Relevant bibliographies by topics / CHLORINE 37 / Journal articles
To see the other types of publications on this topic, follow the link: CHLORINE 37.

Journal articles on the topic 'CHLORINE 37'

Author: Grafiati
Published: 4 June 2021
Last updated: 5 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'CHLORINE 37.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Wadsworth, Alan H., Steve Montgomery, Kenneth W. M. Lawrie, and Richard M. Carr. "Isotopic labelling with chlorine-37." Journal of Labelled Compounds and Radiopharmaceuticals 50, no. 5-6 (2007): 471–72. http://dx.doi.org/10.1002/jlcr.1200.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Chang, Yoon-Seok, and Max L. Deinzer. "Synthesis of Regiospecific Chlorine-37 Labeled Trichlorodibenzofuran." Synthetic Communications 20, no. 16 (August 1990): 2501–6. http://dx.doi.org/10.1080/00397919008053199.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

CHANG, Y. S., and M. L. DEINZER. "ChemInform Abstract: Synthesis of Regiospecific Chlorine-37 Labeled Trichlorodibenzofuran." ChemInform 22, no. 12 (August 23, 2010): no. http://dx.doi.org/10.1002/chin.199112128.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Chang, Yoon-Seok, and Max L. Deinzer. "Regiospecific synthesis of polychlorinated dibenzofurans with chlorine-37 excess." Journal of Labelled Compounds and Radiopharmaceuticals 29, no. 1 (January 1991): 43–62. http://dx.doi.org/10.1002/jlcr.2580290108.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Chang, Yoon Seok, James A. Laramee, and Max L. Deinzer. "Regioselective chloride ion loss from chlorine-37 enriched polychlorodibenzofurans by negative ion mass spectrometry." Analytical Chemistry 63, no. 23 (December 1991): 2715–18. http://dx.doi.org/10.1021/ac00023a010.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Schaefer, Ted, and Rudy Sebastian. "Chlorine-37/chlorine-35 isotope effects on the proton NMR spectra of some chloromethane derivatives. Practical consequences." Journal of the American Chemical Society 109, no. 21 (October 1987): 6508–9. http://dx.doi.org/10.1021/ja00255a044.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Iba, Yoshihisa, Fumiaki Kumasaka, Masayuki Takeda, Hajime Aoyama, and Masaki Yamabe. "Etching Residues of Sputtered Ta Film Using Chlorine-Based Plasma." Japanese Journal of Applied Physics 37, Part 2, No. 2B (February 15, 1998): L251—L254. http://dx.doi.org/10.1143/jjap.37.l251.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Heineking, N., M. Andolfatto, U. Keussen, A. Mues, and H. Dreizler. "Deuterium Quadrupole Coupling Constants in Deuterochloroacetylene." Zeitschrift für Naturforschung A 44, no. 8 (August 1, 1989): 735–37. http://dx.doi.org/10.1515/zna-1989-0809.

Full text
Abstract:
Abstract The deuterium and chlorine nuclear quadrupole coupling constants have been determined for both of the chlorine isotopomers of deuterochloroacetylene (DCCC1), along with the rotational, centrifugal distortion, and chlorine spin-rotation coupling constants. The values are B = 5186.97631 (22) MHz, DJ= 1.13(2) kHz, eQq(Cl)= -79.7358(19) MHz, cI(Cl) = 1.10(31)kHz, and eQq(D) = 207.0(28)kHz for DCCCl-35, and B = 5084.17839(30) MHz, DJ = 0.99(2) kHz, eQq(Cl)= -62.8451(27) MHz, cI(CI) = 0.76(43) kHz, and eQq(D) = 205.8(39)kHz for DCCCl-37.
APA, Harvard, Vancouver, ISO, and other styles
9

Amrute, Amol P., Gastón O. Larrazábal, Cecilia Mondelli, and Javier Pérez-Ramírez. "Titelbild: CuCrO2Delafossite: A Stable Copper Catalyst for Chlorine Production (Angew. Chem. 37/2013)." Angewandte Chemie 125, no. 37 (August 12, 2013): 9763. http://dx.doi.org/10.1002/ange.201306290.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Vahala, R., V. A. Långvik, and R. Laukkanen. "Controlling Adsorbable Organic Halogens (AOX) and Trihalomethanes (THM) Formation by Ozonation and Two-Step Granule Activated Carbon (GAC) Filtration." Water Science and Technology 40, no. 9 (November 1, 1999): 249–56. http://dx.doi.org/10.2166/wst.1999.0488.

Full text
Abstract:
A pilot plant study in four parallel filter runs was performed in order to determine the effect of ozonation and two-step granular activated carbon (GAC) filtration on the removal of disinfection by-product (DBP) precursors. The results showed that ozonation significantly decreased the adsorbable organic halogens (AOX) (35%), simulated distribution system (SDS) AOX (37%) and SDS trihalomethanes (THM) (76%) from chemically treated and sand-filtered lake water, but did not decrease either short-term or the long-term chlorine demand. Biofiltration with exhausted GAC had a minor importance in the precursor removal (0-20%). The performance of adsorptive GAC filtration was strongly dependent on the age of the GAC filter bed, which was also seen as a strong correlation between the natural organic matter (NOM) measurements and DBP formation potential. Disinfection with chloramine produced lower THM, AOX, mutagenicity and MX (Z-3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone) levels compared to chlorine disinfection.
APA, Harvard, Vancouver, ISO, and other styles
11

Mahiou, Belaid, and Max L. Deinzer. "Synthetic strategies in the preparation of regiospecifically chlorine-37 labeled polychlorinated dibenzo-p-dioxins." Journal of Labelled Compounds and Radiopharmaceuticals 31, no. 4 (April 1992): 261–87. http://dx.doi.org/10.1002/jlcr.2580310403.

Full text
APA, Harvard, Vancouver, ISO, and other styles
12

Gettins, Peter, and Leon W. Cunningham. "A unique pair of zinc binding sites in the human .alpha.2-macroglobulin tetramer. A chlorine-35 and chlorine-37 NMR study." Biochemistry 25, no. 18 (September 1986): 5004–10. http://dx.doi.org/10.1021/bi00366a006.

Full text
APA, Harvard, Vancouver, ISO, and other styles
13

Frostell, Björn, Bengt Boman, Mats Ek, Björn Palvall, Marie Berglund, and Anders Lindström. "Influence of Bleaching Conditions and Membrane Filtration on Pilot Scale Biological Treatment of Kraft Mill Bleach Plant Effluent." Water Science and Technology 29, no. 5-6 (March 1, 1994): 163–76. http://dx.doi.org/10.2166/wst.1994.0711.

Full text
Abstract:
A kraft mill bleach plant effluent was treated in a pilot station with a common pretreatment stage and three parallel biological treatment plants. The possibility to membrane filter the E-stage effluent before biological treatment was provided. In the first pilot plant, three 0.7 m3 anaerobic fixed film reactors were followed by an activated sludge plant with two 0.7 m3 aerobic tanks in series. The second plant comprised a 10 m3 anaerobic hybrid reactor followed by a 2.5 m3 activated sludge plant. The third line was a 4.5 m3 activated sludge plant. All three plants were connected on-line to the bleach plant in a kraft mill. During the study, the bleaching conditions were changed from 75% substitution of chlorine for chlorine dioxide to 100% chlorine dioxide bleaching. In the comparisons, a total hydraulic retention time of 12 hours was used in all the three systems. The influent temperature was kept at 37-38°C. Biomass concentrations were 1.5-4 kg TSS/m3 in the aerobic parts. The concentration of fixed biomass was estimated to be 10-20 kg/m3 in the anaerobic reactors after the experiments. The change in bleaching conditions decreased the discharge of AOX more than 50% and had a positive effect on the biological treatability of the bleach plant effluent. The transformation of organic and chloroorganic material increased, a more stable operation could be obtained and the quality of the sludge improved. Except for chlorate, there were no major differences in treatment efficiency between the three systems studied. Anaerobic pretreatment resulted in a somewhat higher AOX removal and a somewhat better tolerance to shock loads, especially with chlorine used in bleaching. Membrane filtration of the E-stage effluent gave a significant contribution to the overall treatment result with 75% chlorine dioxide (D) in the first bleaching stage, but contributed only marginally with 100% D.
APA, Harvard, Vancouver, ISO, and other styles
14

NUNOKAWA, HIROSHI, and HISAKAZU MINAKATA. "A STATISTICAL ANALYSIS OF THE CHLORINE SOLAR NEUTRINO EXPERIMENT." International Journal of Modern Physics A 06, no. 13 (May 30, 1991): 2347–60. http://dx.doi.org/10.1142/s0217751x91001155.

Full text
Abstract:
A detailed analysis is performed so as to reveal the statistical significance of the possible anticorrelation between the solar neutrino flux, measured by the 37 Cl experiment, and the sunspot activity. We find that the new data added since 1986 do contribute to improving the significance of the anticorrelation. However, we also observe that the statistical significance depends upon the treatment of errors rather sensitively. Therefore, we conclude that the anticorrelation is not definitively established at the present stage of the experiment. We also point out the possibility of a new type of correlation.
APA, Harvard, Vancouver, ISO, and other styles
15

Morgan, I. J., and W. T. W. Potts. "The effects of thiocyanate on the intracellular ion concentrations of branchial epithelial cells of brown trout." Journal of Experimental Biology 198, no. 5 (May 1, 1995): 1229–32. http://dx.doi.org/10.1242/jeb.198.5.1229.

Full text
Abstract:
Exposure of brown trout (Salmo trutta) in fresh water to 0.15 mmol l-1 external thiocyanate for 1 h resulted in a significant decrease in chlorine concentration in the branchial mitochondria-rich (MR) cells from 37 mmol l-1 to 22 mmol l-1. The intracellular sodium concentration in these cells decreased by a similar amount, whilst the intracellular phosphorus concentration increased significantly. In contrast to the MR cells, 0.15 mmol l-1 external thiocyanate had no effect on the intracellular ion concentrations in the pavement epithelial cells. Thiocyanate is known to inhibit chloride uptake in a number of freshwater animals and therefore these data suggest that it is only the MR cells that are involved in the uptake of Cl- in brown trout.
APA, Harvard, Vancouver, ISO, and other styles
16

Cantu, A. M., and W. H. Parkinson. "Absorption spectrum of atomic chlorine 950 Å to 600 Å." Physica Scripta 37, no. 3 (March 1, 1988): 336–41. http://dx.doi.org/10.1088/0031-8949/37/3/005.

Full text
APA, Harvard, Vancouver, ISO, and other styles
17

ALLWOOD, PAUL B., YASHPAL S. MALIK, CRAIG W. HEDBERG, and SAGAR M. GOYAL. "Effect of Temperature and Sanitizers on the Survival of Feline Calicivirus, Escherichia coli, and F-Specific Coliphage MS2 on Leafy Salad Vegetables." Journal of Food Protection 67, no. 7 (July 1, 2004): 1451–56. http://dx.doi.org/10.4315/0362-028x-67.7.1451.

Full text
Abstract:
We conducted a series of experiments to compare the survival of Escherichia coli, feline calicivirus, and F-specific coliphage MS2 on lettuce and cabbage with and without disinfection. Inoculated produce was held at 4, 25, or 37°C for 21 days or was treated with different concentrations of sodium bicarbonate, chlorine bleach, peroxyacetic acid, or hydrogen peroxide. Survival was measured by the decimal reduction value (time to 90% reduction in titer) and the change in log titers of the test organisms. A stronger correlation of survival measures was observed between feline calicivirus and MS2 than between E. coli and either of the viral agents at 25 and 37°C. The maximum time to detection limit for MS2 at all temperatures was 9 days, whereas feline calicivirus was detected for a maximum of 14 days at 4°C. In contrast, E. coli was detectable for 21 days at 4 and 25°C and for 14 days at 37°C. Significant increases in E. coli titer occurred within the first 5 days, but virus titers decreased steadily throughout the experiments. E. coli was also highly susceptible to all disinfectants except 1% sodium bicarbonate and 50 ppm chlorine bleach, whereas the viruses were resistant to all four disinfectants.
APA, Harvard, Vancouver, ISO, and other styles
18

Amrute, Amol P., Gastón O. Larrazábal, Cecilia Mondelli, and Javier Pérez-Ramírez. "Cover Picture: CuCrO2Delafossite: A Stable Copper Catalyst for Chlorine Production (Angew. Chem. Int. Ed. 37/2013)." Angewandte Chemie International Edition 52, no. 37 (August 12, 2013): 9585. http://dx.doi.org/10.1002/anie.201306290.

Full text
APA, Harvard, Vancouver, ISO, and other styles
19

Abdullah, Norazharuddin Shah, Azizan Aziz, and Hussin Kamarudin. "Ilmenite Chlorination: Usage of Gaseous Carbon Tetrachloride at Relatively Lower Temperatures." Advanced Materials Research 1087 (February 2015): 389–93. http://dx.doi.org/10.4028/www.scientific.net/amr.1087.389.

Full text
Abstract:
Malaysian ilmenite from “amang” or tin mining waste is well known for its physical and chemical complexity, making it difficult to be treated conventionally. With knowledge of ilmenite is rich in titania and iron, extractive efforts were made in order to segregate and recover the components of ilmenite, with major interest being the removal and retrieval of titanium. In this study, the extent of chlorination execution is observed by means of weight loss studies under various parameters, with an aim of successful chlorination at lower temperatures. At 723 K, chlorination trials were done using gaseous hydrogen chloride (gHCl), carbon monoxide-chlorine gas mixtures (gCO-Cl) and gaseous carbon tetrachloride (gCT). It was clearly seen that at such a relatively low temperature, only gCT was able to obtain a good chlorination degree, with up to 90% chlorination of –45+37 μm ilmenite particles were observed after 1 hour of reaction. With similar size fraction and time, hydrogen chloride was only able to give approximately 6% of chlorination while the mixture of carbon monoxide and chlorine was seen incapable of giving anything higher than a 6% reaction. Initial observation suggests that the chlorination of ilmenite by carbon tetrachloride physically resembles the core shrinking model, although proper kinetic studies needs to be done to confirm this. Changes in various parameter values are seen to be quite sensitive to the overall ilmenite chlorination (via gCT) process. This study have shown that gCT presents an interesting route for the chlorination of complex ores such as ilmenite.
APA, Harvard, Vancouver, ISO, and other styles
20

PALUMBO, SAMUEL A., JEFFREY CALL, BINH HUYNH, and JOSEPH FANELLI. "Survival and Growth Potential of Aeromonas hydrophila in Reconditioned Pork-Processing-Plant Water†." Journal of Food Protection 59, no. 8 (August 1, 1996): 881–85. http://dx.doi.org/10.4315/0362-028x-59.8.881.

Full text
Abstract:
The growth and survival of Aeromonas hydrophila K144 was studied in reconditioned pork-processing-plant water. Neutralization of residual chlorine by thiosulfate permitted growth and long-term survival of the bacterium at temperatures ranging from 5 to 28°C; growth was also observed at 37 and 42°C but survival times were shorter. The coliform growth response, a bioassay system to measure the amount of nutrients available for microbial growth, for the reconditioned water was 2.91 ± 0.61, which agreed with our observation that this water contained sufficient nutrients to support about 3 log units of growth of A. hydrophila. Our results indicate that residual chlorine levels are necessary to prevent the growth of any A. hydrophila which might contaminate reconditioned water.
APA, Harvard, Vancouver, ISO, and other styles
21

Bryce, David L., and Gregory D. Sward. "Solid-state NMR spectroscopy of the quadrupolar halogens: chlorine-35/37, bromine-79/81, and iodine-127." Magnetic Resonance in Chemistry 44, no. 4 (2006): 409–50. http://dx.doi.org/10.1002/mrc.1741.

Full text
APA, Harvard, Vancouver, ISO, and other styles
22

Ruf, M.-W., S. Barsotti, M. Braun, H. Hotop, and I. I. Fabrikant. "Dissociative attachment and vibrational excitation in low-energy electron collisions with chlorine molecules." Journal of Physics B: Atomic, Molecular and Optical Physics 37, no. 1 (December 8, 2003): 41–62. http://dx.doi.org/10.1088/0953-4075/37/1/003.

Full text
APA, Harvard, Vancouver, ISO, and other styles
23

Sharma, Swati, Mausumi Mukhopadhyay, and Z. V. P. Murthy. "Investigation of photo-assisted and crude peroxidase mediated transformations of chlorinated phenols (CPs) from spiked and industrial wastewaters: identification of reaction products." Water Science and Technology 72, no. 5 (May 27, 2015): 746–53. http://dx.doi.org/10.2166/wst.2015.269.

Full text
Abstract:
This work focused on photo-assisted crude peroxidase mediated transformations of chlorinated phenols (CPs) from spiked and industrial wastewaters and the identification of reaction products formed. Garden radish Raphanus sativus was the source of crude peroxidase. No chlorine bearing compounds were detected by gas chromatography-high resolution mass spectrometry analysis. Under identical test conditions, the concentrations of 4-chlorophenol and 2,4-dichlorophenol were demoted to zero from 514 mg/L, 652 mg/L and that of 2,4,6-trichlorophenol and pentachlorophenol were reduced to 18 mg/L and 37 mg/L from 790 mg/L and 1066 mg/L, respectively (high-pressure liquid chromatography analysis). Chloride ion release profiles also showed a progressively increasing trend. A neat chemical oxygen demand removal to the extent of 63–79% was achieved in the case of spiked wastewater sample and to the extent of 77% for industrial wastewaters. A hypothesis reaction scheme was also suggested to comprehend the mechanism of degradation reactions.
APA, Harvard, Vancouver, ISO, and other styles
24

TAKEUCHI, KAZUE, and JOSEPH F. FRANK. "Penetration of Escherichia coli O157:H7 into Lettuce Tissues as Affected by Inoculum Size and Temperature and the Effect of Chlorine Treatment on Cell Viability." Journal of Food Protection 63, no. 4 (April 1, 2000): 434–40. http://dx.doi.org/10.4315/0362-028x-63.4.434.

Full text
Abstract:
Penetration of Escherichia coli O157:H7 into iceberg lettuce tissues and the effect of chlorine treatment on cell viability were evaluated. Attachment of different inoculum levels (109, 108, and 107 CFU/ml) was examined by determining the number of cells at the surface and the cut edge of lettuce leaves (2 by 2 cm). E. coli O157:H7 attached preferentially to cut edges at all inoculum levels, with greater attachment per cm2 of lettuce at higher inoculum levels. A longer attachment time allowed more cells to attach at both sites. Immunostaining with a fluorescein isothiocyanate–labeled antibody revealed that cells penetrated into lettuce leaves from cut edges. Cells showed greater penetration when lettuce was held at 4°C compared with 7, 25, or 37°C and were detected at an average of 73.5 ± 16.0 μm below the surfaces of cut tissues. Penetrating cells were mostly found at the junction of lettuce cells. The viability of attached cells after treatment with 200 mg/liter (200 ppm) of free chlorine for 5 min was examined by plating on tryptic soy agar and by a nalidixic acid elongation method. Although chlorine treatment caused significant reduction in attachment (0.7- and 1.0-log reduction at surfaces and cut edges, respectively), cells remained attached at high numbers (7.9 and 8.1 log CFU/cm2 at surfaces and cut edges, respectively). Elongated cells were observed in stomata and within the tissues of the lettuce, indicating they were protected from contact with chlorine.
APA, Harvard, Vancouver, ISO, and other styles
25

Gowda, B. Thimme, and Alarich Weiss. "The Bond N -Cl. A Spectroscopic (35Cl-NQR, IR) Investigation." Zeitschrift für Naturforschung A 49, no. 6 (June 1, 1994): 695–702. http://dx.doi.org/10.1515/zna-1994-0607.

Full text
Abstract:
Abstract Chlorine bound to nitrogen is an interesting oxidizing agent in aqueous, partial aqueous and non-aqueous media. One can assume that the oxidizing action of the chlorine depends on the polarization of the Cl atom in the bond N -Cl which will depend on the electron distribution in the ligands R and R″ of the configuration R -NCl -CO -R″. 17 compounds were synthesized with R = substituted phenyl radical C6H5-y Xy, X = Cl, NO2, R″ = CH2Cl. The 35Cl NQR frequencies are observed in the range 52 to 54 MHz (T = 77 K) for the Cl(N) 34 to 37 MHz for the phenyl chlorines and the CH2Cl group. Their temperature dependence was followed up to 300 K. Therefrom the assignment of the resonance to certain Cl-atoms in the molecules is possible. Generally, the substitution of a negative substituent X (Cl, NO2) in the phenyl ring raises the resonance frequencies; the influence of the CH2Cl group on the N -Cl bond is weak. Strong is the influence of the carbonyl group on the N -C l bond. The IR group frequencies ν(C = O) are found in the range 1680 ≤ ν (C = O)/ cm−1≤ 1717, shifted up by ≤ 20 cm−1 compared to the corresponding acetamide R ⎯ NH ⎯CO ⎯ R″. Influence of the phenyl ring substitution on ν (C = O) does not follow a simple law of inductive effect. Also a correlation between the vibration frequencies of the N ⎯ Cl group and the phenyl group substitution is not found.
APA, Harvard, Vancouver, ISO, and other styles
26

TAORMINA, PETER J., and LARRY R. BEUCHAT. "Comparison of Chemical Treatments to Eliminate Enterohemorrhagic Escherichia coli O157:H7 on Alfalfa Seeds." Journal of Food Protection 62, no. 4 (April 1, 1999): 318–24. http://dx.doi.org/10.4315/0362-028x-62.4.318.

Full text
Abstract:
The focus of this study was to determine the efficacy of various chemicals in eliminating 2.04 to 3.23 log10 CFU/g of Escherichia coli O157:H7 from alfalfa seeds and to determine the survivability of the pathogen on seeds stored for prolonged periods at three temperatures. Significant (P ≤ 0.05) reductions in populations of E. coli O157:H7 on inoculated seeds were observed after treatments with 500 and 1,000 ppm of active chlorine (as Ca[OCl]2) for 3 but not 10 min and with ≥2,000 ppm of Ca(OCl)2 regardless of pretreatment with a surfactant. Treatment with 20,000 ppm of active chlorine failed to kill 2.68 log10 CFU/g of seeds. Acidified NaClO2 (500 ppm) was effective in reducing populations of the pathogen by >2 logs per g. Acidified ClO2 significantly reduced populations of E. coli O157:H7 on seeds at concentrations ≥100 ppm, and 500 ppm of ClO2 reduced the pathogen from 2.7 log10 CFU/g to <0.5 CFU/g. Chlorine (as NaOCl) was not effective at concentrations ≤1,000 ppm; significant reduction was achieved only after treatment with 2,000 ppm for 3 or 10 min. Notable reduction in populations was observed after treatment with 30 or 70% C2H3OH, but there was a dramatic decrease in germination percentage. Treatment with 0.2% H2O2 significantly reduced populations, and the organism was not detected by direct plating after treatment with ≥1% H2O2. Significant reduction in population of E. coli O157:H7 occurred after treatment with 1% trisodium phosphate, 40 ppm of Tsunami and Vortexx, and 1% Vegi-Clean. A significant decrease in the number of E. coli O157:H7 on dry seeds was observed within 1 week of storage at 25 and 37°C, but not at 5°C. Between 1 and 38 weeks, populations on seeds stored at 5°C remained relatively constant. The pathogen was recovered from alfalfa seeds initially containing 3.04 log10 CFU/g after storage at 25 or 37°C for 38 weeks but not 54 weeks.
APA, Harvard, Vancouver, ISO, and other styles
27

BURNETT, ANDREA B., MONTSERRAT H. ITURRIAGA, EDUARDO F. ESCARTIN, CHARLES A. PETTIGREW, and LARRY R. BEUCHAT. "Influence of Variations in Methodology on Populations of Listeria monocytogenes Recovered from Lettuce Treated with Sanitizers." Journal of Food Protection 67, no. 4 (April 1, 2004): 742–50. http://dx.doi.org/10.4315/0362-028x-67.4.742.

Full text
Abstract:
The elimination of Listeria monocytogenes inoculated onto a piece of cut iceberg lettuce (3.8 by 3.8 cm) by treatment with chlorinated water (200 μg/ml free chlorine) and a 0.5% (wt/vol) solution of FIT Professional Line Antibacterial Cleaner (FIT) was investigated. The efficacy of the two sanitizers was not influenced by the composition of the medium used to culture the L. monocytogenes used in the inocula, the number of strains in the inoculum, or the recovery medium used to enumerate the pathogen on lettuce after treatment. Drying inoculum on lettuce for 45 min at 37°C caused more cells to die or not be retrieved compared with drying inoculum for 30 min at 25°C. However, the percentage of cells in the inoculum recovered from lettuce treated with chlorine or FIT was not significantly different, regardless of the drying method. Stomaching, homogenizing, or stomaching followed by homogenizing lettuce treated with sanitizers resulted in recovery of similar numbers of L. monocytogenes, indicating that stomaching and homogenizing are equivalent in extracting cells; the sequential use of both processing methods did not substantially increase the efficiency of recovery. Washing lettuce with water or treating lettuce with 200 μg/ml chlorine or FIT resulted in decreases in populations of 0.60, 1.76, and 1.51 log CFU per lettuce piece, respectively, regardless of variations in test parameters. Reductions caused by sanitizers were significantly greater (α = 0.05) than that observed for water but not significantly different from each other. It is concluded that evaluation of sanitizers for their efficacy in killing L. monocytogenes on lettuce can be determined by spot inoculating 50 μl of a five-strain mixture of cells from 24-h cultures suspended in 5% horse serum albumen, followed by drying the inoculum for 45 min at 37°C, treatment by submerging in 50 ml of sanitizer for 5 min, stomaching samples in 50 ml of Dey-Engley neutralizing broth for 2 min, and enumerating survivors on modified Oxford medium.
APA, Harvard, Vancouver, ISO, and other styles
28

Dufour, Alfred P., Otis Evans, Thomas D. Behymer, and Ricardo Cantú. "Water ingestion during swimming activities in a pool: A pilot study." Journal of Water and Health 4, no. 4 (December 1, 2006): 425–30. http://dx.doi.org/10.2166/wh.2006.0026.

Full text
Abstract:
Chloroisocyanurates are commonly added to outdoor swimming pools to stabilize chlorine disinfectants. The chloroisocyanurates decompose slowly to release chlorine and cyanuric acid. Studies conducted to determine if the chloroisocyanurates might be toxic to swimmers showed that they were not and that ingested cyanuric acid passed through the body unmetabolized. This fact was used to determine the amount of water swallowed during swimming activity. Fifty-three recreational swimmers, using a community swimming pool disinfected with cyanuric acid stabilized chlorine, participated in the study. The participants did not swim on the day before or after the test swim. The swimmers were asked to actively swim for at least 45 minutes and to collect their urine for the next 24 hours. Cyanuric acid was measured in pool water using high performance liquid chromatography and porous graphitic carbon columns with UV detection. The urine sample assay required a clean-up procedure to remove urinary proteins and interfering substances. Results of the study indicate that non-adults ingest about twice as much water as adults during swimming activity. The average amount of water swallowed by non-adults and adults was 37 ml and 16 ml, respectively. The design for this study and the analytical methodology used to assay cyanuric acid in swimming pool water and human urine were effective for measuring the volume of water swallowed during swimming activity.
APA, Harvard, Vancouver, ISO, and other styles
29

Matthews, Robert L., and Rosalind Tung. "Broader incubation temperature tolerances for microbial drinking water testing with enzyme substrate tests." Journal of Water and Health 12, no. 1 (December 20, 2013): 113–21. http://dx.doi.org/10.2166/wh.2013.076.

Full text
Abstract:
Microbiological testing is an integral part of measures to ensure safe drinking water. However, testing can be restricted in low-resource settings by the requirement for specialized laboratory facilities and testing procedures. Precisely controlled incubation temperature is one example. The effect of varied incubation temperatures on the performance of two enzyme substrate tests for the detection of Escherichia coli and total coliforms has been examined. The aim was to determine whether these tests would provide consistent and comparable enumeration over a broader temperature range than currently specified. Recovery of chlorine-injured and wild type E. coli was examined over a range of non-standard incubation temperatures in comparison to 37 °C ± 1. Colilert® and Aquatest, a new E. coli-specific detection medium, served as the two representative enzyme substrate media. Recovery of chlorine-injured E. coli in Colilert was not impaired within the range 33–39 °C; the equivalent range in Aquatest medium was 31–43 °C. Both these tests recovered E. coli without significant loss of performance over a wider range of temperatures than currently specified.
APA, Harvard, Vancouver, ISO, and other styles
30

Taormina, P. J., and L. R. Beuchat. "Survival and Heat Resistance of Listeria monocytogenes after Exposure to Alkali and Chlorine." Applied and Environmental Microbiology 67, no. 6 (June 1, 2001): 2555–63. http://dx.doi.org/10.1128/aem.67.6.2555-2563.2001.

Full text
Abstract:
ABSTRACT A strain of Listeria monocytogenes isolated from a drain in a food-processing plant was demonstrated, by determination of D values, to be more resistant to the lethal effect of heat at 56 or 59°C following incubation for 45 min in tryptose phosphate broth (TPB) at pH 12.0 than to that of incubation for the same time in TPB at pH 7.3. Cells survived for at least 6 days when they were suspended in TPB at pHs 9.0, 10.0, and 11.0 and stored at 4 or 21°C. Cells ofL. monocytogenes incubated at 37°C for 45 min and then stored for 48 or 144 h in TPB at pH 10.0 were more resistant to heat treatment at 56°C than were cells stored in TPB at pH 7.3. The alkaline-stress response in L. monocytogenes may induce resistance to otherwise lethal thermal-processing conditions. Treatment of cells in 0.05 M potassium phosphate buffer (pH 7.00 ± 0.05) containing 2.0 or 2.4 mg of free chlorine per liter reduced populations by as much as 1.3 log10 CFU/ml, while treatment with 6.0 mg of free chlorine per liter reduced populations by as much as 4.02 log10 CFU/ml. Remaining subpopulations of chlorine-treated cells exhibited some injury, and cells treated with chlorine for 10 min were more sensitive to heating at 56°C than cells treated for 5 min. Contamination of foods by L. monocytogenes cells that have survived exposure to processing environments ineffectively cleaned or sanitized with alkaline detergents or disinfectants may have more severe implications than previously recognized. Alkaline-pH-induced cross-protection of L. monocytogenes against heat has the potential to enhance survival in minimally processed as well as in heat-and-serve foods and in foods on holding tables, in food service facilities, and in the home. Cells surviving exposure to chlorine, in contrast, are more sensitive to heat; thus, the effectiveness of thermal processing in achieving desired log10-unit reductions is not compromised in these cells.
APA, Harvard, Vancouver, ISO, and other styles
31

Bryce, David L., and Gregory D. Sward. "Chlorine-35/37 NMR Spectroscopy of Solid Amino Acid Hydrochlorides: Refinement of Hydrogen-Bonded Proton Positions Using Experiment and Theory." Journal of Physical Chemistry B 110, no. 51 (December 2006): 26461–70. http://dx.doi.org/10.1021/jp065878c.

Full text
APA, Harvard, Vancouver, ISO, and other styles
32

Zeinaly, Farhad, Konstantin Gabov, Hadi Kanåni Sula, Arash Babavand, and Pedro Fardim. "Using Oxone and TAED activator in non-chlorine bleaching of soda bagasse pulp." Nordic Pulp & Paper Research Journal 34, no. 4 (November 18, 2019): 422–32. http://dx.doi.org/10.1515/npprj-2019-0010.

Full text
Abstract:
Abstract Bagasse fiber has been used in the production of bleached chemical pulp by the Pars Paper Company. In this company, a conventional three-stage sequence of hypochlorite, alkaline extraction and second hypochlorite (HEH) is applied in pulp bleaching. Pulp bleaching is one of the most important environmental pollutant stages in the pulp and paper industry. In this research, the bleaching of soda bagasse pulp by applying Oxone and TAED-activator in non-chlorine bleaching sequences has been investigated. The unbleached pulp, with kappa number of 20, 955 ml/g viscosity and 37 % brightness, was prepared from Pars Paper Company. Results indicated that, the TAED at the first and second stages were more effective than in the Oxone stages. Moreover, the sequences, which contained TAED- and Oxone-second-stage, could reach the minimum level of kappa (1.7), but the highest brightness (80 %) was attained by using only TAED with a comparatively high level of pulp viscosity (752).
APA, Harvard, Vancouver, ISO, and other styles
33

Mohseni, H. K., D. Cowan, D. R. Chettle, N. D. Priest, J. Atanackovic, S. H. Byun, and W. V. Prestwich. "In vivoneutron activation study of the short-term kinetic behaviour of sodium and chlorine in the human hand." Physiological Measurement 37, no. 11 (October 6, 2016): N76—N83. http://dx.doi.org/10.1088/0967-3334/37/11/n76.

Full text
APA, Harvard, Vancouver, ISO, and other styles
34

Grenfell, P., C. L. Little, S. Surman-Lee, M. Greenwood, J. Averns, S. Westacott, C. Lane, and G. Nichols. "The microbiological quality of potable water on board ships docking in the UK and the Channel Islands: an association of Port Health Authorities and Health Protection Agency Study." Journal of Water and Health 6, no. 2 (January 1, 2008): 215–24. http://dx.doi.org/10.2166/wh.2008.045.

Full text
Abstract:
Providing safe potable water onboard vessels presents particular challenges and contamination can occur directly from source waters as well as during loading, storage and distribution. Between May and October 2005, 950 potable water samples were collected from 342 ships docking at ports. Comparison with Guidelines found 9% of samples contained coliforms, Escherichia coli or enterococci and 2.8% had faecal indicators (E. coli or enterococci). Action levels of aerobic colony count (ACC) bacteria were detected in 20% (22°C) and 21.5% (37°C) of samples. ACC results from one-off sampling are not informative as this does not enable port health authorities to monitor ACC trends. They should be removed as a routine criterion for remedial action and vessels should adopt the WHO Water Safety Plan approach, whilst continuing to monitor water quality with public health-based indicators (e.g. chlorine residual, coliforms, E. coli and enterococci). Logistic regression analyses identified practices associated with water quality. Practices protective against coliforms, E. coli or enterococci in potable supplies were: good hose hygiene, processing water onboard, maintaining free chlorine residual at ≥0.2 mg/L. This emphasizes the importance of good hygiene during potable water loading and maintaining adequate disinfection of supplies onboard.
APA, Harvard, Vancouver, ISO, and other styles
35

Ballal, Nidambur Vasudev, Anja Ivica, Pamela Meneses, Raj Kumar Narkedamalli, Thomas Attin, and Matthias Zehnder. "Influence of 1-Hydroxyethylidene-1,1-Diphosphonic Acid on the Soft Tissue-Dissolving and Gelatinolytic Effect of Ultrasonically Activated Sodium Hypochlorite in Simulated Endodontic Environments." Materials 14, no. 10 (May 13, 2021): 2531. http://dx.doi.org/10.3390/ma14102531.

Full text
Abstract:
The addition of Dual Rinse HEDP, an etidronate powder, to a sodium hypochlorite (NaOCl) solution can create a combined single endodontic irrigant with a soft tissue-dissolving and a decalcifying effect, which can replace traditional alternating irrigation with chemically non-compatible solutions. While the short-term compatibility between NaOCl and 1-hydroxyethylidene-1,1-diphosphonic acid (HEDP) has been shown, it remains unclear whether ultrasonic activation of a combined NaOCl & HEDP solution immediately reduces the available chlorine and/or renders the NaOCl ineffective in dissolving organic tissue remnants. This was tested in three experiments: (1) direct activation in test tubes in an ultrasonic bath and then the activation by an ultrasonically oscillating tip (IrriSafe) in (2) an epoxy resin model containing a simulated isthmus filled with gelatin, and (3) extracted teeth with simulated resorption cavities filled with soft tissue. The control solutions were physiological saline and 2.5% NaOCl without HEDP. In (1), available chlorine after 30 s of ultrasonic activation (37 kHz) of test and control solution was assessed, as well as shrimp tissue weight loss in direct exposure. In (2) and (3), the ultrasonic tip was driven at 1/3 of full power using the respective unit, and areas of removed gelatin from the isthmus and tissue weight loss were used as the outcomes, respectively. Experiment (1) revealed no negative impact by HEDP on available chlorine (1), while all three experiments showed a highly significant (p > 0.001) synergistic effect, which was not hampered by HEDP, between NaOCl and ultrasonic activation regarding tissue weight loss (1, 3) and dissolution of gelatin (2).
APA, Harvard, Vancouver, ISO, and other styles
36

Wen, Xin, Rashed Almousa, Gregory G. Anderson, and Dong Xie. "Developing a novel antibacterial dental resin composite with improved properties." Journal of Composite Materials 53, no. 22 (April 2, 2019): 3085–92. http://dx.doi.org/10.1177/0021998319839134.

Full text
Abstract:
A novel antibacterial resin composite has been developed and evaluated. Glycerol dimethacrylate was derivatized to have an antibacterial moiety attached and incorporated to a conventional resin composite formulation. Compressive strength and bacterial viability were used to evaluate the modified resin composites. Results showed that the modified resin composites showed a significantly enhanced antibacterial activity along with improved mechanical and physical properties. It was found that bromine-containing resin composite showed a higher antibacterial activity than its chlorine-containing counterpart. The modified resin composites showed an increase of 37–41% in yield strength, 23–27% in modulus, 9–15% in diametral tensile strength and 5–12% in flexural strength and a decrease of 35–69% in bacterial viability, 20–37% in water sorption, 7–12% in shrinkage and 7–10% in compressive strength, as compared to unmodified resin composite. Within the limitations of this study, the modified resin composite may potentially be developed into a clinically useful dental restorative since it demonstrated good mechanical strengths and potent antibacterial function.
APA, Harvard, Vancouver, ISO, and other styles
37

Nagarathnamma, R., and Pratima Bajpai. "Decolorization and Detoxification of Extraction-Stage Effluent from Chlorine Bleaching of Kraft Pulp by Rhizopus oryzae." Applied and Environmental Microbiology 65, no. 3 (March 1, 1999): 1078–82. http://dx.doi.org/10.1128/aem.65.3.1078-1082.1999.

Full text
Abstract:
ABSTRACT Rhizopus oryzae, a zygomycete, was found to decolorize, dechlorinate, and detoxify bleach plant effluent at lower cosubstrate concentrations than the basidiomycetes previously investigated. With glucose at 1 g/liter, this fungus removed 92 to 95% of the color, 50% of the chemical oxygen demand, 72% of the adsorbable organic halide, and 37% of the extractable organic halide in 24 h at temperatures of 25 to 45°C and a pH of 3 to 5. Even without added cosubstrate the fungus removed up to 78% of the color. Monomeric chlorinated aromatic compounds were removed almost completely, and toxicity to zebra fish was eliminated. The fungal mycelium could be immobilized in polyurethane foam and used repeatedly to treat batches of effluent. The residue after treatment was not further improved by exposure to fresh R. oryzaemycelium.
APA, Harvard, Vancouver, ISO, and other styles
38

Xiao, Fangxing, Xiaobin Yao, Qianhong Bao, Danzhen Li, and Yi Zheng. "Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL." Bioinorganic Chemistry and Applications 2012 (2012): 1–10. http://dx.doi.org/10.1155/2012/649640.

Full text
Abstract:
The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.
APA, Harvard, Vancouver, ISO, and other styles
39

Rahman, Mohammad Mizanur, Md Miaruddin, Md Golam Ferdous Chowdhury, Md Hafizul Haque Khan, and MA Matin. "Effect of different packaging systems and chlorination on the quality and shelf life of green chili." Bangladesh Journal of Agricultural Research 37, no. 4 (April 2, 2013): 729–36. http://dx.doi.org/10.3329/bjar.v37i4.14397.

Full text
Abstract:
The experiment was conducted to evaluate the effect of packaging materials on the quality and shelf life of green chili (Capsicum annuum) using passive modification of modified atmosphere packaging system. The modified atmosphere was created by making perforation in the polypropylene packets. Green chili pre-treated with chlorine water and then packaging in 0.3% perforated polypropylene packet resulted substantial reduction of weight loss and rotting/shriveling. These treatment combinations also considerably retained vitamin C, ß-carotene, moisture content, etc. Under this condition the retention of quality and shelf life of green chili could be extended up to 10 days at ambient condition as compared to non-treated and without packaging. DOI: http://dx.doi.org/10.3329/bjar.v37i4.14397 Bangladesh J. Agril. Res. 37(4): 729-736, December 2012
APA, Harvard, Vancouver, ISO, and other styles
40

Gheorghe, S., A. Catrangiu, I. Lucaciu, O. Tiron, C. Cosma, C. Stoica, and L. Dinu. "Water microbial quality during drinking water treatment technology and distribution provided by two Romanian companies." Water Supply 15, no. 1 (August 23, 2014): 66–74. http://dx.doi.org/10.2166/ws.2014.085.

Full text
Abstract:
Under European Economic Area Agreement, Romania and Norway have developed a project for monitoring the quality of raw and potable water (from production technology until distribution) supplied by two Romanian water companies. In the present study was investigated the microbiological quality of water, which was compared with organic matter loads. Resulting free chlorine and trihalomethane compounds after disinfection processes were also analysed. The raw water collected from Danube hydrographical basin showed significant pollution with potential pathogenic microorganisms with faecal origin such as Salmonella sp., Escherichia coli, Enterobacter sp., Klebsiella pneumoniae, Proteus mirabilis, Citrobacter braakii, Providencia stuartii, and Enterococcus sp. Also other bacteria such as Pseudomonas aeruginosa, Acinetobacter, total number of bacteria at 22 and 37 °C were detected, being related to high water oxidability. The microbial load was reduced considerably after the disinfection process. However, the total number of bacteria at 22 or 37 °C was constantly higher than the imposed limit and Clostridium perfringens was identified occasionally. The tap water presented a sporadic microbial loading with Enterococcus sp., Pseudomonas aeruginosa and E. coli and constantly with total number of bacteria due to an improper water distribution network.
APA, Harvard, Vancouver, ISO, and other styles
41

Arni, Stephan, Tatsuo Maeyashiki, Isabelle Opitz, and Ilhan Inci. "Subnormothermic ex vivo lung perfusion attenuates ischemia reperfusion injury from donation after circulatory death donors." PLOS ONE 16, no. 8 (August 2, 2021): e0255155. http://dx.doi.org/10.1371/journal.pone.0255155.

Full text
Abstract:
Use of normothermic ex vivo lung perfusion (EVLP) was adopted in clinical practice to assess the quality of marginal donor lungs. Subnormothermic perfusion temperatures are in use among other solid organs to improve biochemical, clinical and immunological parameters. In a rat EVLP model of donation after circulatory death (DCD) lung donors, we tested the effect of four subnormothermic EVLP temperatures that could further improve organ preservation. Warm ischemic time was of 2 hours. EVLP time was of 4 hours. Lung physiological data were recorded and metabolic parameters were assessed. Lung oxygenation at 21°C and 24°C were significantly improved whereas pulmonary vascular resistance and edema formation at 21°C EVLP were significantly worsened when compared to 37°C EVLP. The perfusate concentrations of potassium ions and lactate exiting the lungs with 28°C EVLP were significantly lower whereas sodium and chlorine ions with 32°C EVLP were significantly higher when compared to 37°C EVLP. Also compared to 37°C EVLP, the pro-inflammatory chemokines MIP2, MIP-1α, GRO-α, the cytokine IL-6 were significantly lower with 21°C, 24°C and 28°C EVLP, the IL-18 was significantly lower but only with 21°C EVLP and IL-1β was significantly lower at 21°C and 24°C EVLP. Compared to the 37°C EVLP, the lung tissue ATP content after 21°C, 24°C and 28°C EVLP were significantly higher, the carbonylated protein content after 28°C EVLP was significantly lower and we measured significantly higher myeloperoxidase activities in lung tissues with 21°C, 24°C and 32°C. The 28°C EVLP demonstrated acceptable physiological variables, significantly higher lung tissue ATP content and decreased tissue carbonylated proteins with reduced release of pro-inflammatory cytokines. In conclusion, the 28°C EVLP is a non inferior setting in comparison to the clinically approved 37°C EVLP and significantly improve biochemical, clinical and immunological parameters and may reduce I/R injuries of DCD lung donors.
APA, Harvard, Vancouver, ISO, and other styles
42

Deulkar, Swati, Shenuka Singh, and Dileep Tiwari. "Isolation of selected possible aerobic bacterial pathogens from dental environmental surfaces after use of disinfectants - A case study at a public dental clinic, in KwaZulu-Natal." South African Dental Journal 75, no. 5 (June 30, 2020): 241–46. http://dx.doi.org/10.17159/2519-0105/2020/v75no5a2.

Full text
Abstract:
Cross infection in the dental clinical environment remains a low priority in conversations around oral health care despite the high risk of exposure to blood and airborne infections. The aim of this study was to determine the presence of selected pathogens after use of disinfectants on specific dental environmental surfaces at a public oral health facility in KwaZulu-Natal. This was a cross-sectional descriptive case study with a non-experimental design. The dental clinical environment was divided into four zones and 9 dental units were systematically selected. Swabs were collected from the 26 identified areas at specific time intervals (7.00, 9.00, 11.00, and 16.00) after the use of chlorine, ethanol (70% in water) and glutaraldehyde (2%) as surface disinfectants. The collected swab samples were cultured in nutrient agar media for two days at 37°C. The colony forming units were then examined and characterized using the MALDI-TOF spectrometer. Out of the 312 samples taken, 262 (84%) were shown to be bacterial culture positive. The most contaminated areas in the dental environment were around the chair area (86.53%) and the area away from the chair (92%). Glutaraldehyde was found to be more effective than chlorine and ethanol. The study suggests an association between the frequency of cleaning, the type of disinfectant used and the bacterial microbial count on the specified dental environmental surfaces at the identified oral health facility.
APA, Harvard, Vancouver, ISO, and other styles
43

Pugachev, A. D., V. V. Tkachev, S. M. Aldoshin, N. I. Makarova, I. A. Rostovtseva, A. V. Metelitsa, N. V. Stankevich, G. V. Shilov, and B. S. Lukyanov. "Structure and Properties of 1,3,3-Trimethyl-6′-chlorospiro[indoline-2,2′-2H-chromene]." Russian Journal of General Chemistry 91, no. 7 (July 2021): 1297–304. http://dx.doi.org/10.1134/s1070363221070069.

Full text
Abstract:
Abstract Indoline spiropyran containing an σ-acceptor chlorine atom in 6′ position of the 2H-chromene part of the molecule was synthesized and studied. The use of 1,2,3,3-tetramethyl-3H-indolium perchlorate as a starting compound made it possible to achieve higher product yields as compared to previous studies. The molecular structure of the compound was established by single crystal X-ray diffraction analysis. The features of the crystal structure and intermolecular interactions were investigated using CrystalExplorer17 software package. The photochromic behavior in acetonitrile solution was studied for the first time. It was found that the merocyanine form of spiropyran is characterized by an absorption maximum at 592 nm, which is 37 nm closer to the range of the “biological window” in comparison with the nitro-substituted analog.
APA, Harvard, Vancouver, ISO, and other styles
44

Ramirez, Adrian, Jose L. Hueso, Hugo Suarez, Reyes Mallada, Alfonso Ibarra, Silvia Irusta, and Jesus Santamaria. "Innentitelbild: A Nanoarchitecture Based on Silver and Copper Oxide with an Exceptional Response in the Chlorine-Promoted Epoxidation of Ethylene (Angew. Chem. 37/2016)." Angewandte Chemie 128, no. 37 (July 28, 2016): 11082. http://dx.doi.org/10.1002/ange.201606755.

Full text
APA, Harvard, Vancouver, ISO, and other styles
45

KWON, N. H., S. H. KIM, J. Y. KIM, J. Y. LIM, J. M. KIM, W. K. JUNG, K. T. PARK, et al. "Antimicrobial Performance of Alkaline Ionic Fluid (GC-100X) and Its Ability To Remove Escherichia coli O157:H7 from the Surface of Tomatoes." Journal of Food Protection 66, no. 9 (September 1, 2003): 1604–10. http://dx.doi.org/10.4315/0362-028x-66.9.1604.

Full text
Abstract:
An efficacy test of GC-100X, a noncorrosive alkaline ionic fluid (pH 12) composed of free radicals and supplemented with xylitol, was carried out against six major foodborne pathogens—Staphylococcus aureus FRI 913, Salmonella enterica serovar Enteritidis ATCC 13076, S. enterica serovar Typhimurium DT104 Korean isolate, Vibrio parahaemolyticus ATCC 17803, Escherichia coli O157:H7 ATCC 43894, and Pseudomonas aeruginosa KCTC 1637—at three different temperatures (4, 25, and 36°C) with or without organic load (2% yeast extract). Results revealed a more than 4-log10 (CFU/ml) reduction (1.0 × 104 CFU/ml reduction) against all pathogens reacted at 37°C for 3 h in the absence of organic material. GC-100X solution diluted with an equal volume of distilled or standard hard water (300 ppm CaCO3) showed effective bactericidal activity, particularly against gram-negative bacteria. Washing efficacy of GC-100X solution was compared against E. coli O157:H7 on cherry tomato surfaces with those of a commercially used detergent and chlorine water (100 ppm). Viable cell counts of E. coli O157:H7 that had penetrated to the cores of tomatoes after sanitizing treatment revealed that GC-100X stock and its 5% diluted solutions had similar washing effects to 100-ppm chlorine water and were more effective than the other kitchen detergent. These results indicate that GC-100X has good bactericidal and sanitizing activities and is useful as a new sanitizer for food safety and kitchen hygiene.
APA, Harvard, Vancouver, ISO, and other styles
46

KIM, MIN-JEONG, EUN SEOB LIM, and JOO-SUNG KIM. "Enzymatic Inactivation of Pathogenic and Nonpathogenic Bacteria in Biofilms in Combination with Chlorine." Journal of Food Protection 82, no. 4 (March 25, 2019): 605–14. http://dx.doi.org/10.4315/0362-028x.jfp-18-244.

Full text
Abstract:
ABSTRACT This study investigated the effects of enzyme application on biofilms of bacterial isolates from a cafeteria kitchen and foodborne pathogens and the susceptibility of Salmonella biofilms to proteinase K combined with chlorine treatment. For four isolates from a cafeteria kitchen (Acinetobacter, Enterobacter, and Kocuria) and six strains of foodborne pathogens (Salmonella enterica, Staphylococcus aureus, and Vibrio parahaemolyticus), the inhibitory effect of enzymes on biofilm formation at 25°C for 24 h or the degradative efficacy of enzymes on 24-h mature biofilm at 37°C for 1 h in tryptic soy broth (TSB) was examined in a polystyrene microtiter plate. The effect of enzymes was also evaluated on a subset of these strains in 20 times diluted TSB (1/20 TSB) at 25°C. The working concentrations of five enzymes were 1 U/100 μL for α-amylase, amyloglucosidase, cellulase, and DNase and 1 milli-Anson unit/100 μL for proteinase K. In addition, 24-h mature Salmonella Typhimurium biofilm on a stainless steel coupon was treated with proteinase K for 1 h at 25°C followed by 20 ppm of chlorine for 1 min at 25°C. The results showed that certain enzymes inhibited biofilm formation by the kitchen-originated bacteria; however, the enzymatic effect was diminished on the mature biofilms. Biofilm formation of V. parahaemolyticus was suppressed by all tested enzymes, whereas the mature biofilm was degraded by α-amylase, DNase I, and proteinase K. Proteinase K was effective in controlling Salmonella biofilms, whereas a strain-dependent variation was observed in S. aureus biofilms. In 1/20 TSB, Enterobacter cancerogenus and Kocuria varians were more susceptible to certain enzymes during biofilm formation than those in TSB, whereas the enzymatic effect was much decreased on 24-h mature biofilms, regardless of nutrient conditions. Furthermore, synergistic inactivation of Salmonella Typhimurium in biofilms was observed in the combined treatment of proteinase K followed by chlorine. Live/Dead assays also revealed a decrease in density and loss of membrane integrity in Salmonella Typhimurium biofilms exposed to the combined treatment. Therefore, certain enzymes can control biofilms of isolates residing in a cafeteria kitchen and foodborne pathogens. This study demonstrates the potential of enzymes for the sanitation of food processing environments and of proteinase K combined with chlorine to control Salmonella biofilms on food contact surfaces.
APA, Harvard, Vancouver, ISO, and other styles
47

Orlov, Yu P., N. V. Govorova, M. S. Neifeld, and I. A. Gorst. "Positive water balance and consequences for water-electrolyte metabolism in patients with polytrauma." Medical alphabet 2, no. 31 (November 12, 2019): 37–40. http://dx.doi.org/10.33667/2078-5631-2019-2-31(406)-37-40.

Full text
Abstract:
Objective. To assess the effect of a three-day positive water balance (PWB) during infusion therapy on the level of blood plasma electrolytes (sodium, chlorine), hematocrit, the concentration of total hemoglobin and the influence of the studied factors on patient survival in the intensive care unit.Materials and methods. In 47 patients with polytrauma who had multiple organ dysfunction and signs of systemic inflammation, using non-parametric analysis, the ROC-curve method, logistic regression, and relative risk analysis, we studied the effect of PWB on sodium and chlorine metabolism, hematocrit, total hemoglobin concentration and evaluated their relationship with treatment outcome. The subjects were divided into two groups: I — surviving patients whose PWB level for three days was less than 3,000 ml (n = 28) and II — the died (n = 19) whose PWB level for three days was more than 3,000 ml.Results. The average value of sodium for three days was significantly higher in patients of group II: 140.267 ± 3.713 mmol/l against the patients (138.067 ± 2.515 mmol/l; p = 0.020906) of group I. By the end of three days, the level of total hemoglobin was statistically significantly lower in group II (101.89 ± 18.27 g/l) than in group I (120.30 ± 21.70 g/l); p < 0.000025. The hematocrit index was also significantly lower in patients of group II (29.40 ± 4.85 %) than in group I (34.30 ± 6.03 %); p < 0.000034.Conclusion. At a PWB level of three days over 3,000 ml, there is an increase in blood sodium with a tendency to hypernatremia, a hemodilution effect with a decrease in hemoglobin and hematocrit. A negative effect of PWB on water-electrolyte metabolism, an acid-base state, the disorders of which cause an increased risk of death, is observed several times more often in patients with excess PWB (more than 3,000 ml in three days) than among patients with lower PWB (less than 3,000 ml for the same period).
APA, Harvard, Vancouver, ISO, and other styles
48

Afeng-Nkansah, D., E. Asumanu, P. Nyinaku, F. Acheampong, and R. Lamptey. "Response of Healthcare Workers to COVID-19 Protocols after the Index Case at 37 Military Hospital, Ghana." BioMed Research International 2021 (April 27, 2021): 1–6. http://dx.doi.org/10.1155/2021/2873859.

Full text
Abstract:
The diagnosis and management of COVID-19 are much dependent on the adherence to standardized protocols. Healthcare workers play a crucial role in the case management of COVID-19 in many institutions. Globally, the disease burden is increasing, and the mortality has reached over 2 041 426 compared with 323 000 in May 2020. In West Africa, the pandemic has shown a slow but steady rise in many countries. Existing protocols and their utilization are best assessed after the occurrence of the index case. General aim. The study assessed the health worker’s response to COVID-19 protocols at three designated areas of the in-hospital management care triaging, holding area, and treatment centers. Method. A qualitative design was used to assess the response of healthcare workers with regards to early case detection, infection prevention, risk communication to clients and compliance to protocols. The study conducted observational visits and purposively selected healthcare workers comprising of clinicians, nurses, emergency medical technicians, and laboratory technicians who perform routine duties at the triaging, holding, and treatment centers. A total of 41 observations were made over two weeks. Results. Participants comprised 23 males and 18 females. At all observed units, the case definition was being used to screen attendants presenting, and appropriate categorization of patients was ensured. The use of temperature in screening for COVID-19 at the units was generally adhered to. Only 50% of participants used the prescribed PPEs. The physical distancing between healthcare workers and client and between clients and caregivers were not enforced; however, hand hygiene was practiced. Disinfection of working surfaces and equipment with 0.5% chlorine or 70% alcohol-based rubs were used most of the time. It was observed however that no psychological counselling was given to suspected cases or their relatives. Conclusion. Healthcare workers showed discordant response to different parts of the protocols for COVID-19 especially appropriate distancing. There was an enhanced awareness among healthcare workers and improvement in infection prevention protocols. The study also observed that as the risk of infection increased from triaging to holding area and to treatment centers, the response of healthcare workers to COVID-19 protocols also improved. Risk communication is an essential part of the COVID-19 management strategy. At the treatment centers, healthcare workers adhered to this protocol, whereas it was a major gap at the triaging and holding areas.
APA, Harvard, Vancouver, ISO, and other styles
49

Kuttippurath, J., S. Godin-Beekmann, F. Lefèvre, and F. Goutail. "Spatial, temporal, and vertical variability of polar stratospheric ozone loss in the Arctic winters 2004/05–2009/10." Atmospheric Chemistry and Physics Discussions 10, no. 6 (June 15, 2010): 14675–711. http://dx.doi.org/10.5194/acpd-10-14675-2010.

Full text
Abstract:
Abstract. The stratospheric ozone loss during the Arctic winters 2004/05–2009/10 is investigated by using high resolution simulations from the chemical transport model Mimosa-Chim and observations from Microwave Limb Sounder (MLS) on Aura by the passive tracer technique. The winter 2004/05 was the coldest of the series with strongest chlorine activation. The ozone loss diagnosed from both model and measurements inside the polar vortex at 475 K ranges from ~1–0.7 ppmv in the warm winter 2005/06 to 1.7 ppmv in the cold winter 2004/05. Halogenated (chlorine and bromine) catalytic cycles contribute to 75–90% of the accumulated ozone loss at this level. At 675 K the lowest loss of ~0.4 ppmv is computed in 2008/09 from both simulations and observations and, the highest loss is estimated in 2006/07 by the model (1.3 ppmv) and in 2004/05 by MLS (1.5 ppmv). Most of the ozone loss (60–75%) at this level results from cycles catalysed by nitrogen oxides (NO and NO2) rather than halogens. At both 475 and 675 K levels the simulated ozone evolution inside the polar vortex is in reasonably good agreement with the observations. The ozone total column loss deduced from the model calculations at the MLS sampling locations inside the vortex ranges between 40 DU in 2005/06 and 94 DU in 2004/05, while that derived from observations ranges between 37 DU and 111 DU in the same winters. These estimates from both Mimosa-Chim and MLS are in general good agreement with those from the ground-based UV-VIS (ultra violet–visible) ozone loss analyses for the respective winters.
APA, Harvard, Vancouver, ISO, and other styles
50

Lazareva, E. A., and S. P. Yatsentyuk. "Effect of Disinfectants on SARS-CoV-2 RNA Detection in Swabs from Various Surfaces." Biotekhnologiya 37, no. 4 (2021): 78–84. http://dx.doi.org/10.21519/0234-2758-2021-37-4-78-84.

Full text
Abstract:
The COVID-19 pandemic has spread rapidly around the world, and some countries have introduced controls on imported products, including testing for viral nucleic acids. In this work, the influence of disinfectants for treatment of various SARS-CoV-2-contaminated surfaces on the detection of viral RNA fragments in swabs from these surfaces was analyzed using quantitative RT-PCR. The effect of disinfectants based on quaternary ammonium salt, hydrogen peroxide, 1-propanol, sodium salt of dichloroisocyanuric acid and ultraviolet radiation was investigated. Our results show that without the exposure to disinfectants, viral RNA can be detected on the surface of all examined materials for at least three days. UV irradiation or irrigation with a disinfectant containing 0.2% active chlorine had the greatest effect on the decontamination of non-porous surfaces as measured by RT-PCR of swabs from these surfaces. Irrigation of porous surfaces (cardboard) with disinfectants had practically no effect on the detection of SARS-CoV-2 RNA by RT-PCR. Key words: SARS-CoV-2, viral RNA, RT-PCR, disinfectants, UV irradiation, surface swabs Funding - This work was supported by the Federal Service of Veterinary and Phytosanitary Surveillance (Rosselkhoznadzor).
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography