Relevant bibliographies by topics / Central African Country

Contents

  1. Journal articles
  2. Dissertations / Theses
  3. Books
  4. Book chapters
  5. Conference papers
  6. Reports

Academic literature on the topic 'Central African Country'

Author: Grafiati
Published: 4 June 2021
Last updated: 19 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Central African Country.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Central African Country"

1

TANGWA, GODFREY B., and NCHANGWI SYNTIA MUNUNG. "Sprinting Research and Spot Jogging Regulation: The State of Bioethics in Cameroon." Cambridge Quarterly of Healthcare Ethics 20, no. 3 (2011): 356–66. http://dx.doi.org/10.1017/s0963180111000041.

Full text
Abstract:
Cameroon is a Central African country lying at latitude 6°N and longitude 12°E. The country has a surface area of circa 475,442 square kilometers, and is bordered by several other African countries: Nigeria, Chad, the Central African Republic, the Republic of Congo, Equatorial Guinea, and Gabon. With a population of nearly 20 million inhabitants, Cameroon is a very diverse country, geographically, culturally, and linguistically.
APA, Harvard, Vancouver, ISO, and other styles
2

Ferreira, Rialize. "SOUTH AFRICA’S PARTICIPATION IN THE CENTRAL AFRICAN REPUBLIC AND DEMOCRATIC REPUBLIC OF CONGO PEACE MISS IONS: A COMPARISON." Politeia 33, no. 2 (2016): 4–27. http://dx.doi.org/10.25159/0256-8845/1776.

Full text
Abstract:
After the peacekeeping tragedy in the Central African Republic (CAR) in March 2013, South Africa’s participation in peacekeeping missions on the African continent is under investigation. Military personnel of the South African National Defence Force recently took part in both conventional and unconventional, asymmetric warfare in two peace missions, one in the CAR and one in the Democratic Republic of Congo (DRC). In the CAR a unilateral military agreement between states existed, while in the DRC a United Nations (UN) mandate for multilateral offensive peacekeeping was authorised. The rationale for South Africa’s participation in African missions is important while the country is serving as a non-permanent member of the UN Security Council. Its role as one of the leading nations in Africa to deploy peacekeepers is central to its foreign policy. The article focuses on contrasting operations, and diverse challenges such as the authorisation of mandates, funding, logistics and shortcomings in asymmetric training for irregular “new wars” where peacekeepers are required to protect civilians in countries to which they owe little allegiance. Lessons learnt from the widely differing operational experiences in these recent peace missions are discussed.
APA, Harvard, Vancouver, ISO, and other styles
3

Mathenjwa, Mbuzeni. "THE ROLE OF LOCAL GOVERNMENT IN STRENGTHENING DEMOCRACY." Journal of Law, Society and Development 3, no. 1 (2016): 115–31. http://dx.doi.org/10.25159/2520-9515/1091.

Full text
Abstract:
The place and role of local government within the structure of government in Africa has attracted much public interest. Prior to and after independence, African countries used local government as the administrative units of central governments without their having any legal status, to the extent that local authorities were under the strict control of central governments. The autonomy of local government is pivotal in the democratisation of a country. The United Nations, European Union and African Union have adopted treaties to promote the recognition and protection of local government in the state parties’ constitutions. Accordingly, this article explains the status of local government in Africa and its impact on strengthening democracy in African states.
APA, Harvard, Vancouver, ISO, and other styles
4

Rich, Paul. "United States containment policy, South Africa and the apartheid dilemma." Review of International Studies 14, no. 3 (1988): 179–94. http://dx.doi.org/10.1017/s0260210500113257.

Full text
Abstract:
Since the early 1970s, South Africa has become an increasingly important issue within US foreign policy after a long period of benign neglect. For a considerable part of the post-war period, US decision-makers felt it possible to avoid a direct confrontation with the moral and ethical issues involved in the South African government's policy of apartheid; the relative geographical isolation of the country from many central theatres of East–West conflict in central Europe, the Middle East and South East Asia ensured that South Africa was not in the front line of strategically vital states. Furthermore, South Africa's membership of the Commonwealth until 1960 meant that, for many US policy makers, South Africa could be seen as an issue within Commonwealth relations and thus not one for direct US involvement.
APA, Harvard, Vancouver, ISO, and other styles
5

Osiak, Martyna. "Dental support for African residents." Prosthodontics 68, no. 1 (2018): 108–12. http://dx.doi.org/10.5604/01.3001.0011.6812.

Full text
Abstract:
Central African Republic is the poorest country in the world (Global Finance Magazine, 2017). In Monasao, a small town located in the heart of the savannah, surrounded by virgin jungles, I spent three months working as a dentist in a small health clinic.
APA, Harvard, Vancouver, ISO, and other styles
6

Alecu, Ana Raluca, and Andrei Miroiu. "Christian Dimensions of Violence: The Séléka/Anti-Balaka Militias And The Lord’s Resistance Army In The Central African Republic." Studia Universitatis Babeș-Bolyai Studia Europaea 66, no. 1 (2021): 5–23. http://dx.doi.org/10.24193/subbeuropaea.2021.1.01.

Full text
Abstract:
"Beginning in 2013, the Central African Republic has been engulfed in a civil war pitting successive governments against a substantial number of armed groups who also compete against each other for control over territory, population and resources. Some of these groups are claiming to be defenders of religious groups in the country, with the Séléka militias fighting for the Muslim communities and the anti-Balaka groups claiming Christian roots and inclinations. Other religiously inspired armed groups such as the Lord’s Resistance Army are also present in the country. The following study is an attempt to understand how the “religious” label can be applied to such armed groups and whether it can influence their behavior, thus bringing into light a valuable, albeit lesser known example on how AGs and religion are connected in contemporary Africa. Keywords: armed groups, religion, Central African Republic, violence, civil war "
APA, Harvard, Vancouver, ISO, and other styles
7

Steyn, H. Christina. "South African New Age Prophets: Past and Present." Religion and Theology 9, no. 3-4 (2002): 282–96. http://dx.doi.org/10.1163/157430102x00151.

Full text
Abstract:
AbstractThis article explores the visions, beliefs and prophecies of three remarkable South Africans. Johanna Brandt, Jan Smuts, and Joseph Busby espoused ideas that are central to New Age thought today. All three may be seen as Prophets': Brandt as the messenger of God who receives visions and is compelled to proclaim it to the nation; Smuts as the visionary with remarkable insight into the nature of reality; and Busby as the mouthpiece of an Ascended Master of the Spiritual Hierarchy who conveys important messages to the South African people. Brandt and Smuts were ahead of their time and their work was not at all well received by the local community. Brandt was eventually censored by her church and although Smuts was honoured in many circles for his statesmanship, his scientific theories with their metaphysical implications were spurned in this country. Busby, on the other hand, was not a particularly well-known person outside New Age circles, but he had a following among whom his work was welcomed and honoured. From this short review, it is clear that the central concepts of New Age philosophy have been taught in South Africa for many years and today it has penetrated the minds and beliefs of many South Africans.
APA, Harvard, Vancouver, ISO, and other styles
8

Longué, D. R. S., A. Galzi-Pinel, S. Semballa, I. Zinga, D. Fargette, and O. Traoré. "First Report of Rice yellow mottle virus in Rice in the Central African Republic." Plant Disease 98, no. 1 (2014): 162. http://dx.doi.org/10.1094/pdis-04-13-0418-pdn.

Full text
Abstract:
Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.
APA, Harvard, Vancouver, ISO, and other styles
9

Otekunrin, Olutosin Ademola, Oluwaseun Aramide Otekunrin, Barbara Sawicka, and Idris A. Ayinde. "Three decades of fighting against hunger in Africa: Progress, challenges and opportunities." World Nutrition 11, no. 3 (2020): 86–111. http://dx.doi.org/10.26596/wn.202011386-111.

Full text
Abstract:
Tackling hunger is a challenge for many African governments because of its endemic nature on the continent. Many African countries have found it difficult to achieve significant reductions in hunger and malnutrition since 1990. In this paper, we review the progress of African countries in the fight against hunger over the past three decades, using the Global Hunger Index (GHI) scores. Ghana had the best GHI improvement (-53.1%) while Zimbabwe and Central African Republic had slightly increased GHI scores (+1.6%). Within this time period, few countries had significant reductions in their GHI scores, while some suffered increases. Furthermore, in assessing the three indicators of GHI: (i) prevalence of undernourishment (percent population), (ii) prevalence of stunting in children (%) and (iii) prevalence of wasting in children (%), we found that no country in Africa was able to achieve all three targets. Six countries (Tunisia, Ghana, South Africa, Morocco, Mauritius and Algeria) were able to achieve targets for two of these while the majority achieved only one. We present country-level evidence of clear links between GHI scores with score for human development, social protection and terrorism. Some challenges that made the zero hunger target a difficult task in Africa are reviewed while opportunities for moving the continent towards the zero-hunger target by 2030 are also explored.
APA, Harvard, Vancouver, ISO, and other styles
10

Okeke, Remi Chukwudi, and Sylvia Uchenna Agu. "Global Challenges in Democratic Local Governance of the African States." International Letters of Social and Humanistic Sciences 71 (July 2016): 33–39. http://dx.doi.org/10.18052/www.scipress.com/ilshs.71.33.

Full text
Abstract:
Local governments in many parts of Africa are yet to be fully accepted as important levels of government (by political actors at the central and sub-central levels). This gives rise to the contradictory scenario whereby such political actors at the central and sub-central levels remain the apostles of centralization on one hand and exponents of democracy as a model of national government on the other hand. Nigeria is the most populous African country. And this marginalization of the local government in the democratic process is prevalent in Nigeria. Invariably, the pervasive effect of this condition, as it negatively affects the availability of dividends of democracy to the African citizen, is worrisome. In the meantime, the continent of Europe is perceived in the study as having possibly taken local government understanding to a model level of local self-governance, through its European Charter of Local Self-Government. Europe is thus, seen in this study as a region in the lead in situating the local government paradigm, within its proper democratic context. The theoretical framework of deliberative democracy is adopted in the study to engage African states to embrace local self-governance as a critical component of democratization.
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "Central African Country"

1

Gassama, Musa Yerro. "Opportunity and Sex Offending by International Peacekeepers in the Central African Republic." ScholarWorks, 2018. https://scholarworks.waldenu.edu/dissertations/5337.

Full text
Abstract:
Despite their peacekeeping role in the management of internal armed conflicts, some military peacekeepers have sexually exploited local populations in host countries, resulting in dire social and health consequences and threats to the success of international peace operations. Although researchers have examined sexual violence committed by peacekeepers, few researchers, if any, have used routine activities theory to examine sex offending by peacekeepers. The purpose of this study was to explore the extent to which situational opportunities influenced international military peacekeepers' engagement in the sexual exploitation of civilians in the Central African Republic, a peacekeeping host country. Data were collected from face-to-face interviews with 15 research participants, including local witnesses, military officers, representatives of civil society organizations, and United Nations policy makers, and from public records obtained from online sources. Data were coded using an inductive coding strategy and then analyzed using thematic analysis. The findings indicated that both the local and peacekeeping conditions, including lack of deterrence and accountability mechanisms, heightened the vulnerability of local populations to sex predation and motivated peacekeeper sex offenders to engage in sex offending. Local community leaders, civil society organizations, peacekeepers, and policy makers could use study findings to promote educational programs on the institutional responsibility to protect vulnerable civilians as well as shape policies to prevent the commission of sexual exploitation by peacekeepers. These actions may also help susceptible civilians, especially women and girls, to be aware of the risks linked to their vulnerability and empower them to seek legal redress.
APA, Harvard, Vancouver, ISO, and other styles
2

Freercks, Robert Jeremy. "The impact of vascular calcification on ambulatory and central aortic blood pressure in a South African dwelling dialysis population : a clinical, radiological and pathophysiological study of vascular health in a young prevalent dialysis population in a developing country." Master's thesis, University of Cape Town, 2011. http://hdl.handle.net/11427/11995.

Full text
Abstract:
Includes abstract.<br>Includes bibliographical references.<br>In Sub-Saharan Africa, the prevalence of vascular calcification (VC) in CKD-5D is unknown. We undertook to determine the effect of ethnicity on VC, the risk factors for VC, the utility of abdominal X-ray (AXR) in predicting coronary calcium score (CCS) and the effect of VC on central aortic systolic pressure (CASP) and left ventricular mass index (LVMI) in South African dialysis patients. ... Black race significantly protects from VC in South African CKD-5D patients and warrants further study. The AXR is a useful screening tool for CCS in our population. VC does not appear to influence CASP in our population.
APA, Harvard, Vancouver, ISO, and other styles
3

Mitchell, Keva Latrice. "Perceptions from the Principals’ Desks: African American Elementary Principals and Reading Curriculum and Instruction in a Central Florida County." [Tampa, Fla.] : University of South Florida, 2004. http://purl.fcla.edu/fcla/etd/SFE0000398.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

De, Sousa Vanessa Alexandre. "The impact of a merger on the motivational levels and organisational culture of amalgamated beverage industries employees in country region." Thesis, Bloemfontein : Central University of Technology, Free State, 2006. http://hdl.handle.net/11462/69.

Full text
Abstract:
Thesis (M. Tech.) -- Central University of Technology, Free State, 2006<br>In today’s dynamic and uncertain business environment, employees are required to work together to achieve a common goal. An organisation cannot survive without a highly motivated and progressive workforce. Management need to be highly innovative and adaptive, to survive the intensity of competition and change. This study is based on the conviction that enhancing and sustaining employee motivation is a manager’s major function. In effect, management need to create and maintain a culture that fosters motivation, and determine whether employees are culturally adaptable, when two established cultures merge as one. Against this background, the focus fell on attaining optimum performance and a culture that evokes a spirit of co-operation and is conducive to motivating employees to work willingly and effectively. The Amalgamated Beverage Industry was selected for the purpose of this study. The perceptions and opinions of management and that of the lower level employees were examined to determine the impact on the work motivational levels and organiastional culture within Country Region employees. A probable influence was also given on the possible factors contributing to the maintained level of organisational culture and the high motivational levels within ABI. Attention was also focused on culture change and its possible impact on employees.
APA, Harvard, Vancouver, ISO, and other styles
5

Kinuthia, Wanyee. "“Accumulation by Dispossession” by the Global Extractive Industry: The Case of Canada." Thèse, Université d'Ottawa / University of Ottawa, 2013. http://hdl.handle.net/10393/30170.

Full text
Abstract:
This thesis draws on David Harvey’s concept of “accumulation by dispossession” and an international political economy (IPE) approach centred on the institutional arrangements and power structures that privilege certain actors and values, in order to critique current capitalist practices of primitive accumulation by the global corporate extractive industry. The thesis examines how accumulation by dispossession by the global extractive industry is facilitated by the “free entry” or “free mining” principle. It does so by focusing on Canada as a leader in the global extractive industry and the spread of this country’s mining laws to other countries – in other words, the transnationalisation of norms in the global extractive industry – so as to maintain a consistent and familiar operating environment for Canadian extractive companies. The transnationalisation of norms is further promoted by key international institutions such as the World Bank, which is also the world’s largest development lender and also plays a key role in shaping the regulations that govern natural resource extraction. The thesis briefly investigates some Canadian examples of resource extraction projects, in order to demonstrate the weaknesses of Canadian mining laws, particularly the lack of protection of landowners’ rights under the free entry system and the subsequent need for “free, prior and informed consent” (FPIC). The thesis also considers some of the challenges to the adoption and implementation of the right to FPIC. These challenges include embedded institutional structures like the free entry mining system, international political economy (IPE) as shaped by international institutions and powerful corporations, as well as concerns regarding ‘local’ power structures or the legitimacy of representatives of communities affected by extractive projects. The thesis concludes that in order for Canada to be truly recognized as a leader in the global extractive industry, it must establish legal norms domestically to ensure that Canadian mining companies and residents can be held accountable when there is evidence of environmental and/or human rights violations associated with the activities of Canadian mining companies abroad. The thesis also concludes that Canada needs to address underlying structural issues such as the free entry mining system and implement FPIC, in order to curb “accumulation by dispossession” by the extractive industry, both domestically and abroad.
APA, Harvard, Vancouver, ISO, and other styles

Books on the topic "Central African Country"

1

Cruson, Daniel. The slaves of central Fairfield County, Connecticut. History Press, 2007.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Rwanda: A country torn apart. Lerner Publications, 2000.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Phillis, Gershator, and Greenseid Diane ill, eds. Kallaloo!: A Caribbean tale. Marshall Cavendish, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Centre for African Family Studies. In-country training services in family planning. Centre for African Family Studies, 1993.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Canada. Parliament. House of Commons. Bill: An act to authorize the corporation of the township of Collingwood, in the county of Grey, to impose and collect tolls or harbor dues, and for other purposes. I.B. Taylor, 2002.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Publications, USA International Business. Central African Republic Country. 3rd ed. Intl Business Pubns USA, 2001.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

Publications, USA International Business. Central African Republic Country Study Guide. 2nd ed. International Business Publications, USA, 2000.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Kelly, Robert C. Central African Republic Country Review 2000. CountryWatch.com, 1999.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

USA, International Business Publications. Central African Republic Country Study Guide. International Business Publications, USA, 2003.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

USA, USA IBP. Central African Republic Country Study Guide. International Business Publications, USA, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "Central African Country"

1

Tesfaye, Argaw, and Arragaw Alemayehu. "Climate Change and Variability on Food Security of Rural Household: Central Highlands, Ethiopia." In African Handbook of Climate Change Adaptation. Springer International Publishing, 2021. http://dx.doi.org/10.1007/978-3-030-45106-6_188.

Full text
Abstract:
AbstractThis chapter analyzes the impact of climate change and variability on food security of rural households in the central highlands of Ethiopia taking Basona Werana district as a case study site. Data were obtained from 123 households selected using simple random sampling from three agro ecological zones. Key informant interviews and focus group discussion (FDG) were used to supplement the data obtained from household survey. The monthly rainfall and temperature data are for 56 points of 10 × 10 km grids reconstructed from weather stations and meteorological satellite observations, which cover the period between 1983 and 2016. Standardized rainfall anomaly (SRA), linear regression (LR), and coefficient of variation (CV) are used to examine inter-annual and intra-annual variability of rainfall. Annual and seasonal rainfalls show decreasing trends over the period of observation. The decreasing trends in annual and March–May (Belg) rainfall totals exhibit statically significant decreasing trends at p = 0.05 level. Kiremt (June–September) shows statically significant decreasing trends at p = 0.1 level. Mean annual maximum and minimum temperatures show statically significant increasing trends at p = 0.05 level. More than 80% of households perceived that the climate is changing and their livelihoods (crop and livestock production) are impacted. The district belongs to one of the most vulnerable areas to climate change and variability in the country where large proportions of households (62%) are under different food insecurity classes. Results suggest that local level investigations are useful in developing context-specific climate change adaptation.
APA, Harvard, Vancouver, ISO, and other styles
2

Njarui, D. M. G., M. Gatheru, and S. R. Ghimire. "Brachiaria Grass for Climate Resilient and Sustainable Livestock Production in Kenya." In African Handbook of Climate Change Adaptation. Springer International Publishing, 2021. http://dx.doi.org/10.1007/978-3-030-45106-6_146.

Full text
Abstract:
AbstractBrachiaria grass is a “climate smart” forage that produces high amount of palatable and nutritious biomass for livestock and performs well in infertile soils, sequesters carbon in soil, and provides several environmental benefits. The objective of the study was to validate the productivity of Brachiaria grass and upscale the suitable cultivars for improved livestock feed resources in Kenya. We assume integrating Brachiaria grass into mixed crop-livestock system will enhance feed availability and livestock productivity, leading to increased food and nutrition security. Farmer participatory approach was adopted to evaluate and promote four Brachiaria grass (Brachiaria decumbens cv. Basilisk, B. brizantha cvs. Xaraes, Piata, and MG-4) in the Central Highland and Eastern Midland of Kenya. The extension/advisory approaches used to promote Brachiaria grass cultivars included field days, village knowledge centres, agricultural shows, posters, and linkages with other institutions through multi-actor platform established under the InnovAfrica project. Generally, Brachiaria grass cultivars were more productive than the control (Rhodes grass) in most harvests reaching peak of 5.1–7.7 t/ha in the fifth harvest. For Rhodes grass, DM was less than 4 t/ha in all harvest and died by sixth harvest. Similarly, based on farmers’ evaluation using phenotypic traits, the Brachiaria grass cultivars had higher score than Rhodes grass except cv. Piata. The mean score ranged from 2.75 to 3.19 for Brachiaria cultivars, while for Rhodes the mean score was 2.63. Within 2 years of intervention, over 4000 farmers in the 2 project sites and additional 1500 farmers from other parts of the country have planted the Brachiaria grass. The demand for Brachiaria grass seeds is increasing due to benefits gained, e.g., increased milk production from dairy cattle fed on the grass. Our study will quantify the associated benefits from cultivation of Brachiaria grass with respect to a set of ecological, food and nutrition security, and social-economic indicators.
APA, Harvard, Vancouver, ISO, and other styles
3

Quenum, Gandome Mayeul L. D., Nana A. B. Klutse, Eric A. Alamou, Emmanuel A. Lawin, and Philip G. Oguntunde. "Precipitation Variability in West Africa in the Context of Global Warming and Adaptation Recommendations." In African Handbook of Climate Change Adaptation. Springer International Publishing, 2021. http://dx.doi.org/10.1007/978-3-030-45106-6_85.

Full text
Abstract:
AbstractIt is commonly accepted that the Earth’s climate is changing and will continue to change in the future. Rising temperatures are one of the direct indicators of global climate change. To investigate how the rising global temperature will affect the spatial pattern of rainfall in West Africa, the precipitation and potential evapotranspiration variables from ten Global Climate Models (GCMs) under the RCP8.5 scenario were driven by the Rossby Centre regional atmospheric model (RCA4) from the COordinated Regional Climate Downscaling EXperiment (CORDEX) and analyzed at four specific global warming levels (GWLs) (i.e., 1.5 °C, 2.0 °C, 2.5 °C, and 3.0 °C) above the preindustrial level. This study utilized three indices, the precipitation concentration index (PCI), the precipitation concentration degree (PCD), and the precipitation concentration period (PCP) over West Africa to explore the spatiotemporal variations in the characteristics of precipitation concentrations. Besides, the analysis of the effect of the specified GWLs on the Consecutive Dry Days (CDD), Consecutive Wet Days (CWD), and frequency of the intense rainfall events allowed to a better understanding of the spatial and temporal patterns of extreme precipitation in West Africa. Results reveal that, for the projections simulations and at each GWL, the rainfall onset starts one month earlier in the Gulf of Guinea in response to the control period. To encourage adaptation to the various changes in climate in general, and particularly in respect of rainfall, this study proposes several adaptation methods that can be implemented at the local (country) level, as well as some mitigation and adaptation strategies at the regional (West African) level.
APA, Harvard, Vancouver, ISO, and other styles
4

Jjagwe, Aisha, Vincent Kakembo, and Barasa Bernard. "Land Use Cover Types and Forest Management Options for Carbon in Mabira Central Forest Reserve." In African Handbook of Climate Change Adaptation. Springer International Publishing, 2021. http://dx.doi.org/10.1007/978-3-030-45106-6_145.

Full text
Abstract:
AbstractMabira Central Forest Reserve (CFR), one of the biggest forest reserves in Uganda, has increasingly undergone encroachments and deforestation. This chapter presents the implications of a range of forest management options for carbon stocks in the Mabira CFR. The effects of forest management options were reviewed by comparing above-ground biomass (AGB), carbon, and soil organic carbon (SOC) in three management zones. The chapter attempts to provide estimates of AGB and carbon stocks (t/ha) of forest (trees) and SOC using sampling techniques and allometric equations. AGB and carbon were obtained from a count of 143 trees, measuring parameters of diameter at breast height (DBH), crown diameter (CW), and height (H) with tree coordinates. It also makes use of the Velle (Estimation of standing stock of woody biomass in areas where little or no baseline data are available. A study based on field measurements in Uganda. Norges Landbrukshoegskole, Ås, 1995) allometric equations developed for Uganda to estimate AGB.The strict nature reserve management zone was noted to sink the highest volume of carbon of approximately 6,771,092.34 tonnes, as compared to the recreation zone (2,196,467.59 tonnes) and production zone (458,903.57 tonnes). A statistically significant relationship was identified between AGB and carbon. SOC varied with soil depth, with the soil surface of 0–10 cm depth registering the highest mean of 2.78% across all the management zones. Soil depth and land use/cover types also had a statistically significant effect on the percentage of SOC (P = 0.05). A statistically significant difference at the 95% significance level was also identified between the mean carbon stocks from one level of management zones to another. Recommendations include: demarcating forest boundaries to minimize encroachment, enforcement of forestry policy for sustainable development, promote reforestation, and increase human resources for efficient monitoring of the forest compartments.
APA, Harvard, Vancouver, ISO, and other styles
5

Miriti, Joseph M., Anthony O. Esilaba, Karuturi P. C. Rao, et al. "Adapting Agriculture to Climate Change: An Evaluation of Yield Potential of Maize, Sorghum, Common Bean and Pigeon Pea Varieties in a Very Cool-Wet Region of Nyandarua County, Central Kenya." In Adapting African Agriculture to Climate Change. Springer International Publishing, 2014. http://dx.doi.org/10.1007/978-3-319-13000-2_8.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Schneider, Marius, and Vanessa Ferguson. "Central African Republic." In Enforcement of Intellectual Property Rights in Africa. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780198837336.003.0012.

Full text
Abstract:
The Central African Republic (Centrafrique) is a landlocked country bordered by Chad, Sudan, South Sudan, the Democratic Republic of the Congo, the Republic of the Congo, and Cameroon. It is 622,984 square kilometres (km) and has a population of 4.7 million. Centrafrique has a long history of political instability and the latest security and humanitarian crisis of 2013 has deeply affected the country, leading to the displacement of approximately 25 per cent of the population. Although the United Nations Multidimensional Integrated Stabilization Mission in the Central African Republic (MINUSCA) has been deployed since April 2014 and democratic elections took place in 2016, Centrafrique is still very much a country in crisis, where violent conflict is all too common.
APA, Harvard, Vancouver, ISO, and other styles
7

"African Debt Management Policies Cross Country Overview." In African Central Government Debt. OECD, 2012. http://dx.doi.org/10.1787/acgd-2012-4-en.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

"African debt management policies: Cross-country overview." In African Central Government Debt. OECD, 2013. http://dx.doi.org/10.1787/acgd-2013-5-en.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

"African debt management policies: Cross-country overview." In African Central Government Debt. OECD, 2015. http://dx.doi.org/10.1787/acgd-2014-5-en.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Smith, Stephen W. "The Elite’s Road to Riches in a Poor Country." In Making Sense of the Central African Republic. Zed Books Ltd, 2015. http://dx.doi.org/10.5040/9781350221246.ch-005.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Central African Country"

1

Roy-Aikins, Joseph, and Reshleu J. Rampershad. "Technical and Economic Analysis of Repowering a Coal-Fired Power Plant." In ASME 1999 International Gas Turbine and Aeroengine Congress and Exhibition. American Society of Mechanical Engineers, 1999. http://dx.doi.org/10.1115/99-gt-007.

Full text
Abstract:
Owing to an abundance of coal reserves, about 92 percent of the electrical power produced in South Africa is generated in central power stations fired on cheaply priced coal. With a few power stations approaching the end of their design life, the question arises as to what to do with these outdated and inefficient plants. Retrofitting or repowering a station with gas turbines is one option being considered. As a case study, this paper investigates the technical and economic feasibility of repowering the Arnot power station to convert it to a combined cycle plant with increased capacity. This power station has six generating units, each of nominal capacity 350 MW and of average age 25 years. Four are in service, and the others are in reserve storage. Several repowering options were considered and the proposed re-design is parallel repowering, where additional steam for a steam turbine is generated in a gas turbine heat recovery steam generator to supplement the steam generated in a coal-fired boiler. Since natural gas, the preferred fuel for gas turbines, is not readily available in the country, kerosene was used as gas turbine fuel. Consequently, the performance of the chosen gas turbine had to be re-evaluated. The output of each unit increased by 77 MW and the efficiency by 8 percentage points to 43 percent, after repowering. Repowering was feasible, technically. An economic analysis was required to determine the magnitude of the economic benefits of repowering, if any, and it turned out that the cost of electricity generated by the new technology was higher than that produced by the outgoing one. It was concluded, therefore, that repowering the steam turbine units with gas turbines fired on kerosene was uneconomical, for the performance level achieved.
APA, Harvard, Vancouver, ISO, and other styles
2

Batra, Ankit. "Clinical comparison of toxicity pattern of two linear quadratic model-baesd fractionation schemes of high-dose-rate intracavitary brachytherapy for cervical cancer." In 16th Annual International Conference RGCON. Thieme Medical and Scientific Publishers Private Ltd., 2016. http://dx.doi.org/10.1055/s-0039-1685255.

Full text
Abstract:
Introduction: Carcinoma cervix is the fourth (GLOBACON 2012) most common cancer among women worldwide, and the main cancer affecting women in Sub-Saharan Africa, Central America and south-central Asia. In India, approx. 1,23,000 (GLOBACON 2012) new cases of carcinoma cervix are diagnosed each year. Brachytherapy is an integral part of treatment of cancer cervix. In the context of a developing country like us where maximum utilization of the resource is of prime importance to provide treatment to the large patient cohort, shortening the treatment duration and number of fractions always increases efficiency. In order to maximize the logistic benefits of HDR-BT while improving patient compliance and resource sparing, various fractionation regimens are used. Fractionation and dose adjustments of the total dose are radiobiologically important factors in lowering the incidence of complications without compromising the treatment results. Aim: To compare patient outcomes and complications using two linear-quadratic model-based fractionation schemes of high-dose-rate intracavitary brachytherapy (HDR-IC) used to treat cervical cancer. Materials and Methods: A prospective randomized study on 318 patients, with histologically proven advanced carcinoma cervix (stages IIB-IIIB) was enrolled in the study. All patients received External Beam Radio Therapy (EBRT) 50 Gy in 25 fractions with concurrent chemotherapy (cisplatin 35 mg/m2) followed by IntraCavitary brachytherapy using high dose rate equipment. Patients were randomised after completion of EBRT into two arms: (1) Arm 1: HDR ICRT 6.5 Gy per fraction for 3 fractions, a week apart. (2) Arm 2: HDR ICRT, 9 Gy per fraction for 2 fractions, 1 week apart. On completion of treatment, patients were assessed monthly for 3 months followed by 3 monthly thereafter. Treatment response was assessed according to WHO criteria after one month of completion of radiotherapy. The RTOG criteria were used for radiation induced toxicities. We analyzed late toxicities in terms of Rectal, Bladder, Small Bowel toxicity and Vaginal Stenosis. Results: Acute reactions in both the groups were comparable. None of the patient developed Grade 4 toxicity in our study and no toxicity related mortality was encountered. A slightly high frequency of late toxicity was observed in 9Gy Arm patients but was not statistically significant. Conclusion: In our setup, HDR brachytherapy at 9 Gy per fraction in two fractions is safe, effective and resource saving method with good local control, survival, and manageable normal tissue toxicity.
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "Central African Country"

1

Duffy, Grace, and Gabrielle Daoust. ACLED Country Report: Central African Republic. Defense Technical Information Center, 2015. http://dx.doi.org/10.21236/ada624354.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Thorsen, Dorte, and Affoué Philomène Koffi. Imagined Futures: Gaps in Support for Rural Youth in Côte d’Ivoire. Institute of Development Studies (IDS), 2021. http://dx.doi.org/10.19088/ids.2021.041.

Full text
Abstract:
Lack of employment opportunities for young people is a major concern across Africa, and involves many policy areas. In Côte d’Ivoire, the situation is challenging because of political and economic crises that have beset the country in recent decades, impacting negatively on education and accentuating job insecurity, particularly among rural youth. Tackling the problem in rural areas requires a youth-centred approach that builds long-term, well-targeted and coordinated interventions based on young people’s lived experience.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'Central African Country' for particular source types:
Journal articles Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography