Academic literature on the topic 'Calothrixin'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Calothrixin.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Calothrixin"

1

Owen, Elisabeth A., and Max A. Keniry. "Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor." Australian Journal of Chemistry 62, no. 11 (2009): 1544. http://dx.doi.org/10.1071/ch09169.

Full text
Abstract:
Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.
APA, Harvard, Vancouver, ISO, and other styles
2

Guingant, André, Drissa Sissouma, and Sylvain Collet. "A Synthesis of Calothrixin B." Synlett 2004, no. 14 (October 20, 2004): 2612–14. http://dx.doi.org/10.1055/s-2004-834831.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Kaliyaperumal, Srinivasan A., Shyamapada Banerjee, and Syam Kumar U. K. "Palladium mediated intramolecular multiple C–X/C–H cross coupling and C–H activation: synthesis of carbazole alkaloids calothrixin B and murrayaquinone A." Org. Biomol. Chem. 12, no. 32 (2014): 6105–13. http://dx.doi.org/10.1039/c4ob00493k.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "Total synthesis of calothrixin B via sequential Sonogashira coupling/copper-catalyzed oxidative cyclization." Organic & Biomolecular Chemistry 13, no. 45 (2015): 11046–51. http://dx.doi.org/10.1039/c5ob01766a.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Sperry, Jonathan, Christopher S. P. McErlean, Alexandra M. Z. Slawin, and Christopher J. Moody. "A biomimetic synthesis of calothrixin B." Tetrahedron Letters 48, no. 2 (January 2007): 231–34. http://dx.doi.org/10.1016/j.tetlet.2006.11.053.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Chai, Christina, Paul Bernardo, and Wuri Fitriyanto. "Palladium-Mediated Synthesis of Calothrixin B." Synlett 2007, no. 12 (July 2007): 1935–39. http://dx.doi.org/10.1055/s-2007-984520.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "Formal total synthesis of calothrixin B and its N-benzyl analogues." RSC Advances 5, no. 107 (2015): 87838–40. http://dx.doi.org/10.1039/c5ra18120h.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Bhosale, Shrikar M., Rupesh L. Gawade, Vedavati G. Puranik, and Radhika S. Kusurkar. "An efficient total synthesis of calothrixin B." Tetrahedron Letters 53, no. 23 (June 2012): 2894–96. http://dx.doi.org/10.1016/j.tetlet.2012.03.131.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Sissouma, Drissa, Lucie Maingot, Sylvain Collet, and André Guingant. "Concise and Efficient Synthesis of Calothrixin B." Journal of Organic Chemistry 71, no. 22 (October 2006): 8384–89. http://dx.doi.org/10.1021/jo061270o.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Bernardo, Paul H., Christina L. L. Chai, and John A. Elix. "A simple and concise route to calothrixin B." Tetrahedron Letters 43, no. 16 (April 2002): 2939–40. http://dx.doi.org/10.1016/s0040-4039(02)00434-3.

Full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "Calothrixin"

1

Islam, M. D. Rafiqul. "Nitrogen fixation by a Bangladesh deepwater rice-field Calothrix." Thesis, Durham University, 1990. http://etheses.dur.ac.uk/6180/.

Full text
Abstract:
In order to study the influence on blue-green algal nitrogenase activity of environmental variables in deepwater rice-fields (DWR), a laboratory study was planned on a DWR isolate of Calothrix (D764). The variables chosen were light, oxygen, combined nitrogen, phosphorus and iron. As availability of P is likely to play an especially important role for growth and nitrogen fixation in DWR, studies on phosphatase activity of the isolate were also included. The method used for measuring nitrogenase activity was acetylene reduction assay (ARA). In order to convert nitrogenase activity to nitrogen fixation, the conversion ratio of N(_2) : C(_2)H(_2) reduced was determined by comparing the total amount of N fixed with total C(_2)H(_2) reduced. The ratio was 1 : 4.1 and 1 : 5.2 at 85 and 10 µmol photon m(^-2) s(^-1), respectively. Changes in nitrogenase activity in batch culture were studied in relation to growth characteristics. Maximum activity (10.5 nmol C(_2)H(_4) mg d. wt(^-1) min(^-1)) was observed after two days of growth. During this period, juvenile trichomes (hence maximum heterocyst frequency) were abundant and cyanophycin granules were absent; chl a, phycobiliprotein and algal N decreased. It is suggested that the juvenile filament is the most active nitrogen-fixer during the growth of the alga. The response of nitrogenase to changes in light flux (down- or upshift) was rapid. The alga showed a marked drop in nitrogenase activity in the dark, but subsequent changes were slow, with detectable activity after 24 h. Higher nitrogenase activity was observed when the dark grown alga was re-illuminated, than the maximum activity found under continuous illumination. Nitrogen fixation and heterocyst differentiation were suppressed when 10 mg 1(^-1) NH(_4)-N was added to a batch culture. Fe-deficient cultures had lower nitrogenase activity and N content than Fe-sufficient cultures. Fe- deficiency led to the development of a series of new heterocysts apical to the basal ones. Addition of Fe to Fe-deficient cultures led to a marked increase in nitrogenase activity and loss of the degenerated basal heterocysts. The alga was capable of using a number of organic P substrates as the sole source of phosphorus and showed both cell-bound phosphomono- and phosphodiesterase activities. In batch culture, phosphatase activity was detected when cellular P content dropped to 0.98%. A brief study on the influence of the environmental factors on cell-bound phosphatase activities of the alga has been included. A brief comparison in nitrogenase activity of a UK field Rivularia population and bacterised laboratory isolate Rivularia D403 was made and probable behaviour of algae in DWR is discussed.
APA, Harvard, Vancouver, ISO, and other styles
2

Quest, Benjamin. "Biochemische und Spektroskopische Charakterisierung zweier cyanobakterieller Phytochrome aus Calothrix PCC 7601." Diss., lmu, 2003. http://nbn-resolving.de/urn:nbn:de:bvb:19-9357.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Maingot, Lucie. "Synthèses et modifications de calothrixines et de C-glycosylangucyclinones en vue d'évaluations biologiques." Nantes, 2008. http://www.theses.fr/2008NANT2010.

Full text
Abstract:
Dans un premier chapitre, nous nous sommes intéressés aux angucyclines qui constituent une classe importante d’antibiotiques naturels. La structure de ces composés est caractérisée par un squelette angulaire tétracyclique benz[a]anthracène et un C-arylglycoside. Dans ce travail, nous nous sommes intéressés principalement à la préparation de C-naphtylglycosides précurseurs de juglones. Pour ce faire, nous avons choisi une stratégie de construction de la partie osidique faisant intervenir une hétérocycloaddition à demande électronique inverse permettant l’accès à des dihydropyranes "prosucre". Dans un second chapitre, nous nous sommes intéressés aux Calothrixines. La Calothrixine B et son dérivé N-oxyde (calothrixine A) sont des molécules naturelles isolées d’extraits cellulaires de cyanobactéries calothrix possédant des activités biologiques intéressantes. Une nouvelle synthèse de la calothrixine B a été envisagée en s’inspirant des récents résultats obtenus dans le domaine de la synthèse d’aza-analogues d’angucyclines. La stratégie choisie fait intervenir une réaction d’hétéro-Diels-Alder entre une bromocarbazole-1,4-dione et un 2-aza-1,3-diène. Cette stratégie a permis dans un second temps la synthèse d’un nouvel analogue de la calothrixine : l’isocalothrixine
In a first part, we were interested in angucyclines which represent a large group of natural antibiotics. The structure of these compounds is characterized by an angular tetracyclic benz[a] anthracene skeleton and a C-arylglycoside. In this work, we were interested in most cases in the preparation of C-naphtylglycosides precursor of juglones. We develop a strategy consisting in building the glycoside part using an inverse electron demand heterocycloaddition in order to access to ‘‘prosugar’’ dihydropyranes. In a second part, we were interested in calothrixins. Calothrixine B and his N-oxyde derivative (calothrixine A) are natural products isolated from the cell extracts of Calothrix cyanobacteria which exhibit interesting biological activities. A new synthesis of calothrixin B inspired by recent results acquired in the field of angucyclines aza-analogues syntheses was considered. Our strategy consists in an hetero-Diels-Alder reaction between a bromocarbazole-1,4-dione and an 2-aza-1,3-diene. Moreover, this strategy allowed us to obtain a new analogue of calothrixin : isocalothrixin
APA, Harvard, Vancouver, ISO, and other styles
4

SCHYNS, GHISLAIN. "Reconnaissance specifique de promoteurs chez la cyanobacterie calothrix pcc 7601 : arn polymerase et effecteurs." Paris 7, 1995. http://www.theses.fr/1995PA077254.

Full text
Abstract:
Procaryotes photosynthetiques, les cyanobacteries sont des bacteries qui ont develope un grand nombre de mecanismes d'adaptation aux modifications des conditions de l'environnement comme, par exemple, la fixation de l'azote atmospherique, la differenciation cellulaire en hormogonies ou en heterocystes ou l'adaptation chromatique complementaire. Apres avoir developpe une methode de purification de l'arn polymerase de calothrix pcc 7601, nous avons mis au point un systeme de transcription in vitro grace auquel nous avons etudie la specificite de reconnaissance par l'enzyme des onze promoteurs de genes de calothrix pcc 7601 cartographies a ce jour. Ce travail a egalement permis de montrer que la proteine rcaa, effecteur decrit anterieurement comme se fixant au niveau de la region promotrice de l'operon qui specifie la phycoerythrine, cpeba, entraine une modification specifique du profil de transcription pour quatre des promoteurs examines. Ces quatre promoteurs appartiennent a des genes codant pour des constituants du phycobilisome. La proteine rcaa, tout comme rcad, proteine affine de la region promotrice de l'operon specifiant la phycocyanine 2, cpc2, modifie in vitro la transcription de l'operon cpc1 qui code pour la phycocyanine 1. Les resultats obtenus nous ont permis de proposer un modele pour la regulation transcriptionnelle de l'expression de trois operons codant pour des phycobiliproteines. Enfin, ce travail a fourni l'occasion de comparer la transcription chez escherichia coli et chez calothrix pcc 7601
APA, Harvard, Vancouver, ISO, and other styles
5

LIOTENBERG, SYLVIANE. "Relations entre l'assimilation de l'azote et la photosynthese chez les cyanobacteries du genre calothrix." Paris 7, 1995. http://www.theses.fr/1995PA077226.

Full text
Abstract:
Les cyanobacteries possedent un appareil photosynthetique proche de celui des plantes. Chez ces dernieres, l'appareil photosynthetique est intramembranaire et les antennes photocollectrices sont constituees de chlorophylles a et b. Chez les cyanobacteries, seule la chlorophylle a est synthetisee et les antennes photocollectrices sont des structures extramembranaires appelees phycobilisomes. Ces structures sont constituees de proteines de liaison et de proteines chromophoriques, les phycobiliproteines. Nous avons etudie les relations existant entre la photosynthese et l'assimilation de l'azote chez les cyanobacteries filamenteuses du genre calothrix. Differents parametres ont ete etudies durant la phase exponentielle de croissance de calothrix pcc 7601 cultive en presence de nitrate ou d'ammoniaque: la synthese des phycobiliproteines et des reserves cellulaires (cyanophycine et glycogene), la synthese et l'activite de la glutamine synthetase et les contenus en glutamine et glutamate. Ces etudes ont conduit aux conclusions suivantes: i) il existe un controle transcriptionnel de la synthese des phycobiliproteines et de la glutamine synthetase en fonction de la nature de la source d'azote combine ; ii) les reserves de cyanophycine s'accumulent specifiquement dans les cellules cultivees en presence d'ammoniaque, alors que le contenu en glycogene varie peu en fonction de la source d'azote combine ; iii) les contenus en glutamine et en glutamate varient avec la nature de la source d'azote. Certains de ces parametres varient aussi en fonction du stade de croissance des cellules. Chez les cyanobacteries, l'etat de phosphorylation de la proteine pii repond a l'equilibre carbone/azote. L'etat de modification de cette proteine a ete etudie chez diverses souches de calothrix afin de determiner s'il existait des relations entre la modification de cette proteine et l'effet de la nature de la source d'azote combine sur la synthese des phycobiliproteines et la regulation de la glutamine synthetase. Cette etude a montre que l'etat de modification de la proteine pii varie en fonction des proprietes physiologiques de ces souches. Le gene glnb correspondant a ete clone chez calothrix pcc 7601 et l'effet de la source d'azote combine sur l'expression de ce gene a ete etudie apres son transfert chez une souche unicellulaire glnb#-
APA, Harvard, Vancouver, ISO, and other styles
6

SOBCZYK, ANDRE. "Caracterisation d'effecteurs transcriptionnels impliques dans la regulation de l'adaptation chromatique complementaire chez la cyanobacterie calothrix pcc7601." Paris 7, 1994. http://www.theses.fr/1994PA077093.

Full text
Abstract:
Les cyanobacteries sont des procaryotes photosynthetiques dont certaines, comme calothrix pcc 7601, sont capables de moduler le contenu pigmentaire de leurs antennes collectrices de l'energie lumineuse (phycobilisomes) en reponse a des variations de la qualite spectrale de la lumiere. En lumiere verte, les phycobilisomes contiennent de la phycoerythrine, tandis qu'en lumiere rouge ils contiennent de la phycocyanine-2. Cette propriete est appelee adaptation chromatique complementaire (acc). Le travail presente permet de conclure que la regulation de l'acc implique au moins trois effecteurs proteiques ayant de l'affinite pour l'adn. En lumiere verte, deux de ces effecteurs (rcaa et rcab) ont de l'affinite pour la region promoteur de l'operon cpeba, qui specifie la phycoerythrine. Le troisieme effecteur (rcad) a de l'affinite, en lumiere rouge, pour la region promoteur de l'operon cpc2, qui specifie la phycocyanine-2. Seules les formes phosphorylees de rcaa et de rcad ont de l'affinite pour leurs cibles respectives. Par l'intermediaire d'experiences d'empreinte a la dnase i sur les promoteurs, les cibles des deux phosphoproteines ont ete determinees. Rcaa a pour cible une region longue de 22 nucleotides, composee de deux hexameres repetes directement et centree en position -57 par rapport au site d'initiation de la transcription de l'operon cpeba. Rcad, possede de l'affinite pour deux regions semblables, de 22 nucleotides de long, centrees en -175 et -255 par rapport au site d'initiation de la transcription de l'operon cpc2. Ces deux regions sont aussi composees de deux hexameres repetes directement, mais ils sont de sequence differente de ceux composant la cible de rcaa. Les resultats obtenus au cours de la recherche et de la caracterisation d'effecteurs transcriptionnels nous permettent, finalement, de proposer un modele pour la regulation transcriptionnelle de l'expression des operons cpeba et cpc2 au cours de l'adaptation chromatique complementaire chez calothrix pcc 7601
APA, Harvard, Vancouver, ISO, and other styles
7

Kone, Aboudramane. "Récentes avancées dans la synthèse de topopyrones et de calothrixines synthèse et évaluation biologique de molécules de type benzimidazolyl-chalcone." Thesis, Nantes, 2018. http://www.theses.fr/2018NANT4039/document.

Full text
Abstract:
Ce travail a pour objet la synthèse et l’évaluation de molécule bioactives pouvant contribuer efficacement à la lutte contre certains germes infectieux et le cancer. Le premier volet consiste en la synthèse de composés d’origine naturelle, les topopyrones et les calothrixines. En ce qui concerne les topopyrones, cinq hétérodiènes ont été synthétisés et leurs réactivités ont été étudiées face à un diénophile de type naphthoquinone suivant une réaction de cycloaddition [4+2] de Diels-Alder. . Cela a conduit l’édification d’un squelette tétracyclique proche des topopyrones. Quant aux calothrixines, nous avons exploré deux nouvelles voies qui ont abouti à la synthèse de la calothrixine B et d’un analogue bromé. Dans le second volet, en nous basant sur le concept pharmacochimique de juxtaposition d’entités bioactives, nous avons conceptualisé puis synthétisé douze benzimidazolyl-chalcones et une chroménone. Les molécules ainsi obtenues ont fait l’objet d’une évaluation de leurs activités anticancéreuses vis-à-vis de sept lignes cellulaires cancéreuses humaines et une lignée de fibroblastes normaux de la peau humaine. Ces composés ont montré de bonnes activités anticancéreuses quelque soit la lignée. Ces activités sont supérieures à celles de la Roscoviitine mais restent inférieures à celles du Taxol. Cependant, les molécules synthétisées se sont montrées moins toxiques que la molécule de référence Taxol
This work aims is the synthesis and evaluation of bioactive molecules that can effectively contribute to fight against some infectious germs and the cancer. The first component consists of the synthesis of naturally occurring compounds, topopyrones and calothrixins. With regard to the topopyrones, five heterodienes were synthesized and their reactivities were studied, compared with a naphthoquinone-type dienophile following a Diels-Alder [4+2] cycloaddition reaction. This led to the construction of a tetracyclic skeleton close to topopyrones. As for calothrixins, we explored two new pathways that resulted in the synthesis of calothrixin B and an bromine analogue. In the second part, based on the pharmacochemical concept of juxtaposition of bioactive entities, we conceptualized and synthesized twelve benzimidazolyl-chalcones and one chromenone. The molecules thus obtained were evaluated for their anticancer activities against seven human cancer cell lines and a normal fibroblast line of human skin. These compounds showed good anticancer activities regardless of the line. These activities are superior to those of Roscovitine but lower than those of Taxol. However, the synthesized molecules were less toxic than that of the Taxol reference molecule
APA, Harvard, Vancouver, ISO, and other styles
8

JIA, LIN. "Adaptation de la cyanobacterie calothrix pcc 7601 a son environnement, caracterisation de deux elements de regulation : rcaa et cyaa." Paris 7, 1996. http://www.theses.fr/1996PA077224.

Full text
Abstract:
Les cyanobacteries sont des procaryotes qui effectuent les reactions de la photosynthese en degageant de l'oxygene. Parmi elles, la souche filamenteuse calothrix pcc 7601 possede des proprietes physiologiques remarquables: elle est photoheterotrophe facultative, elle possede de plus les genes nif et peut differencier des proheterocystes ; elle peut aussi differencier des hormogonies, petites cellules mobiles remplies de vesicules a gaz conferant aux cellules une flottabilite ; enfin, elle peut moduler la nature des pigments de ses antennes photocollectrices (phycobilisomes) selon la qualite spectrale de la lumiere (adaptation chromatique complementaire). En lumiere rouge, les cellules contiennent de la phycocyanine-2 (operon cpc2), tandis qu'en lumiere verte elles contiennent de la phycoerythrine (operons cpe). Cette adaptation resulte d'un controle transcriptionnel des operons correspondants, rcaa et rcab en lumiere verte pour cpeba, rcad en lumiere rouge pour cpc2 etant des proteines affines specifiques. Une methode de purification a ete developpee qui a permis d'obtenir une preparation tres homogene de la proteine rcaa. Par des experiences de transcription in vitro controlee, nous avons montre que rcaa modifiait l'efficacite et la specificite de transcription pour au moins quatre promoteurs d'operons codant pour des phycobiliproteines, et que les proprietes de rcaa en tant que facteur de transcription etaient affectees par son etat de phosphorylation. A partir de la sequence de peptides internes a rcaa, et par des experiences d'amplification de type pcr, le gene rcaa a ete clone. Apres sequencage, il est apparu que rcaa presente beaucoup d'homologie avec les glutamyl tarn synthetases (gltx), observation dont les consequences sont discutees. Un modele est propose pour la regulation transcriptionnelle de l'expression des operons codant pour les composants majeurs des phycobilisomes, lors de l'adaptation chromatique complementaire chez calothrix pcc 7601. Enfin, le gene cyaa de calothrix pcc 7601 a ete caracterise. Il code pour une adenylate cyclase (686 residus) de classe iii (universelle) de structure tres originale, la partie n-terminale (aa 1-260) et la partie centrale (aa 321-450) formant deux domaines, respectivement tres similaires aux histidine kinases (sensors) et aux transmetteurs (response regulators) des systemes a deux composants tres repandus dans le monde bacterien
APA, Harvard, Vancouver, ISO, and other styles
9

Kendall, Shana. "Effects of Aerial Exposure on Preservation of Low-Temperature Calothrix Biosignatures in Silica Sinter from Queen's Laundry, Yellowstone National Park, USA." PDXScholar, 2015. https://pdxscholar.library.pdx.edu/open_access_etds/2537.

Full text
Abstract:
Mineral-depositing hydrothermal ecosystems, such as the hot springs in Yellowstone National Park, provide an unparalleled opportunity to document how microbial biosignatures form and contribute to the body of evidence indicative of the microbial inhabitants of active hot springs. Mineralization of microbial communities in silica-depositing hot springs can result in the preservation of microbial biofacies in the geologic record. To determine the effects of prolonged aerial exposure on the preservation potential of mid-to-low temperature cyanobacteria dominated microbial communities that are typically permineralized in the siliceous sinter, modern biofacies samples of such communities were collected from the active and inactive parts of Queen's Laundry hot spring in Yellowstone National Park. The strategy of the research was to: (1) perform qualitative and quantitative characterization of structural and morphometric attributes of subaqueous and aerially exposed Calothrix biofacies samples collected from terraces; and (2) determine whether prolonged subaerial exposure affected the fidelity of morphological biosignatures (i.e., biofabrics and microbial cells) in the aerially exposed samples. To ensure that the permanently subaqueous and aerially exposed samples were comparable, a protocol developed to describe structural and morphological attributes of stromatolites was utilized to characterize the hot spring samples. Morphometric analysis of both types of Calothrix biofacies samples (i.e., partly silicified subaqueous and aerially exposed samples) revealed the presence of: distinct microbially influenced structures; thicker lamina at or near the base of the terraces; the greatest density of microorganisms in microbial structures; and increased microbial structure flatness as height of the microbial structures within the terrace proper increased. These characteristics were also used to provide a means to interpret the environmental conditions within which the terrace structures developed. To determine whether prolonged subaerial exposure affected the morphological fidelity of the biosignatures in the aerially exposed samples, the microstructure of these samples was studied in detail petrographically. A silica layer defined the boundary between laminae and was referred to as the "capping" silica deposit because it was found to "cap" all of the laminae in the Calothrix biofacies samples. The top most capping silica deposit of the aerially exposed Calothrix biofacies samples was found to be distinctly different from the capping silica deposits in the interior of the same sample and in the partly mineralized subaqueous Calothrix biofacies samples. The aerially exposed capping silica deposit was milky and glassy in appearance and contained fine laminations. The fine laminations were not found in any laminae of the biofacies samples. Another key finding of the project is a new evaluation of the preservation potential of the Calothrix terrace samples. Petrographic observations revealed that preservation of the morphological fidelity of the laminae and the microstructures within them was significantly higher within the microbial shrub and domical structures in both the partially silicified subaqueous and aerially exposed Calothrix biofacies samples than other microstructure types observed. In summary, a detailed morphometric characterization protocol confirmed that it is possible to identify similar features in Calothrix biofacies found inside the active part of the hot spring as well as beyond the perimeter (i.e., aerially exposed for ≥ 3 years) at multiple spatial scales; only the top-most capping silica deposit of the aerially exposed samples is altered by subaerial exposure; the preservation potential for Calothrix biofabrics is highest within shrub and domical structures; and morphometric analysis on a variety of Calothrix terraced structures could lend insight into the factor(s) responsible for terrace formation. This research lays the foundation for analyzing similar structures in geologically older rocks and for recognizing how microbial organisms can and likely have influenced terrace formation. The work also suggests that aerial processes can alter such samples and biosignatures within them. It is recommended that additional non-destructive and spatially correlated analytical methods be considered in the search for chemofossils in the sinter surrounding filaments past and present.
APA, Harvard, Vancouver, ISO, and other styles
10

Noubir, Sanaâ. "Adaptation de la cyanobacterie calothrix pcc 7601 a son environnement : caracterisation de rcad, un effecteur de la transcription implique dans la regulation de l'adaptation chromatique complementaire." Paris 11, 2000. http://www.theses.fr/2000PA112389.

Full text
Abstract:
Les cyanobacteries sont des procaryotes photosynthetiques qui ont developpe plusieurs mecanismes d'adaptation aux changements de l'environnement (lumiere et nutriments). La souche calothrix pcc 7601 est capable, en particulier, de moduler, en fonction de la longueur d'onde de la lumiere incidente, la composition en phycobiliproteines de son antenne, le phycobilisome, synthetisant : phycoerythrine (pe) en lumiere verte et phycocyanine-2 (pc2) en lumiere rouge. Ce phenomene, appele adaptation chromatique complementaire (acc), se caracterise par une regulation de l'expression des genes, essentiellement au niveau transcriptionnel. Celle-ci implique au moins deux facteurs de transcription : rcaa et rcad affines, respectivement, de p c p e b a, promoteur de l'operon cpeba, qui specifie pe, et de p c p c 2 celui de l'operon cpc2, qui specifie pc2. Afin de mieux comprendre l'acc, la proteine rcad a ete purifiee et microsequencee pour cloner le gene rcad. Le sequencage a montre la presence d'un gene, rcag, immediatement en aval. La proteine rcad a ete surproduite sous forme etiquetee his 6, ce qui a permis de confirmer la liaison de cette proteine a p c p c 2. Rcad native se lie aussi a p c p c 1 et p a p c 1, promoteurs d'operons codant pour la phycocyanine-1 et l'allophycocyanine. Un site unique de demarrage de transcription a ete cartographie et, par rt-pcr, l'existence d'un operon rcadg a ete demontree. Des etudes in silico ont permis de proposer que rcad et rcag, a l'exemple des proteines e2 et e1 des papillomavirus, interagiraient pour permettre l'activation des genes cibles. Un mutant rcad a ete construit par substitution allelique. Une mutation faux-sens a ete introduite dans rcad afin d'eviter un effet polaire sur rcag. L'analyse biochimique du phenotype de ce mutant a montre que le rapport pe/pc etait modifie. Les blots d'arn realises ont permis de voir que, lors d'un transfert des cellules de lumiere verte a rouge, la transcription des operons cpc2, mais aussi celle d'apc1 et de cpc1 etait affectee dans le mutant. Rcad jouerait donc un role plus general que precedemment envisage dans la regulation de l'expression des genes specifiant les phycobiliproteines, remettant en cause le modele simple prealablement propose pour l'acc.
APA, Harvard, Vancouver, ISO, and other styles

Book chapters on the topic "Calothrixin"

1

Pentecost, Allan. "Growth and Calcification of Calothrix — Dominated Oncolites from Northern England." In Origin, Evolution, and Modern Aspects of Biomineralization in Plants and Animals, 443–54. Boston, MA: Springer US, 1989. http://dx.doi.org/10.1007/978-1-4757-6114-6_35.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Kahn, Katherine, Didier Mazel, Jean Houmard, Nicole Tandeau de Marsac, and Michael R. Schaefer. "Tn5469 Mutagenesis of Chromatic Adaptation Genes in Calothrix sp. strain PCC 7601." In Photosynthesis: from Light to Biosphere, 2393–96. Dordrecht: Springer Netherlands, 1995. http://dx.doi.org/10.1007/978-94-009-0173-5_563.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Matthijs, Hans C. P., Jeroen H. Geerdink, Hans Balke, Andrea Haker, Hendrik Schubert, Luuc R. Mur, and Klaas J. Hellingwerf. "Sensing of Green Light in Complementary Chromatic Adaptation of the Cyanobacterium Calothrix sp." In The Phototrophic Prokaryotes, 187–94. Boston, MA: Springer US, 1999. http://dx.doi.org/10.1007/978-1-4615-4827-0_22.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Kahn, Katherine, Roxanne P. Nieder, and Michael R. Schaefer. "RpbA Functions in Transcriptional Control of the Constitutive Phycocyanin Gene Set in Calothrix sp. PCC 7601." In The Phototrophic Prokaryotes, 77–82. Boston, MA: Springer US, 1999. http://dx.doi.org/10.1007/978-1-4615-4827-0_9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

De Marsac, Nicole Tandeau, Didier Mazel, Thierry Damerval, Gérard Guglielmi, Véronique Capuano, and Jean Houmard. "Photoregulation of gene expression in the filamentous cyanobacterium Calothrix sp. PCC 7601: light-harvesting complexes and cell differentiation." In Molecular Biology of Photosynthesis, 195–228. Dordrecht: Springer Netherlands, 1988. http://dx.doi.org/10.1007/978-94-009-2269-3_10.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Matthijs, Hans C. P., Hans Balke, Udo M. van Hes, and Luuc R. Mur. "Application of Light-Emitting Diodes (Led’s) in Algal Culture: In Culture Light Harvesting Efficiency of the Green Alga Chlorella and the Cyanobacterium Calothrix." In Photosynthesis: Mechanisms and Effects, 4129–34. Dordrecht: Springer Netherlands, 1998. http://dx.doi.org/10.1007/978-94-011-3953-3_958.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Calothrixin"

1

Singh, Tripti, Su Xu, Sadanandan Velu, and Santosh K. Katiyar. "Abstract 5386: Calothrixin A, a metabolite fromCalothrixcyanobacteria, inhibits class I histone deacetylases leading to suppression of cell growth and induction of apoptosis in human melanoma cells." In Proceedings: AACR 106th Annual Meeting 2015; April 18-22, 2015; Philadelphia, PA. American Association for Cancer Research, 2015. http://dx.doi.org/10.1158/1538-7445.am2015-5386.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "Calothrixin"

1

Kendall, Shana. Effects of Aerial Exposure on Preservation of Low-Temperature Calothrix Biosignatures in Silica Sinter from Queen's Laundry, Yellowstone National Park, USA. Portland State University Library, January 2000. http://dx.doi.org/10.15760/etd.2534.

Full text
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography