Journal articles: 'Church of Uganda, Rwanda, and Burundi'

1

Okia, C. A., W. Odongo, P. Nzabamwita, J. Ndimubandi, N. Nalika, and P. Nyeko. "Local knowledge and practices on use and management of edible insects in Lake Victoria basin, East Africa." Journal of Insects as Food and Feed 3, no. 2 (June 16, 2017): 83–93. http://dx.doi.org/10.3920/jiff2016.0051.

Full text

Abstract:

Edible insects (EIs) provide an important food source in Africa, but their potential to improve livelihoods and environmental conservation is yet to be fully exploited. This study contributes towards enhancing the use of EIs in the Lake Victoria basin (LVB), with particular attention to local perspectives of the catalogue, ecology, management, collection, processing and consumption. The study was conducted along the LVB in Uganda, Burundi and Rwanda between 2012 and 2013 using a household survey and focus group discussions. Results revealed that up to 20 insect species were eaten in Uganda, 13 in Burundi, and six in Rwanda. In Uganda, the most consumed insects were a katydid grasshopper (Ruspolia differens), palm weevil (Rhynchophorus phoenicis) larvae and termites (Macrotermes), while in Rwanda and Burundi, Macrotermes species were the most consumed. The most common source of EIs in households was their own collection from the wild, although a number of insects were also bought from markets. Local communities reported various ways of collecting, processing and storing insects. Overall, most of these activities require technological interventions. Despite the high consumption of EIs, no deliberate efforts were reported on conservation and rearing of any of the insects consumed in the three countries. This raises serious questions pertaining to the sustainable consumption of EIs, especially in the face of climate change in this region.

APA, Harvard, Vancouver, ISO, and other styles

2

Olasunkanmi, OSENI Isiaq. "Analysis of Convergence of Fiscal Variables in Sub-Saharan African Countries (1981-2007): A Stochastic Technique." Journal of Economics and Behavioral Studies 3, no. 4 (October 15, 2011): 235–48. http://dx.doi.org/10.22610/jebs.v3i4.276.

Full text

Abstract:

The study examined the analysis of convergence of fiscal variables among Sub-Saharan Africa (SSA) countries for the period 1981-2007. Secondary time-series data were used for the study and analysed using econometric techniques. The results showed that there were convergence in Burkina Faso, Cameroon, Nigeria, Rwanda, Sierra Leone and Uganda while there were divergence in Burundi, Kenya, Mauritius and South Africa. The study concluded that only Burkina Faso, Cameroon, Nigeria, Rwanda, Sierra Leone and Uganda could form Economic and Monetary Union (EMU) as a result of their convergence of Fiscal Variables.

APA, Harvard, Vancouver, ISO, and other styles

3

Ndikumana, I., A. Pinel-Galzi, Z. Negussie, S. N'chimbi Msolla, P. Njau, R. K. Singh, I. R. Choi, J. Bigirimana, D. Fargette, and E. Hébrard. "First Report of Rice yellow mottle virus on Rice in Burundi." Plant Disease 96, no. 8 (August 2012): 1230. http://dx.doi.org/10.1094/pdis-03-12-0293-pdn.

Full text

Abstract:

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

APA, Harvard, Vancouver, ISO, and other styles

4

Salih, Shadia A., Labuschange T. Labuschange, and Abdalla H. Mohammed. "ASSESSMENT OF GENETIC DIVERSITY OF SORGHUM [SORGHUM BICOLOR (L.) MOENCH] GERMPLASM IN EAST AND CENTRAL AFRICA." World Journal of Biology and Biotechnology 1, no. 3 (December 15, 2016): 115. http://dx.doi.org/10.33865/wjb.001.03.0010.

Full text

Abstract:

The study of genetic diversity in crops has a strong impact on plant breeding and maintenance of genetic resources. Comprehensive knowledge of the genetic biodiversity of cultivated and wild sorghum germplasm is an important prerequisite for sustainability of sorghum production. Recurrent droughts resulting from climate change scenarios’ in many East and Central Africa countries, where sorghum is a significant arable crop, can potentially lead to genetic erosion and loss of valuable genetic resources. This study aimed at assessing the extent and pattern of genetic diversity and population genetic structure among sorghum accessions from selected countries in East and Central Africa (Sudan, Kenya, Uganda, Ethiopia, Eritrea, Rwanda and Burundi) using39 microsatellites markers. The studied loci were polymorphic and revealed a total of 941 alleles in 1108 sorghum genotypes. High levels of diversity were revealed with Sudan (68.5) having the highest level of genetic diversity followed by Ethiopia (65.3), whereas Burundi (0.45) and Rwanda (0.33) had the lowest level of genetic diversity. Analysis of molecular variance indicated, all variance components to be highly significant (p<0.001). The bulk of the variation was partitioned within countries (68.1%) compared to among countries (31.9%). Genetic differentiation between countries based on FST values was high and highly significant (FST=0.32). Neighbour-joining (NJ) analysis formed two distinct clusters according to geographic regions, namely the central region (Kenya, Burundi, Uganda and Rwanda) and the eastern region (Sudan, Ethiopia, and Eritrea). Population structure analysis revealed six distinct populations corresponding to NJ analysis and geographical origin of accessions. Countries clustered independently with small integration, which indicated the role of farmers’ practices in the maintenance of landrace identity and genetic diversity. The observed high level of genetic diversity indicated that germplasm from East Africa should be preserved from genetic erosion, especially in countries with the highest diversity.

APA, Harvard, Vancouver, ISO, and other styles

5

Njuguna, Joseph, and Margaret Jjuuko. "A framing analysis of mainstream newspaper coverage of the 2013 ‘Coalition of the Willing’ initiative in East Africa." Journal of African Media Studies 12, no. 3 (September 1, 2020): 241–54. http://dx.doi.org/10.1386/jams_00022_1.

Full text

Abstract:

The phrase, ‘Coalition of the Willing’, emerged in East Africa in 2013, when three East African Community (EAC) members (Kenya, Uganda and Rwanda) forged a Tripartite Initiative to fast-track the EAC regional integration, sidelining Tanzania and Burundi, for their apparent ‘aloofness’ to integration. This coalition created tensions among the five countries, exacerbating an already simmering conflict between Tanzania and Rwanda involving the expulsion of ‘illegal’ Rwandan migrants from Tanzania. Informed by contemporary political communication and media framing, this article examines how these events were framed in five leading newspapers in East Africa: the Daily Nation (Kenya), the Daily Monitor (Uganda), The Citizen (Tanzania), The New Times (Rwanda) and The East African (EAC region). Through a thematic frame analysis, we interrogate the prevalence and implications of five prominent themes found in most political conflicts (attributions of responsibility, conflict, human interest, economic consequences and morality) on the ‘Coalition of the Willing’ media debate. The analysis reveals conflicting frames with a potential to inflame antagonistic media debates to the integration efforts ‐ by the resultant blame-game and opening up of historical wounds and personal differences, among the key players.

APA, Harvard, Vancouver, ISO, and other styles

6

Krichene, Noureddine. "Purchasing Power Parities in Five East African Countries: Burundi, Kenya, Rwanda, Tanzania, and Uganda." IMF Working Papers 98, no. 148 (1998): 1. http://dx.doi.org/10.5089/9781451856798.001.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

SWAIN, ASHOK. "Ethiopia, the Sudan, and Egypt: The Nile River Dispute." Journal of Modern African Studies 35, no. 4 (December 1997): 675–94. http://dx.doi.org/10.1017/s0022278x97002577.

Full text

Abstract:

The Nile flows for 6,700 kilometres through ten countries in north-eastern Africa – Rwanda, Burundi, Zaïre/Congo, Tanzania, Kenya, Uganda, Eritrea, Ethiopia, the Sudan, and Egypt – before reaching the Mediterranean, and is the longest international river system in the world – see Map 1. Its two main tributaries converge at Khartoum: the White Nile, which originates from Burundi and flows through the Equatorial Lakes, provides a small but steady flow that is fed by the eternal snows of the Ruwenzori (the ‘rain giver’) mountains, while the Blue Nile, which suffers from high seasonal fluctuations, descends from the lofty Ethiopian ‘water tower’ highlands. They provide 86 per cent of the waters of the Nile – Blue Nile 59 per cent, Baro-Akobo (Sobat) 14 per cent, Tekesse (Atbara) 13 per cent – while the contribution from the Equatorial Lakes region is only 14 per cent.

APA, Harvard, Vancouver, ISO, and other styles

8

Vangroenweghe, Daniel. "The earliest cases of human immunodeficiency virus type 1 group M in Congo-Kinshasa, Rwanda and Burundi and the origin of acquired immune deficiency syndrome." Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 356, no. 1410 (June 29, 2001): 923–25. http://dx.doi.org/10.1098/rstb.2001.0876.

Full text

Abstract:

The early cases of acquired immune deficiency syndrome and human immunodeficiency virus type 1 (HIV–1) infection in the 1960s and 1970s in Congo–Kinshasa (Zaire), Rwanda and Burundi are reviewed. These countries appear to be the source of the HIV–1 group M epidemic, which then spread outwards to neighbouring Tanzania and Uganda in the east, and Congo–Brazzaville in the west. Further spread to Haiti and onwards to the USA can be explained by the hundreds of single men from Haiti who participated in the UNESCO educational programme in the Congo between 1960 and 1975.

APA, Harvard, Vancouver, ISO, and other styles

9

Smith, Charles David. "The Geopolitics of Rwandan Resettlement: Uganda and Tanzania." Issue: A Journal of Opinion 23, no. 2 (1995): 54–57. http://dx.doi.org/10.1017/s0047160700502042.

Full text

Abstract:

By October 1994 the population of refugees from Rwanda and Burundi registered with the UN High Commission of Refugees in Tanzania was about 570,000. (Personal communication: Yukiko Hameda, UNHCR-Nairobi.) And from the point of view of the international and Tanzanian authorities responsible for refugees, the crisis continues to grow. On December 23, 1994, Patrick Chokala, Press Secretary to the Tanzanian President, claimed that 300-400 refugees enter Tanzania every day; the total number then was 591,000. (Daily News, Dar es Salaam, Tanzania, 24 December 1994.)The human tragedy, the genocide which began after President Habyarimana’s plane was shot down on April 6, 1994 and which in the space of a few short months left one-half million people dead and precipitated the flight of two and one-half million people to refugee camps in Zaire and Tanzania, cannot be undone, although expeditious and fair judicial procedures are a necessary step to a secure future.

APA, Harvard, Vancouver, ISO, and other styles

10

Brett, E. A. "Neutralising the Use of Force in Uganda: the Rôle of the Military in Politics." Journal of Modern African Studies 33, no. 1 (March 1995): 129–52. http://dx.doi.org/10.1017/s0022278x00020887.

Full text

Abstract:

Bullets rather than ballots have dominated politics in Uganda since independence, where two governments have been removed by coups, one by a foreign invasion, and another by an armed rebellion. Force has not only dominated the formal political system, but also threatened the economic and social basis on which democratic processes and progressive development depends. For 25 years predatory military rule and civil war have destroyed lives, skills, and assets, undermined institutional competence and accountability, caused widespread per sonal trauma, suppressed autonomous organisations in civil society, and intensified ethnic hostility and conflict. And Uganda is not alone in this – the middle of the twentieth century was dominated by fascism and war, while sectarian or ethnic conflicts in Bosnia, Ulster, Sri Lanka, Somalia, the Sudan, Angola, Liberia, Zaï, Burundi, and Rwanda have inflicted untold damage on people and property.1

APA, Harvard, Vancouver, ISO, and other styles

11

Bagi, Judit. "A nők és a földkérdés a Kelet-afrikai Közösség tagállamaiban." Afrika Tanulmányok / Hungarian Journal of African Studies 13, no. 1-2. (August 20, 2019): 45–56. http://dx.doi.org/10.15170/at.2019.13.1-2.3.

Full text

Abstract:

In this paper I am introducing the change in women’s rights regarding land inheritance and the way it has impacted society in the member states of the East African Community. Besides presenting the results achieved, I am highlighting its inadequacies and the challenges yet to solve as well. Some interviews have aided my research, which I have conducted recently about the East African land inheritance situation with international Africa experts, and with the representative of the Rwandan Gender Monitoring Office in 2016. I am focusing on Rwanda, but also mentioning Kenya, Uganda, Burundi, Tanzania, and South Sudan due to the regional comparison of the relevant laws affecting land ownership and inheritance.

APA, Harvard, Vancouver, ISO, and other styles

12

Nsabimana, A., and M. K. Ocran. "Money Demand Stability and Inflation Prediction in the EAC Countries: Burundi, Kenya, Rwanda, Tanzania, and Uganda." Studies in Economics and Econometrics 39, no. 1 (April 1, 2015): 71–98. http://dx.doi.org/10.1080/10800379.2015.12097277.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Bird, Lyndsay. "Learning about War and Peace in the Great Lakes Region of Africa." Research in Comparative and International Education 2, no. 3 (September 2007): 176–90. http://dx.doi.org/10.2304/rcie.2007.2.3.176.

Full text

Abstract:

Two-thirds of the world's conflicts are in Africa. In particular, the Great Lakes region (Rwanda, Burundi, Democratic Republic of Congo, Uganda and Tanzania) continues to see conflicts that are complex, extreme and seemingly intractable. By exploring the narrative experiences of those most affected by the conflicts in the region – specifically refugees from Burundi, the Democratic Republic of Congo and Rwanda living in camps in north-western Tanzania – this article examines to what extent educative processes (holistic formal and informal learning processes) affect people's experience and engagement in violent conflict. The article draws on the author's research that identified different information circuits by which people learned about conflict. In opposition to the common perception that formal schooling effects change, the findings indicated that the primary mechanisms were oral/aural, such as gossip, traditional storytelling and radio. Individual and collective identities were constructed through this process and the research identified how identities could be shifted through different formal and informal educative processes – often through indoctrination or coercion. This article concludes with an indication of alternative strategies for conflict prevention and peacebuilding (particularly within a refugee or similar context). Efforts at peacebuilding continue to falter in the region and this illustrates the need to construct a more inclusive peacemaking process, taking into account the insights and values of those most affected.

APA, Harvard, Vancouver, ISO, and other styles

14

Adeyemi, Olukemi, Mary Lyons, Tsi Njim, Joseph Okebe, Josephine Birungi, Kevin Nana, Jean Claude Mbanya, et al. "Integration of non-communicable disease and HIV/AIDS management: a review of healthcare policies and plans in East Africa." BMJ Global Health 6, no. 5 (May 2021): e004669. http://dx.doi.org/10.1136/bmjgh-2020-004669.

Full text

Abstract:

BackgroundLow-income and middle-income countries are struggling to manage growing numbers of patients with chronic non-communicable diseases (NCDs), while services for patients with HIV infection are well established. There have been calls for integration of HIV and NCD services to increase efficiency and improve coverage of NCD care, although evidence of effectiveness remains unclear. In this review, we assess the extent to which National HIV and NCD policies in East Africa reflect the calls for HIV-NCD service integration.MethodsBetween April 2018 and December 2020, we searched for policies, strategies and guidelines associated with HIV and NCDs programmes in Burundi, Kenya, Rwanda, South Sudan, Tanzania and Uganda. Documents were searched manually for plans for integration of HIV and NCD services. Data were analysed qualitatively using document analysis.ResultsThirty-one documents were screened, and 13 contained action plans for HIV and NCDs service integration. Integrated delivery of HIV and NCD care is recommended in high level health policies and treatment guidelines in four countries in the East African region; Kenya, Rwanda, Tanzania and Uganda, mostly relating to integrating NCD care into HIV programmes. The increasing burden of NCDs, as well as a move towards person-centred differentiated delivery of services for people living with HIV, is a factor in the recent adoption of integrated HIV and NCD service delivery plans. Both South Sudan and Burundi report a focus on building their healthcare infrastructure and improving coverage and quality of healthcare provision, with no reported plans for HIV and NCD care integration.ConclusionDespite the limited evidence of effectiveness, some East African countries have already taken steps towards HIV and NCD service integration. Close monitoring and evaluation of the integrated HIV and NCD programmes is necessary to provide insight into the associated benefits and risks, and to inform future service developments.

APA, Harvard, Vancouver, ISO, and other styles

15

Shuriye, Abdi O., and Mosud T. Ajala. "The Future of Statehood in East Africa." Journal of Sustainable Development 9, no. 2 (March 30, 2016): 221. http://dx.doi.org/10.5539/jsd.v9n2p221.

Full text

Abstract:

With the deterioration of political and security situations in Somalia and Kenya’s involvement in the war against al-shabaab as well as its political miscalculation and the lack of exit plan, add to this, the fading democratic conditions in Eritrea, accompanied by the political uncertainties in Ethiopia, since the demise Meles Zenawi Asres and the extermination of the opponents, as shown in last general election, as well as the one-man-show political scenario in Uganda and the likely disintegration of Tanzania into Zanzibar and Tanganyika, indicated by the ongoing elections; the political future of East African governments is predictably taking erroneous turns. It seems therefore, God forbids, there is a political catastrophe in the making as far as the state as an authoritative institution is concerned in East Africa. One observes that the social fabric of these states, take Kenya, which used to be a solid in its social and political values, as an example, is drastically changing into a pattern-of-Somali-like tribal syndrome. The expiration of the government institutions, civil societies, law and order in Eritrea, the austere political future of Djibouti, the irrepressible and incurable wounds of Burundi and Rwanda are shrilling pointers of such fear. Not to forget, the strained Muslim-Christian relations, which is now deeply rooted in these communities and states, the thick-headedness of most East Africa’s political leaders and the rapid increase of the youth population as well as the proxy war in business between China and the West on the region. These factors are the core indicators of the future of state and strong government in East Africa. The study covers several nations in East Africa including Burundi, Djibouti, Eritrea, Ethiopia, Kenya, Rwanda, Somalia, Tanzania, and Uganda.

APA, Harvard, Vancouver, ISO, and other styles

16

Njoroge, Anne W., Björn Andersson, Alison K. Lees, Collins Mutai, Gregory A. Forbes, Jonathan E. Yuen, and Roger Pelle. "Genotyping of Phytophthora infestans in Eastern Africa Reveals a Dominating Invasive European Lineage." Phytopathology® 109, no. 4 (April 2019): 670–80. http://dx.doi.org/10.1094/phyto-07-18-0234-r.

Full text

Abstract:

Strains of Phytophthora infestans, the pathogen causing late blight of potato and tomato, are thought to be moved around the world through infected planting material. Since its first appearance in 1941, late blight has caused important losses to potato production in the eastern-Africa region (EAR). In the current study, the genetic structure of the population in Kenya, Uganda, Tanzania, Burundi, and Rwanda was characterized using 12-plex microsatellite markers with the aim of testing the hypothesis that a strain originating from Europe, 2_A1, has recently dominated the population in EAR. Analyses of 1,093 potato and 165 tomato samples collected between 2013 and 2016 revealed the dominance on potato in all countries of the 2_A1 clonal lineage. On tomato, a host-specialized form of the US-1 lineage appears to persist in Rwanda, Uganda, and Tanzania whereas, in Kenya, most samples from tomato (72.5%) were 2_A1. The US-1 lineage in Tanzania had two private alleles at the Pi02 marker, suggesting a possible independent introduction into the region. US-1 had higher genetic variability than 2_A1, consistent with the earlier establishment of the former. Continuous tracking of P. infestans population changes should help identify new virulent and aggressive strains, which would inform strategic disease management options.

APA, Harvard, Vancouver, ISO, and other styles

17

van Soesbergen, Arnout, Andrew P. Arnell, Marieke Sassen, Benjamin Stuch, Rüdiger Schaldach, Jan Göpel, Joost Vervoort, Daniel Mason-D’Croz, Shahnila Islam, and Amanda Palazzo. "Exploring future agricultural development and biodiversity in Uganda, Rwanda and Burundi: a spatially explicit scenario-based assessment." Regional Environmental Change 17, no. 5 (May 21, 2016): 1409–20. http://dx.doi.org/10.1007/s10113-016-0983-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Mengisteab, Kidane. "Africa’s Intrastate Conflicts: Relevance and Limitations of Diplomacy." African Issues 32, no. 1-2 (2003): 25–39. http://dx.doi.org/10.1017/s1548450500006594.

Full text

Abstract:

The African continent remains besieged by many conflicts. Since 1970, Africa has seen more than thirty wars which have resulted in more than half of all war-related deaths worldwide and have produced about 9.5 million refugees (The Observer, June 15, 2003). The conflicts have led to genocide in Rwanda and gross violations of human rights, including gruesome mutilations of large numbers of people, in Sierra Leone, Burundi, the Democratic Republic of the Congo, Angola, the Sudan, and Uganda. In addition to causing the collapse or near collapse of some states, these conflicts have produced severe economic dislocation and disruption in the provision of public services. Moreover, there are growing indications that they have directly or indirectly exacerbated the spread of HIV/AIDS and other infectious diseases.

APA, Harvard, Vancouver, ISO, and other styles

19

Ignatov, P. A., A. A. Ivanov, A. V. Abramov, and J. Kasigwa. "Fragment of a central-type large structure located in southern Uganda and its metallogenic value." Proceedings of higher educational establishments. Geology and Exploration, no. 6 (March 19, 2020): 18–25. http://dx.doi.org/10.32454/0016-7762-2019-6-18-25.

Full text

Abstract:

For the southern regions of Uganda, the metallogenic value of the regional arc belt of dikes of the main and ultrabasic composition was considered. It is shown that it is part of the arc sector of a large central-type structure with a diameter of about 700 km. It had a long development in the Riphean sequence of tectono-magmatic activation. This structure was formed over 1,37 billion years ago and reformed approximately 1 billion years ago and at the end of the Riphean sequence (0,5—0,6 billion years ago).This structure includes all major deposits of Sn, W, Na, Nb, Ni, REE and Au in Burundi, Congo, Rwanda, Tanzania and Uganda. In Uganda, the Sn, W and rare metals fields are controlled by small intrusions of granite with an age of 1 billion years and crossing nodes of radial faults, which are the central-type structures of small order that are included in the central part of the allocated megastructure. Materials in the relationship of ore-grade gold mineralisation with the crossing nodes of large arc, radial and overfault-shift faults are given.

APA, Harvard, Vancouver, ISO, and other styles

20

d'Ardenne, Patricia, Hanspeter Dorner, James Walugembe, Allen Nakibuuka, James Nsereko, Tom Onen, and Cerdic Hall. "Training in the management of post-traumatic stress disorder in Uganda." International Psychiatry 6, no. 3 (July 2009): 67–68. http://dx.doi.org/10.1192/s174936760000062x.

Full text

Abstract:

The aims of this study were to establish the feasibility and effectiveness of training Ugandan mental health workers in the management of post-traumatic stress disorder (PTSD) based on guidelines from the UK National Institute of Health and Clinical Excellence (NICE). The Butabika Link is a mental health partnership between the East London Foundation NHS Trust (ELFT) and Butabika National Psychiatric Referral Hospital, Kampala, Uganda, supported by the Tropical Health Education Trust (THET), and based on the recommendations of the Crisp report (Crisp, 2007). The Link has worked on the principle that the most effective partnership between high-income and low- or middle-income countries is through organisations already delivering healthcare, that is, through the support of existing services. Butabika Hospital is a centre of excellence, serving an entire nation of 30 million people, many of them recovering from 20 years of armed conflict that took place mainly in the north of Uganda. In addition, Uganda has received refugees from conflicts in neighbouring states, including Congo, Rwanda, Kenya, Sudan and Burundi. The Ugandan Ministry of Health's Strategic Plan (2000) has prioritised post-conflict mental disorders and domestic violence, which is reflected in the vision of the Link's work.

APA, Harvard, Vancouver, ISO, and other styles

21

John, Roy. ""The Birds of East Africa: Kenya, Tanzania, Uganda, Rwanda, Burundi" by Terry Stevenson and John Fanshawe [book review]." Canadian Field-Naturalist 120, no. 1 (January 1, 2006): 113. http://dx.doi.org/10.22621/cfn.v120i1.259.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Wurzinger, M., D. Ndumu, R. Baumung, A. Drucker, A. M. Okeyo, D. K. Semambo, N. Byamungu, and J. Sölkner. "Comparison of production systems and selection criteria of Ankole cattle by breeders in Burundi, Rwanda, Tanzania and Uganda." Tropical Animal Health and Production 38, no. 7-8 (October 2006): 571–81. http://dx.doi.org/10.1007/s11250-006-4426-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Karangwa, Patrick, Diane Mostert, Privat Ndayihanzamaso, Thomas Dubois, Björn Niere, Alexandra zum Felde, Alexander Schouten, Guy Blomme, Fenton Beed, and Altus Viljoen. "Genetic Diversity of Fusarium oxysporum f. sp. cubense in East and Central Africa." Plant Disease 102, no. 3 (March 2018): 552–60. http://dx.doi.org/10.1094/pdis-02-17-0282-re.

Full text

Abstract:

Banana Fusarium wilt is a major production constraint globally and a significant threat to the livelihoods of millions of people in East and Central Africa (ECA). A proper understanding of the diversity and population dynamics of the causal agent, Fusarium oxysporum f. sp. cubense (Foc), could be useful for the development of sustainable disease management strategies for the pathogen. The current study investigated the diversity of Foc in ECA using vegetative compatibility group (VCG) analysis, PCR-RFLPs of the ribosomal DNA’s intergenic spacer region, as well as phylogenetic analysis of the elongation factor-1α gene. Six VCGs (0124, 0125, 0128, 01212, 01220, and 01222), which all belong to one lineage (Foc lineage VI), were widely distributed throughout the region. VCGs 0128 and 01220 are reported for the first time in Burundi, the Democratic Republic of Congo (DRC), Rwanda, Tanzania, and Uganda, while VCG 01212 is reported in the DRC and Rwanda. Isolates that did not belong to any of the known VCGs were identified as Foc lineage VI members by phylogenetic analysis and may represent novel VCGs. CAV 2734, a banana pathogen collected in Rwanda, clustered with nonpathogenic F. oxysporum isolates in lineage VIII. Results from this study will contribute significantly toward the implementation of banana Fusarium wilt disease management practices in the region, such as the restricted movement of infected planting material and the selective planting of resistant banana varieties.

APA, Harvard, Vancouver, ISO, and other styles

24

Abila, Derrick Bary, Sulaiman Bugosera Wasukira, Provia Ainembabazi, and Henry Wabinga. "Burden of Risk Factors for Cervical Cancer Among Women Living in East Africa: An Analysis of the Latest Demographic Health Surveys Conducted Between 2014 and 2017." JCO Global Oncology, no. 7 (July 2021): 1116–28. http://dx.doi.org/10.1200/go.21.00123.

Full text

Abstract:

PURPOSE In East Africa, cervical cancer is a leading cause of morbidity and mortality among women diagnosed with cancer. In this study, we describe the burden of risk factors for cervical cancer among women of reproductive age in five East African countries. METHODS For each country, using STATA13 software and sampling weights, we analyzed the latest Demographic and Health Survey data sets conducted between 2014 and 2017 in Burundi, Kenya, Rwanda, Tanzania, and Uganda. We included women age 15-49 years and considered six risk factors (tobacco use, body mass index, age at first sexual intercourse, age at first birth, number of children, and hormonal contraceptive use). RESULTS Of the 93,616 women from the five countries, each country had more than half of the women younger than 30 years and lived in rural areas. Pooled proportion of women with at least one risk factor was 89% (95% CI, 87 to 91). Living in a rural area in Burundi (adjusted incidence rate ration 0.94; 95% CI, 0.9 to 0.99; P = .019) and Rwanda (adjusted incidence rate Ration 0.92; 95% CI, 0.88 to 0.96; P < .001) was associated with a lower number of risk factors compared with living in an urban area. In all the countries, women with complete secondary education were associated with a lower number of risk factors compared with those with no education. CONCLUSION This study reveals a high burden of risk factors for cervical cancer in East Africa, with a high proportion of women exposed to at least one risk factor. There is a need for interventions to reduce the exposure of women to these risk factors.

APA, Harvard, Vancouver, ISO, and other styles

25

Oloo, Michael, Mary Mbithi, and Martin Oleche. "Threshold Effect of Macroeconomic Convergence Criteria on Real GDP Growth Rate within the East African Community." European Journal of Development Studies 2, no. 2 (March 16, 2022): 11–25. http://dx.doi.org/10.24018/ejdevelop.2022.2.2.67.

Full text

Abstract:

This study investigates how the thresholds set by the East African Monetary Committee (EAMC) have impacted the growth of the East African Countries (Kenya, Tanzania, Uganda, Rwanda, and Burundi). The analysis establishes the actual thresholds supported by a panel data model, running from 2005 to 2020, which are drawn from World Development Indicators data from the World Bank website. The actual thresholds obtained are compared to the thresholds adopted by EAMC. This data was analysed using a Dynamic Threshold Panel model; the results show a slight deviation of the actual (optimal) data thresholds from the thresholds adopted as the EAC criteria for the formation of a Monetary Union. Therefore, there is need to reconsider the thresholds criteria to enable them to become feasible for the member states to achieve so as to form the Monetary Union.

APA, Harvard, Vancouver, ISO, and other styles

26

Reyntjens, Filip. "The New Geostrategic Situation in Central Africa." Issue: A Journal of Opinion 26, no. 1 (1998): 10–13. http://dx.doi.org/10.1017/s0047160700502765.

Full text

Abstract:

The war that brought Laurent-Désiré Kabila and the AFDL (Alliance of the Democratic Forces for the Liberation of Congo/Zaire) into power in Kinshasa must be placed in the broader context of three conflicts—that of the Great Lakes, of course, which is the most immediately obvious, but also those of Sudan and Angola. The proximity of these unstable locations and the game of alliances (every actor uses the “my enemy’s enemy is my friend” logic) brought these conflicts together, creating a potential war zone from Asmara to Luanda. Zaire is the connection among these three wars: Mobutu’s government supported Khartoum’s regime against the South Sudanese guerrillas, in particular the SPLA, who are supported in turn by Asmara, Addis Ababa, and Kampala. Zaire’s territory served as a rear base for attacks by the diverse armed movements against Uganda, Rwanda, and Burundi.

APA, Harvard, Vancouver, ISO, and other styles

27

Guibourdenche, M., E. A. Høiby, J. Y. Riou, F. Varaine, C. Joguet, and D. A. Caugant. "Epidemics of serogroup ANeisseria meningitidisof subgroup III in Africa, 1989–94." Epidemiology and Infection 116, no. 2 (April 1996): 115–20. http://dx.doi.org/10.1017/s095026880005233x.

Full text

Abstract:

SUMMARYA total of 125 strains ofNeisseria meningitidisrecovered in the course of outbreaks from patients with systemic disease in 11 African countries between 1989 and 1994 were analysed by serogrouping, serotyping and multilocus enzyme electrophoresis. Of the 125 patient strains 115 (92%) belonged to the clone-complex of serogroup A meningococci, designated subgroup III. Among the remaining strains, 4 were also serogroup A, but belonged to the clonal groups I and IV-1 (2 strains each), whilst 6 strains (4 serogroup C and 2 serogroup W135) represented clones of the ET-37 complex. Our results indicated that the second pandemic caused by clones of subgroup III is still spreading in Africa. Towards the West it has reached Niger, Mali, Guinea and The Gambia, and towards the South, the Central African Republic, Uganda, Rwanda, Burundi, Tanzania and Zambia.

APA, Harvard, Vancouver, ISO, and other styles

28

Tekle, Luel, and Ingyu Chiou. "Financial Intermediation and Economic Growth: Evidence from East Africa." Journal of Finance Issues 10, no. 2 (December 31, 2012): 153–65. http://dx.doi.org/10.58886/jfi.v10i2.2300.

Full text

Abstract:

This paper investigates the relationship between financial development and economic growth in 12 East African countries (Burundi, Comoros, Djibouti, Eritrea, Ethiopia, Kenya, Madagascar, Rwanda, Seychelles, Sudan, Tanzania, and Uganda) for the period 1981-2007. The dynamic panel generalized method of moments (GMM) estimation is employed to test whether financial sector development has a positive impact in economic growth of East Africa. Theresults show that each of 2 financial development measures (domestic credit provided to the private sector and liquid liability) has a positive impact on economic growth and is statistically significant at the 5% level. These results provide additional evidence to the literature. The findings suggest that governments in East Africa can spur long run and sustainable economic growth by developing their financial sectors. Therefore, policies aimed at improving financial development and intermediation should be promoted.

APA, Harvard, Vancouver, ISO, and other styles

29

Warinda, Enock, Dickson M. Nyariki, Stephen Wambua, Reuben M. Muasya, and Munir A. Hanjra. "Sustainable development in East Africa: impact evaluation of regional agricultural development projects in Burundi, Kenya, Rwanda, Tanzania, and Uganda." Natural Resources Forum 44, no. 1 (February 2020): 3–39. http://dx.doi.org/10.1111/1477-8947.12191.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Ezra, Peter, Benard Kitheka, Edwin Sabuhoro, Geoffrey K. Riungu, Agnes Sirima, and Annah Amani. "Responses and Impacts of COVID-19 on East Africa’s Tourism Industry." African Journal of Hospitality, Tourism and Leisure 10, no. 10(6) (December 31, 2021): 1711–27. http://dx.doi.org/10.46222/ajhtl.19770720.188.

Full text

Abstract:

The COVID-19 pandemic has affected all economies and life support systems world-wide. Owing to the pandemic's unpredictable nature, experts and policymakers struggle to find a headway to slow infections and further economic deterioration. The purpose of this study is to assess East African Community (EAC) states’ early responses and the pandemic’s impacts on the tourism industry. Data were collected through a review of secondary data, including academic and media reports. Special attention was paid to respective policy responses during the early stages of the pandemic outbreak. Findings show that Kenya, Uganda, and Rwanda employed more robust measures to curb the spread of COVID-19, whereas Tanzania and Burundi resorted to censorship and protectionism. The EAC should quickly learn from the current crisis and devise strategies to handle future shocks to the tourism-system. The states should prioritize economic diversification, retraining of the workforce, global engagement, and collaborative management.

APA, Harvard, Vancouver, ISO, and other styles

31

Cantrell, Phillip A. "“We Were a Chosen People”: The East African Revival and Its Return To Post-Genocide Rwanda." Church History 83, no. 2 (May 27, 2014): 422–45. http://dx.doi.org/10.1017/s0009640714000080.

Full text

Abstract:

This article, drawing upon primary field research, analyzes the origins and history of the East African Revival of the 1930s and its ongoing relevance and role in post-genocide Rwanda. Starting as a Holiness-inspired, Anglican movement, the Revival persisted among the Tutsi Diaspora during their exile to refugee camps in Uganda following the 1959 Hutu-led Revolution and has returned with them following the coming to power of the Rwandan Patriotic Front in 1994. The Revival, as it presently experiences a reawakening in the post-genocide church, provides the Tutsi returnees with a spiritual mechanism to explain their plight as refugees and a means by which to heal from decades of suffering. Additionally, a narrative has emerged in which they believe themselves to be a “Chosen People” who found redemption and healing in the refugee camps by embracing the revival spirit. Many Anglican returnees further believe they have been “chosen” to bring healing and reconciliation, through the revivalist tradition, to post-genocide Rwanda. While the return of the Revival tradition in the post-genocide Anglican Church offers potential benefits for Rwanda's reconciliation and recovery, the church must also abandon its apolitical inclinations and challenge the ruling regime in the name of truth, democratization, and justice.

APA, Harvard, Vancouver, ISO, and other styles

32

Daniel, Mburamatare, William K. Gboney, Hakizimana Jean de Dieu, Akumuntu Joseph, and Fidele Mutemberezi. "Empirical assessment of drivers of electricity prices in East Africa: Panel data experience of Rwanda, Uganda, Tanzania, Burundi, and Kenya." AIMS Energy 11, no. 1 (2023): 1–30. http://dx.doi.org/10.3934/energy.2023001.

Full text

Abstract:

<abstract> Sustainable electricity supply plays a key role in economic development. Cost recovery, profitability and affordability of electricity through power tariff regulation, have become a subject of conflict between private providers and regulators. Consequently, regulators need to balance the interests of all stakeholders. The objective of this study, is to measure to which extent, Electricity Net Consumption (EC), Electricity Net Generation (EG), electricity transmission and distribution losses (Losses), International Average Crude oil prices (FP), Consumer Price Index (CPI), Industry Value Added (IVA) could influence the Average Electricity Prices (EP) in East Africa, especially in Rwanda, Uganda, Tanzania, Burundi, and Kenya. The data are from World Bank Indicators and cover the period from 2000 to 2019. This study adopts a three-stage approach, consisting of panel unit root tests, panel cointegration tests and estimating the long run cointegration relationship of the variables in a panel context. We applied four different panel unit root tests including ADF-Fisher Chi-square, Levin, Lin and Chu (LLC); PP-Fisher Chi-square, and Im, Pesaran, and Shin, (IPS). The results reveal that the variables are non-stationary at "level", stationary at first-differences and integrated with order one denoted as I(1). The Pedroni, Kao and Johansen Fisher co-integration tests were performed. This study uses full modified ordinary least squares (FMOLS) and dynamic ordinary least squares (DOLS) to estimate the long run relationship among the variables. We find that the increase in EG, FP, and CPI increase the Average Electricity Prices (EP); while the increase in Losses, EC, and IVA decreases EP. Therefore, we recommend the promotion of long-term investment policies in renewable sources and efficient policies to reduce technical and commercial losses. In addition, this study suggests that appropriate policies related to subsidized electricity prices would, however, prevent adverse effects related to inefficient over-consumption of electricity. </abstract>

APA, Harvard, Vancouver, ISO, and other styles

33

Nabudere, Harriet, Gabriel L. Upunda, and Malick Juma. "Policy brief on improving access to artemisinin-based combination therapies for malaria in the East African community." International Journal of Technology Assessment in Health Care 26, no. 2 (April 2010): 255–59. http://dx.doi.org/10.1017/s026646231000019x.

Full text

Abstract:

The World Health Organization (WHO) since June 1998 has advocated for the use of artemisinin-based combination therapies (ACTs) in countries where Plasmodium falciparum malaria is resistant to traditional antimalarial therapies such as chloroquine, sulfadoxine-pyrimethamine, and amodiaquine (19;22). In 2006, WHO released evidence-based guidelines for the treatment of malaria backed by findings from various scientific studies (21). During the period between 2002 and 2006, all the five East African states Tanzania, Kenya, Uganda, Rwanda, and Burundi changed their national antimalarial treatment policies to use ACTs as first-line treatments for uncomplicated falciparum malaria and commenced with deployment of the drugs in the state-managed health facilities (12–15). To scale up the use of ACTs in the East African region to combat malaria and speed up progress toward the sixth Millennium Development Goal, a combination of delivery, financial, and governance arrangements tailored to national or subnational contexts needs to be considered.

APA, Harvard, Vancouver, ISO, and other styles

34

Kraef, Christian, Pamela A. Juma, Joseph Mucumbitsi, Kaushik Ramaiya, Francois Ndikumwenayo, Per Kallestrup, and Gerald Yonga. "Fighting non-communicable diseases in East Africa: assessing progress and identifying the next steps." BMJ Global Health 5, no. 11 (November 2020): e003325. http://dx.doi.org/10.1136/bmjgh-2020-003325.

Full text

Abstract:

Sub-Saharan Africa has seen a rapid increase in non-communicable disease (NCD) burden over the last decades. The East African Community (EAC) comprises Burundi, Rwanda, Kenya, Tanzania, South Sudan and Uganda, with a population of 177 million. In those countries, 40% of deaths in 2015 were attributable to NCDs. We review the status of the NCD response in the countries of the EAC based on the available monitoring tools, the WHO NCD progress monitors in 2017 and 2020 and the East African NCD Alliance benchmark survey in 2017. In the EAC, modest progress in governance, prevention of risk factors, monitoring, surveillance and evaluation of health systems can be observed. Many policies exist on paper, implementation and healthcare are weak and there are large regional and subnational differences. Enhanced efforts by regional and national policy-makers, non-governmental organisations and other stakeholders are needed to ensure future NCD policies and implementation improvements.

APA, Harvard, Vancouver, ISO, and other styles

35

Ayugi, Brian, Zhihong Jiang, Vedaste Iyakaremye, Hamida Ngoma, Hassen Babaousmail, Charles Onyutha, Victor Nnamdi Dike, Richard Mumo, and Victor Ongoma. "East African population exposure to precipitation extremes under 1.5 °C and 2.0 °C warming levels based on CMIP6 models." Environmental Research Letters 17, no. 4 (March 29, 2022): 044051. http://dx.doi.org/10.1088/1748-9326/ac5d9d.

Full text

Abstract:

Abstract Understanding population exposure to precipitation-related extreme events is important for effective climate change adaptation and mitigation measures. We analyze extreme precipitation using indices (EPIs), including consecutive dry days (CDD), annual total precipitation, simple daily intensity, and the number of extremely wet days, under the past and future climatic conditions over East Africa. The exposure of the East African population to these extreme events at 1.5 °C and 2.0 °C global warming levels (GWLs) is analyzed based on Climate Model Intercomparison Project phase 6 models. Exposure is computed from extremely wet and dry days (R95p and CDD, respectively). Under both GWLs, EPIs (except CDD) averaged over East Africa are projected to increase under the Shared Socio-economic Pathways (SSP)2-4.5 and SSP5-8.5 scenarios. The largest increase in wet events will likely occur in eastern and northern Kenya. The results also reveal an intensification of precipitation extremes over Burundi, Rwanda, and some parts of Uganda. However, small changes are expected over most parts of Kenya and Tanzania. Examination of population exposure to EPIs shows that the most prominent and net intense occurrence is over Burundi, Rwanda, and some parts of Uganda. In contrast, less change is noted to occur over vast parts of Kenya and Tanzania. Meanwhile, limiting the warming target to less than 1.5 °C but not more than 2.0 °C has 37% (44.2%) and 92% (4%) less impact on the occurrence of EPIs for R95p (CDD) under SSP2-4.5 (SSP5-8.5) scenarios, respectively. The study establishes that future exposure is predominantly driven by changes in population compared to other factors such as climate or concurrent changes in climate and population (the nonlinear interaction effect). For instance, climate effects are anticipated to contribute ∼10.6% (12.6%) of the total change in population exposure under 1.5 °C (2.0 °C) warming levels, while population and interaction effects are expected to contribute ∼77.4% (71.9%) and 12% (15.5%), respectively, under 1.5 °C (2.0 °C) scenarios. Interestingly, the projected changes in regional exposure due to the interaction effects under SSP2-4.5 are greater than the climate effect, while the reverse pattern is observed under SSP5-8.5. For example, under SSP5-8.5, climate effects for 1.5 °C and 2.0 °C are larger (after population effect) with ∼3.8 × 105 (15.7%) and ∼6.1 × 105 (17.5%) billion person-mm, respectively. The high exposure noted over East Africa calls for a shift in policies to instate suitable adaptation measures to cushion the already vulnerable population.

APA, Harvard, Vancouver, ISO, and other styles

36

Weld, Emma L. "‘Walking in the light’: the Liturgy of Fellowship in the Early Years of the East African Revival." Studies in Church History 35 (1999): 419–31. http://dx.doi.org/10.1017/s0424208400014182.

Full text

Abstract:

During a Christmas convention at Gahini mission station in Rwanda in 1933, a large number of people publicly confessed their sins, resolved to turn from their present beliefs and embraced the Christian Faith. From then on, missionaries of the Ruanda Mission wrote enthusiastically to their supporters in Britain of people flocking into churches in South-West Uganda and Rwanda, of ‘changed lives’, of emotional confessions followed by ‘tremendous joy’, and of the spontaneous forming of fellowship groups and mission teams. Ugandans working at Gahini saw an opportunity for ‘waking’ the sleeping Anglican Church in Buganda and elsewhere which had, they believed, lost its fervour. Following in the tradition of the evangelists of the 1880s and 1890s they travelled vast distances to share their message of repentance and forgiveness with others. This was the beginning of the East African Revival, long prayed for by Ruanda missionaries and the Ugandans who worked alongside them. Max Warren, General Secretary of the Church Missionary Society, writing in 1954 when the Revival was still pulsating through East Africa, perceived the revival phenomenon as ‘a reaffirmation of theology, a resuscitation of worship and a reviving of conscience … for the church’. All three were in evidence from the early years of the East African Revival, but perhaps the most dramatic change was the form taken by the ‘resuscitation of worship’.

APA, Harvard, Vancouver, ISO, and other styles

37

Jolly, Dominique, David Taylor, Robert Marchant, Alan Hamilton, Raymonde Bonnefille, Guillaume Buchet, and Guy Riollet. "Vegetation dynamics in central Africa since 18,000 yr BP: pollen records from the interlacustrine highlands of Burundi, Rwanda and western Uganda." Journal of Biogeography 24, no. 4 (July 1997): 492–512. http://dx.doi.org/10.1111/j.1365-2699.1997.00182.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Joanna Bar. "East African Communities (1967-1978, 1999-) and their Activity for Political Stability of the Region." Politeja 15, no. 56 (June 18, 2019): 247–66. http://dx.doi.org/10.12797/politeja.15.2018.56.14.

Full text

Abstract:

The East African Community (EAC) is a regional intergovernmental organisation founded on 30 November 1999, including such member states as Burundi, Kenya, Rwanda, South Sudan, Tanzania, and Uganda. The EAC was meant as the reactivation and expansion of an earlier organisation founded in 1967 by Kenya, Tanzania and Uganda. Unlike its predecessor (which collapsed in 1978), not only has the contemporary Community been operating stably for almost 20 years, but it has also proved to be successful in improving the economic growth of its member states. Simultaneously, it supports the internal and national security of individual member states and the stability of the entire region. In recent years, the stabilisation capabilities of the Community have been tested through the accession of South Sudan, a country driven by a domestic conflict. Republic of South Sudan contributes not only rich crude oil deposits and water resources, but also a heavy burden of political issues in the form of both domestic conflicts and unresolved international problems such as a border conflict with the Republic of (north) Sudan. Successful economic cooperation may, however, reduce poverty and boost the development of South Sudan, both with regard to its economy and within the social and political aspects. This, in turn, may translate into good governance and the formation of a civil society.

APA, Harvard, Vancouver, ISO, and other styles

39

Bagi, Judit. "Female Political Representation in EAC States." Afrika Tanulmányok / Hungarian Journal of African Studies 12, no. 4. (May 22, 2019): 54–65. http://dx.doi.org/10.15170/at.2018.12.4.4.

Full text

Abstract:

Almost all East African Community (EAC) member states have more than 30 percent female MPs in their national parliaments: Rwanda (61.3%), Tanzania (37.2%), Burundi (36.4%), Uganda (34.3%), Kenya (21.8%), and South Sudan (28.5%). What could be the reason for the fact that all EAC countries, except Kenya, are above the so-called ‘critical mass’ in the field of female political representation? In the last decades, both conflict and political transition have emerged in EAC countries. During the post-conflict period, gender norms and values (with a focus on gender quota regulations) have been implemented into national policies. The newly established liberal constitutions and gender policy creation have affected the status of East African women positively, although there is a big difference between the states concerning the effectiveness of gender policy-making. My paper (with the help of my field trips in Arusha and Kigali in 2015 and 2016) intends to contribute to a better understanding of EAC countries in transition, with an emphasis on the changing role of women in society, particularly in the important fields of gender politics and political representation.

APA, Harvard, Vancouver, ISO, and other styles

40

Dushime, Joseph, Immaculate Nakalembe, Yar Makuei, Albert Kwitonda, Samuel Hakizimana, and Stephen Muathe. "Microfinance Institutions as a Vehicle for Poverty Eradication in Developing Countries: Evidence from the East African Community Member States." European Scientific Journal, ESJ 18, no. 22 (July 31, 2022): 207. http://dx.doi.org/10.19044/esj.2022.v18n22p207.

Full text

Abstract:

This paper focuses on examining the link that exists between microfinance institutions (MFIs) and poverty eradication efforts in developing countries, specifically focusing on the East African member states of Burundi, Democratic Republic of Congo (DRC), Kenya, Rwanda, South Sudan, Tanzania, and Uganda. The study was driven by the varying interpretations, debates, and opposing opinions in literature on the effects of MFIs on poverty eradication in developing economies, particularly in the East African Community (EAC). The study used a depth literature search using secondary data on the role of MFIs in poverty eradication in the EAC context. The results pointed out that despite the challenges such as high transaction rates, limited funding and others, microfinance credit has played a significant role in poverty eradication among poor/low-income families in the EAC Member States. Therefore, the study recommends that governments of the EAC Member States should increase government support, and conducive working environments should be provided to ensure microfinance institutions reach as many less privileged individuals as possible so as to raise their economic status.

APA, Harvard, Vancouver, ISO, and other styles

41

Harb and Abd Alhameed. "ENGINEERING ARTIFICIAL INTELLIGENCE FOR STRATEGIC MANAGEMENT OF EQUITABLE RESOURCE DISTRIBUTION IN NILE BASIN." International Journal of Research -GRANTHAALAYAH 4, no. 8 (August 31, 2016): 32–45. http://dx.doi.org/10.29121/granthaalayah.v4.i8.2016.2558.

Full text

Abstract:

Uganda, Tanzania, the Sudan, South Sudan, Rwanda, Kenya, Ethiopia, Egypt, DR Congo, and Burundi all make entitlement claims to the ecological system of the Nile Basin. This region is rich in resources, yet prone to interstate conflict, drought, and other vulnerabilities. Water resource conservation systems, alternative purification systems, and rainfall stimulation systems programmed by artificial intelligence can facilitate the establishment of transboundary partnerships that reduce international conflict and serve as a foundation for economic growth and job creation in the Nile Basin region. Water conservation systems using artificial intelligence have been found to increase rainfall capture by an average of 1.5 billion gallons of stormwater per year or enough to provide clean drinking water for 36,000 people per year (O’Neill et. al, 2012). The ecological framework of Nile Basin’s various regions will determine the appropriate artificial intelligence systems that can be implemented to promote the equitable distribution the Nile Basin’s resources. These systems will lessen political conflict that can negatively impact the agricultural practices of Nile Basin farmers and inhabitants who depend on the Nile Basin’s resources for their livelihoods.

APA, Harvard, Vancouver, ISO, and other styles

42

Lavis, John N., and Ulysses Panisset. "EVIPNet Africa's first series of policy briefs to support evidence-informed policymaking." International Journal of Technology Assessment in Health Care 26, no. 2 (April 2010): 229–32. http://dx.doi.org/10.1017/s0266462310000206.

Full text

Abstract:

EVIPNet (Evidence-Informed Policy Network) Africa—a network of World Health Organization (WHO)-sponsored knowledge-translation (KT) platforms in seven sub-Saharan African countries—was launched at a meeting in Brazzaville, Congo, in March 2006 (1;2). EVIPNet Africa can trace its origins to resolutions from both the Ministerial Summit on Health Research (November 2004) and the World Health Assembly (May 2005) (10;11), the spirit of which was re-affirmed at the Global Ministerial Forum on Research for Health (November 2008) (13). The World Health Assembly called for “establishing or strengthening mechanisms to transfer knowledge in support of evidence-based public health and health care delivery systems and evidence-based related policies” (10). EVIPNet Africa can trace its inspiration to a more local development: the preparatory work that led to the establishment of the East African Community–sponsored Regional East African Community Health (REACH) Policy initiative, a KT platform involving Kenya, Tanzania, and Uganda (and more recently Burundi and Rwanda as well). REACH Policy is now part of the EVIPNet Africa family.

APA, Harvard, Vancouver, ISO, and other styles

43

Rakotomanana, Hasina, Joel J. Komakech, Christine N. Walters, and Barbara J. Stoecker. "The WHO and UNICEF Joint Monitoring Programme (JMP) Indicators for Water Supply, Sanitation and Hygiene and Their Association with Linear Growth in Children 6 to 23 Months in East Africa." International Journal of Environmental Research and Public Health 17, no. 17 (August 28, 2020): 6262. http://dx.doi.org/10.3390/ijerph17176262.

Full text

Abstract:

The slow decrease in child stunting rates in East Africa warrants further research to identify the influence of contributing factors such as water, sanitation, and hygiene (WASH). This study investigated the association between child length and WASH conditions using the recently revised WHO and UNICEF (United Nations Children’s Fund) Joint Monitoring Programme (JMP) indicators. Data from households with infants and young children aged 6–23 months from the Demographic and Health Surveys in Burundi, Ethiopia, Kenya, Malawi, Rwanda, Tanzania, Uganda, and Zambia were used. Associations for each country between WASH conditions and length-for-age z-scores (LAZ) were analyzed using linear regression. Stunting rates were high (>20%) reaching 45% in Burundi. At the time of the most recent Demographic and Health Survey (DHS), more than half of the households in most countries did not have basic or safely managed WASH indicators. Models predicted significantly higher LAZ for children living in households with safely managed drinking water compared to those living in households drinking from surface water in Kenya (β = 0.13, p < 0.01) and Tanzania (β = 0.08, p < 0.05) after adjustment with child, maternal, and household covariates. Children living in households with improved sanitation facilities not shared with other households were also taller than children living in households practicing open defecation in Ethiopia (β = 0.07, p < 0.01) and Tanzania (β = 0.08, p < 0.01) in the adjusted models. All countries need improved WASH conditions to reduce pathogen and helminth contamination. Targeting adherence to the highest JMP indicators would support efforts to reduce child stunting in East Africa.

APA, Harvard, Vancouver, ISO, and other styles

44

Abdul Basit, Tehmina Fiaz Qazi, and Abdul Aziz Khan. "A Country-Level Analysis of Worldwide Official Financing by International Financial Institutions." sjesr 4, no. 2 (May 1, 2021): 139–46. http://dx.doi.org/10.36902/sjesr-vol4-iss2-2021(139-146).

Full text

Abstract:

This study aims to evaluate worldwide official financial flows by international financial institutions to selected 123 countries of the world. The design of the study is composed of a review of literature elicited from research databases, extraction of secondary data of World Development Indicators (WDI) 2020, and mathematical analysis. In real time, cross-sectional country-level data, a classical process of Grey Relational Analysis (GRA) has been applied. Results of the study show that Argentina, Ethiopia, Bangladesh, India, Egypt, Arab Rep., Kenya, Costa Rica, Vietnam, Chad, Tanzania, Colombia, Uzbekistan, Nepal, Indonesia, Nigeria, Rwanda, Cameroon, and Uganda have exceptionally high grey relational grade meaning thereby, having an effective system of obtaining official international financial flows. Zimbabwe, Russian Federation, Botswana, Afghanistan, Bulgaria, South Africa, Burundi, Belarus, Kazakhstan, Armenia, Pakistan, Peru, Romania, and Ukraine have poor grey relational grade meaning thereby, having a relatively weak system of obtaining official financial flows. It is a unique study that provides extensive information on the official financial flows of more than a hundred countries of the world and provides the basis for the informed opinion of policymakers, political governments, economic policymakers, researchers, and academia. It also provides valuable information useful for international financial institutions.

APA, Harvard, Vancouver, ISO, and other styles

45

Nasubo, Fred, Dorothy Nyakwaka, and Kali Moeketsi. "East African Community’s Response to Coronavirus: Old Habits Die Hard." East African Journal of Arts and Social Sciences 5, no. 2 (September 7, 2022): 17–29. http://dx.doi.org/10.37284/eajass.5.2.620.

Full text

Abstract:

The coronavirus response divulged how EAC partner states prioritize national interests over regional ones and exposed widening cracks within the community. After detecting the virus in the region, individual countries deployed varied approaches against the pandemic despite the indication of a joint response from the EAC secretariat. On the outset, the secretariat called for harmonized surveillance and reporting of the pandemic at all border points, control and prevention materials distribution, and joint training of the EAC mobile laboratory experts. Contrarily, each country acted unilaterally by imposing restrictions and border checks. Some concealed Covid-19 cases and issued non-harmonized Covid-19 certificates at regional border points. While the absence of regional solidarity might have been motivated by the need to contain the spread of the virus, lack of collective action was greatly influenced by simmering differences among EAC member countries. Before Covid-19, tensions revolved around Burundi, Rwanda, Uganda, Tanzania, and Kenya. No wonder the region’s responses to the pandemic laid bare the simmering disagreement within the community. This paper employs discourse analysis to examine how Covid-19 revealed cracks in the community reminiscent of the one leading to the collapse of EAC I.

APA, Harvard, Vancouver, ISO, and other styles

46

Mamboleo, Martin. "Evaluation and use of existing economic valuation methodologies in the management of Lake Victoria’s water resources." RUDN Journal of Ecology and Life Safety 29, no. 4 (December 30, 2021): 341–54. http://dx.doi.org/10.22363/2313-2310-2021-29-4-341-354.

Full text

Abstract:

Lake Victoria is the second-largest freshwater lake in the world, with an eco-system critical to 25-30 million inhabitants of Kenya, Uganda, Tanzania, Rwanda, and Burundi who live in the lake basin. The lake provides several ecosystem services from inland waterway transport, fisheries to hydropower and supports many different industries such as tourism, trade, and wildlife. However, Lake Victorias ecosystem management has been highly extractive; hence its water resources are either inefficiently or overused. This is because the value of this resource is either unknown or underestimated. The main purpose of the research was to contribute to Lake Victorias conservation efforts by providing the best techniques that can be used to assess the value of this resource and develop appropriate policies for the sustainable management of the lake. The study reviewed relevant literature on the economic assessment methods of environmental resources in the context of water management. Search engines such as Google Scholar, Web of Science, and ScienceDirect were used for it. The study suggests methods for economic valuation of Lake Victoria water ecosystem for each service. The proposed techniques can be used for assessing the value and benefits of conservation and restoration of Lake Victoria ecosystem.

APA, Harvard, Vancouver, ISO, and other styles

47

"The Recurring Great Lakes Crisis: Identity, Violence and Power - Jean-Pierre Chretién and Richard Banégas (eds)." International Dialogue, October 2011. http://dx.doi.org/10.32873/uno.dc.id.1.1.1005.

Full text

Abstract:

The Recurring Great Lakes Crisis is an edited volume comprising individual case studies that examine aspects of historical and on-going violence in Rwanda, Burundi, Uganda, and Congo-Kinshasa. The purpose of the volume is to “lead to a better understanding of the changes in the perceptions of violence which constitute one of the most serious obstacles to lasting peace” (1). The case studies encompass a diverse array of aspects of each of the conflicts, from the role of the Catholic Church in Rwanda since 1957, to the political and social problems created by the label “disaster victims” in Burundi after the 1993 crisis, to the “ethnic” conflict between the Wahendu and Walema in the Ituri district of Congo between 1999 and 2003. Most case studies resulted from field research carried out by the contributors in the Great Lakes region between 2000 and 2002.

APA, Harvard, Vancouver, ISO, and other styles

48

"Cylas brunneus. [Distribution map]." Distribution Maps of Plant Pests, June (August 1, 1993). http://dx.doi.org/10.1079/dmpp/20056600537.

Full text

Abstract:

Abstract A new distribution map is provided for Cylas brunneus (Fabricius) Coleoptera: Curculionidae. Attacks sweet-potato. Information is given on the geographical distribution in AFRICA, Burundi, Ghana, Ivory Coast, Kenya, Nigeria, Rwanda, Sierra Leone, Togo, Uganda.

APA, Harvard, Vancouver, ISO, and other styles

49

"Ugandan cassava brown streak virus. [Distribution map]." Distribution Maps of Plant Diseases, No.October (August 1, 2013). http://dx.doi.org/10.1079/dmpd/20133421487.

Full text

Abstract:

Abstract A new distribution map is provided for Ugandan cassava brown streak virus. Potyviridae: Ipomovirus. Hosts: cassava (Manihot esculenta). Information is given on the geographical distribution in Africa (Burundi, Congo Democratic Republic, Kenya, Malawi, Mozambique, Rwanda, Tanzania, Uganda).

APA, Harvard, Vancouver, ISO, and other styles

50

"Cylas brunneus. [Distribution map]." Distribution Maps of Plant Pests, no. 1st revision) (August 1, 2005). http://dx.doi.org/10.1079/dmpp20066600537.

Full text

Abstract:

Abstract A new distribution map is provided for Cylas brunneus (Olivier) Coleoptera: Brentidae Hosts: Sweet potato (Ipomoea batatas). Information is given on the geographical distribution in AFRICA, Burundi, Cote d'Ivoire, Ghana, Kenya, Nigeria, Rwanda, Sierra Leone, Togo, Uganda.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Church of Uganda, Rwanda, and Burundi'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles