To see the other types of publications on this topic, follow the link: Cisplatin Biochemistry.
Journal articles on the topic 'Cisplatin Biochemistry'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Cisplatin Biochemistry.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Elferink, F., W. J. van der Vijgh, I. Klein, and H. M. Pinedo. "Interaction of cisplatin and carboplatin with sodium thiosulfate: reaction rates and protein binding." Clinical Chemistry 32, no. 4 (April 1, 1986): 641–45. http://dx.doi.org/10.1093/clinchem/32.4.641.
Full textAbstract:
Abstract Toxicity of cisplatin can be decreased by concomitant administration of sodium thiosulfate, which perhaps chemically inactivates this platinum compound. We studied the disappearance of cisplatin and carboplatin in aqueous solutions of thiosulfate at 37 degrees C by means of liquid chromatography. At initial concentrations that were similar to therapeutic concentrations in plasma, both drugs disappeared, with half-lives of 66 and 537 min for cisplatin and carboplatin, respectively. At higher thiosulfate concentrations, as found in urine, the respective half-lives were 3.7 and 33.8 min. These values suggest that direct chemical interaction in the plasma compartment has limited therapeutic consequences, whereas the anti-toxic effect of thiosulfate might be explained by the rapid inactivation of cisplatin in the kidneys. Reaction products of cisplatin and thiosulfate bound instantaneously and mainly reversibly to plasma proteins. Protein-bound cisplatin was not released by added thiosulfate--which may explain why thiosulfate, to be effective, must be given in advance of and during cisplatin administration.
2
Wang, Wenyu, Jihye Im, Soochi Kim, Suin Jang, Youngjin Han, Kyung-Min Yang, Seong-Jin Kim, Danny N. Dhanasekaran, and Yong Sang Song. "ROS-Induced SIRT2 Upregulation Contributes to Cisplatin Sensitivity in Ovarian Cancer." Antioxidants 9, no. 11 (November 16, 2020): 1137. http://dx.doi.org/10.3390/antiox9111137.
Full textAbstract:
Cisplatin resistance remains a significant obstacle for improving the clinical outcome of ovarian cancer patients. Recent studies have demonstrated that cisplatin is an important inducer of intracellullar reactive oxygen species (ROS), triggering cancer cell death. Sirtuin 2 (SIRT2), a member of class III NAD+ dependent histone deacetylases (HDACs), has been reported to be involved in regulating cancer hallmarks including drug response. In this study, we aimed to identify the role of SIRT2 in oxidative stress and cisplatin response in cancer. Two ovarian cancer cell lines featuring different sensitivities to cisplatin were used in this study. We found different expression patterns of SIRT2 in cisplatin-sensitive (A2780/S) and cisplatin-resistant (A2780/CP) cancer cells with cisplatin treatment, where SIRT2 expression was augmented only in A2780/S cells. Furthermore, cisplatin-induced ROS generation was responsible for the upregulation of SIRT2 in A2780/S cells, whereas overexpression of SIRT2 significantly enhanced the sensitivity of cisplatin-resistant counterpart cells to cisplatin. Our study proposes that targeting SIRT2 may provide new strategies to potentiate platinum-based chemotherapy in ovarian cancer patients.
3
Fujimoto, T., H. Maeda, K. Kubo, Y. Sugita, T. Nakashima, E. Sato, Y. Tanaka, M. Madachi, M. Aiba, and Y. Kameyama. "Enhanced Anti-tumour Effect of Cisplatin with Low-voltage Electrochemotherapy in Hamster Oral Fibrosarcoma." Journal of International Medical Research 33, no. 5 (September 2005): 507–12. http://dx.doi.org/10.1177/147323000503300505.
Full textAbstract:
The aim of this study was to determine the effects of low-voltage electrochemotherapy with intraperitoneal cisplatin on hamster oral fibrosarcoma. Oral fibrosarcoma was transplanted sub-mucosally into the cheek pouch mucosa of 100 hamsters. After transplantation, the hamsters were randomly divided into four equal groups. These groups received no treatment (D-E-); 2 mg/kg body weight cisplatin treatment without electroporation (D+E-); electroporation without cisplatin treatment (D-E+);or 2 mg/kg body weight cisplatin treatment followed by electroporation (D+E+). Electrical pulse treatment together with cisplatin injection markedly reduced the size of the tumour, whereas cisplatin injection or electrical pulse treatment alone did not. These results clearly indicate that the anti-tumour effect of cisplatin on hamster oral fibrosarcoma was considerably potentiated or enhanced by the administration of local electrical pulses at low voltages.
4
Murray, Vincent. "Nucleosomes and Cisplatin." Chemistry & Biology 17, no. 12 (December 2010): 1271–72. http://dx.doi.org/10.1016/j.chembiol.2010.12.002.
Full text
5
Yi, Junyeong, Tae Su Kim, Jhang Ho Pak, and Jong Woo Chung. "Protective Effects of Glucose-Related Protein 78 and 94 on Cisplatin-Mediated Ototoxicity." Antioxidants 9, no. 8 (August 2, 2020): 686. http://dx.doi.org/10.3390/antiox9080686.
Full textAbstract:
Cisplatin is a widely used chemotherapeutic drug for treating various solid tumors. Ototoxicity is a major dose-limiting side effect of cisplatin, which causes progressive and irreversible sensorineural hearing loss. Here, we examined the protective effects of glucose-related protein (GRP) 78 and 94, also identified as endoplasmic reticulum (ER) chaperone proteins, on cisplatin-induced ototoxicity. Treating murine auditory cells (HEI-OC1) with 25 μM cisplatin for 24 h increased cell death resulting from excessive intracellular reactive oxygen species (ROS) accumulation and caspase-involved apoptotic signaling pathway activation with subsequent DNA fragmentation. GRP78 and GRP94 expression was increased in cells treated with 3 nM thapsigargin or 0.1 μg/mL tunicamycin for 24 h, referred to as mild ER stress condition. This condition, prior to cisplatin exposure, attenuated cisplatin-induced ototoxicity. The involvement of GRP78 and GRP94 induction was demonstrated by the knockdown of GRP78 or GRP94 expression using small interfering RNAs, which abolished the protective effect of mild ER stress condition on cisplatin-induced cytotoxicity. These results indicated that GRP78 and GRP94 induction plays a protective role in remediating cisplatin-ototoxicity.
6
Mapuskar, Kranti A., Emily J. Steinbach, Amira Zaher, Dennis P. Riley, Robert A. Beardsley, Jeffery L. Keene, Jon T. Holmlund, et al. "Mitochondrial Superoxide Dismutase in Cisplatin-Induced Kidney Injury." Antioxidants 10, no. 9 (August 24, 2021): 1329. http://dx.doi.org/10.3390/antiox10091329.
Full textAbstract:
Cisplatin is a chemotherapy agent commonly used to treat a wide variety of cancers. Despite the potential for both severe acute and chronic side effects, it remains a preferred therapeutic option for many malignancies due to its potent anti-tumor activity. Common cisplatin-associated side-effects include acute kidney injury (AKI) and chronic kidney disease (CKD). These renal injuries may cause delays and potentially cessation of cisplatin therapy and have long-term effects on renal function reserve. Thus, developing mechanism-based interventional strategies that minimize cisplatin-associated kidney injury without reducing efficacy would be of great benefit. In addition to its action of cross-linking DNA, cisplatin has been shown to affect mitochondrial metabolism, resulting in mitochondrially derived reactive oxygen species (ROS). Increased ROS formation in renal proximal convoluted tubule cells is associated with cisplatin-induced AKI and CKD. We review the mechanisms by which cisplatin may induce AKI and CKD and discuss the potential of mitochondrial superoxide dismutase mimetics to prevent platinum-associated nephrotoxicity.
7
Xing, Jing-Jing, Jin-Gang Hou, Ying Liu, Ruo-Bing Zhang, Shuang Jiang, Shen Ren, Ying-Ping Wang, et al. "Supplementation of Saponins from Leaves of Panax quinquefolius Mitigates Cisplatin-Evoked Cardiotoxicity via Inhibiting Oxidative Stress-Associated Inflammation and Apoptosis in Mice." Antioxidants 8, no. 9 (September 1, 2019): 347. http://dx.doi.org/10.3390/antiox8090347.
Full textAbstract:
Background: Although kidney injury caused by cisplatin has attracted much attention, cisplatin-induced cardiotoxicity is elusive. Our previous studies have confirmed that saponins (ginsenosides) from Panax quinquefolius can effectively reduce acute renal injuries. Our current study aimed to identify the potential effects of saponins from leaves of P. quinquefolius (PQS) on cisplatin-evoked cardiotoxicity. Methods: Mice were intragastrically with PQS at the doses of 125 and 250 mg/kg daily for 15 days. The mice in cisplatin group and PQS + cisplatin groups received four times intraperitoneal injections of cisplatin (3 mg/kg) two days at a time from the 7th day, respectively. All mice were killed at 48 h following final cisplatin injection. Body weights, blood and organic samples were collected immediately. Results: Our results showed that cisplatin-challenged mice experienced a remarkable cardiac damage with obvious histopathological changes and elevation of lactate dehydrogenase (LDH), creatine kinase (CK), creatine kinase isoenzyme MB (CK-MB) and cardiac troponin T (cTnT) concentrations and viabilities in serum. Cisplatin also impaired antioxidative defense system in heart tissues manifested by a remarkable reduction in reduced glutathione (GSH) content and superoxide dismutase (SOD) activity, demonstrating the overproduction of reactive oxygen species (ROS) and oxidative stress. Interestingly, PQS (125 and 250 mg/kg) can attenuate cisplatin-evoked changes in the above-mentioned parameters. Additionally, PQS administration significantly alleviated the oxidation resulted from inflammatory responses and apoptosis in cardiac tissues via inhibition of overexpressions of TNF-α, IL-1β, Bax, and Bad as well as the caspase family members like caspase-3, and 8, respectively. Conclusion: Findings from our present research clearly indicated that PQS exerted significant effects on cisplatin-induced cardiotoxicity in part by inhibition of the NF-κB activity and regulation of PI3K/Akt/apoptosis mediated signaling pathways.
8
Kohda, Yuka, Yoshiko Kawai, Noriaki Iwamoto, Yoshiko Matsunaga, Hiromi Aiga, Akira Awaya, and Munekazu Gemba. "Serum thymic factor, FTS, attenuates cisplatin nephrotoxicity by suppressing cisplatin-induced ERK activation." Biochemical Pharmacology 70, no. 9 (November 2005): 1408–16. http://dx.doi.org/10.1016/j.bcp.2005.08.002.
Full text
9
Rodríguez-Ulloa, Arielis, Yassel Ramos, Aniel Sánchez-Puente, Yasser Perera, Alexis Musacchio-Lasa, Jorge Fernández-de-Cossio, Gabriel Padrón, Luis J. G. López, Vladimir Besada, and Silvio E. Perea. "The Combination of the CIGB-300 Anticancer Peptide and Cisplatin Modulates Proteins Related to Cell Survival, DNA Repair and Metastasis in a Lung Cancer Cell Line Model." Current Proteomics 16, no. 4 (April 25, 2019): 338–49. http://dx.doi.org/10.2174/1570164616666190126104325.
Full textAbstract:
Background: CIGB-300 is a pro-apoptotic peptide that abrogates CK2-mediated phosphorylation, and can elicit synergistic interaction in vitro and in vivo when combined with certain anticancer drugs. Objective: The combination of CIGB-300 with cisplatin is studied through data mining and expressionbased proteomics to reveal the molecular basis of this interaction. Cisplatin resistance-associated proteins, which have also been reported as CK2 substrates, were first identified by bioinformatic analyses. Methods: Data from these analyses suggested that the cisplatin resistance phenotype could be directly improved by inhibiting CK2 phosphorylation on specific substrates. Furthermore, 157 proteins were differentially modulated on the NCI-H125 lung cancer cell line in response to CIGB-300, cisplatin or both drugs as determined by LC-MS/MS. Results: The expression of 28 cisplatin resistance-associated proteins was changed when cisplatin was combined with CIGB-300. Overall, the proteins identified are also related to cell survival, cell proliferation and metastasis. Furthermore, the CIGB-300 regulated proteome revealed proteins that were initially involved in the mechanism of action of CIGB-300 and cisplatin as single agents. Conclusion: This is the first report describing the protein array modulated by combining CIGB-300 and cisplatin that will support the rationale for future clinical settings based on a multi-target cancer therapy.
10
Bushau-Sprinkle, Adrienne M., Michelle T. Barati, Yuxuan Zheng, Walter H. Watson, Kenneth B. Gagnon, Syed Jalal Khundmiri, Kathleen T. Kitterman, et al. "Na/H Exchange Regulatory Factor 1 Deficient Mice Show Evidence of Oxidative Stress and Altered Cisplatin Pharmacokinetics." Antioxidants 10, no. 7 (June 28, 2021): 1036. http://dx.doi.org/10.3390/antiox10071036.
Full textAbstract:
(1) Background: One third of patients who receive cisplatin develop an acute kidney injury. We previously demonstrated the Na/H Exchange Regulatory Factor 1 (NHERF1) loss resulted in increased kidney enzyme activity of the pentose phosphate pathway and was associated with more severe cisplatin nephrotoxicity. We hypothesized that changes in proximal tubule biochemical pathways associated with NHERF1 loss alters renal metabolism of cisplatin or response to cisplatin, resulting in exacerbated nephrotoxicity. (2) Methods: 2–4 month-old male wild-type and NHERF1 knock out littermate mice were treated with either vehicle or cisplatin (20 mg/kg dose IP), with samples taken at either 4, 24, or 72 h. Kidney injury was determined by urinary neutrophil gelatinase-associated lipocalin and histology. Glutathione metabolites were measured by HPLC and genes involved in glutathione synthesis were measured by qPCR. Kidney handling of cisplatin was assessed by a kidney cortex measurement of γ-glutamyl transferase activity, Western blot for γ-glutamyl transferase and cysteine S-conjugate beta lyase, and ICP-MS for platinum content. (3) Results: At 24 h knock out kidneys show evidence of greater tubular injury after cisplatin and exhibit a decreased reduced/oxidized glutathione ratio under baseline conditions in comparison to wild-type. KO kidneys fail to show an increase in γ-glutamyl transferase activity and experience a more rapid decline in tissue platinum when compared to wild-type. (4) Conclusions: Knock out kidneys show evidence of greater oxidative stress than wild-type accompanied by a greater degree of early injury in response to cisplatin. NHERF1 loss has no effect on the initial accumulation of cisplatin in the kidney cortex but is associated with an altered redox status which may alter the activity of enzymes involved in cisplatin metabolism.
11
Dabrowski, Tomasz, and Bartlomiej Kwiatkowski. "Sensitivity of Vi phages III to gamma-radiation in the presence of cisplatin." Acta Biochimica Polonica 52, no. 2 (May 31, 2005): 545–50. http://dx.doi.org/10.18388/abp.2005_3471.
Full textAbstract:
In this study we determined Vi bacteriophage III sensitivity to native cisplatin, gamma radiation ((60)Co) or to irradiated cisplatin, and checked the possibility of enhanced Vi bacteriophage III inactivation under combined exposure to cisplatin and gamma radiation. We used highly purified phage suspensions in 0.9% NaCl solution or phosphate-buffered saline. Phage suspensions were titrated using a double agar layer method. Our study implies that survival of Vi bacteriophage III shows an exponential inverse correlation with cisplatin concentration in the incubation medium and the time of phage incubation in the presence of cisplatin. The use of irradiated cisplatin reduces phage survival in comparison with suspensions containing non-irradiated cisplatin. Irradiation of phage suspension with cisplatin causes a significant increase of phage inactivation in comparison with either treatment alone. Our results suggest that presence of cisplatin in irradiated medium enhances the radiobiological effect on Vi bacteriophages III.
12
Song, Lin, Zhilei Cui, and Xuejun Guo. "Comprehensive analysis of circular RNA expression profiles in cisplatin-resistant non-small cell lung cancer cell lines." Acta Biochimica et Biophysica Sinica 52, no. 9 (July 27, 2020): 944–53. http://dx.doi.org/10.1093/abbs/gmaa085.
Full textAbstract:
Abstract Platinum-based drugs such as cisplatin are widely used in combination chemotherapy for non-small cell lung cancer (NSCLC) owing to their high clinical response rate; however, acquired resistance to cisplatin is eventually inevitable. Circular RNAs (circRNAs) are involved in the development of diverse types of cancers, but their connection to cisplatin-resistance in NSCLC has not been studied. In the present study, two cisplatin-resistant NSCLC cell lines (A549/DDP and PC9/DDP) were established by gradually increasing concentrations of cisplatin in the media. The resulting cell lines possessed high resistance to cisplatin and strong proliferation, migration, and colony formation abilities compared to the parental cells. Microarray analysis identified 19,161 circRNAs that were dysregulated in cisplatin-resistant cell lines (fold change abs>2), including 11,915 up-regulated and 7246 down-regulated circRNAs. The expression of the top five up-regulated and down-regulated circRNAs was validated using real-time quantitative polymerase chain reaction. A circRNA–micro RNA (miRNA) network of the top 20 dysregulated circRNAs and their predicted miRNAs was constructed using Cytoscape. Gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses revealed that the host genes of the identified circRNAs were involved in the regulation of MAP kinase kinase kinase kinase activity, 6-phosphofructo-2-kinase activity, focal adhesion, ErbB signaling, and ECM-receptor interactions, which may contribute to cisplatin resistance in NSCLC. In summary, this is the first report on circRNA profiling in cisplatin-resistant NSCLC cells and it provides new potential targets for the reversal of cisplatin resistance in NSCLC.
13
Nanji, A. A., D. J. Stewart, and N. Z. Mikhael. "11 cisplatin induced hyperuricemia." Clinical Biochemistry 18, no. 3 (June 1985): 202. http://dx.doi.org/10.1016/s0009-9120(85)80121-1.
Full text
14
Sun, Tianyu, Jingge Zhang, Bo Deng, Xiaoqing Fan, Tan Long, Hua Jin, Shaolin Tao, Poming Kang, and Qunyou Tan. "FOXO1 and FOXO3a sensitize non-small-cell lung cancer cells to cisplatin-induced apoptosis independent of Bim." Acta Biochimica et Biophysica Sinica 52, no. 12 (November 10, 2020): 1348–59. http://dx.doi.org/10.1093/abbs/gmaa129.
Full textAbstract:
Abstract Low sensitivity to chemotherapy has been a major challenge in the treatment of non-small-cell lung cancer (NSCLC). It is of great clinical significance to discover its mechanisms to improve cell sensitivity to chemotherapeutic drugs. The forkhead box subfamily O (FOXO) transcriptional factors are downstream factors of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway and are reported to play pro-apoptotic roles in a variety of cells including NSCLC cells. But their roles and mechanisms in mediating cell response to chemotherapy remain to be discovered. We proposed that FOXO1 and FOXO3a may increase the sensitivity of NSCLC cells to cisplatin. Moreover, we presumed that LY294002, an inhibitor of the PI3K/AKT pathway, may enhance the cytotoxic effects of cisplatin through upregulating FOXO1 and FOXO3a. In the present study, we found that cisplatin initially increased the expressions and nuclear accumulation of FOXO1 and FOXO3a in NSCLC. Knockdown of FOXO1 and FOXO3a significantly decreased the cell sensitivity to cisplatin in vitro and in vivo. Moreover, inhibition of FOXO1 and FOXO3a attenuated cisplatin-induced cell apoptosis independent of Bim, a pro-apoptotic protein downstream of the FOXOs. Moreover, LY294002 synergistically increased the cytotoxic effects of cisplatin. Mechanistically, LY294002 increased the expressions and nuclear accumulation of FOXO1 and FOXO3a. Knockdown of FOXO1 and FOXO3a abrogated the enhancing effect of LY294002 on cisplatin. Taken together, our results suggested that FOXO1 and FOXO3a sensitize NSCLC cells to cisplatin and mediate the enhancing effects of LY294002 on cisplatin.
15
Garrido, Nuria, Acisclo Pérez-Martos, Mercedes Faro, José Manuel Lou-Bonafonte, Patricio Fernández-Silva, Manuel José López-Pérez, Julio Montoya, and José Antonio Enríquez. "Cisplatin-mediated impairment of mitochondrial DNA metabolism inversely correlates with glutathione levels." Biochemical Journal 414, no. 1 (July 29, 2008): 93–102. http://dx.doi.org/10.1042/bj20071615.
Full textAbstract:
Cisplatin accumulates in mitochondria, which are a major target for this drug in cancer cells. Thus alterations in mitochondrial function have been implicated in cancer cell resistance to chemotherapeutic agents. Moreover, cisplatin toxic side effects seem to be associated with mitochondrial injury in vivo and in vitro. In order to clarify the potential effect of cisplatin in mtDNA (mitochondrial DNA) maintenance and expression, we have analysed rat liver mtDNA and mtRNA (mitochondrial RNA) synthesis as well as their stability under the influence of in vivo treatment or in vitro exposure to cisplatin. We show that cisplatin causes a direct and significant impairment of mtDNA and mtRNA synthesis and decreases steady-state levels of mtRNAs in isolated mitochondria. Furthermore, in vivo treatment of the animals with cisplatin exerts a protective effect from the impairment of mtRNA metabolism caused by in vitro exposure to the drug, by means of increased mitochondrial GSH levels after in vivo cisplatin treatment.
16
Zhang, Jiangnan, Tingting Zhao, Changyuan Wang, Qiang Meng, Xiaokui Huo, Chong Wang, Pengyuan Sun, et al. "Catalpol-Induced AMPK Activation Alleviates Cisplatin-Induced Nephrotoxicity through the Mitochondrial-Dependent Pathway without Compromising Its Anticancer Properties." Oxidative Medicine and Cellular Longevity 2021 (January 15, 2021): 1–13. http://dx.doi.org/10.1155/2021/7467156.
Full textAbstract:
Nephrotoxicity is a common complication of cisplatin chemotherapy and, thus, limits the clinical application of cisplatin. In this work, the effects of catalpol (CAT), a bioactive ingredient extracted from Rehmannia glutinosa, on cisplatin-induced nephrotoxicity and antitumor efficacy were comprehensively investigated. Specifically, the protective effect of CAT on cisplatin-induced injury was explored in mice and HK-2 cells. In vivo, CAT administration strikingly suppressed cisplatin-induced renal dysfunction, morphology damage, apoptosis, and inflammation. In vitro, CAT induced activation of adenosine 5 ′ -monophosphate- (AMP-) activated protein kinase (AMPK), improved mitochondrial function, and decreased generation of cellular reactive oxygen species (ROS), leading to a reduction in inflammation and apoptosis, which ultimately protected from cisplatin-induced injury. However, the beneficial effects of CAT were mostly blocked by coincubation with compound C. Furthermore, molecular docking results indicated that CAT had a higher affinity for AMPK than other AMPK activators such as danthron, phenformin, and metformin. Importantly, CAT possessed the ability to reverse drug resistance without compromising the antitumor properties of cisplatin. These findings suggest that CAT exerts positive effects against cisplatin-induced renal injury through reversing drug resistance via the mitochondrial-dependent pathway without affecting the anticancer activity of cisplatin.
17
Dolgova, Nataliya V., Sergiy Nokhrin, Corey H. Yu, Graham N. George, and Oleg Y. Dmitriev. "Copper chaperone Atox1 interacts with the metal-binding domain of Wilson's disease protein in cisplatin detoxification." Biochemical Journal 454, no. 1 (July 26, 2013): 147–56. http://dx.doi.org/10.1042/bj20121656.
Full textAbstract:
Human copper transporters ATP7B (Wilson's disease protein) and ATP7A (Menkes' disease protein) have been implicated in tumour resistance to cisplatin, a widely used anticancer drug. Cisplatin binds to the copper-binding sites in the N-terminal domain of ATP7B, and this binding may be an essential step of cisplatin detoxification involving copper ATPases. In the present study, we demonstrate that cisplatin and a related platinum drug carboplatin produce the same adduct following reaction with MBD2 [metal-binding domain (repeat) 2], where platinum is bound to the side chains of the cysteine residues in the CxxC copper-binding motif. This suggests the same mechanism for detoxification of both drugs by ATP7B. Platinum can also be transferred to MBD2 from copper chaperone Atox1, which was shown previously to bind cisplatin. Binding of the free cisplatin and reaction with the cisplatin-loaded Atox1 produce the same protein-bound platinum intermediate. Transfer of platinum along the copper-transport pathways in the cell may serve as a mechanism of drug delivery to its target in the cell nucleus, and explain tumour-cell resistance to cisplatin associated with the overexpression of copper transporters ATP7B and ATP7A.
18
Liu, Hung-Ting, Tse-En Wang, Yu-Ting Hsu, Chi-Chung Chou, Kai-Hung Huang, Cheng-Chih Hsu, Hong-Jen Liang, Hui-Wen Chang, Tzong-Huei Lee, and Pei-Shiue Tsai. "Nanoparticulated Honokiol Mitigates Cisplatin-Induced Chronic Kidney Injury by Maintaining Mitochondria Antioxidant Capacity and Reducing Caspase 3-Associated Cellular Apoptosis." Antioxidants 8, no. 10 (October 9, 2019): 466. http://dx.doi.org/10.3390/antiox8100466.
Full textAbstract:
Cisplatin is a potent anti-cancer drug, however, its accompanied organ-toxicity hampers its clinical applications. Cisplatin-associated kidney injury is known to result from its accumulation in the renal tubule with excessive generation of reactive oxygen species. In this study, we encapsulated honokiol, a natural lipophilic polyphenol constituent extracted from Magnolia officinalis into nano-sized liposomes (nanosome honokiol) and examined the in vivo countering effects on cisplatin-induced renal injury. We observed that 5 mg/kg body weight. nanosome honokiol was the lowest effective dosage to efficiently restore renal functions of cisplatin-treated animals. The improvement is likely due the maintenance of cellular localization of cytochrome c and thus preserves mitochondria integrity and their redox activity, which as a consequence, reduced cellular oxidative stress and caspase 3-associated apoptosis. These improvements at the cellular level are later reflected on the observed reduction of kidney inflammation and fibrosis. In agreement with our earlier in vitro study showing protective effects of honokiol on kidney cell lines, we demonstrated further in the current study, that nanosuspension-formulated honokiol provides protective effects against cisplatin-induced chronic kidney damages in vivo. Our findings not only benefit cisplatin-receiving patients with reduced renal side effects, but also provide potential alternative and synergic solutions to improve clinical safety and efficacy of cisplatin treatment on cancer patients.
19
Manguinhas, Rita, Ana S. Fernandes, João G. Costa, Nuno Saraiva, Sérgio P. Camões, Nuno Gil, Rafael Rosell, Matilde Castro, Joana P. Miranda, and Nuno G. Oliveira. "Impact of the APE1 Redox Function Inhibitor E3330 in Non-Small Cell Lung Cancer Cells Exposed to Cisplatin: Increased Cytotoxicity and Impairment of Cell Migration and Invasion." Antioxidants 9, no. 6 (June 24, 2020): 550. http://dx.doi.org/10.3390/antiox9060550.
Full textAbstract:
Elevated expression levels of the apurinic/apyrimidinic endonuclease 1 (APE1) have been correlated with the more aggressive phenotypes and poor prognosis of non-small cell lung cancer (NSCLC). This study aimed to assess the impact of the inhibition of the redox function of APE1 with E3330 either alone or in combination with cisplatin in NSCLC cells. For this purpose, complementary endpoints focusing on cell viability, apoptosis, cell cycle distribution, and migration/invasion were studied. Cisplatin decreased the viability of H1975 cells in a time- and concentration-dependent manner, with IC50 values of 9.6 µM for crystal violet assay and 15.9 µM for 3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay. E3330 was clearly cytotoxic for concentrations above 30 µM. The co-incubation of E3330 and cisplatin significantly decreased cell viability compared to cisplatin alone. Regarding cell cycle distribution, cisplatin led to an increase in sub-G1, whereas the co-treatment with E3330 did not change this profile, which was then confirmed in terms of % apoptotic cells. In addition, the combination of E3330 and cisplatin at low concentrations decreased collective and chemotactic migration, and also chemoinvasion, by reducing these capabilities up to 20%. Overall, these results point to E3330 as a promising compound to boost cisplatin therapy that warrants further investigation in NSCLC.
20
Mao, Pingping, Mary P. Hever, Lynne M. Niemaszyk, Jessica M. Haghkerdar, Esty G. Yanco, Damayanti Desai, Maroun J. Beyrouthy, Joanna S. Kerley-Hamilton, Sarah J. Freemantle, and Michael J. Spinella. "Serine/Threonine Kinase 17A Is a Novel p53 Target Gene and Modulator of Cisplatin Toxicity and Reactive Oxygen Species in Testicular Cancer Cells." Journal of Biological Chemistry 286, no. 22 (April 13, 2011): 19381–91. http://dx.doi.org/10.1074/jbc.m111.218040.
Full textAbstract:
Testicular cancer is highly curable with cisplatin-based therapy, and testicular cancer-derived human embryonal carcinoma (EC) cells undergo a p53-dominant transcriptional response to cisplatin. In this study, we have discovered that a poorly characterized member of the death-associated protein family of serine/threonine kinases, STK17A (also called DRAK1), is a novel p53 target gene. Cisplatin-mediated induction of STK17A in the EC cell line NT2/D1 was prevented with p53 siRNA. Furthermore, STK17A was induced with cisplatin in HCT116 and MCF10A cells but to a much lesser extent in isogenic p53-suppressed cells. A functional p53 response element that binds endogenous p53 in a cisplatin-dependent manner was identified 5 kb upstream of the first coding exon of STK17A. STK17A is not present in the mouse genome, but the closely related gene STK17B is induced with cisplatin in mouse NIH3T3 cells, although this induction is p53-independent. Interestingly, in human cells containing both STK17A and STK17B, only STK17A is induced with cisplatin. Knockdown of STK17A conferred resistance to cisplatin-induced growth suppression and apoptotic cell death in EC cells. This was associated with the up-regulation of detoxifying and antioxidant genes, including metallothioneins MT1H, MT1M, and MT1X that have previously been implicated in cisplatin resistance. In addition, knockdown of STK17A resulted in decreased cellular reactive oxygen species, whereas STK17A overexpression increased reactive oxygen species. In summary, we have identified STK17A as a novel direct target of p53 and a modulator of cisplatin toxicity and reactive oxygen species in testicular cancer cells.
21
Dolgova, Nataliya V., Doug Olson, Svetlana Lutsenko, and Oleg Y. Dmitriev. "The soluble metal-binding domain of the copper transporter ATP7B binds and detoxifies cisplatin." Biochemical Journal 419, no. 1 (March 13, 2009): 51–59. http://dx.doi.org/10.1042/bj20081359.
Full textAbstract:
Wilson disease ATPase (ATP7B) has been implicated in the resistance of cancer cells to cisplatin. Using a simple in vivo assay in bacterial culture, in the present study we demonstrate that ATP7B can confer resistance to cisplatin by sequestering the drug in its N-terminal metal-binding domain without active drug extrusion from the cell. Expression of a protein fragment containing four N-terminal MBRs (metal-binding repeats) of ATP7B (MBR1–4) protects cells from the toxic effects of cisplatin. One MBR1–4 molecule binds up to three cisplatin molecules at the copper-binding sites in the MBRs. The findings of the present study suggest that suppressing enzymatic activity of ATP7B may not be an effective way of combating cisplatin resistance. Rather, the efforts should be directed at preventing cisplatin binding to the protein.
22
Pasalic, Leonardo, Campbell Heather, Shane Thomas, and Vivien M. Chen. "Cisplatin Fails To Stimulate Production Of Reactive Oxygen Species and Release Of Neutrophil Extracellular Traps By Human Neutrophils In Vitro." Blood 122, no. 21 (November 15, 2013): 4714. http://dx.doi.org/10.1182/blood.v122.21.4714.4714.
Full textAbstract:
Background Cisplatin is a commonly used antineoplastic agent for treatment of a broad range of cancers. Cisplatin-based treatment has been associated with a significant risk of venous thromboembolism. The mechanisms through which cisplatin contributes to a prothrombotic state remain unclear. Neutrophil extracellular traps (NETs) consist of web-like DNA–histone core decorated with granule proteins and are released from activated neutrophils in a process dependent on reactive oxygen species (ROS), in particular hypochlorous acid (HOCl). Recently, NETs have been shown to play an important role in initiation and propagation of venous thrombus in a number of animal models of deep vein thrombosis. The aim of this study was to investigate whether NETs may provide a potential link between cisplatin and venous thromboembolism. Methods and Results To assess the effect of cisplatin on release of NETs by ex vivo human neutrophils isolated by positive immunomagnetic selection we visualised NETs release by confocal fluorescent microscopy and performed fluorimetric quantification of cell-free DNA (CFDNA) using either SYTOX Green nucleic acid stain (10 µM) or an ultrasensitive fluorescent assay Picogreen Quant IT (Invitrogen). In contrast to stimulation with phorbol 12-myristate 13-acetate (PMA) (25 nM),which resulted in 22 ng/104neutrophils of detectable CFDNA, neither of these two assays could detect any significant release of CFDNA by human neutrophils exposed to cisplatin (15 µM) for 2 or 4 hours above baseline similar with vehicle control. Furthermore, confocal fluorescent microscopy imaging of neutrophils stained with non-cell permeable DNA dye SYTOX Red (Invitrogen) demonstrated no difference in NET formation between control and cisplatin treated human neutrophils. Thus we could not demonstrate that NETS are produced in response to cisplatin treatment. In view of consistent reports that NET formation is ROS dependent we decided to investigate whether cisplatin exposure leads to production of ROS by human neutrophils. Few published studies into the effects of cisplatin on the production of ROS by human neutrophils in vitro offer conflicting results. We used flow cytometry and fluorescent probe hydroethidine (HE) for detection of intercellular superoxide anion radical in HL60 granulocytic cells in the presence of cisplatin (up to 50 µM). Differentiation down the granulocytic lineage after stimulation with ATRA was confirmed by light microscopy and by flow cytometry. Capacity of differentiated HL60 cells to generate NET formation after PMA stimulation was confirmed by fluorescence microscopy. Cisplatin failed to augment the spontaneous production of ROS by ATRA differentiated HL60 cells. The number of viable ethidium-high cells in cisplatin treated group did not differ from the vehicle control indicating no detectable production of ROS in response to cisplatin. In contrast, positive control treatment with PMA (25 nM) and menadione (40 µM) resulted in 4- and 20-fold increase in viable ethidium-high population respectively. ROS generation by human neutrophils was measured by a colorimetric assay for chlorination of extracellular taurine to determine if exposure to cisplatin results in the production of HOCl by human neutrophils in vitro. Treatment of resting neutrophils with cisplatin (15 µM) for 30 min or 120 min was not associated with an increase in the spontaneous production of HOCl above the baseline. Furthermore, the PMA (25 nM)-activated generation of HOCl production was not increased by pre-treating neutrophils with cisplatin indicating that there was no potentiation of ROS by pre-treatment with cisplatin. Discussion and Conclusion Our results suggest that cisplatin fails to induce release of NETs or HOCl from human neutrophils in vitro. These negative findings seem to be at odds with the well described pro-oxidative actions of cisplatin. One possible explanation centres on reported findings that the pro-oxidative effects of cisplatin are dependent on the mitochondrial generation of ROS whilst the mitochondria-generated ROS appear not to be instrumental to NET formation. Therefore, we postulate that cisplatin may not be able to induce NET formation by human neutrophils, which are known to contain few mitochondria, due to a sub-threshold ROS signal. Therefore it appears that cisplatin-associated increased risk of venous thrombosis is unlikely to be mediated through NETs. Disclosures: No relevant conflicts of interest to declare.
23
Ferrarelli, Leslie K. "Synthetic lethality with cisplatin." Science Signaling 11, no. 544 (August 21, 2018): eaav1294. http://dx.doi.org/10.1126/scisignal.aav1294.
Full text
24
Kumburovic, Igor, Dragica Selakovic, Tatjana Juric, Nemanja Jovicic, Vladimir Mihailovic, Jelena Katanic Stankovic, Nikola Sreckovic, Davor Kumburovic, Vladimir Jakovljevic, and Gvozden Rosic. "Antioxidant Effects ofSatureja hortensisL. Attenuate the Anxiogenic Effect of Cisplatin in Rats." Oxidative Medicine and Cellular Longevity 2019 (July 29, 2019): 1–15. http://dx.doi.org/10.1155/2019/8307196.
Full textAbstract:
Numerous adverse effects of cisplatin-based therapy are usually accompanied by enhanced oxidative damage and cell apoptosis in various tissues. Even neurotoxic manifestations of cisplatin administration, such as the anxiogenic effect, appear along with the increased oxidative stress and apoptotic indicators in certain brain regions. Thirty-five Wistar albino male rats were divided into seven groups: control, cisplatin (received a single dose of cisplatin: 7.5 mg/kg), three groups with oral administration ofSatureja hortensisL. methanolic extract (SH) (low: 50 mg/kg, middle: 100 mg/kg, and high dose: 200 mg/kg) along with cisplatin application, a group with the extract in high dose alone, and a silymarin group (cisplatin and silymarin: 100 mg/kg), in order to evaluate the antioxidant effects of SH on cisplatin-induced increase in the anxiety level. After completing 10-day pretreatments, behavioral testing was performed in the open field and the elevated plus maze, followed by an investigation of oxidative stress and apoptosis parameters in hippocampal tissue samples. Cisplatin administration resulted in anxiogenic-like behavior, increased lipid peroxidation, and proapoptotic markers accompanied by the decline in antioxidant and antiapoptotic defense. The administration of extract alone did not significantly alter any of the estimated parameters. When applied along with cisplatin, SH in a dose of 100 mg/kg induced the significant anxiolytic effect with concomitant recovery of antioxidant and antiapoptotic activity indicators, while both lower and higher doses of the extract failed to improve the adverse effects of cisplatin administration. The beneficial effects of the middle dose of SH were equivalent to the same dose of silymarin, as a “golden standard.” Our results indicate that the antioxidant supplementation with SH in an optimal dose significantly improved the oxidative status and it had antiapoptotic effect in the rat hippocampus disturbed by cisplatin administration, which was accompanied with attenuation of cisplatin-induced anxiogenic effect.
25
Kim, Ye-Ri, Tae-Jun Kwon, Un-Kyung Kim, In-Kyu Lee, Kyu-Yup Lee, and Jeong-In Baek. "Fursultiamine Prevents Drug-Induced Ototoxicity by Reducing Accumulation of Reactive Oxygen Species in Mouse Cochlea." Antioxidants 10, no. 10 (September 26, 2021): 1526. http://dx.doi.org/10.3390/antiox10101526.
Full textAbstract:
Drug-induced hearing loss is a major type of acquired sensorineural hearing loss. Cisplatin and aminoglycoside antibiotics have been known to cause ototoxicity, and excessive accumulation of intracellular reactive oxygen species (ROS) are suggested as the common major pathology of cisplatin- and aminoglycoside antibiotics-induced ototoxicity. Fursultiamine, also called thiamine tetrahydrofurfuryl disulfide, is a thiamine disulfide derivative that may have antioxidant effects. To evaluate whether fursultiamine can prevent cisplatin- and kanamycin-induced ototoxicity, we investigated their preventive potential using mouse cochlear explant culture system. Immunofluorescence staining of mouse cochlear hair cells showed that fursultiamine pretreatment reduced cisplatin- and kanamycin-induced damage to both inner and outer hair cells. Fursultiamine attenuated mitochondrial ROS accumulation as evidenced by MitoSOX Red staining and restored mitochondrial membrane potential in a JC-1 assay. In addition, fursultiamine pretreatment reduced active caspase-3 and TUNEL signals after cisplatin or kanamycin treatment, indicating that fursultiamine decreased apoptotic hair cell death. This study is the first to show a protective effect of fursultiamine against cisplatin- and aminoglycoside antibiotics-induced ototoxicity. Our results suggest that fursultiamine could act as an antioxidant and anti-apoptotic agent against mitochondrial oxidative stress.in cochlear hair cells
26
Zheng, Lei, Li Li, Yun Lu, Fangfang Jiang, and Xiu-An Yang. "SREBP2 contributes to cisplatin resistance in ovarian cancer cells." Experimental Biology and Medicine 243, no. 7 (February 22, 2018): 655–62. http://dx.doi.org/10.1177/1535370218760283.
Full textAbstract:
This study is to investigate transcription factors involved in cisplatin resistance in ovarian cancer cells. The transcriptome of cisplatin resistant and sensitive A2780 epithelial ovarian cancer cells was obtained from GSE15372. Ovarian transcriptome data GSE62944 was downloaded from TCGA and applied for transcription regulatory network analysis. The analysis results were confirmed using quantitative polymerase chain reaction. The roles of SREBP2 in cisplatin-resistant cells were investigated by RNA inference and cell viability analysis. Transcription regulatory network analysis found that 12 transcription factors and their targets were involved in cisplatin resistant in A2780 cells. Among these factors, the targets of EZH2 and SREBP2 revealed by Transcriptional Regulatory Relationships Unraveled by Sentence-based Text mining were also enriched in differentially expressed genes between cisplatin resistant and cisplatin sensitive cells. Their targets were enriched mainly in cell cycle and cholesterol metabolic process, respectively. Bioinformatic analysis illustrated three known targets of SREBP2, namely LDLR, FDFT1, and HMGCR were increased in A2780-resistant cell lines. Additionally, the three genes and SREBP2 were also elevated in live cells after cisplatin treatment via quantitative polymerase chain reaction. Importantly, RNA inference of SREBP2 in A2780 cell line resulted in a decrease of cell viability after cisplatin treatment. SREBP2 played important roles in cisplatin resistance and cholesterol metabolic process might be a novel target for cancer therapy. Impact statement Transcriptome of cisplatin resistant and sensitive A2780 epithelial ovarian cancer cells was obtained from GSE15372 and TCGA. Twelve transcription factors and their targets were involved in cisplatin resistant. Among these factors, the targets of EZH2 and SREBP2 revealed by Transcriptional Regulatory Relationships Unraveled by Sentence-based Text mining were also enriched in differentially expressed genes. Their targets were enriched mainly in cell cycle and cholesterol metabolic process. Three targets of SREBP2, namely LDLR, FDFT1, and HMGCR were increased in A2780-resistant cell lines and were found elevated in live cells after cisplatin treatment via qPCR. RNAi of SREBP2 in A2780 cell line resulted in a decrease of cell viability after cisplatin treatment. SREBP2 played important roles in cisplatin resistance and might be a novel target for cancer therapy.
27
Xiao, Fangxing, Xiaobin Yao, Qianhong Bao, Danzhen Li, and Yi Zheng. "Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL." Bioinorganic Chemistry and Applications 2012 (2012): 1–10. http://dx.doi.org/10.1155/2012/649640.
Full textAbstract:
The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.
28
Tinker, N. D., H. L. Sharma, and C. A. McAuliffe. "[82Br]cisplatin derivative: A potential biological model for cisplatin." Journal of Labelled Compounds and Radiopharmaceuticals 28, no. 8 (August 1990): 971–76. http://dx.doi.org/10.1002/jlcr.2580280811.
Full text
29
Wang, Tse-En, Yu-Hua Lai, Kai-Chien Yang, Sung-Jan Lin, Chih-Lin Chen, and Pei-Shiue Tsai. "Counteracting Cisplatin-Induced Testicular Damages by Natural Polyphenol Constituent Honokiol." Antioxidants 9, no. 8 (August 9, 2020): 723. http://dx.doi.org/10.3390/antiox9080723.
Full textAbstract:
Cisplatin, despite its anti-cancer ability, exhibits severe testicular toxicities when applied systemically. Due to its wide application in cancer treatment, reduction of its damages to normal tissue is an imminent clinical need. Here we evaluated the effects of honokiol, a natural lipophilic polyphenol compound, on cisplatin-induced testicular injury. We showed in-vitro and in-vivo that nanosome-encapsulated honokiol attenuated cisplatin-induced DNA oxidative stress by suppressing intracellular reactive oxygen species production and elevating gene expressions of mitochondrial antioxidation enzymes. Nanosome honokiol also mitigated endoplasmic reticulum stress through down regulation of Bip-ATF4-CHOP signaling pathway. Additionally, this natural polyphenol compound diminished cisplatin-induced DNA breaks and cellular apoptosis. The reduced type I collagen accumulation in the testis likely attributed from inhibition of TGFβ1, αSMA and ER protein TXNDC5 protein expression. The combinatorial beneficial effects better preserve spermatogenic layers and facilitate repopulation of sperm cells. Our study renders opportunity for re-introducing cisplatin to systemic anti-cancer therapy with reduced testicular toxicity and restored fertility.
30
Ahmad, Sarfraz, Amina Hussain, Aroosha Hussain, Iskandar Abdullah, Muhammad Sajjad Ali, Matheus Froeyen, and Muhammad Usman Mirza. "Quantification of Berberine in Berberis vulgaris L. Root Extract and Its Curative and Prophylactic Role in Cisplatin-Induced In Vivo Toxicity and In Vitro Cytotoxicity." Antioxidants 8, no. 6 (June 19, 2019): 185. http://dx.doi.org/10.3390/antiox8060185.
Full textAbstract:
Cisplatin is amongst the most potent chemotherapeutic drugs with applications in more than 50% of cancer treatments, but dose-dependent side effects limit its usefulness. Berberis vulgaris L. (B. vulgaris) has a proven role in several therapeutic applications in the traditional medicinal system. High-performance liquid chromatography was used to quantify berberine, a potent alkaloid in the methanolic root extract of B. vulgaris (BvRE). Berberine chloride in BvRE was found to be 10.29% w/w. To assess the prophylactic and curative protective effects of BvRE on cisplatin-induced nephrotoxicity, hepatotoxicity, and hyperlipidemia, in vivo toxicity trials were carried out on 25 healthy male albino Wistar rats (130–180 g). Both prophylactic and curative trials included a single dose of cisplatin (4 mg/kg, i.p.) and nine doses of BvRE (500 mg/kg/day, orally). An array of marked toxicity effects appeared in response to cisplatin dosage evident by morphological condition, biochemical analysis of serum (urea, creatinine, total protein, alanine transaminase, aspartate transaminase, total cholesterol, and triglyceride), and organ tissue homogenates (malondialdehyde and catalase). Statistically-significant (p < 0.05) variations were observed in various parameters. Moreover, histological studies of liver and kidney tissues revealed that the protective effect of BvRE effectively minimized and reversed nephrotoxic, hepatotoxic, and hyperlipidemic effects caused by cisplatin in both prophylactic and curative groups with relatively promising ameliorative effects in the prophylactic regimen. The in vitro cell viability effect of cisplatin, BvRE, and their combination was determined on HeLa cells using the tetrazolium (MTT) assay. MTT clearly corroborated that HeLa cells appeared to be less sensitive to cisplatin and berberine individually, while the combination of both at the same concentrations resulted in growth inhibition of HeLa cells in a remarkable synergistic way. The present validated the use of BvRE as a protective agent in combination therapy with cisplatin.
31
Tang, Zuxiong, Jun He, Jiayue Zou, Shufei Yu, Xiaoming Sun, and Lei Qin. "Cisplatin-resistant HepG2 cell-derived exosomes transfer cisplatin resistance to cisplatin-sensitive cells in HCC." PeerJ 9 (April 13, 2021): e11200. http://dx.doi.org/10.7717/peerj.11200.
Full textAbstract:
Backgrounds Cancer cell resistance to chemotherapy drugs such as Gemcitabine, Oxaliplatin, Cisplatin, Doxorubicin, and 5-fluorouracil account for the main reason of chemotherapy failure for HCC patients, especially for those with advanced HCC or metastasis patients. This emerging resistance limits the effectiveness and clinical application of these chemotherapy drugs. Previous studies reported that drug-resistant tumor cell-derived exosomes could transfer their resistance property to tumor sensitive cells in some cancer, including lung and gastric cancer. This study sought to explore whether HepG2/DDP cell-derived exosomes transmit cisplatin (DDP) resistance to HepG2 and other HCC sensitive cells, and provide considerable guidance for HCC nursing with Cisplatin DDP clinically. Methods The HepG2 DDP-resistant cell line (HepG2/DDP) was established, and the exosomes from both HepG2/DDP and HepG2 cells were isolated and named ES-2, ES-1, respectively. HepG2 or SMMC-7721 or Huh7 cells were treated with DDP or DDP + ES-2, and HepG2/DDP cells were treated with ES-1. Then, the activation of drug resistance via HepG2/DDP exosomes transfer to HepG2, SMMC-7721 and Huh7 cells were assessed by cell viability assay and ROS formation. Moreover, the relative expression of P-glycoprotein (P-gp) was measured by western blot analysis. Results HepG2/DDP cell-derived exosomes were successfully isolated from cisplatin-resistant HepG2 cells, and named ES-2. Cell viability of HepG2 or SMMC-7721 or Huh7 cells treated with DDP + ES-2 was enhanced compared with that of DDP treatment group. Also, the concentration of ROS generated in cells under DDP or DDP + ES-2 treatment was strongly increased compared with that of control, although the concentration of ROS was clearly smaller in DDP + ES-2 treatment group compared with DDP treatment. At the same time, the expression of P-gp was upregulated on the ES-2 surface. Conclusion The results mentioned above clarified that HepG2/DDP cell-derived exosomes conferred cisplatin resistance to HepG2 and other HCC cell lines, and provided a new significance for improving the effectiveness of DDP in treating HCC.
32
Peters, Richard H., and Robert K. Stuart. "Synergism between 4-hydroperoxycyclophosphamide and cisplatin: importance of incubation sequence and measurement of cisplatin accumulation." Biochemical Pharmacology 39, no. 3 (February 1990): 607–9. http://dx.doi.org/10.1016/0006-2952(90)90070-2.
Full text
33
Xue, Danfeng, Shu-Ting Pan, Xiongming Zhou, Fangfei Ye, Qun Zhou, Fanzhe Shi, Fei He, Hui Yu, and Jiaxuan Qiu. "Plumbagin Enhances the Anticancer Efficacy of Cisplatin by Increasing Intracellular ROS in Human Tongue Squamous Cell Carcinoma." Oxidative Medicine and Cellular Longevity 2020 (March 26, 2020): 1–21. http://dx.doi.org/10.1155/2020/5649174.
Full textAbstract:
Cisplatin is widely used in the treatment of tongue squamous cell carcinoma (TSCC), but its clinical efficacy is limited by drug resistance and toxic side effects. Hence, a novel compound capable of enhancing the anticancer effect of cisplatin while reducing the side effects is urgently needed. We have previously shown that plumbagin (PLB), an anticancer phytochemical, is able to inhibit the growth of TSCC in vitro and in vivo. The objective of this study was to investigate the effect of PLB in reversing the resistance of TSCC to cisplatin as well as its molecular mechanisms. Here, we found that PLB enhances cisplatin-induced cytotoxicity, apoptosis, and autophagy in CAL27 and cisplatin-resistant CAL27/CDDP cells. PLB could inhibit the viability and growth of TSCC cells by increasing the production of intracellular reactive oxygen species (ROS). In addition, the combination treatment of PLB and cisplatin resulted in a synergistic inhibition of TSCC viability, apoptosis, and autophagy by increasing intracellular ROS, which may be achieved by activating JNK and inhibiting AKT/mTOR signaling pathways. Finally, the synergistic treatment was also demonstrated in vivo. Therefore, PLB combined with cisplatin is a potential therapeutic strategy against therapy TSCC cisplatin resistance.
34
KAMARAJAN, Pachiyappan, Nian-Kang SUN, and Chuck C. K. CHAO. "Up-regulation of FLIP in cisplatin-selected HeLa cells causes cross-resistance to CD95/Fas death signalling." Biochemical Journal 376, no. 1 (November 15, 2003): 253–60. http://dx.doi.org/10.1042/bj20030659.
Full textAbstract:
Cisplatin-selected cervix carcinoma HeLa cell lines induced less apoptosis, and weaker activation by cisplatin or Fas-activating antibody, of mitochondrial-associated caspase-9 and death receptor-mediated caspase-8 than did parental cells. Furthermore, less DISC (death-inducing signalling complex) was formed in cisplatin-selected cell lines than in parental cells. Ac-IETD-CHO (acetyl-Ile-Glu-Thr-Asp-aldehyde), which has a certain preference for inhibiting caspase-8, or Fas-antagonistic antibody, significantly inhibited cisplatin-induced apoptosis in both parental and cisplatin-selected HeLa cell lines. These results imply that cell-surface death signalling is inducible by cisplatin; that reduction of this pathway is associated with drug resistance, and that cisplatin-selected cells acquire cross-resistance to cell-surface death signalling. Sequential up-regulation of FLIP (FLICE-like inhibitory protein), but not Bcl-2, Bcl-xL or inhibitors of apoptosis protein (IAPs), was observed in resistant cells but not in parental cells. The inhibition of FLIP by FLIP antisense oligonucleotides promotes cisplatin and Fas-antibody-induced apoptosis. However, the modulation of apoptosis by FLIP antisense oligonucleotides in resistant cells is greater than that in parental cells. The presented data reveal that the up-regulation of FLIP may contribute to the suppression of apoptosis and thereby change cells that are resistant to cisplatin and Fas-mediated death signals. The results also show that cancer cells that have undergone long-term chemotherapy and become chemoresistant may change the FLIP level, becoming cross-resistant to death factors such as Fas.
35
Kim, Jung-Yeon, Jungmin Jo, Jaechan Leem, and Kwan-Kyu Park. "Inhibition of p300 by Garcinol Protects against Cisplatin-Induced Acute Kidney Injury through Suppression of Oxidative Stress, Inflammation, and Tubular Cell Death in Mice." Antioxidants 9, no. 12 (December 14, 2020): 1271. http://dx.doi.org/10.3390/antiox9121271.
Full textAbstract:
Emerging evidence suggests that epigenetic mechanisms such as histone modification are crucially involved in the pathophysiology of acute kidney injury (AKI). The histone acetyltransferase p300 regulates several biological processes through the acetylation of histones or transcription factors. However, the role of p300 in cisplatin-induced AKI remains poorly understood. Therefore, we investigated the effects of garcinol, a potent p300 inhibitor, on cisplatin-induced AKI and explored the mechanisms. Administration of garcinol significantly reversed the upregulation of p300 and increased acetylation of histone H3, along with amelioration of renal dysfunction and histopathological injury in the kidneys of cisplatin-injected mice. Garcinol also attenuated oxidative stress and reduced expression of pro-oxidant enzymes. In addition, garcinol reduced the elevated production of cytokines and chemokines and suppressed immune cell accumulation together with downregulation of vascular adhesion molecules. These beneficial effects of garcinol were associated with a reduction in acetylation of the p65 subunit of nuclear factor kappa-B. Further, garcinol significantly inhibited apoptosis and caspase-3 activation, with a decrease in p53 acetylation in cisplatin-injected mice. Taken together, we demonstrated that the inhibition of p300 by garcinol ameliorated cisplatin-induced renal injury, presumably through epigenetic mechanisms. These results suggest that garcinol might be a potential preventive agent for cisplatin-induced AKI.
36
Salatino, Alessandro, Ilenia Aversa, Anna Martina Battaglia, Alessandro Sacco, Anna Di Vito, Gianluca Santamaria, Roberta Chirillo, et al. "H-Ferritin Affects Cisplatin-Induced Cytotoxicity in Ovarian Cancer Cells through the Modulation of ROS." Oxidative Medicine and Cellular Longevity 2019 (October 31, 2019): 1–13. http://dx.doi.org/10.1155/2019/3461251.
Full textAbstract:
Reactive oxygen species (ROS) mediates cisplatin-induced cytotoxicity in tumor cells. However, when cisplatin-induced ROS do not reach cytotoxic levels, cancer cells may develop chemoresistance. This phenomenon can be attributed to the inherited high expression of antioxidant protein network. H-Ferritin is an important member of the antioxidant system due to its ability to store iron in a nontoxic form. Altered expression of H-Ferritin has been described in ovarian cancers; however, its functional role in cisplatin-based chemoresistance of this cancer type has never been explored. Here, we investigated whether the modulation of H-Ferritin might affect cisplatin-induced cytotoxicity in ovarian cancer cells. First, we characterized OVCAR3 and OVCAR8 cells for their relative ROS and H-Ferritin baseline amounts. OVCAR3 exhibited lower ROS levels compared to OVCAR8 and greater expression of H-Ferritin. In addition, OVCAR3 showed pronounced growth potential and survival accompanied by the strong activation of pERK/pAKT and overexpression of c-Myc and cyclin E1. When exposed to different concentrations of cisplatin, OVCAR3 were less sensitive than OVCAR8. At the lowest concentration of cisplatin (6 μM), OVCAR8 underwent a consistent apoptosis along with a downregulation of H-Ferritin and a consistent increase of ROS levels; on the other hand, OVCAR3 cells were totally unresponsive, H-Ferritin was almost unaffected, and ROS amounts met a slight increase. Thus, we assessed whether the modulation of H-Ferritin levels was able to affect the cisplatin-mediated cytotoxicity in both the cell lines. H-Ferritin knockdown strengthened cisplatin-mediated ROS increase and significantly restored sensitivity to 6 μM cisplatin in resistant OVCAR3 cells. Conversely, forced overexpression of H-Ferritin significantly suppressed the cisplatin-mediated elevation of intracellular ROS subsequently leading to a reduced responsiveness in OVCAR8 cells. Overall, our findings suggest that H-Ferritin might be a key protein in cisplatin-based chemoresistance and that its inhibition may represent a potential approach for enhancing cisplatin sensitivity of resistant ovarian cancer cells.
37
Dmitriev, Oleg Y. "Mechanism of tumor resistance to cisplatin mediated by the copper transporter ATP7BThis paper is one of a selection of papers published in a Special Issue entitled CSBMCB 53rd Annual Meeting — Membrane Proteins in Health and Disease, and has undergone the Journal’s usual peer review process." Biochemistry and Cell Biology 89, no. 2 (April 2011): 138–47. http://dx.doi.org/10.1139/o10-150.
Full textAbstract:
The Wilson disease protein (ATP7B) is a copper-transporting ATPase that is responsible for regulating copper homeostasis in human tissues. ATP7B is associated with cancer resistance to cisplatin, one of the most widely used anticancer drugs. This minireview discusses the possible mechanisms of tumor resistance to cisplatin mediated by ATP7B. Cisplatin binds to the N-terminal cytosolic domain of ATP7B, which contains multiple copper-binding sites. Active platinum efflux catalyzed by ATP7B is unlikely to significantly contribute to cisplatin resistance in vivo. Transient platinum sequestration in the metal-binding domain followed by transfer to an acceptor protein or a low molecular weight compound is proposed as an alternative mechanism of cisplatin detoxification in the cell.
38
Sarkhosh‐Inanlou, Roya, Morteza Molaparast, Adel Mohammadzadeh, and Vahid Shafiei‐Irannejad. "Sanguinarine enhances cisplatin sensitivity via glutathione depletion in cisplatin‐resistant ovarian cancer (A2780) cells." Chemical Biology & Drug Design 95, no. 2 (September 21, 2019): 215–23. http://dx.doi.org/10.1111/cbdd.13621.
Full text
39
Zou, Wei, Xiangdong Ma, Hong Yang, Wei Hua, Biliang Chen, and Guoqing Cai. "Hepatitis B X-interacting protein promotes cisplatin resistance and regulates CD147 via Sp1 in ovarian cancer." Experimental Biology and Medicine 242, no. 5 (January 5, 2017): 497–504. http://dx.doi.org/10.1177/1535370216685007.
Full textAbstract:
Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in ovarian cancer cell lines. Impact statement We found that hepatitis B X-interacting protein (HBXIP) was able to activate the CD147 promoter through Sp1. In vivo, depletion of HBXIP decreased the tumor volume and weight induced by CP. Taken together, these results indicate that HBXIP promotes cisplatin resistance and regulated CD147 via Sp1 in ovarian cancer cell lines.
40
Liu, Yupeng, Hui Wu, Fan Zhang, Jun Yang, and Jingchun He. "Resveratrol upregulates miR-455-5p to antagonize cisplatin ototoxicity via modulating the PTEN–PI3K–AKT axis." Biochemistry and Cell Biology 99, no. 3 (June 2021): 385–95. http://dx.doi.org/10.1139/bcb-2020-0459.
Full textAbstract:
Resveratrol is a non-flavonoid polyphenol compound that exists in many plants, and is considered an antitoxin. This study explores the effects from the regulation of miR-455-5p by resveratrol on cisplatin-induced ototoxicity via the PTEN–PI3K–AKT signaling pathway. For this, House Ear Institute–Organ of Corti 1 (HEI-OC1) cells were transfected with miR-455-5p inhibitor and treated with cisplatin and resveratrol, then cell proliferation, apoptosis, and oxidative stress were evaluated. A mouse model of hearing loss was established, and these mice were treated with cisplatin, resveratrol, or cisplatin combined with resveratrol, by intraperitoneal injection. The auditory brainstem response (ABR) threshold was measured, and hair cells were examined using immunofluorescence staining. The expression levels of miR-455-5p, PTEN, and PI3K/Akt proteins were examined. The results from our in-vitro experiments indicate that resveratrol promoted viability and reduced apoptosis and oxidative stress in cisplatin-induced HEI-OC1 cells. Resveratrol upregulated miR-455-5p, downregulated PTEN, and activated the PI3K–Akt axis. These effects of resveratrol were reversed by knock-down of miR-455-5p. The results from our in-vivo experiments indicate that resveratrol protected hearing and inhibited the hair-cell injury caused by cisplatin ototoxicity. Resveratrol also upregulated miR-455-5p, downregulated PTEN, and activated the PTEN–PI3K–Akt axis in cochlear tissues from cisplatin-treated mice. These results indicate that resveratrol upregulates miR-455-5p to target PTEN and activate the PI3K–Akt signaling pathway to counteract cisplatin ototoxicity.
41
Xiao, Yang. "Effect of hTR Antisense Oligodeoxynucleotides on Telomerase Acitvity and Ciplatin -Sensitivity of Primary Acute Leukemia Cells." Blood 104, no. 11 (November 16, 2004): 4359. http://dx.doi.org/10.1182/blood.v104.11.4359.4359.
Full textAbstract:
Abstract BACKGROUND: Between the three key components part of human telomerase, human telomerase RNA (hTR) and human telomerase reverse transcriptase (hTERT) have significant correlation with telomerase activity. The previous study has identified that the telomerase activity of K562 and HL-60 cells was special suppresssed significantly by phosphorothoate antisense oligodeoxynucleotide (ASODN) complementary to the initiator codon of hTR. This study was designed to evalutae the effection of hTR ASODN on telomerase activity and apoptosis of primary acute leukemic cells. To research whether hTR ASODN could enhance apoptosis rates of primary leukemic cells to cisplatin. METHODS: Primary leukemic cells were treated with phosphorothoate ASODN complementary to the initiator codon of hTR in vivo. The changing of telomerase activity was assayed by telomeric repeat amplification protocol(TRAP) and polymerase chain reaction enzyme-linked immunoassay(PCR-ELISA). The survival rates of cells was measured by trypan blue exclusion. Apoptosis was assayed by morphological observation (Giemsa and PI), DNA gel electrophoresis and flow cytometry analysis technology. RESULTS: Primary acute leukemic cells expressed high level of telomerase activity which decreased as the cells treated by hTR ASODN. The telomerase activity was suppresssed significantly by 10umol/L ASODN and the effecttion was most significantly at 72h; Apoptotic bodies of primary leukemic cells were observed easily by fluorescence micrscope when cisplatin was added 48h after ASODN treatment for 24h; Agarose gel electrophoresis of genomic DNA from primary leukemic cells treated with ASODN and cisplatin combination for 72h showed typical DNA ladder; neither did DNA from primary leukemic cells treated with sense oligodeoxynucleotide (SODN) plus cisplatin nor cisplatin alone. In addition, apoptosis rates of primary leukemic cells treated with ASODN for 24h and then with cisplatin for 72h were 41.36±9.28%. There were statistically significant difference in the percentage of apoptotic cells between hTR ASODN plus cisplatin and SODN plus cisplatin (14.51±4.78%) or cisplatin alone group (12.61±2.56)% (P<0.01). CONCLUSIONS: ASODN complementary to the region of hTR could significantly inhibit the telomerase activity of primary acute leukemic cells, and increased the cisplatin-induced apoptosis and enhanced cisplatin-sensitivity in vivo, indicating telomerase may be a new target of treatment to leukemia.
42
Lin, Shyh-Horng, Ming-Han Li, Kai-An Chuang, Ni-Hsuan Lin, Chih-Hsuan Chang, Hsin-Chieh Wu, Ya-Hsuan Chao, et al. "Chlorella sorokiniana Extract Prevents Cisplatin-Induced Myelotoxicity In Vitro and In Vivo." Oxidative Medicine and Cellular Longevity 2020 (January 25, 2020): 1–14. http://dx.doi.org/10.1155/2020/7353618.
Full textAbstract:
Cisplatin chemotherapy causes myelosuppression and often limits treatment duration and dose escalation in patients. Novel approaches to circumvent or lessen myelotoxicity may improve clinical outcome and quality of life in these patients. Chlorella sorokiniana (CS) is a freshwater unicellular green alga and exhibits encouraging efficacy in immunomodulation and anticancer in preclinical studies. However, the efficacy of CS on chemoprotection remains unclear. We report here, for the first time, that CS extract (CSE) could protect normal myeloid cells and PBMCs from cisplatin toxicity. Also, cisplatin-induced apoptosis in HL-60 cells was rescued through reservation of mitochondrial function, inhibition of cytochrome c release to cytosol, and suppression of caspase and PARP activation. Intriguingly, cotreatment of CSE attenuated cisplatin-evoked hypocellularity of bone marrow in mice. Furthermore, we observed the enhancement of CSF-GM activity in bone marrow and spleen in mice administered CSE and cisplatin, along with increased CD11b levels in spleen. In conclusion, we uncovered a novel mechanism of CSE on myeloprotection, whereby potentially supports the use of CSE as a chemoprotector against cisplatin-induced bone marrow toxicity. Further clinical investigation of CSE in combination with cisplatin is warranted.
43
Alkahtani, Saad, Saud Alarifi, Gadah Albasher, Mohammed Al-Zharani, Nada H. Aljarba, Mohammed H. Almarzoug, Norah M. Alhoshani, Norah S. AL-Johani, Hani Alothaid, and Abdullah A. Alkahtane. "Poly Lactic-Co-Glycolic Acid- (PLGA-) Loaded Nanoformulation of Cisplatin as a Therapeutic Approach for Breast Cancers." Oxidative Medicine and Cellular Longevity 2021 (June 28, 2021): 1–8. http://dx.doi.org/10.1155/2021/5834418.
Full textAbstract:
Despite recent advancements in cisplatin (cis-diamminedichloroplatinum II) and other platinum-based chemotherapeutic drugs for treating solid tumors, their uses are limited by either in terms of toxicity and/or acquired drug resistance. These side effects have a dangerous problem with higher dose for severe patients. To overcome the low therapeutic ratio of the free drug, a polymeric nanoparticle drug delivery system has been explored promoting delivery of cisplatin to tumors. Recently, the applications of nanoparticles (NPs) have been underlined for encouraging the effects of chemotherapeutic drugs in cancerous cells. The intention of this project is to assess the potential of poly lactic-co-glycolic acid (PLGA) nanoparticles (NPs) for enhancing the effects of anticancer drug cisplatin. For the purpose, we have synthesized PLGA-cisplatin nanoparticles for increasing its bioavailability and studied the comparative cytotoxicity of free cisplatin and PLGA-cisplatin against MCF-7 cancer cell lines and HEK-293 normal cell lines. We have also analyzed the hallmarks of PLGA-cisplatin-induced apoptosis. The outcomes of this study may provide the possibility of delivery of anticancer drug to their specific site, which could minimize toxicity and optimize the drug efficacy.
44
Martelli, Laura, Francesco Di Mario, Eugenio Ragazzi, Piero Apostoli, Roberto Leone, Paola Perego, and Guido Fumagalli. "Different accumulation of cisplatin, oxaliplatin and JM216 in sensitive and cisplatin-resistant human cervical tumour cells." Biochemical Pharmacology 72, no. 6 (September 2006): 693–700. http://dx.doi.org/10.1016/j.bcp.2006.06.008.
Full text
45
Plumb, J. A., N. Steele, P. W. Finn, and R. Brown. "Epigenetic approaches to cancer therapy." Biochemical Society Transactions 32, no. 6 (October 26, 2004): 1095–97. http://dx.doi.org/10.1042/bst0321095.
Full textAbstract:
Histone deacetylation and DNA methylation have a central role in the control of gene expression, including transcriptional repression of tumour suppressor genes. Loss of DNA mismatch repair due to methylation of the hMLH1 gene promoter results in resistance to cisplatin in vitro and in vivo. The cisplatin-resistant cell line A2780/cp70 is 8-fold more resistant to cisplatin than the non-resistant cell line, and has the hMLH1 gene methylated. Treatment with an inhibitor of DNA methyltransferase, DAC (2-deoxy-5′-azacytidine), results in a partial reversal of DNA methylation, re-expression of MLH1 (mutL homologue 1) and sensitization to cisplatin both in vitro and in vivo. PXD101 is a novel hydroxamate type histone deacetylase inhibitor that shows antitumour activity in vivo and is currently in phase I clinical evaluation. Treatment of A2780/cp70 tumour-bearing mice with DAC followed by PXD101 results in a marked increase in the number of cells that re-express MLH1. Since the clinical use of DAC may be limited by toxicity and eventual re-methylation of genes, we suggest that the combination of DAC and PXD101 could have a role in increasing the efficacy of chemotherapy in patients with tumours that lack MLH1 expression due to hMLH1 gene promoter methylation.
46
Metzler-Nolte, Nils. "Book Review: Cisplatin. Chemistry and Biochemistry of a Leading Anticancer Drug. By Bernhard Lippert." Angewandte Chemie International Edition 40, no. 1 (January 5, 2001): 258–59. http://dx.doi.org/10.1002/1521-3773(20010105)40:1<258::aid-anie258>3.0.co;2-x.
Full text
47
Metzler-Nolte, Nils. "Buchbesprechung: Cisplatin. Chemistry and Biochemistry of a Leading Anticancer Drug. Herausgegeben von Bernhard Lippert." Angewandte Chemie 113, no. 1 (January 5, 2001): 266–67. http://dx.doi.org/10.1002/1521-3757(20010105)113:1<266::aid-ange266>3.0.co;2-j.
Full text
48
Raudenska, Martina, Jan Balvan, Michaela Fojtu, Jaromir Gumulec, and Michal Masarik. "Unexpected therapeutic effects of cisplatin." Metallomics 11, no. 7 (2019): 1182–99. http://dx.doi.org/10.1039/c9mt00049f.
Full text
49
Raeisi, Elham, Mathias Hossain Aazami, Seyed Mahmud Reza Aghamiri, Atefeh Satari, Safoura Hosseinzadeh, Yves Lemoigne, and Esfandiar Heidarian. "Bromelain-based chemo-herbal combination effect on human cancer cells: in-vitro study on AGS and MCF7 proliferation and apoptosis." Current Issues in Pharmacy and Medical Sciences 33, no. 3 (September 1, 2020): 155–61. http://dx.doi.org/10.2478/cipms-2020-0028.
Full textAbstract:
AbstractAim. Chemo-herbal combinations promise new clinical anticancer therapeutic modalities. The current study investigated and compared the in vitro effects of a bromelain-based chemo-herbal combination to/with cisplatin or 5-FU, with regard to the proliferation and apoptosis of human gastric AGS and breast MCF7 cell lines.Material and methods. AGS and MCF7 cells were either treated with different concentrations of bromelain, cisplatin or 5-FU; or with bromelain-cisplatin and bromelain-5-FU combinations for 48h. Cell proliferative inhibition and inductive apoptosis were appraised using MTT assay and flowcytometry, respectively. Kruskal-Wallis and Dunn’s tests were used to analyze differences in cell groups’ means.Results. AGS proliferation was adversely affected by single treatments of bromelain and cisplatin (p <0.003) or 5-FU (p <0.05). The anti-proliferative impact of single treatments was more pronounced on MCF7 cells. The bromelain-cisplatin combinations displayed synergistic effect on MCF7 cells (CIs ≤1), while being additive or antagonistic with cisplatin IC30 and IC40 to AGS cell proliferation, respectively. In addition, bromelian-5-FU combinations showed synergistic effect on AGS cells, while antagonistic to MCF7 cells. In terms of cell apoptosis induction, bromelain (IC30)-cisplatin (IC20) displayed additive effect on MCF7, compared to cisplatin single treatment (p <0.04), while bromelain (IC40)-5-FU (IC10) and bromelain (IC30)-5-FU (IC20) afforded additive apoptotic effects on AGS (p <0.04) and MCF7 (p <0.05), respectively, in comparison to 5-FU single treatment.Conclusion. A bromelain-based combination using cisplatin showed concordant effects on cell proliferation impediment and apoptotic induction on MCF7, while the same results were noticed with a bromelain-5-FU combination to AGS cells. The bromelain-based chemo-herbal pathways should further be investigated in the frame of multi-chemotherapeutic drugs researches.
50
Kou, Wen, Hongyan Qin, Shahbaz Hanif, and Xinan Wu. "Nephrotoxicity Evaluation on Cisplatin Combined with 5-HT3 Receptor Antagonists: A Retrospective Study." BioMed Research International 2018 (May 30, 2018): 1–5. http://dx.doi.org/10.1155/2018/1024324.
Full textAbstract:
Objective. 5-HT3 receptor antagonist (ondansetron) has been reported to have nephrotoxic effect when combined with cisplatin in mice; however, little evidence exists in explaining its nephrotoxic effects on patients. The aim of this present study was to investigate whether 5-HT3 receptor antagonist could enhance or aggravate the incidence of cisplatin-induced nephrotoxicity in patients. Methods. We retrospectively reviewed 600 tumor patients which were treated with cisplatin (⩾60 mg/m2) as a first-time chemotherapy and combined with 5-HT3 receptor antagonist (i.e., ondansetron, tropisetron, or ramosetron, each kind of 5-HT3 receptor antagonist contains 200 cases) between January 2010 and December 2015. Cisplatin dosing, the baseline creatinine clearance, and other independent risk factors such as patient’s age, sex, PS score, and weight associated with nephrotoxicity were evaluated in a multivariable model. Results. The incidence of Grade ⩾ 2 serum creatinine elevation in cisplatin + ondansetron group was significantly higher than cisplatin + tropisetron group (P=0.04), but no significant difference was found between cisplatin + ondansetron group and cisplatin + ramosetron group (P=0.3). It was also found that cisplatin dosage and tumor type were independent risk factors in the development of nephrotoxicity. Conclusion. Higher cisplatin dosage and regular use of ondansetron combined with cisplatin are more likely to increase the incidence of nephrotoxicity; tropisetron showed the relatively mild effect on kidney function, suggesting that tropisetron is a preferable alternative in the process of cisplatin chemotherapy.