Relevant bibliographies by topics / Church of Uganda, Rwanda, and Burundi

Contents

  1. Journal articles
  2. Dissertations / Theses
  3. Books
  4. Book chapters
  5. Conference papers
  6. Reports

Academic literature on the topic 'Church of Uganda, Rwanda, and Burundi'

Author: Grafiati
Published: 4 June 2021
Last updated: 24 February 2023

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Church of Uganda, Rwanda, and Burundi.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Church of Uganda, Rwanda, and Burundi"

1

Okia, C. A., W. Odongo, P. Nzabamwita, J. Ndimubandi, N. Nalika, and P. Nyeko. "Local knowledge and practices on use and management of edible insects in Lake Victoria basin, East Africa." Journal of Insects as Food and Feed 3, no. 2 (June 16, 2017): 83–93. http://dx.doi.org/10.3920/jiff2016.0051.

Full text
Abstract:
Edible insects (EIs) provide an important food source in Africa, but their potential to improve livelihoods and environmental conservation is yet to be fully exploited. This study contributes towards enhancing the use of EIs in the Lake Victoria basin (LVB), with particular attention to local perspectives of the catalogue, ecology, management, collection, processing and consumption. The study was conducted along the LVB in Uganda, Burundi and Rwanda between 2012 and 2013 using a household survey and focus group discussions. Results revealed that up to 20 insect species were eaten in Uganda, 13 in Burundi, and six in Rwanda. In Uganda, the most consumed insects were a katydid grasshopper (Ruspolia differens), palm weevil (Rhynchophorus phoenicis) larvae and termites (Macrotermes), while in Rwanda and Burundi, Macrotermes species were the most consumed. The most common source of EIs in households was their own collection from the wild, although a number of insects were also bought from markets. Local communities reported various ways of collecting, processing and storing insects. Overall, most of these activities require technological interventions. Despite the high consumption of EIs, no deliberate efforts were reported on conservation and rearing of any of the insects consumed in the three countries. This raises serious questions pertaining to the sustainable consumption of EIs, especially in the face of climate change in this region.
APA, Harvard, Vancouver, ISO, and other styles
2

Olasunkanmi, OSENI Isiaq. "Analysis of Convergence of Fiscal Variables in Sub-Saharan African Countries (1981-2007): A Stochastic Technique." Journal of Economics and Behavioral Studies 3, no. 4 (October 15, 2011): 235–48. http://dx.doi.org/10.22610/jebs.v3i4.276.

Full text
Abstract:
The study examined the analysis of convergence of fiscal variables among Sub-Saharan Africa (SSA) countries for the period 1981-2007. Secondary time-series data were used for the study and analysed using econometric techniques. The results showed that there were convergence in Burkina Faso, Cameroon, Nigeria, Rwanda, Sierra Leone and Uganda while there were divergence in Burundi, Kenya, Mauritius and South Africa. The study concluded that only Burkina Faso, Cameroon, Nigeria, Rwanda, Sierra Leone and Uganda could form Economic and Monetary Union (EMU) as a result of their convergence of Fiscal Variables.
APA, Harvard, Vancouver, ISO, and other styles
3

Ndikumana, I., A. Pinel-Galzi, Z. Negussie, S. N'chimbi Msolla, P. Njau, R. K. Singh, I. R. Choi, J. Bigirimana, D. Fargette, and E. Hébrard. "First Report of Rice yellow mottle virus on Rice in Burundi." Plant Disease 96, no. 8 (August 2012): 1230. http://dx.doi.org/10.1094/pdis-03-12-0293-pdn.

Full text
Abstract:
Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.
APA, Harvard, Vancouver, ISO, and other styles
4

Salih, Shadia A., Labuschange T. Labuschange, and Abdalla H. Mohammed. "ASSESSMENT OF GENETIC DIVERSITY OF SORGHUM [SORGHUM BICOLOR (L.) MOENCH] GERMPLASM IN EAST AND CENTRAL AFRICA." World Journal of Biology and Biotechnology 1, no. 3 (December 15, 2016): 115. http://dx.doi.org/10.33865/wjb.001.03.0010.

Full text
Abstract:
The study of genetic diversity in crops has a strong impact on plant breeding and maintenance of genetic resources. Comprehensive knowledge of the genetic biodiversity of cultivated and wild sorghum germplasm is an important prerequisite for sustainability of sorghum production. Recurrent droughts resulting from climate change scenarios’ in many East and Central Africa countries, where sorghum is a significant arable crop, can potentially lead to genetic erosion and loss of valuable genetic resources. This study aimed at assessing the extent and pattern of genetic diversity and population genetic structure among sorghum accessions from selected countries in East and Central Africa (Sudan, Kenya, Uganda, Ethiopia, Eritrea, Rwanda and Burundi) using39 microsatellites markers. The studied loci were polymorphic and revealed a total of 941 alleles in 1108 sorghum genotypes. High levels of diversity were revealed with Sudan (68.5) having the highest level of genetic diversity followed by Ethiopia (65.3), whereas Burundi (0.45) and Rwanda (0.33) had the lowest level of genetic diversity. Analysis of molecular variance indicated, all variance components to be highly significant (p<0.001). The bulk of the variation was partitioned within countries (68.1%) compared to among countries (31.9%). Genetic differentiation between countries based on FST values was high and highly significant (FST=0.32). Neighbour-joining (NJ) analysis formed two distinct clusters according to geographic regions, namely the central region (Kenya, Burundi, Uganda and Rwanda) and the eastern region (Sudan, Ethiopia, and Eritrea). Population structure analysis revealed six distinct populations corresponding to NJ analysis and geographical origin of accessions. Countries clustered independently with small integration, which indicated the role of farmers’ practices in the maintenance of landrace identity and genetic diversity. The observed high level of genetic diversity indicated that germplasm from East Africa should be preserved from genetic erosion, especially in countries with the highest diversity.
APA, Harvard, Vancouver, ISO, and other styles
5

Njuguna, Joseph, and Margaret Jjuuko. "A framing analysis of mainstream newspaper coverage of the 2013 ‘Coalition of the Willing’ initiative in East Africa." Journal of African Media Studies 12, no. 3 (September 1, 2020): 241–54. http://dx.doi.org/10.1386/jams_00022_1.

Full text
Abstract:
The phrase, ‘Coalition of the Willing’, emerged in East Africa in 2013, when three East African Community (EAC) members (Kenya, Uganda and Rwanda) forged a Tripartite Initiative to fast-track the EAC regional integration, sidelining Tanzania and Burundi, for their apparent ‘aloofness’ to integration. This coalition created tensions among the five countries, exacerbating an already simmering conflict between Tanzania and Rwanda involving the expulsion of ‘illegal’ Rwandan migrants from Tanzania. Informed by contemporary political communication and media framing, this article examines how these events were framed in five leading newspapers in East Africa: the Daily Nation (Kenya), the Daily Monitor (Uganda), The Citizen (Tanzania), The New Times (Rwanda) and The East African (EAC region). Through a thematic frame analysis, we interrogate the prevalence and implications of five prominent themes found in most political conflicts (attributions of responsibility, conflict, human interest, economic consequences and morality) on the ‘Coalition of the Willing’ media debate. The analysis reveals conflicting frames with a potential to inflame antagonistic media debates to the integration efforts ‐ by the resultant blame-game and opening up of historical wounds and personal differences, among the key players.
APA, Harvard, Vancouver, ISO, and other styles
6

Krichene, Noureddine. "Purchasing Power Parities in Five East African Countries: Burundi, Kenya, Rwanda, Tanzania, and Uganda." IMF Working Papers 98, no. 148 (1998): 1. http://dx.doi.org/10.5089/9781451856798.001.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

SWAIN, ASHOK. "Ethiopia, the Sudan, and Egypt: The Nile River Dispute." Journal of Modern African Studies 35, no. 4 (December 1997): 675–94. http://dx.doi.org/10.1017/s0022278x97002577.

Full text
Abstract:
The Nile flows for 6,700 kilometres through ten countries in north-eastern Africa – Rwanda, Burundi, Zaïre/Congo, Tanzania, Kenya, Uganda, Eritrea, Ethiopia, the Sudan, and Egypt – before reaching the Mediterranean, and is the longest international river system in the world – see Map 1. Its two main tributaries converge at Khartoum: the White Nile, which originates from Burundi and flows through the Equatorial Lakes, provides a small but steady flow that is fed by the eternal snows of the Ruwenzori (the ‘rain giver’) mountains, while the Blue Nile, which suffers from high seasonal fluctuations, descends from the lofty Ethiopian ‘water tower’ highlands. They provide 86 per cent of the waters of the Nile – Blue Nile 59 per cent, Baro-Akobo (Sobat) 14 per cent, Tekesse (Atbara) 13 per cent – while the contribution from the Equatorial Lakes region is only 14 per cent.
APA, Harvard, Vancouver, ISO, and other styles
8

Vangroenweghe, Daniel. "The earliest cases of human immunodeficiency virus type 1 group M in Congo-Kinshasa, Rwanda and Burundi and the origin of acquired immune deficiency syndrome." Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 356, no. 1410 (June 29, 2001): 923–25. http://dx.doi.org/10.1098/rstb.2001.0876.

Full text
Abstract:
The early cases of acquired immune deficiency syndrome and human immunodeficiency virus type 1 (HIV–1) infection in the 1960s and 1970s in Congo–Kinshasa (Zaire), Rwanda and Burundi are reviewed. These countries appear to be the source of the HIV–1 group M epidemic, which then spread outwards to neighbouring Tanzania and Uganda in the east, and Congo–Brazzaville in the west. Further spread to Haiti and onwards to the USA can be explained by the hundreds of single men from Haiti who participated in the UNESCO educational programme in the Congo between 1960 and 1975.
APA, Harvard, Vancouver, ISO, and other styles
9

Smith, Charles David. "The Geopolitics of Rwandan Resettlement: Uganda and Tanzania." Issue: A Journal of Opinion 23, no. 2 (1995): 54–57. http://dx.doi.org/10.1017/s0047160700502042.

Full text
Abstract:
By October 1994 the population of refugees from Rwanda and Burundi registered with the UN High Commission of Refugees in Tanzania was about 570,000. (Personal communication: Yukiko Hameda, UNHCR-Nairobi.) And from the point of view of the international and Tanzanian authorities responsible for refugees, the crisis continues to grow. On December 23, 1994, Patrick Chokala, Press Secretary to the Tanzanian President, claimed that 300-400 refugees enter Tanzania every day; the total number then was 591,000. (Daily News, Dar es Salaam, Tanzania, 24 December 1994.)The human tragedy, the genocide which began after President Habyarimana’s plane was shot down on April 6, 1994 and which in the space of a few short months left one-half million people dead and precipitated the flight of two and one-half million people to refugee camps in Zaire and Tanzania, cannot be undone, although expeditious and fair judicial procedures are a necessary step to a secure future.
APA, Harvard, Vancouver, ISO, and other styles
10

Brett, E. A. "Neutralising the Use of Force in Uganda: the Rôle of the Military in Politics." Journal of Modern African Studies 33, no. 1 (March 1995): 129–52. http://dx.doi.org/10.1017/s0022278x00020887.

Full text
Abstract:
Bullets rather than ballots have dominated politics in Uganda since independence, where two governments have been removed by coups, one by a foreign invasion, and another by an armed rebellion. Force has not only dominated the formal political system, but also threatened the economic and social basis on which democratic processes and progressive development depends. For 25 years predatory military rule and civil war have destroyed lives, skills, and assets, undermined institutional competence and accountability, caused widespread per sonal trauma, suppressed autonomous organisations in civil society, and intensified ethnic hostility and conflict. And Uganda is not alone in this – the middle of the twentieth century was dominated by fascism and war, while sectarian or ethnic conflicts in Bosnia, Ulster, Sri Lanka, Somalia, the Sudan, Angola, Liberia, Zaï, Burundi, and Rwanda have inflicted untold damage on people and property.1
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "Church of Uganda, Rwanda, and Burundi"

1

Ntukanyagwe, Michelle M. "A retrospective comparative analysis of the maternal and child health MDGs in Rwanda, Burundi and Uganda: Beyond 2015." Master's thesis, Faculty of Commerce, 2019. http://hdl.handle.net/11427/31186.

Full text
Abstract:
The timeline of the Millennium Development Goals (MDGs) elapsed in 2015, global indicators showed that Africa still accounts for almost half of all child deaths globally and has the world’s highest maternal mortality rates. By the year 2015, Africa as a continent was unable to meet the maternal and child health MDG targets. This study seeks to retrospectively compare, the progress made on the maternal and child health related Millennium Development Goals namely: MDG4- Reduce child mortality and MDG5- Improve Maternal Health, in Burundi, Rwanda and Uganda. Indicators show that, only Rwanda was able to achieve the maternal and child health MDGs. Specifically, the study provides a contextual understanding of the policy interventions implemented by Rwanda, despite starting from a lower base in comparison to Burundi and Uganda due to the 1994 Genocide against the Tutsi. The study also sought to understand how broad governance indicators specifically, government effectiveness and control of corruption vary between the three countries: Rwanda, Burundi and Uganda as well as their impact on maternal and child health trends. The study illustrates how Rwanda’s governance is underpinned by a system that is strongly hinged on ideological clarity, good leadership, country ownership for effective policy execution and enforcement of accountability through home grown solutions like imihigo. The integration of imihigo within the health sector has, in addition to other innovative interventions, like the implementation of the Community Health Insurance Policy, deployment of over 60,000 community health workers, innovative use of ICT in health like rapid short message service (sms), drones among others. In contrasting the governance of the health sectors in Rwanda and Uganda, one of the striking differences is that in Rwanda, there are strong linkages between the local and central levels for policy implementation and evaluation, and between the health sector and finance ministry. These are indicative of strong intra-governmental accountability. Uganda on the other hand, despite having good laws and policies in place, still faces poor implementation and lack of strong accountability mechanisms, due to low levels of ownership. The contrast is also sharply illustrated by Rwanda’s higher score in the indicative measures of “government effectiveness and control of corruption”. In short, better quality governments usually have positive effect on development outcomes thanks to overall efficiency in the delivery of public services. Specific recommendations include for Uganda to generate good local governance, effective implementation of decentralisation, follow through of policies and enforcement of accountability for performance failures, the use of community health workers to address existing scarcity of health sector personnel as well as the adoption of ICT policies to support the implementation of health interventions.
APA, Harvard, Vancouver, ISO, and other styles
2

Drozenová, Blanka. "Postavení vybraných zemí východní Afriky ve světové ekonomice a perspektivy jejich budoucího vývoje." Master's thesis, Vysoká škola ekonomická v Praze, 2010. http://www.nusl.cz/ntk/nusl-73748.

Full text
Abstract:
This thesis deals with the position of the selected countries of East Africa in the world economy and prospects of their future development. The first chapter provides basic information about Rwanda, Burundi and Uganda. The second chapter belongs to the most important ones and deals with the historical context. The third part adds some information about the UN approach to the events in this territory. The fourth chapter is devoted to foreign policy orientation. The next two chapters are the most significant ones: the fifth part deals with development of economy and current economic situation, the sixth part discusses foreign trade. The last chapter provides an outlook for the future of these African countries.
APA, Harvard, Vancouver, ISO, and other styles
3

Hategekimana, Celestin. "Solidarity with strangers : the challenges posed by the Great Lakes region refugees to the Ministry of the Anglican Cathedral of the Holy Nativity, Pietermaritzburg." Thesis, 2007. http://hdl.handle.net/10413/282.

Full text
Abstract:
This thesis focuses on the challenges posed by the refugees from the Great Lakes Region to the ministry of the Anglican Cathedral of the Holy Nativity in Pietermaritzburg, South Africa. It intends to inform the Christian world in general and specifically the Anglican Cathedral of the Holy Nativity of the current refugee situation and its causes. Furthermore, this study shows that understanding the refugees' livelihood strategies is a prerequisite to improved interventions. Using the Sustainable Livelihood Framework, this study describes some of the positive and negative outcomes from the mechanisms and strategies developed by refugees in order to stabilize and enhance their situation. Looking at the livelihood challenges faced by the Great Lakes Region refugees, this study shows how UNHCR (United Nations High Commission for Refugees) has been in a weak position to challenge the policies of its funders and host governments even when those policies fail to respond adequately to refugee problems.
Thesis (M.Th.)-University of KwaZulu-Natal, Pietermaritzburg, 2007.
APA, Harvard, Vancouver, ISO, and other styles

Books on the topic "Church of Uganda, Rwanda, and Burundi"

1

Bishop Alfred Robert Tucker and the establishment of the African Anglican Church. Nairobi: WordAlive Publishers, 2008.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Organization, Kagera Basin. Information document: (Burundi-Rwanda-Tanzania-Uganda). [Kigali, Rwanda?]: Secretariat, 1990.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

John, Fanshawe, and Stevenson Terry, eds. Birds of East Africa: Kenya, Tanzania, Uganda, Rwanda, and Burundi. Princeton, N.J: Princeton University Press, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

1936-, Parker Ian, ed. African wildlife safaris: Kenya, Uganda, Tanzania, Ethiopia, Somalia, Malawi, Zambia, Rwanda, Burundi. Ashbourne, Derbyshire: Moorland, 1989.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

John, Fanshawe, ed. Field guide to the birds of East Africa: Kenya, Tanzania, Uganda, Rwanda, Burundi. London: T & A D Poyser, 2002.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Krichene, Noureddine. Purchasing power parities in five East African countries: Burundi, Kenya, Rwanda, Tanzania, and Uganda. [Washington, D.C.]: International Monetary Fund, African Department, 1998.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

1953-, Spawls Stephen, ed. A field guide to the reptiles of East Africa: Kenya, Tanzania, Uganda, Rwanda and Burundi. San Diego: Academic Press, 2002.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

trad, Féménias Anne, ed. Kenya, Tanzanie, Burundi, Comores, Ouganda, Ruanda, Zaïre. Paris: Arthaud, 1989.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

The great lakes of Africa: Two thousand years of history. New York: Zone Books, 2003.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

University, Uganda Christian, ed. Church of Uganda archives. Leiden, The Netherlands: IDC Publishers, 2008.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "Church of Uganda, Rwanda, and Burundi"

1

Mashingia, Jane, and Aarti Patel. "Pharmaceutical Policy in the East African Community: Burundi, Kenya, Uganda, Rwanda, Tanzania." In Pharmaceutical Policy in Countries with Developing Healthcare Systems, 13–24. Cham: Springer International Publishing, 2017. http://dx.doi.org/10.1007/978-3-319-51673-8_2.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Ejigu, Mersie. "Environmental Scarcity, Insecurity and Conflict: The Cases of Uganda, Rwanda, Ethiopia and Burundi." In Hexagon Series on Human and Environmental Security and Peace, 885–93. Berlin, Heidelberg: Springer Berlin Heidelberg, 2009. http://dx.doi.org/10.1007/978-3-540-68488-6_68.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Kalyango, Yusuf. "Radio Regulation in East Africa: Obstacles to Social Change and Democratization in Burundi, Kenya, Rwanda, and Uganda." In The Palgrave Handbook of Global Radio, 501–18. London: Palgrave Macmillan UK, 2012. http://dx.doi.org/10.1007/978-0-230-37332-7_28.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Schneider, Marius, and Vanessa Ferguson. "Rwanda." In Enforcement of Intellectual Property Rights in Africa. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780198837336.003.0043.

Full text
Abstract:
Found in East Africa, Rwanda borders the Democratic Republic of Congo (DRC), Tanzania, Uganda, and Burundi. It is a hilly and fertile landlocked state of 26,338 square kilometres (km). It is one of the smallest countries on the continent but is densely populated with 12.2 million people in 2017. Kigali is the capital of and largest city in Rwanda. It is also Rwanda’s economic, cultural, and transport hub and is found in the centre of the country. Most of the population lives in rural areas. Rwanda has a forty-five-hour working week and the currency used is Rwandan franc (FRW).
APA, Harvard, Vancouver, ISO, and other styles
5

Schneider, Marius, and Vanessa Ferguson. "Uganda." In Enforcement of Intellectual Property Rights in Africa. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780198837336.003.0055.

Full text
Abstract:
Uganda is a landlocked country situated in East Africa and is bordered by Congo, the Sudan, Kenya, Tanzania, and Rwanda. Lake Victoria forms part of the southern border. The country’s land area is 241,037 square kilometre (km) with a population of approximately 42.27 million, according to 2019 estimates. Kampala is the capital and by far the largest city in Uganda, with a population around 1.66 million. Kira Town lies approximately 14 km north-east of Kampala. The town is the second largest urban centre of Uganda after Kampala. The Kampala Industrial Business Park is situated at the south-eastern end of Kira town. Nansana, located 13 km northwest of Kampala, serves as a dormitory town to the city of Kampala and there are plans to transform the town into a commercial hub although currently small informal markets dominate the economy. Mbarara in the western region is the capital and main administrative hub and commercial centre of the Mbarara District. It is also the largest industrial town second to Kampala and crucial transportation hub for goods in transit to Rwanda, Burundi, and the Democratic Republic of Congo. Other main cities include Gulu and Lira in the northern region, and Jinja in the eastern
APA, Harvard, Vancouver, ISO, and other styles
6

Schneider, Marius, and Vanessa Ferguson. "Democratic Republic of the Congo." In Enforcement of Intellectual Property Rights in Africa. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780198837336.003.0016.

Full text
Abstract:
The Democratic Republic of the Congo, also known as the DRC or Congo-Kinshasa, is located in Central Africa. It borders nine African countries: Congo (Brazzaville), Central African Republic, Sudan, Uganda, Rwanda, Burundi, Tanzania, Zambia, and Angola. It has a small coastline on the Atlantic. It is the largest Francophone country in Africa, the second largest country in Africa, and the eleventh largest country in the world. The size of the country means that the DRC spans two time zones. Sparsely populated, the DRC had 81.3 million inhabitants in 2017. Business hours for most firms and government offices are from 0800 to 1700 Monday to Friday and Saturday from 0730 to 1200. The national currency in DRC is the Congolese franc (CDF).
APA, Harvard, Vancouver, ISO, and other styles
7

Ilunga, Yvan Yenda. "Regional Political Leadership and Policy Integration in Great Lakes Region of Africa." In Advances in Electronic Government, Digital Divide, and Regional Development, 267–77. IGI Global, 2018. http://dx.doi.org/10.4018/978-1-5225-4993-2.ch013.

Full text
Abstract:
For the past two decades, following the Rwandan genocide in 1994, the Great Lakes Region of Africa has become a conflict-ridden zone marked by mass violations of human rights and political instabilities. Part of these instabilities and violence is due to the lack of strong and stable political leadership and institutions in many of the countries in the region. In 1996, the Democratic Republic of Congo (DRC) was plagued by the uprising of the rebel movement called the Alliance des Forces Démocratiques pour la Libération du Congo-Zaïre. This movement was a coalition of Rwanda, Burundi, and Uganda, along with Congolese people. However, the AFDL victory was short-lived since the coalition parties broke up their alliance in 1998, which led to a new cycle of conflict which continued to destabilize the DRC to date with its Eastern provinces being most affected. In addition to conflict within the DRC, political instability and crisis of legitimacy of political leadership in South Sudan, Burundi, and the Central African Republic have also exacerbated the instability in the region. In this chapter, the author argues that peace and stability in the Great Lakes Region of Africa would depend on how best several facets of policies are integrated into one operational framework for peace and stability.
APA, Harvard, Vancouver, ISO, and other styles
8

Asiimwe, Edgar Napoleon, and Grönlund Åke. "E-Waste Management in East African Community." In Handbook of Research on E-Government in Emerging Economies, 307–27. IGI Global, 2012. http://dx.doi.org/10.4018/978-1-4666-0324-0.ch015.

Full text
Abstract:
The rapidly increased use of Information and Communications Technologies (ICTs) has increased demand for electronic equipment such as mobile phones and computers. Individuals and government institutions worldwide are adopting ICTs at a fast pace. Increased consumption has resulted in huge amounts of e-Waste generated from scrapped electronics. E-Waste contains chemical substances that have adverse effects on the environment and human health. Consequently, handling of e-Waste needs to be organized in ways that minimize the adverse effects. This chapter investigates how the East African Community (EAC) governments, i.e., Kenya, Uganda, Tanzania, Rwanda, and Burundi, conceive their role in combating negative impact of e-Waste and how their views and current actions compare to the current state of the art practices in e-Waste management. As data on e-Waste handling in EAC countries is not publicly available, semi-structured interviews with high government officials and a literature review were conducted. The results show that EAC governments consider e-Waste to be an emerging problem. Despite this awareness and attempts to mitigate the problem in some of the countries, there are currently no solid solutions that have been crafted to rectify or mitigate this problem. The study suggests practical solutions for resolving e-Waste challenges in EAC.
APA, Harvard, Vancouver, ISO, and other styles
9

Gathii, James Thuo. "International Courts as Coordination Devices for Opposition Parties." In The Performance of Africa's International Courts, 35–87. Oxford University Press, 2020. http://dx.doi.org/10.1093/oso/9780198868477.003.0002.

Full text
Abstract:
This chapter examines how opposition political parties have sought to overcome repressive practices in four of the six East African Community Member States: Kenya, Tanzania, Uganda, and South Sudan. Opposition political parties and politicians from these countries have prodded the East African Court of Justice (EACJ) to use a treaty remedy for violations of rules governing the elections of members to the East African Legislative Assembly (EALA) in each of these countries. They have done so by pursuing a judicial remedy in the EACJ to resolve a coordination problem that opposition parties face when their opportunity to participate in an above-board election is compromised. These cases show how challenging the electoral malpractices of dominant parties in the EACJ facilitate opposition mobilization in ways that are not always possible, or even anticipated, in their home country. The EACJ has facilitated this coordination by consistently affirming that above-board elections are the only permissible mode of electing members of the EALA. This has helped opposition political parties to know when they have a factual basis with a likelihood of success so they could bring cases against dominant political parties in the EACJ. By contrast, the lack of cases from Burundi and Rwanda shows that the clamp down on organizational rights in these countries have made it impossible for opposition parties and politicians to bring election cases before the EACJ.
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Church of Uganda, Rwanda, and Burundi"

1

Tangwa, Elvis, Vit Voženílek, Jan Brus, and Vilem Pechanec. "CLIMATE CHANGE AND THE AGRICULTURAL POTENTIAL OF SELECTED LEGUME CROPS IN EAST AFRICA." In GEOLINKS International Conference. SAIMA Consult Ltd, 2020. http://dx.doi.org/10.32008/geolinks2020/b1/v2/02.

Full text
Abstract:
Land expansion to increase agricultural production in East Africa (Burundi, Ethiopia, Kenya, Rwanda, Tanzania and Uganda) will be limited by climate change. In this study, we predict landscape suitability for chickpea (Cicer arietinum), common bean (Phaseolus vulgaris), lentil (Lens culinaris), field pea (Pisum sativum) and pigeon pea (Cajanus cajan) cultivated across diverse agro-ecological zones (AEZs) in East Africa from 1970 to 2070, under the 4.5 emission scenario. Our aim was to understand how suitability shifts among the AEZs might affect the agricultural potential of the selected crops. We use the geolocations of each crop together with response curves from the species distribution software, Maxent to fine-tune the expert based EcoCrop model to the prevailing climatic conditions in the study region. Our optimal precipitation and temperature ranges compared reasonably with the FAO base parameters, deviating by ±200mm and ±5oC, respectively. There is currently a high potential for lentil, pea and common bean in the region. However, under future climates, the suitability of common bean and lentil with a much narrow climate range will shrink considerably while pigeon pea and chickpea will continue to be suitable. Under projected climatic conditions, the agricultural potential of these legumes will be limited by drought or heat stress as landscape suitability will shift optimally toward the cool sub-humid (tcsh), and the cool semi-arid (tcsa) zones. Tanzania, Kenya and Uganda will be the most affected and will lose a large share of suitable arable land. Different adaptation measures will be needed to increase the agricultural potential and optimized production in vulnerable AEZs. In general, smallholder farmers will have to substitute lentil and common bean for chickpea and pigeon pea or other suitable substitutes to address food security issues. Notwithstanding the limitations of this study, our results highlight the vulnerability of legumes crops as well as their production zones which could be useful in the formulation of adaptation strategies for the East African region.
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "Church of Uganda, Rwanda, and Burundi"

1

Evaluation of United Nations-supported pilot projects for the prevention of mother-to-child transmission of HIV: Overview of findings. Population Council, 2003. http://dx.doi.org/10.31899/hiv2003.1008.

Full text
Abstract:
Worldwide about 800,000 children a year get HIV infections from their mothers—either during pregnancy, childbirth, or breastfeeding. Countries have the potential to prevent a large share of these infections through low-cost, effective interventions. UN agencies have taken the lead in helping developing countries mount programs for prevention of mother-to-child transmission (PMTCT). This working paper presents key findings from an evaluation of UN-supported pilot PMTCT projects in 11 countries: Botswana, Burundi, Cote d’Ivoire, Honduras, India, Kenya, Rwanda, Tanzania, Uganda, Zambia, and Zimbabwe. Key findings include feasibility and coverage, factors contributing to program coverage, program challenges, scaling up, the special case of low-prevalence countries, and recommendations. The pilot experience has shown that introducing PMTCT programs into antenatal care in a wide variety of settings is feasible and acceptable to a significant proportion of antenatal care clients who have a demand for HIV information, counseling, and testing. As they go to scale, PMTCT programs can learn from the pilot phase, during which hundreds of thousands of clients were successfully reached.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'Church of Uganda, Rwanda, and Burundi' for particular source types:
Journal articles Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography