,203) μm, odontostyle 83 ± 3.5 (80 to 90) μm, odontophore 54.8 ± 4.2 (50 to 65) μm, total stylet 137.8 ± 4.2 (130 to 145) μm, guiding ring from oral aperture 70 ± 5.1 (60 to 75) μm, tail 30.8 ± 2.5 (27.5 to 35.0) μm, body diameter at anus 24.7 ± 1.7 (22 to 28) μm, J (hyaline portion of tail) 6.0 ± 0.9 (5.0 to 7.5) μm, body diameter at beginning of J 8.5 ± 1.0 (7.5 to 10.5) μm, body diameter at 5 μm from tail terminus 7.5 ± 0.2 (7.0 to 8.0) μm, and V% 52.2 ± 1.8 (49.4 to 55.0) μm. Molecular diagnosis of X. rivesi was confirmed after DNA was extracted from two individual nematodes by mechanical disruption with a micro knife in 20 μl worm lysis buffer containing 500 mM KCl, 100 mM Tris-Cl (pH8.3), 15 mM MgCl2, 10 mM dithiothreitol (DTT), 4.5% Tween 20, and 0.1% gelatin. DNA extracts were stored at –80°C until needed, then thawed, 1 μl proteinase K (from 2 mg/ml stock) was added, and the tubes were incubated at 60°C for 60 min, followed by 95°C for 15 min. The 28S large ribosomal D2-D3 expansion segment was amplified with D2A (5′-ACAAGTACCGTGAGGGAAAGTT-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′), and the internal transcribed spacer (ITS) region was amplified with primers TW81 (5′-GTTTCCGTAGGTGAACCTGC-3′) and AB28 (5′-ATATGCTTAAGTTCAGCGGGT-3′), as previously described (3). To verify the identity of the sequences generated from PCR, sequenced products were subjected to a database search using BLAST. Sequences from the 28S region were >99% identical to several sequences of X. rivesi sampled from Spain (GenBank Accessions JQ990038, JQ990039, HM921357, and HM921358). Sequences from the ITS region were 97 to 98% identical to X. rivesi sequences (FR878063 to FR878066) obtained from the host Vitis vinifera from Italy. To the best of our knowledge, this is the first report of this nematode from the Washington. The quick and persistent spread of CRLV in most of the orchards visited calls for concern and there is need for urgent control measures against this vector nematode. References: (1) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (2) S. Sirca et al. Plant Dis. 91:770, 2007. (3) Skantar et al. J. Nematol. 44:58, 2012. (4) M. R. Wojtowicz. et al. J. Nematol. 14:511, 1982.

During late spring of 2012 in Snohomish County of Washington State, chlorotic yellow leaf blotch symptoms suggestive of a virus infection were observed on Portuguese laurel (Prunus lusitanica) planted in a hedge row. Leaf samples from representative trees were initially tested for the presence of Cherry leaf roll virus (CLRV) and Plum pox virus (PPV) by ELISA with antibodies specific to CLRV and general potyvirus, respectively (Agdia, Inc., Elkhart, IN). The ELISA test yielded negative results for both viruses. Reverse transcription (RT)-PCR was pursued to detect other viruses known to infect Prunus spp., namely American plum line pattern virus (APLPV), Apple chlorotic leafspot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry raspleaf virus (CRLV), Cherry virus A (CVA), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV), as well as CLRV and PPV. None of these viruses were detected. However, RT-PCR with a generic primer pair Fovea2/AdPr (3) that amplifies the coat protein (CP) coding sequence and 3′-untranslated regions (3′-UTR) of several members of the family Betaflexiviridae yielded a 1.4-kb amplicon that was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. KF356396). The sequences from three clones were 99.8% identical to each other at the nucleotide level. Comparison of the consensus CP coding region with the nucleotide sequence database revealed 86 to 93% identity to Cherry rusty mottle associated virus (CRMaV), and only 73 to 75% identities to Cherry necrotic rusty mottle virus (CNRMV) (1) and 71 to 76% identities to Cherry green ring mottle virus (CGRMV) (4) isolates from sweet cherry (P. avium). This result suggested that the cloned fragment represents a strain of CRMaV. Prunus avium ‘Bing’ and ‘Sam,’ and P. serrulata ‘Kwanzan’ were grafted with bark patches from the symptomatic tree and observed for induction of cherry rusty mottle disease (CRMD) symptoms. Ninety days after grafting, symptoms typical of CRMD consisting of chlorotic yellow mottle appeared on ‘Bing,’ ‘Sam,’ and ‘Kwanzan’ indicators. Small necrotic spots also appeared on the leaves of the latter. Angular necrotic lesions on ‘Sam’ and epinasty of ‘Kwanzan’ that are diagnostic symptoms of cherry necrotic rusty mottle disease (CNRMD) and cherry green ring mottle disease (CGRMD), respectively, were absent from graft inoculated indicators. Further RT-PCR tests on the indicators using primers specific to CNRMV, CGRMV, and CRMaV (2) yielded negative results for CNRMV and CGRMV but showed positive amplification for CRMaV. The results of the woody indexing corroborate the presence of CRMaV but the absence of CNRMV and CGRMV in the symptomatic Portuguese laurel. To our knowledge, this is the first report of CRMaV in Portuguese laurel in the United States and the first description of symptoms associated with CRMaV in this host. As a potential reservoir of CRMaV, Portuguese laurel could play an important component in management of CRMD in cherry production areas where this ornamental cherry is also present. References: (1) M. E. Rott and W. Jelkmann. Arch. Virol. 146:395, 2001. (2) D. E. V. Villamor and K. C. Eastwell. Phytopathology 103:1287, 2012. (3) D. V. Villamor et al. Arch. Virol. 158:1805, 2013. (4) Y. P. Zhang et al. J. Gen. Virol. 79:2275, 1998.

In a classic paper of 1960, W. H. Cherry and J. I. Gittleman discussed various thermal and electrodynamic aspects of the superconductive transition process relevant to practical applications. In a section of the paper that has remained unnoticed, they proposed a physical model for the Meissner effect. Earlier in 1940–1943, in work that has also remained unnoticed, K. M. Koch had introduced related physical ideas to explain the Meissner effect. Still earlier in 1937, J. C. Slater proposed a model to explain the perfect diamagnetism of superconductors. None of these ideas are part of the conventional London-BCS understanding of superconductivity, yet I will argue that they are essential to understand the Meissner effect, the most fundamental property of superconductors. The unconventional theory of hole superconductivity unifies and extends these ideas. A key missing element in the conventional theory as well as in these early theories is electron-hole asymmetry. A proper understanding of the Meissner effect may help with practical applications of superconductors, as well as to find new superconducting materials with desirable properties.

The article looking at the effect of Montmorency tart cherry juice supplementation on 50 to 80 years old people with normal cognitive function concluded that supplementation may improve cognitive functioning.

From the spring of 2003 to the summer of 2006, sweet cherry (Prunus avium) trees in orchards near Lvshun City, in the northeast People's Republic of China, had symptoms suggestive of those caused by Cucumber mosaic virus (CMV; genus Cucumovirus, family Bromoviridae). Symptoms included chlorotic patches or mottling on leaves that were also deformed (4). In April 2006, 20 symptomatic leaves sampled from 10 trees in each of four orchards were assayed for CMV with a CMV-specific antiserum (Agdia Inc., Elkhart, IN) in a double-antibody sandwich-ELISA. Of the 80 symptomatic leaf samples, 27 tested positive for the presence of CMV. CMV was detected in all four orchards, within which incidence varied between 0.5 and 4%. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from symptomatic leaves. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 30 nm in diameter, which is also typical of CMV. Total RNA was also extracted from 100 mg of symptomatic tissue following a Trizol-based protocol (1). A reverse transcriptase-PCR assay with nucleocapsid gene-specific primers was then used (forward primer 5′-ATGGCGACGTCCTCGTTCA-3′; reverse primer 5′-CATCGTTCCCTTCAAAATAG-3′) (3). A PCR product of approximately 633 bp was obtained. The PCR product was cloned and sequenced. The sequence (GenBank Accession No. HM996559) had 95% identity with the RNA-1 sequence from CMV ‘Fny’ strain in GenBank (Accession No. D00356.1). The People's Republic of China is one of the major producers of sweet cherry in Asia and the spread of CMV in China may cause significant economic losses. Thus, virus-infected material should not be used for propagation and surveys should be undertaken to determine if the aphid vectors capable of transmitting CMV are present (2).To our knowledge, this is the first report of CMV occurring in sweet cherry orchards in the People's Republic of China. References: (1) P. Chomczynski and K. Mackey. Biotechniques 19:942, 1995. (2) F. E. Gildow et al. Phytopathology 98:1233, 2008. (3) T. M. Rizzo and P. Palukaitis. J. Gen. Virol. 70:1, 1989. (4) J. Shang et al. Z. Naturforsch. C 65:73, 2010.

During May and June of 2006, ‘Lapins’ sweet cherry (Prunus avium) trees were observed with white fungal growth on blossoms and young fruit in two commercial orchards in central Oregon (Wasco County). Entire blossom clusters and 30% of fruit clusters were affected. Rot on the fruit was firm, light brown, and covered the entire fruit, extending halfway down the pedicel. Affected blossoms were light brown and stuck to adjacent fruit and blossoms. Six disease samples from fruit, four samples from pedicels, and four samples from blossoms were surface sterilized and plated on potato dextrose agar acidified with lactic acid ([APDA] 1.5%). A white fungus producing sclerotia measuring 4 to 8 mm in diameter was recovered from all the samples after 10 days on APDA at 25°C. Koch's postulates were satisfied by inoculating green, pea-sized ‘Lapins’ cherry fruit with mycelial plugs colonized by the white fungus. Symptoms and signs similar to those seen in the orchard were produced. The same sclerotium-producing fungus was recovered from all inoculated fruit. The pathogen was identified as Sclerotinia sclerotiorum (Lib.) de Bary on the basis of the size of sclerotia and nested PCR using fungal universal primer pair ITS4/ITS5 and S. sclerotiorum-specific primer pair SSFWD/SSREV (2). A negative control, devoid of DNA templates in the reaction mix, was included in the PCR assay. S. sclerotiorum is endemic on wheat in Wasco County. The affected orchards were surrounded by wheat fields in which snow mold disease that is caused by S. sclerotiorum was particularly serious in the spring of 2006 compared with previous years. Rot on cherries was first observed and very severe in May of 2005, with symptoms and signs mainly on leaves of all trees across 45 ha. New symptoms continued to appear on cherry until mid-June. During 2006, most symptoms and signs were on fruit with some leaf spotting. Both years had unusually wet springs with 12.2 cm of rainfall received from April to June 2005 and 12.4 cm from April to June 2006, which is well above the 6.81 cm average for the previous 5 years. S. sclerotiorum causes green fruit rot of stone fruits, including almond, apricot (3), nectarine, and peach (1). To our knowledge, this is the first report of S. sclerotiorum causing blossom blight and green fruit rot on sweet cherry in Oregon. References: (1) K. M. Flint. Green fruit rot. Page 15 in: Compendium of Stone Fruit Diseases. The American Phytopathological Society. St. Paul, MN, 1995. (2) J. Freeman et al. Eur. J. Plant Pathol. 108:877, 2002. (3) R. E. Smith. Phytopathology 31:407, 1931.

California is the second largest sweet cherry producer in the United States with approximately 10,800 ha and an average annual crop value of approximately $150 million. Perennial canker diseases constitute major threats to the cherry industry productivity by reducing tree health, longevity, and yields. During the course of summer 2006, we observed severe limb and branch dieback of sweet cherry (Prunus avium L.) in San Joaquin, San Benito, Contra Costa, and Stanislaus counties of California. Isolation from diseased branches repeatedly yielded the fungus Calosphaeria pulchella (Pers.: Fr.) J. Schröt. (1,2). Cankers and vascular necroses had developed in tree limbs and branches, generally initiating from the heart wood and later spreading into the sapwood. External symptoms of disease may be unapparent throughout the early stages of infection, particularly in large diameter shoots. Older infections often appeared as wilted leaves. Branches and trunks affected with cankers from which C. pulchella was isolated also generally bore perithecia of C. pulchella beneath the periderm. Perithecia were nonstromatic and arranged in dense, circinate groups, with elongated necks converging radially and fissuring the periderm. Asci were unitunicate, clavate, and 45 to 55 × 5 to 5.5 μm. Ascospores were allantoid to suballantoid, hyaline, and 5 to 6 × 1 μm. Colonies on potato dextrose agar (PDA) were dark pink to red in their center with a white margin. Conidia were hyaline, allantoid to oblong-ellipsoidal, and (3–) 4 to 6 (–9) × 1.5 to 2 (–2.5) μm. Identification of C. pulchella isolates also was confirmed by sequence comparison in GenBank database using the internal transcribed spacer region (ITS1-5.8S-ITS2) of the rDNA. Sequences of California isolates shared 100% similarity with C. pulchella reference isolate CBS 115999 (EU367451) (2). ITS sequences of the California isolates used in this study were deposited into GenBank (Nos. HM237297 to HM237300). Pathogenicity of four isolates recovered from the margin of active cankers was determined by branch inoculations. In December 2006, 2- to 4-year-old twigs of P. avium cv. Bing were inoculated with a 5-mm cork borer to remove bark and by placing an agar plug from the growing margin of 8-day-old colonies directly into the fresh wound, mycelium side down. Ten branches per isolate were inoculated. Ten control shoots were inoculated with noncolonized agar plugs. Inoculations were covered with vaseline and wrapped with Parafilm to retain moisture. Branches were harvested in July 2007 and taken to the laboratory to be examined for canker development, and the extent of vascular discoloration in each branch was assessed. Isolations from the edge of discolored tissue were conducted to fulfill Koch's postulates. After 8 months, C. pulchella was reisolated from 100% of the inoculated branches. Length of vascular discoloration averaged 62.5 mm in branches inoculated with the four C. pulchella isolates and 16.5 mm in the control twigs. No fungi were reisolated from the slightly discolored tissue of the controls. To our knowledge, this study constitutes the first report of C. pulchella as a pathogen of sweet cherry trees in California. References: (1) M. E. Barr. Mycologia 77:549, 1985. (2) U. Damm et al. Persoonia 20:39, 2008.

The objective of this study was to assess the biological activity of essential oils (EOs) of four Juniperus species obtained via two different distillation methods and their potential as biopesticides. The studied factors were juniper species (Juniperus communis L., J. oxycedrus L., J. pygmaea C. Koch., and J. sibirica Burgsd), plant sex (male (M) and female (F)), and distillation method (hydrodistillation via a standard Clevenger apparatus (ClevA) and semi-commercial (SCom) steam distillation). The hypothesis was that the EO will have differential antioxidant, antimicrobial, and insecticidal activities as a function of plant species, plant sex, and distillation method. The two distillation methods resulted in similar EO composition within a given species. However, there were differences in the EO content (yield) due to the sex of the plant, and also differences in the proportions of some EO components. The concentration of α-pinene, β-caryophyllene, δ-cadinene and δ-cadinol was dissimilar between the EO of M and F plants within all four species. Additionally, M and F plants of J. pygmaea, and J. sibirica had significantly different concentrations of sabinene within the respective species. The EOs obtained via ClevA extraction showed higher antioxidant capacity within a species compared with those from SCom extraction. All of the tested EOs had significant repellent and insecticidal activity against the two aphid species Rhopalosiphum padi (bird cherry-oat aphid) and Sitobion avenae (English grain aphid) at concentrations of the EO in the solution of 1%, 2.5%, and 5%. The tested EOs demonstrated moderate activity against selected pathogens Fusarium spp., Botrytis cinerea, Colletotrichum spp., Rhizoctonia solani and Cylindrocarpon pauciseptatum. The results demonstrate that the standard ClevA would provide comparable EO content and composition in comparison with SCom steam distillation; however, even slight differences in the EO composition may translate into differential bioactivity.

A virus, designated JCM-79, was isolated from wild potato (Solanum acaule Bitt.) plants grown from true seed received at USDA-APHIS Potato Quarantine Program from Peru. JCM-79 was mechanically transmissible to Nicotiana clevelandii and N. tabacum cv. Samsun NN. Symptoms in the original S. acaule were general chlorosis and spreading necrotic lesions. Symptoms in N. tabacum and N. clevelandii included necrotic ringspots on inoculated leaves and oak-leaf patterns or necrotic spots, respectively, on upper leaves. Cultivated potatoes (S. tuberosum) infected with JCM-79 by grafting from N. clevelandii were symptomless but virus was detected by back-inoculation to N. clevelandii. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from N. clevelandii and N. tabacum. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 25 nm in diameter. Two RNA species of approximately 8,000 and 6,500 nucleotides were obtained from nucleoproteins digested with sodium dodecyl sulfate and Proteinase K. The above characteristics suggested JCM-79 was a nepovirus or nepovirus-like in nature. Reverse transcription (RT)-PCR tests for Cherry rasp leaf virus, genus Cheravirus, which was reported from potato (3), were negative. An approximately 1,600-bp cDNA clone was obtained from RNA of JCM-79 by oligo dT primed reverse transcription and second strand cDNA synthesis. Sequence analysis (GenBank No. GU321989) revealed the closest homology (82%) to nucleotides 327 to 1801 of Accession No. S84125 Cherry leaf roll virus (CLRV), genus Nepovirus. Subsequent RT-PCR tests with CLRV-specific primers (4) resulted in amplification of a 417-bp product from nucleic acid extracts of infected N. clevelandii and N. tabacum. The amplified product from N. clevelandii was cloned and three clones were sequenced in both directions. The consensus sequence (GenBank No. GU321988) showed approximately 90% homology to the 3′ untranslated region of isolates of CLRV including those from birch, walnut, and sweet cherry (GenBank Nos. S84124, Z34265, and AJ877128, respectively). JCM-79 was also detected in extracts of infected plants by ELISA using CLRV-cherry reagents (Bioreba AG, Reinach, Switzerland). These results indicate JCM-79 represents a new variant of CLRV. To our knowledge, this is the first report of CLRV naturally infecting S. acaule. S. acaule is common in the Andean regions of South America and has been used for crosses with S. tuberosum because of its pathogen resistance (1). The fact that JCM-79 is seed transmitted in S. acaule suggests that this virus could be a threat to potato-breeding programs. Another nepo-like virus with properties similar to JCM-79, designated Potato virus U (PVU), was reported from South America, but PVU was not serologically related to CLRV (2). References: (1) K. Hosaka and D. M. Spooner. Theor. Appl. Genet. 84:851, 1992. (2) R. A. C. Jones et al. Phytopathology 73:195, 1983. (3) J. R. Thompson et al. Arch. Virol. 149:2141, 2004. (4) B. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

In the eastern United States, Monilinia laxa (Aderh. & Ruhl.) Honey has only been reported on tart cherry in New York (NY) (1). As a result of considerable rain in May of 2009 and 2011, an ornamental planting of Kwanzan cherries in Middletown, Rhode Island (RI), a planting of sweet cherry cvs. Ulster, Hedelfingen, Sam, and Lapins in Lanesboro, Massachusetts (MA), and plantings of apricot cvs. Harcot and Hargrande in Albion, Aurora, and Geneva, NY, and Harogem in Lanesboro, MA developed severe shoot blight (>15 to 100% of first-year shoots). Blighted shoots were wilted with the blight encompassing the distal end and often extending into second-year tissue with a distinct sunken margin. Leaves on symptomatic shoots had flushed, but were blighted and light brown. Blossom spurs were often blighted and gummosis was frequently observed at the base. In these same years, sweet cherry cv. Black Gold in Walworth, NY and plum cv. Stanley in Olcott, NY developed severe fruit rot (35 to 70% incidence). Plantings suffering from fruit rot had fruit lesions that began as pale brown, soft lesions with indiscriminant margins that covered 15 to 85% of the fruit surface area. Many blighted spurs, shoot tissues, and infected fruit were sporulating with tan-to-buff colored conidia produced in chains. From each planting with shoot blight, shoot tips were removed for pathogen isolation. Sections of symptomatic shoots (5 cm long) were surface sterilized in 0.6% NaOCl for 1 min and rinsed in sterile dH20. From plantings displaying blighted spurs or fruit rot, isolation was attempted directly from sporulating tissue. Cross sections of sterilized shoot tissue (3 mm thick) or tufts of sporulation from fruit and spurs were placed on potato dextrose agar amended with 50 μg/ml of streptomycin sulfate. After incubation at 24°C for 5 days, colonies with lobed margins, commonly described for M. laxa (4), were obtained. Several colonies resembling M. fructicola were isolated from all locations, but the majority of isolates from spurs and shoots resembled M. laxa. Conidia from both colony morphotypes were lemon shaped, but as expected, those from putative M. laxa isolates were smaller (10.75 × 12.0 μm) compared with those from putative M. fructicola isolates (15.75 × 18.25 μm) (4). Confirmation of M. laxa was further achieved by PCR amplification of the β-tubulin gene using M. laxa-specific primers as previously described (3). Pathogenicity of M. laxa isolates was proven by inoculating fruit of the stone fruit crop from which they were isolated as previously described (2). Fruit inoculated with M. laxa developed brown, soft sporulating lesions identical to the original observations, while those inoculated with water remained healthy. M. laxa was reisolated from symptomatic shoots and spurs, but not from water-inoculated tissues. The presence of M. laxa has been reported on tart cherries in NY (1), but to our knowledge, this is the first instance of economically devastating shoot blight on apricot in NY and MA, ornamental cherry in RI, and sweet cherry in MA and fruit rot on sweet cherry and plum in NY caused by M. laxa. In wet seasons, stone fruit growers may need to revise their chemical management programs to better prepare for M. laxa epidemics on several stone fruit species. References: (1) K. D. Cox and S. M. Villani. Plant Dis. 94:783, 2010. (2) K. D. Cox and S. M. Villani. Plant Dis. 95:828, 2011. (3) Z. Ma et al. Pest Manag. Sci. 61:449, 2005. J.M. (4) G. C. M. van Leeuwen and H. A. van Kesteren. Can. J. Bot. 76:2042, 1998.

ABSTRACT Aim The purpose of this study was to evaluate the color stability of resin composit using different finishing systems and drinks. Materials and methods Composit disks (5 mm diameter, 2 mm thickness) were prepared for each nanofilled composite using a brass mold. The specimens were divided into 5 finishing system groups Mylar strip (Mylar, DuPont, Wilmington, Del., USA), Soft Lex (3M™ ESPE™ St. Paul, MN, USA), Enhance (Dentsply-DeTrey GmbHD Konstanz, Germany), Hiluster (KerrHawe, Bioggio, Switzerland), Opti Disc (KerrHawe, Bioggio, Switzerland) and each group was divided into 10 subgroups (n = 10) and stored for 24 hours at 37°C in different drinks water coffee, coffee with sugar, tea, tea with sugar, diet coke, coke, light sour cherry juice or sour cherry juice. Color of all specimens was measured before and after exposure with a spectrophotometer using CIE L*a*b* relative, and color changes (ΔE*) were then calculated. The data were analyzed with a twoway analysis of variance (ANOVA), and mean values were compared by the Tukey HSD test (p = 0.05). Results For the drinks, the lowest ΔE* values were observed in the water and highest ΔE* values were observed in sour cherry juice. When drinks with and without sugar were compared, all groups with sugar demonstrated a higher color difference than without sugar. For the different finishing systems, Mylar strip group demonstrated signicantly highest color change; Enhance groups demonstrated signicantly lowest color change. Conclusion Finishing treatments and storage solutions significantly affect the color stability of resin composite. The presence of sugar in drinks increased the color difference compared to drinks without composit. Clinical significance Polishing techniques and drinking drinks with sugar may affect the color of esthetic restorations. How to cite this article Berber A, Cakir FY, Baseren M, Gurgan S. Effect of Different Polishing Systems and Drinks on the Color Stability of Resin Composite. J Contemp Dent Pract 2013; 14(4):662-667.

In 2007, a new bacterial disease was observed in greenhouse-cultivated cherry tomatoes in Cheorwon and Iksan provinces, Korea. The disease caused severe wilt of tomatoes (Solanum lycopersicum cv. Koko). Infected young petioles were curled downward. Margins of the leaves rolled upward and whole leaves were distorted. Stem cankers had reddish or dark brown cavities. Vascular tissues in stems cut longitudinally were brown to deep brown, but no bird's eye lesions were observed. Eight bacterial strains recovered from the stems of wilted tomatoes produced yellow colonies on nutrient broth-yeast extract agar and pink colonies on triphenyl tetrazolium chloride. Pathogenicity of the strains (three plants per strain) on 18-day-old tomatoes (cv. Koko) was confirmed by clip inoculation of petioles of second leaves and spray inoculation with bacterial suspensions (1 × 108 CFU/ml) in sterile distilled water. Wilt and canker symptoms were observed 2 weeks after inoculation. Symptoms produced by both inoculation methods were systemic and localized. Clip inoculation of tomatoes resulted in wilt, defoliation, and open stem cankers, whereas small, white spots (2 to 3 mm in diameter) and sometimes water-soaked, dark brown-to-black lesions on the leaf margins were observed with spray inoculation. Bacteria were reisolated from stems and leaves of the inoculated plants and their identities confirmed by direct PCR using specific primer set CMM5/CMM6 (1). No symptoms were observed on negative control plants inoculated with sterile water. All strains were gram-positive aerobic rods with no polar flagella. Strains were positive for esculin hydrolysis, gelatin liquefaction, H2S production from peptone, utilization of citrate and succinate, and acid from d(+)mannose and negative for starch hydrolysis, casein hydrolysis, methyl red reaction, acid from inulin, mannitol, d(+)-melezitose and d(–)sobitol, and utilization of acetate, formate, lactate, propionate, and ribose. Identification as C. michiganensis subsp. michiganensis was confirmed using 16S rDNA universal primers fD1 and rP2 (4) and internal primers (3). The 1,439-bp PCR fragment of strain BC2643 was sequenced (GenBank Accession No. EU685335) and compared with reference C. michiganensis subspecies strains in GenBank: AM410696 (C. michiganensis subsp. michiganensis), AM410693 (C. michiganensis subsp. tessellarius), AM410697 (C. michiganensis subsp. nebraskensis), AM410694 (C. michiganensis subsp. sepedonicus), and AM410695 (C. michiganensis subsp. insidiosus). The sequence had a similarity index of 0.999 calculated by Juke-Cantor model (2) with the 16S rRNA sequence of C. michiganensis subsp. michiganensis (AM410696). The fragment size of eight strains amplified by PCR using CMM5/CMM6 (1) was identical to that of the C. michiganensis subsp. michiganensis reference strain KACC20122. On the basis of the physiological, genetic, and pathological characteristics, all strains were identified as C. michiganensis subsp. michiganenesis. To our knowledge, this is the first report of C. michiganensis subsp. michiganenesis causing bacterial canker on tomato in Korea. References: (1) J. A. Dreier et al. Phytopathology 85:464, 1995. (2) S. Kumar et al. Brief. Bioinform. 5:50, 2004. (3) S. W. Kwon et al. Int. J. Syst. Bacteriol. 47:1061, 1997. (4) W. G. Weinsburg et al. J. Bacteriol. 173, 697, 1991.

Cornelian cherries (Cornus mas), also called cornels, are members of the dogwood family (Cornaceae), and are not true cherries. Cornelian cherry is primarily grown as an edible landscape ornamental in the United States. Brown rot, caused by fungi in the genus Monilinia, is one of the most important diseases of stone fruit worldwide. In the United States, M. fructicola is the most commonly observed Monilina species, although M. fructigena and the European brown rot pathogen, M. laxa, may also infect stone fruit. M. fructigena is the only Monilinia species reported to infect cornelian cherry, but there is only a single report of it occurring in the United States (1,4). All three species have similar morphology and are commonly misidentified (1,3,4). In August of 2010 and 2013, in one location, brown rot was observed on fruit of the cornelian cherry cultivar Elegans. In both instances, only ‘Elegans’ fruit was infected while neighboring ‘Sunrise’ exhibited no symptoms in the field, and lesions did not appear to develop into shoot blight. In 2013, single-spore isolates from the diseased fruit were cultured on potato dextrose agar (PDA) incubated at 25°C for 5 days. Colony morphology was consistent with M. fructicola and was rapidly growing, gray, producing concentric rings, and developing smooth colony margins. Conidia were hyaline, 10 × 15 μm, and formed in branched, monilioid chains of varying lengths (1). Molecular-based species identification was performed on the 450-bp amplified ribosomal internal transcribed spacer (ITS) sequences, using primers ITS1 and ITS4. BLAST searches of the ITS sequences in GenBank showed the highest similarity (100%) with sequences of M. fructicola isolates from Italy (FJ411110), China (FJ515894), and Spain (EF207423). Pathogenicity was confirmed by inoculating surface-sterilized, mature ‘Sunrise’ fruit with mycelial plugs of the isolate identified with the ITS sequence. Mycelial plugs (3 mm in diameter) were removed from the periphery of a 5-day-old colony and placed upside down into five fruit that were wound-inoculated with a 3-mm cork borer, petiole hole-end inoculated, or unwounded but inoculated; control fruit for each treatment received sterile plugs of PDA as a control. All fruit was stored in a moist chamber for the duration of the experiment. Wound-inoculated fruit developed symptoms within 2 days; sporulating lesions developed within 5 days. Symptoms of infection via the petiole developed in 4 days; by day six, three of the five inoculated fruit were infected, and four of the five were infected by day eight. Unwounded, inoculated fruit showed symptoms on day six; three of the five fruit were infected by day eight. None of the control inoculations showed Monilinia infection. Pathogens were re-isolated from the inoculated fruit and confirmed to be M. fructicola on the basis of morphological characteristics. To our knowledge, this is the first fulfillment of Koch's postulates demonstrating that M. fructicola can infect cornelian cherry. A previous report by Höhnel in 1918 described infection by Lambertella corni-mas of a cornelian cherry in Austria; however, the taxonomic details presented are consistent with M. fructigena (2). References: (1) M.-J. Côté et al. Plant Dis. 88:1219, 2004. (2) T. H. Harrison and A. F. El-Helaly. Brit. Mycol. Soc. Trans. 19:199, 1935. (3) C. R. Lane. EPPO Bulletin 32:489, 2002. (4) E. M. Sagasta. EPPO Bulletin 7:105, 1977.

In June 2010, 1-year-old potted plants of cherry laurel (Prunus laurocerasus L.) cv. Novita showing leaf spot symptoms were collected in a commercial nursery in the district of Pistoia (Tuscany, central Italy). Red-purple necrotic lesions (measuring a few millimeters up to 1 cm) surrounded by a brilliant light green halo were observed on the abaxial surface of symptomatic leaves. With age, the necrotic areas drop out, leaving a “shot-hole” appearance. Microscopic observation revealed the absence of fungal structures, whereas bacteria were isolated from symptomatic tissue on nutrient sucrose agar medium. Purified single colonies appeared mucoid, convex, and yellow on yeast extract-dextrose-CaCO3 agar (YDCA) medium, were positive to the KOH test, and induced hypersensitive responses on tobacco (cv. Virginia Bright). Three isolates were selected arbitrarily for further analysis. A fragment of approximately 500 bp of the 16S rRNA gene was amplified via PCR with the universal primer pair 27f/519r and sequenced. Subsequent database searches in the INSD (GenBank, EMBL, and DDBJ) indicated that the resulting sequences had 100% identity over 490 bp with the corresponding gene of a Xanthomonas sp. The isolates were further identified as Xanthomonas arboricola pv. pruni on the basis of quinate metabolism and starch hydrolysis tests and by sequencing the PCR products obtained with the gyrB (4) and X. arboricola pv. pruni-specific (3) primer sets. Pathogenicity tests were conducted on cvs. Novita and Caucasica following the detached leaf bioassay procedure (1) and by injecting with a hypodermic needle a bacterial suspension (1 × 107 CFU/ml) in the leaf mesophyll of 1-year-old potted plants (three plants per cultivar and three leaves per isolate on each plant). Incubation was carried out at 25°C under fluorescent lights with a 16-h photoperiod. After seven (detached leaves) and four (potted plants) days, all leaves inoculated with X. arboricola pv. pruni isolates showed brown necrotic spots delimited by a chlorotic margin. Reisolated bacteria on YDCA showed the same colony morphology as described above and tested positive to the X. arboricola pv. pruni-specific primer set, confirming the causal agent of the disease. Leaf tissue inoculated with sterile distilled water remained symptomless. Bacterial leaf spot on cherry laurel was reported in Lombardy (northern Italy) by the local plant protection service in 2005 but without a confirmatory diagnosis of the causal agent (2). To our knowledge, this is the first confirmed report on the occurrence of X. arboricola pv. pruni on cherry laurel in Italy. The pathogen could have a significant impact on the commercial cherry laurel production in the district of Pistoia, which is the most important area for ornamental plants nurseries (4,536 ha of cultivated surface in 2005) in Italy. X. arboricola pv. pruni is included in the EPPO A2 list of pests recommended for regulation to the member countries. References: (1) Anonymous. EPPO Bull. 36:129, 2006. (2) EPPO Reporting Service. Online publication. Retrieved from archives.eppo.org/EPPOReporting/2006/Rse-0606.pdf , 2006. (3) M. C. Pagani. Ph.D. diss. North Carolina State University. Online publication. http://repository.lib.ncsu.edu/ir/bitstream/1840.16/4540/1/etd.pdf , 2004. (4) N. Parkinson et al. Int. J. Syst. Evol. Microbiol. 59:264, 2009.

Cherry is a main fruit tree species in Shandong Peninsula, which is one of the most important cherry-production areas of China. A stem canker disease was first noted in a 15-year-old cherry orchard in Yantai, Shandong Peninsula in May 2009. Canker and branch dieback were the main symptoms of the disease and cracks often appeared at the margins of sunken cankers, which exposed the wooden stem. In later stages from April to May, black pycnidia were observed on the surface of cankered bark and cirri containing α-conidia were extruded under wet conditions. Wooden tissue under the diseased bark was dark brown, in contrast to the healthy tissue that was yellowish green. On the basis of morphological characteristics, the pathogen was putatively identified as Phomopsis perniciosa (1). Pycnidia were smaller in naturally infected branches than when produced on potato dextrose agar (PDA) medium (180 to 365 × 65 to 226 μm). Cultures of the pathogen appeared creamy white with concentric rings on PDA at 25°C and a mass of α-conidia (5.75 to 11.13 × 2.08 to 3.46 μm) and β-conidia (31.24 to 34.68 × 1.45 to 1.82 μm) were produced within 3 weeks. Alpha-conidia were hyaline, fusiform-elliptic to oblong-elliptic, and biguttulate. Beta-conidia were hyaline and unicellular, filiformia, leviter arcuata vel hamata. Total DNA was extracted from three monoconidial isolates collected from different infected trees. The internal transcribed spacer (ITS) region was amplified using the universal primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-CCTCCGCTTATTGATATGC-3′). The ITS amplicons were sequenced (582 bp) from three isolates and no nucleotide variation was observed. BLAST analysis of the obtained ITS sequences showed that isolate 230101 had 99% homology with a Phomopsis sp. (GenBank Accession No. AB302248) isolated from fruit trees in Japan. The nucleotide sequence from isolate 230101 has been deposited in GenBank (Accession No. JF812647). Pathogenicity of the isolate was confirmed by inoculating branches of 3-year-old cherry trees with either conidia or hyphae. Inoculations were performed by making an incision with a sterile scalpel at the dissected area to expose the tissue under the bark. An agar plug (4 × 4 mm) containing 5-day-old cultured hyphae or 50 μl of a conidium suspension containing 106 α-conidia per ml was placed on each of the inoculation sites, wrapped with moist cheesecloth, and sealed with Parafilm. Control trees were treated similarly with sterile blocks of PDA or water, respectively. For each inoculation technique, five shoots were inoculated and the inoculation treatments were replicated three times. All inoculated and control trees were kept in a greenhouse and watered as needed. After 10 days, cankers and necrotic lesions developed on all shoots inoculated with P. perniciosa and the control trees did not display any symptoms. The same pathogen was reisolated from symptomatic branches. Phomopsis spp. are known to cause cankers and dieback of several woody hosts (2), but no reports have been found that the pathogen causes cherry canker and dieback in China. References: (1) P. K. Chi et al. Flora Fungorum Sinicorum-Phomopsis 34:127, 2007. (2) D. P. Weingartner and E. J. Klos. Phytopathology 65:105, 1975.

Monilinia fructicola (G. Wint.) Honey and M. laxa (Aderh. & Ruhl.) Honey are two pathogens causing brown rot in the United States. While the presence of M. fructicola has been confirmed in all major stone-fruit-production regions in the United States, M. laxa has yet to be detected in much of the eastern production regions. In July 2008, a planting of tart cherries cv. Surefire in Appleton, NY developed severe shoot blight. Blighted shoots (>15% of first-year shoots) were wilted and light brown with the blight encompassing the distal end and often extending into second-year tissue with a distinct sunken margin. Leaves on symptomatic shoots had flushed, but were blighted. Blossom spurs were either blighted at bloom or bore fruit, which were subsequently blighted. Gummosis was commonly observed from cankers at the base of spurs. Both mature and immature mummified fruit in addition to spurs and shoot tissue were sporulating in a manner characteristic of Monilinia (2). Eleven branches displaying symptoms were removed for isolation. Sections of symptomatic shoots (5 cm long) were surface sterilized in 0.6% NaOCl for 1 min and rinsed in sterile dH2O. Cross sections of shoot tissue (3 mm thick), in addition to spores from fruit and spurs, were placed on potato dextrose agar amended with 50 μg/ml of streptomycin sulfate. Following incubation at 24°C for 5 days, 24 colonies exhibiting morphology consistent with that of M. fructicola (uniform colony margin) were obtained, along with nine colonies exhibiting lobed colony margins, commonly associated with M. laxa (3). All colonies resembling M. fructicola were isolated from fruit, whereas those resembling M. laxa were isolated from spurs and shoots. Conidia from both colony morphotypes were lemon-shaped, but those from putative M. laxa isolates were smaller on average (10.75 × 12.0 μm) compared with those from putative M. fructicola isolates (15.75 × 18.25 μm). Confirmation of M. laxa was also accomplished by inoculation of mature green pear (2). Pears inoculated with 104 putative M. laxa conidia per ml produced a region of white-buff colored mycelium but no spores within the inoculated area, while M. fructicola-inoculated pears sporulated abundantly. Identity was further confirmed by PCR amplification of the β-tubulin gene using M. laxa specific primers as previously described (1). Pathogenicity was proven by inoculating flowering shoots of tart cherry trees (cv. Montmorency) in spring 2009. Twenty shoots were spray inoculated with either 104 M. laxa conidia per ml or sterile dH2O and covered with plastic bags for 24 h. Shoots were monitored for symptom development on a weekly basis. Shoots inoculated with M. laxa developed characteristic shoot blight symptoms, while those inoculated with water remained healthy. M. laxa was reisolated from symptomatic shoots and spurs, but not water-inoculated tissues. The presence of M. laxa is reported for the Great Lakes region, which includes New York, but to our knowledge, this report is the first confirmed instance of economically devastating brown rot caused by M. laxa in New York. In the coming seasons, tart cherry growers must consider revising chemical management programs to protect against European brown rot infection during bloom. References: (1) Z. Ma et al. Pest Manag. Sci. 61:449, 2005. (2) J. M. Ogawa et al. Compendium of Stone Fruit Diseases. The American Phytopathological Society. St. Paul, MN, 1995. (3) G. C. M. van Leeuwen and H. A. van Kesteren. Can. J. Bot. 76:2042, 1998.

The sanitary status of peach fruit trees was assessed in central and coastal regions of Montenegro during a survey in September and October of 2011 and 2012. Leaf samples were collected from 58 (2011) and 47 (2012) trees showing chlorotic rings and spots, mosaic, necrosis, leaf distortion, and stunting. Total RNAs was extracted from each sample by RNeasy Plant Mini kit (Qiagen, Germany) and used as a template in PDO (polyvalent degenerate oligonucleotides) nested reverse transcription (RT)-PCR for the detection of fruit tree viruses belonging to the genera Trichovirus, Capillovirus, and Foveavirus (family Betaflexiviridae). PDO primer sets PDO-F1i/PDO-R3i/PDO-R4i and PDO-F2i/PDO-R1i (2) were used in the first RT-PCR and nested PCR, respectively. Total RNAs obtained from Italian Apple chlorotic leaf spot virus (ACLSV)-infected isolate and healthy peach leaves were used as positive and negative controls, respectively. A nested set of primers amplified a 362-bp product from 6 samples collected in 2011 (10.3%) and 13 samples collected in 2012 (27.7%). Sequence analysis included three isolates (367/11, 133/12, and 168/12) chosen from different peach cultivars (Ritastar, Spring Belle, and Redhaven, respectively). Amplified products of expected size of the partial RNA-dependent RNA polymerase from three positive samples were cloned into p-GEM-T Easy Vector (Promega, Madison, WI) and sequenced (MWG-Biotech AG, Germany). Sequences were deposited in GenBank under accession nos. KF534757, KF534769, and KF534766, respectively. BLAST analysis showed that the sequence of isolate 367/11 (KF534757) shared high nucleotide similarity (78.9 to 87.2%) with ACLSV isolates from GenBank, showing highest identity with isolate PBM1 (AJ243438) from Germany. Sequence analysis of isolate 133/12 (KF534769) proved that it is 90.5 to 93.3% identical to Cherry green ring mottle virus (CGRMV) isolates reported from other parts of the world. In particular, the highest nucleotide similarity was showed with isolate P1C124 (AJ291761) from France. Finally, analysis of sequence from the isolate 168/12 (KF534766) revealed high degree of identity (86.1 to 96.1%) with the corresponding nucleotide sequences of the Cherry necrotic rusty mottle virus (CNRMV) isolates, showing highest similarity with isolate 120/86 (AF237816) from Switzerland. To confirm virus infectivity, according to the FAO/IPGRI Technical Guidelines (1), budwood from 367/11, 133/12, and 168/12 samples were grafted into seedlings of peach (GF305), Prunus serrulata (cv. Shirofugen) and P. avium (cv. Sam) then maintained in a greenhouse with controlled conditions. Six months post inoculation, GF305 indexed with 367/11 sample reacts with a green depressed mottle on leaves typical of ACLSV infection. Cherry tree of cv. Shirofugen indexed with sample 133/12 showed symptoms attributable to CGRMV such as epinasty, twisting and curling of leaves while a tree of cv. Sam indexed with 168/12 sample exhibited classical necrotic shot holes in leaves induced by CNRMV infection (1). Sequence analysis of PCR products obtained from indicator plants by RT-PCR as described above showed full nucleotide identity with KF534757, KF534769, and KF534766 sequences and confirmed the presence of previous described viral agents. To our knowledge, this is the first report of ACLSV, CGRMV, and CNRMV occurrence on peach in Montenegro. Due to the economic importance of this crop, sanitation measures should be adopted to improve the control of imported plants and the use of virus-tested propagation material in order to prevent spreading of these viruses. References: (1) M. Diekmann and C. A. J. Putter. FAO/IPGRI Technical Guidelines for the Safe Movement of Germplasm. No. 16. Stone Fruits, 1996. (2) X. Foissac et al. Phytopathology 95:617, 2005.

During August to October 2012, several cherry packers in central Washington State reported that a significant volume of sweet cherries (Prunus avium) (cvs. Staccato, Sweetheart, and Lapin) were rotten by an unknown fungal pathogen after packing. Of 14 boxes (9 kg per box) of commercially packed cherries rejected by a retailer, the average incidence of the decay was 68%. Initial symptoms on infected fruit appeared as soft, slippery skin with tan discoloration and later skin cracking, epidermal breakdown, and severe pitting were observed. To isolate the causal agent, decayed fruit were rinsed with water, sprayed with 70% ethanol, and air-dried in a laminar hood. After removing the fruit skin with a sterile scalpel, small fragments of fruit flesh between decayed and healthy tissue were cut and placed on potato dextrose agar (PDA) acidified with 0.1% lactic acid. The plates were incubated at 20°C for 7 days and sub-cultured on PDA to obtain pure cultures. The colonies initially appeared white to cream, yeast-like, and later turned to light yellow to pink or brown with age. Conidia were hyaline, smooth-walled, single-celled, and ellipsoidal with variable shape and size. The fungus was identified as Aureobasidium pullulans (de Bary) G. Arnaud based on its morphology (1). The identity of three representative isolates were further confirmed by analysis of nucleotide sequences of the internal transcribed spacer (ITS) regions amplified using the primers ITS1/ITS4. A BLAST search showed that the sequences had 99% homology (E-value = 0.0) with that of A. pullulans deposited at GenBank (Accession No. JF440584.1). The nucleotide sequence of the isolate, A625, has been assigned GenBank Accession No. KF569512. To test pathogenicity, three single-spore isolates were grown on PDA at 20°C. Cultures grown on 10-day-old PDA were flooded with 20 ml of sterile deionized water, and the resulting conidial suspensions were filtered through two layers of cheesecloth and adjusted to 5 × 105 conidia/ml with a hemacytometer. Organic cherry fruit (cv. Bing for isolate A625 and cv. Sweetheart for isolates A755 and A757) were surface-disinfested in 0.6% sodium hypochlorite solution for 5 min, rinsed twice with deionized water, and air-dried. Ten fruit per replicate, four replications per treatment were inoculated with the conidial suspension using a hand sprayer and placed on sterilized wet paper towel in a plastic container. Control fruit were sprayed with sterile water. All fruit were incubated at 22 ± 1°C for 5 days. The experiments were conducted twice. The same symptoms of skin cracking and epidermal breakdown developed on 73% of the inoculated fruit, while no such symptoms appeared on the control fruit. Koch's postulates were fulfilled by re-isolating the fungus from the symptomatic fruit. A. pullulans, a ubiquitous saprophytic fungus on many fruits, has been reported as a causal agent of melting decay in grapes (2). To the best of our knowledge, this is the first report of postharvest fruit rot in sweet cherries caused by A. pullulans. References: (1) E. J. Hermanides-Nijhof. Aureobasidium and related genera. Pages 141-181 in: The Black Yeasts and Allied Hyphomycetes. Stud. Mycol. No. 15. Centraalbureau voor Schimmelcultures, Baarn, The Netherlands, 1977. (2) D. P. Morgan and T. J. Michailides. Plant Dis. 88:1047, 2004.

To improve online learning pedagogy within the field of paralegal education, this study investigated how paralegal students and paralegal instructors perceived the effectiveness of synchronous and asynchronous online paralegal courses. This study intended to inform paralegal instructors and course developers how to better design, deliver, and evaluate effective online course instruction in the field of paralegal studies.Survey results were analyzed using independent samples t-test and correlational analysis, and indicated that overall, paralegal students and paralegal instructors positively perceived synchronous and asynchronous online paralegal courses. Paralegal instructors reported statistically significant higher perceptions than paralegal students: (1) of instructional design and course content in synchronous online paralegal courses; and (2) of technical assistance, communication, and course content in asynchronous online paralegal courses. Instructors also reported higher perceptions of the effectiveness of universal design, online instructional design, and course content in synchronous online paralegal courses than in asynchronous online paralegal courses. Paralegal students reported higher perceptions of asynchronous online paralegal course effectiveness regarding universal design than paralegal instructors. No statistically significant differences existed between paralegal students’ perceptions of the effectiveness of synchronous and asynchronous online paralegal courses. A strong, negative relationship existed between paralegal students’ age and their perceptions of effective synchronous paralegal courses, which were statistically and practically significant. Lastly, this study provided practical applicability and opportunities for future research. Akyol, Z., & Garrison, D. R. (2008). The development of a community of inquiry over time in an online course: Understanding the progression and integration of social, cognitive and teaching presence. Journal of Asynchronous Learning Networks, 12, 3-22. Retrieved from https://files.eric.ed.gov/fulltext/EJ837483.pdf Akyol, Z., Garrison, D. R., & Ozden, M. Y. (2009). Online and blended communities of inquiry: Exploring the developmental and perceptional differences. The International Review of Research in Open and Distributed Learning, 10(6), 65-83. Retrieved from http://www.irrodl.org/index.php/irrodl/article/view/765/1436 Allen, I. E., & Seaman, J. (2014). Grade change: Tracking online education in the United States. Babson Park, MA: Babson Survey Research Group and Quahog Research Group, LLC. Retrieved from https://www.utc.edu/learn/pdfs/online/sloanc-report-2014.pdf Alreck, P. L., & Settle, R. B. (2004). The Survey Research Handbook (3rd ed.) New York, NY: McGraw-Hill Irwin. American Association for Paralegal Education (2013, Oct.). AAfPE core competencies for paralegal programs. Retrieved from https://cdn.ymaws.com/www.aafpe.org/resource/resmgr/Docs/AAfPECoreCompetencies.pdf American Bar Association, Standing Committee on Paralegals. (2017). https://www.americanbar.org/groups/paralegals.html American Bar Association, Standing Committee on Paralegals (2013, September). Guidelines for the approval of paralegal education programs. Retrieved from https://www.americanbar.org/content/dam/aba/administrative/paralegals/ls_prlgs_2013_paralegal_guidelines.authcheckdam.pdf Astani, M., Ready, K. J., & Duplaga, E. A. (2010). Online course experience matters: Investigating students’ perceptions of online learning. Issues in Information Systems, 11(2), 14-21. Retrieved from http://iacis.org/iis/2010/14-21_LV2010_1526.pdf Bailey, C. J., & Card, K. A. (2009). Effective pedagogical practices for online teaching: Perception of experienced instructors. The Internet and Higher Education, 12, 152-155. doi: 10.1016/j.iheduc.2009.08.002 Bernard, R., Abrami, P., Borokhovski, E., Wade, C., Tamim , R., Surkes, M., & Bethel, E. (2009). A meta-analysis of three types of interaction treatments in distance education. Review of Educational Research, 79, 1243-1289. doi: 10.3102/0034654309333844 Cherry, S. J., & Flora, B. H. (2017). Radiography faculty engaged in online education: Perceptions of effectiveness, satisfaction, and technological self-efficacy. Radiologic Technology, 88(3), 249-262. http://www.radiologictechnology.org/ Cohen, J. (1988). Statistical power analysis for the behavioral sciences (2nd ed.). New York: Taylor & Francis Group. Colorado, J. T., & Eberle, J. (2010). Student demographics and success in online learning environments. Emporia State Research Studies, 46(1), 4-10. Retrieved from https://esirc.emporia.edu/bitstream/handle/123456789/380/205.2.pdf?sequence=1 Dutcher, C. W., Epps, K. K., & Cleaveland, M. C. (2015). Comparing business law in online and face to face formats: A difference in student learning perception. Academy of Educational Leadership Journal, 19, 123-134. http://www.abacademies.org/journals/academy-of-educational-leadership-journal-home.html Faul, F., Erdfelder, E., Lang, A.-G., & Buchner, A. (2007). G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behavior Research Methods, 39, 175-191. Retrieved from http://www.gpower.hhu.de/fileadmin/redaktion/Fakultaeten/Mathematisch-Naturwissenschaftliche_Fakultaet/Psychologie/AAP/gpower/GPower3-BRM-Paper.pdf Field, A. (2009). Discovery statistics using SPSS. (3rd ed.). Thousand Oaks, CA: Sage Publications, Inc. Gall M., Borg, W., & Gall, J. (1996). Educational research: An introduction (6th ed.). White Plains, NY: Longman Press. Garrison, D. R., Anderson, T., & Archer, W. (2001). Critical thinking, cognitive presence, and computer conferencing in distance education. American Journal of distance education, 15(1), 7-23. Retrieved from http://cde.athabascau.ca/coi_site/documents/Garrison_Anderson_Archer_CogPres_Final.pdf Green, S. B., & Salkind, N. J. (2005). Using SPSS for Windows and Macintosh: Internal consistency estimates of reliability. Upper Saddle River, NJ: Pearson Prentice Hall. Harrell, I. L. (2008). Increasing the Success of Online Students. Inquiry, 13(1), 36-44. Retrieved from http://files.eric.ed.gov/fulltext/EJ833911.pdf Horspool, A., & Lange, C. (2012). Applying the scholarship of teaching and learning: student perceptions, behaviours and success online and face-to-face. Assessment & Evaluation in Higher Education, 37, 73-88. doi: 10.1080/02602938.2010.496532 Inman, E., Kerwin, M., & Mayes, L. (1999). Instructor and student attitudes toward distance learning. Community College Journal of Research & Practice, 23, 581-591. doi:10.1080/106689299264594 Institute of Legal Executives (ILEX). https://www.cilexcareers.org.uk/ Johnson, J. & Taggart, G. (1996). Computer assisted instruction in paralegal education: Does it help? Journal of Paralegal Education and Practice, 12, 1-21. Johnstone, Q. & Flood, J. (1982). Paralegals in English and American law offices. Windsor YB Access to Justice 2, 152. Jones, S. J. (2012). Reading between the lines of online course evaluations: Identifiable actions that improve student perceptions of teaching effectiveness and course value. Journal of Asynchronous Learning Networks, 16(1), 49-58. doi:http://dx.doi.org/10.24059/olj.v16i1.227 Krejcie, R. V., & Morgan, D. W. (1970). Determining sample size for research activities. Educational and psychological measurement, 30, 607-610. http://journals.sagepub.com/home/epm Liu, S., Gomez, J., Khan, B., & Yen, C. J. (2007). Toward a learner-oriented community college online course dropout framework. International Journal on ELearning, 6(4), 519-542. https://www.learntechlib.org/j/IJEL/ Lloyd, S. A., Byrne, M. M., & McCoy, T. S. (2012). Faculty-perceived barriers of online education. Journal of online learning and teaching, 8(1), 1-12. Retrieved from http://jolt.merlot.org/vol8no1/lloyd_0312.pdf Lockee, B., Burton, J., & Potter, K. (2010, March). Organizational perspectives on quality in distance learning. In D. Gibson & B. Dodge (Eds.), Proceedings of SITE 2010—Society for Information Technology & Teacher Education International Conference (pp. 659-664). San Diego, CA: Association for the Advancement of Computing in Education (AACE). https://www.learntechlib.org/p/33419/ Lowerison, G., Sclater, J., Schmid, R. F., & Abrami, P. C. (2006). Student perceived effectiveness of computer technology use in post-secondary classrooms. Computers & Education, 47(4), 465-489. doi:10.1016/j.compedu.2004.10.014 Retrieved from https://pdfs.semanticscholar.org/fc9c/13f0187d3967217aa82cc96c188427e29ec9.pdf Martins, L. L., & Kellermanns, F. W. (2004). A model of business school students' acceptance of a web-based course management system. Academy of Management Learning & Education, 3(1), 7-26. doi: 10.5465/AMLE.2004.12436815 Mayes, J. T. (2001). Quality in an e-University. Assessment & Evaluation in Higher Education, 26, 465-473. doi:10.1080/02602930120082032 McCabe, S. (2007). A brief history of the paralegal profession. Michigan Bar Journal, 86(7), 18-21. Retrieved from https://www.michbar.org/file/barjournal/article/documents/pdf4article1177.pdf McMillan, J. H. (2008). Educational Research: Fundamentals for the customer. Boston, MA: Pearson Education, Inc. Myers, C. B., Bennett, D., Brown, G., & Henderson, T. (2004). Emerging online learning environments and student learning: An analysis of faculty perceptions. Educational Technology & Society, 7(1), 78-86. Retrieved from http://www.ifets.info/journals/7_1/9.pdf Myers, K. (2002). Distance education: A primer. Journal of Paralegal Education & Practice, 18, 57-64. Nunnaly, J. (1978). Psychometric theory. New York: McGraw-Hill. Otter, R. R., Seipel, S., Graeff, T., Alexander, B., Boraiko, C., Gray, J., Petersen, K., & Sadler, K. (2013). Comparing student and faculty perceptions of online and traditional courses. The Internet and Higher Education, 19, 27-35. doi:10.1016/j.iheduc.2013.08.001 Popham, W. J. (2000). Modern educational measurement: Practical guidelines for educational leaders. Boston, MA: Allyn & Bacon. Rich, A. J., & Dereshiwsky, M. I. (2011). Assessing the comparative effectiveness of teaching undergraduate intermediate accounting in the online classroom format. Journal of College Teaching and Learning, 8(9), 19. https://www.cluteinstitute.com/ojs/index.php/TLC/ Robinson, C., & Hullinger, H. (2008). New benchmarks in higher education: Student engagement in online learning. The Journal of Education for Business, 84(2), 101-109. Retrieved from http://anitacrawley.net/Resources/Articles/New%20Benchmarks%20in%20Higher%20Education.pdf Salkind, N. J. (2008). Statistics for people who think they hate statistics. Los Angeles, CA: Sage Publications. Santos, J. (1999, April). Cronbach's Alpha: A tool for assessing the reliability of scales. Journal of Extension, 37, 2. Retrieved from https://www.joe.org/joe/1999april/tt3.php Seok, S., DaCosta, B., Kinsell, C., & Tung, C. K. (2010). Comparison of instructors' and students' perceptions of the effectiveness of online courses. Quarterly Review of Distance Education, 11(1), 25. Retrieved from http://online.nuc.edu/ctl_en/wp-content/uploads/2015/08/Online-education-effectiviness.pdf Sheridan, K., & Kelly, M. A. (2010). The indicators of instructor presence that are important to students in online courses. Journal of Online Learning and Teaching, 6(4), 767-779. Retrieved from http://jolt.merlot.org/vol6no4/sheridan_1210.pdf Shook, B. L., Greer, M. J., & Campbell, S. (2013). Student perceptions of online instruction. International Journal of Arts & Sciences, 6(4), 337. Retrieved from https://s3.amazonaws.com/academia.edu.documents/34496977/Ophoff.pdf?AWSAccessKeyId=AKIAIWOWYYGZ2Y53UL3A&Expires=1508119686&Signature=J1lJ8VO0xardd%2FwH35pGj14UeBg%3D&response-content-disposition=inline%3B%20filename%3DStudent_Perceptions_of_Online_Learning.pdf Song, L., Singleton, E. S., Hill, J. R., & Koh, M. H. (2004). Improving online learning: Student perceptions of useful and challenging characteristics. The Internet and Higher Education, 7, 59-70. doi:10.1016/j.iheduc.2003.11.003 Steiner, S. D., & Hyman, M. R. (2010). Improving the student experience: Allowing students enrolled in a required course to select online or face-to-face instruction. Marketing Education Review, 20, 29-34. doi:10.2753/MER1052-8008200105 Stoel, L., & Hye Lee, K. (2003). Modeling the effect of experience on student acceptance of web-based courseware. Internet Research, 13(5), 364-374. http://www.emeraldinsight.com/loi/intr Taggart, G., & Bodle, J. H. (2003). Example of assessment of student outcomes data from on-line paralegal courses: Lessons learned. Journal of Paralegal Education & Practice, 19, 29-36. Tanner, J. R., Noser, T. C., & Totaro, M. W. (2009). Business faculty and undergraduate students' perceptions of online learning: A comparative study. Journal of Information Systems Education, 20, 29-40. http://jise.org/ Tung, C.K. (2007). Perceptions of students and instructors of online and web-enhanced course effectiveness in community colleges (Doctoral dissertation). Retrieved from ProQuest Dissertations and Theses database (Publication No. AAT 3284232). Vodanovich, S. J. & Piotrowski, C., & (2000). Are the reported barriers to Internet-based instruction warranted? A synthesis of recent research. Education, 121(1), 48-53. http://www.projectinnovation.com/education.html Ward, M. E., Peters, G., & Shelley, K. (2010). Student and faculty perceptions of the quality of online learning experiences. The International Review of Research in Open and Distributed Learning, 11, 57-77. Retrieved from http://www.irrodl.org/index.php/irrodl/article/view/867/1610? Wilkes, R. B., Simon, J. C., & Brooks, L. D. (2006). A comparison of faculty and undergraduate students' perceptions of online courses and degree programs. Journal of Information Systems Education, 17, 131-140. http://jise.org/

DESENVOLVIMENTO DE MUDAS DE PITANGUEIRA EM FUNÇÃO DE LÂMINAS DE IRRIGAÇÃO EM DOIS TAMANHOS DE RECIPIENTE César Antônio da Silva1; Durval Dourado Neto2; Cícero José da Silva3 e Berildo de Melo4 1Tecnólogo em Irrigação e Drenagem, Prof. Dr. Instituto Federal Goiano, Câmpus Morrinhos, Rodovia BR-153, km 633, Zona Rural. CEP 75650-000, Morrinhos, Goiás, Brasil, cesar.antonio@ifgoiano.edu.br2Agrônomo, Prof. Dr. Departamento de Produção Vegetal, Escola Superior de Agricultura “Luiz de Queiroz”/Universidade de São Paulo (ESALQ/USP), Piracicaba, São Paulo, Brasil, ddourado@usp.br3Tecnólogo em Irrigação e Drenagem, Doutorando em Engenharia de Sistemas Agrícolas, Departamento de Engenharia de Biossistemas, ESALQ/USP, Piracicaba, São Paulo, Brasil, cicero.silva@ifgoiano.edu.br4Agrônomo, Prof. Dr. Instituto de Ciências Agrárias, Universidade Federal de Uberlândia (UFU), Uberlândia, Minas Gerais, Brasil, berildo@ufu.br 1 RESUMO Objetivou-se com o trabalho avaliar o desenvolvimento de mudas de pitangueira (Eugenia uniflora L.), em função de lâminas de irrigação em dois tamanhos de recipiente. O experimento foi conduzido em casa de vegetação, na Escola Superior de Agricultura “Luiz de Queiroz”, em Piracicaba, SP, no período de outubro 2010 a abril 2011. O delineamento foi o de blocos ao acaso, com três repetições, em parcelas subdivididas, no esquema 2 x 5. Nas parcelas, foram utilizados vasos rígidos de 2,3 L e sacos plásticos de 2,0 L, e nas subparcelas, lâminas de irrigação por gotejamento, equivalentes a 20, 40, 60, 80 e 100% da evapotranspiração potencial (ETp). No período de 80 a 200 dias após a semeadura, foram avaliados a altura de muda, área foliar, massa de matéria seca de muda, partição da matéria seca e relação entre as massas de raízes e parte aérea. O vaso rígido proporcionou maior ETp, em relação ao saco plástico e, consequentemente, maior massa de matéria seca e desenvolvimento das mudas. A lâmina de irrigação de 100% da ETp propiciou a produção de mudas de pitangueira mais vigorosas. Palavras-chave: Eugenia uniflora, evapotranspiração potencial, deficit hídrico, matéria seca. SILVA, C. A. da; DOURADO NETO, D.; SILVA, C. J. da; MELO, B. deDEVELOPMENT OF SURINAM CHERRY SEEDLINGS AS A FUNCTION OF IRRIGATION DEPTHS IN TWO CONTAINER SIZES 2 ABSTRACT The study aimed to evaluate the development of Surinam cherry (Eugenia uniflora L.) seedlings as a function of irrigation depths in two container sizes. The experiment was carried out in a greenhouse at Luiz de Queiroz Agriculture College, Piracicaba city, SP, from October 2010 to April 2011. The experimental design was randomized blocks with three replicates in a split-plot 2 x 5 factorial design. Rigid pots of 2.3 L and plastic bags of 2.0 L were used in the plots, and irrigation depths by dripping equal to 20, 40, 60, 80 and 100% potential evapotranspiration ( ETp) were used in the subplots. In the period of 80 to 200 days after sowing, the following parameters were evaluated: seedling height, leaf area, seedling dry matter mass, dry matter partitioning and relationship between root and above-ground masses. The rigid pot provided higher ETp as compared with that of the plastic bag, and therefore, higher dry matter mass and seedling development. Irrigation depth of 100% ETp provided production of more vigorous Surinam cherry seedlings. Keywords: Eugenia uniflora, potential evapotranspiration, water deficit, dry matter.

Expressed Emotion (EE) is a well-validated measure of the family environment of individuals with mental and physical conditions that examines relatives’ critical, hostile and emotionally overinvolved attitudes towards a family member with a condition. This review focuses on studies of EE on containing data of the impact of Expressed Emotion on the course of chronic illnesses and clinical outcomes in mental and physical health conditions. The structural literature review is based on the search of articles in peer-reviewed journals from 1991 to November, 2018 in the databases Psyc-Info and PubMed. Taken together, these results suggest that there is an association between EE towards patients with both physical and mental conditions and a poor clinical and personal recovery. Interestingly, the lower levels of EE towards individuals with a condition were observed in partners comparatively with parents, adult children and relatives. However, the results have been obtained only from two populations with dementia and Type I diabetes and have been considered as important issue for future research. 
 References
 
 Ayilara, O., Ogunwale, A., & Babalola, E. (2017). Perceived expressed emotion in relatives of patients with severe mental illness: A comparative study. Psychiatry research, 257, 137-143.
 Bogojevic, G., Ziravac, L., & Zigmund, D. (2015). Impact of expressed emotion on the course of schizophrenia. European Psychiatry, 30, 390.
 Brown, G. W., Birley, J. L. T., & Wing, J. K. (1972). Influence of family life on the course of schizophrenic disorders: A replication. British Journal of Psychiatry, 121, 241–258.
 Chan, K. K., & Mak, W. W. (2017). The content and process of self-stigma in people with mental illness. American Journal of Orthopsychiatry, 87(1), 34-43.
 Cherry, M. G., Taylor, P. J., Brown, S. L., & Sellwood, W. (2018). Attachment, mentalisation and expressed emotion in carers of people with long-term mental health difficulties. BMC Psychiatry, 18(1), 257.
 Coomber, K., & King, R. M. (2013). Perceptions of carer burden: differences between individuals with an eating disorder and their carer. Eating Disorders, 21(1), 26-36
 Engel, G. L. (1977). The need for a new medical model: a challenge for biomedicine. Science, 196(4286), 129-136.
 Flanagan, D. A., & Wagner, H. L. (1991). Expressed emotion and panic fear in the prediction of diet treatment compliance. British Journal of Clinical Psychology, 30, 231–240.
 Hooley, J. M., & Parker, H. A. (2006). Measuring expressed emotion: An evaluation of the shortcuts. Journal of Family Psychology, 20(3), 386.
 Rienecke, R. D., Lebow, J., Lock, J., & Le Grange, D. (2015). Family profiles of expressed emotion in adolescent patients with anorexia nervosa and their parents. Journal of Clinical Child & Adolescent Psychology, 46(3), 428-436.
 Safavi, R., Berry, K., & Wearden, A. (2018). Expressed emotion, burden, and distress in significant others of people with dementia. Journal of Family Psychology, 32(6), 835.
 Romero-Gonzalez, M., Chandler, S., & Simonoff, E. (2018). The relationship of parental expressed emotion to co-occurring psychopathology in individuals with autism spectrum disorder: A systematic review. Research in developmental disabilities, 72, 152-165.
 Wearden, A. J., Tarrier, N., Barrowclough, C., Zastowny, T. R., & Rahill, A. A. (2000). A review of expressed emotion research in health care. Clinical Psychology Review, 20(5), 633-666.
 Wearden, A. J., Tarrier, N., & Davies, R. (2000). Partners' expressed emotion and the control and management of Type 1 diabetes in adults. Journal of Psychosomatic Research, 49(2), 125-130.

Petunia × hybrida Wave series cultivars were observed with symptoms of tan to brown stem lesions, wilt, and branch death in a demonstration/trial planting at Burden Research Center in Baton Rouge, LA, during January and February 2000. Disease signs included the presence of white, cottony mycelia on infected stems and the presence of black sclerotia. Seventeen of 131 plants were infected on 20 February and included individuals of cvs. Wave Purple, Wave Rose, Wave Misty Lilac, Wave Pink, Tidal Wave Hot Pink, and Tidal Wave Cherry. Isolations were made by placing diseased stem sections on acidified potato-dextrose agar. A fungus that produced white mycelia and black sclerotia was consistently isolated from infected stems and identified as Sclerotinia sclerotiorum. Pathogenicity tests were done by pipetting 1 to 2 ml of blended mycelia and sclerotia (one plate culture blended in 100 ml distilled water) at the base of flowering-age Wave series plants. Plants were held for 3 days in a dew chamber maintained at 22°C and then moved to a greenhouse held at 25°C. Wilt and branch death developed on inoculated plants after 5 days and S. sclerotiorum was reisolated. Uninoculated plants remained healthy. Wave series cultivars have a prostrate growth habit that is conducive to disease development. No plants in the trial planting were killed and infected plants had recovered by 1 May and had uniformly covered the plant bed. Sclerotinia blight was previously reported on Petunia × hybrida from Bermuda (2) and Florida (1). References: (1) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN. (2) J. M. Waterston. Dept. Agric. Bermuda Rep., 1947.

BackgroundMultiple genomics-based biomarkers of response to immune checkpoint inhibition have been reported or proposed, including tumor mutation/neoantigen frequency, PD-L1 expression, T cell receptor repertoire clonality, interferon gene signature expression, HLA expression, and others.1 Although genomics associations of response have been reported, the primary studies have used a variety of data generation and processing techniques. There is a need for data harmonization and assessment of generalizability of potential biomarkers across multiple datasets.MethodsWe acquired patient-level RNA sequencing FASTQ data files from 10 data sets reported in seven pan-cancer PD-1 and CTLA-4 immune checkpoint inhibition trials with matched clinical annotations.2–7 We applied a common bioinformatics workflow for quality control, mapping to reference (STAR), generating gene expression matrices (SALMON), T cell receptor repertoire inference (MiXCR), extraction of immune gene signatures and immune subtypes,8 and differential gene expression analysis (DESeq2). We analyzed i) immunogenomics features proposed as biomarkers, and ii) gene expression signatures built from each trial for association with overall survival across the set of trials using univariable Cox proportional hazards regression. In all, we assessed 9 total immunogenomics features/signatures. P-values were adjusted for multiple testing using the Benjamini-Hochberg method.ResultsOf the 9 immunogenomics features assessed, cytolytic activity score and expression of the Follicular Dendritic Cell Secreted Protein gene (FDCSP) were associated with survival in two of seven studies, respectively (adjusted p < 0.05) (figure 1). No proposed biomarkers were significantly associated with survival in more than two studies. The sets of genes significantly associated with clinical benefit across the studies were highly disjoint, with only three genes significant in three studies and thirteen genes significant in two studies (figure 2). No genes were significantly associated with clinical benefit in more than three of seven studies.Abstract 75 Figure 1Association of immunogenomics features and proposed biomarkers with survival in 10 publicly available datasets from 7 clinical trials with immune checkpoint blockade. Nine immunogenomics features were tested in 10 publicly available RNAseq data sets from 7 published clinical trials with immune checkpoint blockade for their correlation with outcome. SKCM, skin cutaneous melanoma; BLCA, bladder cancer; Kidney, kidney cancer; Ureter, ureteral cancer; GBM, glioblastomaAbstract 75 Figure 2Association of gene expression of single genes with survival in 10 publicly available datasets from 7 clinical trials with immune checkpoint inhibitorsConclusionsNo proposed biomarkers were highly generalizable across studies. We expect that integrated modeling incorporating multiple immunogenomics features will be required to build a robust and generalizable biomarker for ICI response. Further work is needed to analyze determinants of response and clinical benefit.AcknowledgementsWe would like to thank SITC for funding for this work as part of the Sparkathon TimIOS collaborative project.ReferencesZappasodi R, Wolchok JD, Merghoub T. Strategies for Predicting Response to Checkpoint Inhibitors. Curr Hematol Malig Rep 2018;13(5):383–95.Liu D, Schilling B, Liu D, Sucker A, Livingstone E, Jerby-Arnon L, Zimmer L, Gutzmer R, Satzger I, Loquai C, Grabbe S, Vokes N, Margolis CA, Conway J, He MX, Elmarakeby H, Dietlein F, Miao D, Tracy A, Gogas H, Goldinger SM, Utikal J, Blank CU, Rauschenberg R, von Bubnoff D, Krackhardt A, Weide B, Haferkamp S, Kiecker F, Izar B, Garraway L, Regev A, Flaherty K, Paschen A, Van Allen EM, Schadendorf D. Integrative molecular and clinical modeling of clinical outcomes to PD1 blockade in patients with metastatic melanoma. Nat Med 2019;25(12):1916–27.Gide TN, Quek C, Menzies AM, Tasker AT, Shang P, Holst J, Madore J, Lim SY, Velickovic R, Wongchenko M, Yan Y, Lo S, Carlino MS, Guminski A, Saw RPM, Pang A, McGuire HM, Palendira U, Thompson JF, Rizos H, Silva IPD, Batten M, Scolyer RA, Long GV, Wilmott JS. distinct immune cell populations define response to anti-pd-1 monotherapy and Anti-PD-1/Anti-CTLA-4 Combined Therapy. Cancer Cell 2019;35(2):238–55 e6.Cloughesy TF, Mochizuki AY, Orpilla JR, Hugo W, Lee AH, Davidson TB, Wang AC, Ellingson BM, Rytlewski JA, Sanders CM, Kawaguchi ES, Du L, Li G, Yong WH, Gaffey SC, Cohen AL, Mellinghoff IK, Lee EQ, Reardon DA, O’Brien BJ, Butowski NA, Nghiemphu PL, Clarke JL, Arrillaga-Romany IC, Colman H, Kaley TJ, de Groot JF, Liau LM, Wen PY, Prins RM. Neoadjuvant anti-PD-1 immunotherapy promotes a survival benefit with intratumoral and systemic immune responses in recurrent glioblastoma. Nat Med. 2019;25(3):477–86.Riaz N, Havel JJ, Makarov V, Desrichard A, Urba WJ, Sims JS, Hodi FS, Martin-Algarra S, Mandal R, Sharfman WH, Bhatia S, Hwu WJ, Gajewski TF, Slingluff CL, Jr., Chowell D, Kendall SM, Chang H, Shah R, Kuo F, Morris LGT, Sidhom JW, Schneck JP, Horak CE, Weinhold N, Chan TA. Tumor and microenvironment evolution during immunotherapy with nivolumab. Cell 2017;171(4):934–49 e16.Hugo W, Zaretsky JM, Sun L, Song C, Moreno BH, Hu-Lieskovan S, Berent-Maoz B, Pang J, Chmielowski B, Cherry G, Seja E, Lomeli S, Kong X, Kelley MC, Sosman JA, Johnson DB, Ribas A, Lo RS. Genomic and transcriptomic features of response to anti-PD-1 therapy in metastatic melanoma. Cell 2016;165(1):35–44.Rosenberg JE, Hoffman-Censits J, Powles T, van der Heijden MS, Balar AV, Necchi A, Dawson N, O’Donnell PH, Balmanoukian A, Loriot Y, Srinivas S, Retz MM, Grivas P, Joseph RW, Galsky MD, Fleming MT, Petrylak DP, Perez-Gracia JL, Burris HA, Castellano D, Canil C, Bellmunt J, Bajorin D, Nickles D, Bourgon R, Frampton GM, Cui N, Mariathasan S, Abidoye O, Fine GD, Dreicer R. Atezolizumab in patients with locally advanced and metastatic urothelial carcinoma who have progressed following treatment with platinum-based chemotherapy: a single-arm, multicentre, phase 2 trial. Lancet. 2016;387(10031):1909–20.Thorsson V, Gibbs DL, Brown SD, Wolf D, Bortone DS, Ou Yang TH, Porta-Pardo E, Gao GF, Plaisier CL, Eddy JA, Ziv E, Culhane AC, Paull EO, Sivakumar IKA, Gentles AJ, Malhotra R, Farshidfar F, Colaprico A, Parker JS, Mose LE, Vo NS, Liu J, Liu Y, Rader J, Dhankani V, Reynolds SM, Bowlby R, Califano A, Cherniack AD, Anastassiou D, Bedognetti D, Mokrab Y, Newman AM, Rao A, Chen K, Krasnitz A, Hu H, Malta TM, Noushmehr H, Pedamallu CS, Bullman S, Ojesina AI, Lamb A, Zhou W, Shen H, Choueiri TK, Weinstein JN, Guinney J, Saltz J, Holt RA, Rabkin CS, Cancer Genome Atlas Research N, Lazar AJ, Serody JS, Demicco EG, Disis ML, Vincent BG, Shmulevich I. The Immune Landscape of Cancer. Immunity 2018;48(4):812–30e14.

The sanitary status of pome fruit trees was evaluated in central and northern Greece during a survey in the autumn of 2004 and spring of 2005. Twenty-six leaf samples were collected from five symptomless and 21 symptomatic quince trees showing fruit deformation (FD) symptoms and diffuse chlorotic leaf spots. All samples were tested for the presence of Apple chlorotic leaf spot virus (ACLSV), a member of the Trichovirus genus, initially by ELISA and then by a specific reverse transcription (RT)-PCR assay reported previously (1). ACLSV has a broad host range that includes most, if not all, Prunoidae (peach, apricot, plum, and cherry) and Maloidae (apple, pear, and quince) fruit tree species. Although it has been tentatively linked with fruit, leaf, bark, and growth retardation symptoms in quince (2,3), its geographic distribution and association with specific symptoms is still poorly determined. ACLSV was initially detected by serology in two plants, one symptomless and one showing FD symptoms. ACLSV presence in these two samples and in an additional symptomless plant was confirmed by the ACLSV-specific RT-PCR assay. Sequencing of the RT-PCR amplicon from the symptomatic isolate (EMBL Accession No. AM292923), which was positive in both assays, confirmed the identification of ACLSV. The obtained sequence shows 93% nucleotide identity with an apple isolate of ACLSV (EMBL Accession No. AY677103). To our knowledge, these findings represent the first report of the presence of ACLSV in quince in Greece. They further indicate that at least for some host-cultivar/virus isolate combinations, ACLSV may be asymptomatic in quince and that the symptoms observed in the plants sampled are unrelated to ACLSV infection. References: (1) T. Candresse et al. Acta Hortic. 386:136, 1995. (2) J. C. Desvignes. Page 202 in: Virus Diseases of Fruit Trees. CTIFL Publishing, 1999. (3) S. Paunovic and M. Rankovic. Jugosl. Vocarstvo 31:231, 1997.

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.