Academic literature on the topic 'Colletotrichum'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Colletotrichum.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Colletotrichum"
1
Shivangi S. Kansara, M. Sruthy. "Effect of Culture Filtrates of Dominant Seed Mycoflora of Chilli on Seed Germination and Seedling Vigour." International Journal of Current Microbiology and Applied Sciences 11, no. 3 (March 10, 2022): 178–87. http://dx.doi.org/10.20546/ijcmas.2022.1103.021.
Full textAbstract:
Effect of culture filtrates of most common and dominant fungi viz., Aspergillus niger, Colletotrichum sp. and Fusarium sp. of chilli seed variety GVC 101 and GVC 111 was studied on seed germination, seedling length, fresh weight, dry weight and vigour index.In GVC 101 variety, the seeds treated with culture filtrate of A. niger showed maximum decrease in seed germination (43.35%) followed by Colletotrichumsp. (20.23%) and Fusarium sp. (9.83%). Average seedling length was also decreased maximum in seeds treated with culture filtrate of A. niger (43.70%) followed by Colletotrichum sp. (40.22%) and Fusarium sp. (23.91%). Seeds treated with culture filtrate of A. niger showed maximum reduction of vigour index by 68.09 per cent followed by Colletotrichum sp. (52.31%) and Fusarium sp. (31.34%). In GVC 111 variety, the seeds treated with culture filtrate of A. niger showed maximum decrease in seed germination (35.12%) followed by Colletotrichum sp. (17.89%) and Fusarium sp. (15.12%). Average seedling length was also decreased maximum in seeds treated with culture filtrate of A. niger (61.14%) followed by Colletotrichum sp. (36.64%) and Fusarium sp. (25.54%). Seeds treated with culture filtrate of A. niger showed maximum reduction of vigour index by 74.73 per cent followed by Colletotrichumsp. (47.91%) and Fusarium sp. (36.73%).
2
Golovin, S. E., and E. V. Kharitonova. "Infestation of red currant berries and its varieties by fungi of genus Colletotrichum Sacc. in Russia." Horticulture and viticulture, no. 1 (March 24, 2022): 31–37. http://dx.doi.org/10.31676/0235-2591-2022-1-31-37.
Full textAbstract:
Some species of parasitic fungi from the genus Colletotrichum afflict the vegetative organs of a plant, while the others affect the reproductive organs. This results in the deterioration of berry quality and yield and the potential death of a plant. Colletotrichum fungi causing anthracnose in the red currant berry were first isolated in Russia from the fruits of red currant (Ribes rubrum) and its varieties received from the Moscow, Yaroslavl and Kostroma regions and the Mari El Republic. The susceptibility of these crop varieties depended on the infection potential of Colletotrichums pp. in the plantings and weather conditions. Infestation symptoms include wrinkled fruit that develops during berry ripening. Species of this pathogen are preserved within mummy berries and dry clusters on the branches. The flowers were infected under the conditions of the Moscow Region in the first decade of May 2021; under the conditions of continental climate in the Mari El Republic, visual symptoms of the disease were absent within this period; however, the pathogen had already been present in the plantations. Therefore, it can be concluded that the pathogens behave as biotrophs when infecting red currant. The results of morphological and molecular genetic analyses showed that two species of the genus Colletotrichum parasitise on red currant in the Moscow region: Colletotrichum godetiae Neerg., Friesia and Colletotrichum fioriniae Marcelino&Gouli.
3
Sopialena. "Test Of The Effectiveness Of Antagonic Fungi In The Control Of Colletotrichum Mushrooms In Tomato Plants (Lycopersicum esculentum L.). In Vitro." Agrifarm : Jurnal Ilmu Pertanian 9, no. 2 (December 7, 2020): 10–14. http://dx.doi.org/10.24903/ajip.v9i2.980.
Full textAbstract:
This study was conducted to test the effectiveness of several antagonistic fungi (Trichoderma sp., Penicillium sp., Gliocladium sp., And Rhizopus sp) in controlling the pathogenic Colletotrichumsp. fungi from tomato plants (Lycopersicon esculentum L.). in vitro. The research was carried out for 2 (two) months at the Laboratory of Pest and Plant Disease Laboratory, Faculty of Agriculture, Mulawarman University. This research was compiled using a Completely Randomized Design (CRD) consisting of 4 (four) treatments, namely Trichoderma sp., Penicillium sp., Gliocladium sp., And Rhizopus sp. Each treatment was repeated 10 times. Data analysis using Analysis of variance and if the results are obtained significantly different then further tested using the Least Significant Difference. The results showed that the most effective antagonistic fungus suppressed the growth of the pathogen Colletotrichum sp. is Gliocladium sp. and Trichoderma sp., meanwhile the antagonist fungus Rhizopus sp., which is less effective in suppressing the growth of the fungus Colletotrichum sp., and the fungus Penicillium sp., are the most ineffective fungi in suppressing the growth of the pathogenic Colletotrichum sp.
Key words: Trichoderma sp., Penicillium sp., Gliocladium sp., And Rhizopus sp., Colletotrichum sp., Tomatoes (Lycopersicon esculentum L.)
Keywords :Pyricularia oryza Cav., Endophyte fungi, Antagonistic mechanim
4
Shamsi, Shamim, and Najmun Naher. "Disease severity and mycoflora associated with anthracnose on leaves of five angiosperms." Bangladesh Journal of Scientific Research 28, no. 2 (February 22, 2016): 103–11. http://dx.doi.org/10.3329/bjsr.v28i2.26781.
Full textAbstract:
Severe anthracnose symptom was recorded on the leaves of five angiosperms during September to November, 2010. In total nine species of fungi belonging to four genera of the class deuteromycetes and a sterile fungus were found to be associated with the infected leaves of Abelmoschus esculentus (L.) Moench, Cucurbita maxima Duchesne, Datura metel L., Gossypium hirsutum L. and Vigna sinensis L. The associated fungi were Aspergillus flvaus Link, A. fumigatus Fresenius, A. nidulans (Eidam) G. Winter, A. niger van Tiegh, Cercospora sp., Colletotrichum capsici (Syd.) Butler & Bisby, Colletotrichum dematium (Pers.) Grove, Colletotricum gloeosporioides (Penz.) Penz. and Sacc., Curvularia clavata Jain, and a sterile fungus.Bangladesh J. Sci. Res. 28(2): 103-111, Dec-2015
5
Sopialena, Sopialena, Muhammad Alexander Mirza, and Rani Soraya. "Influence of biopesticides on growth (Colletotrichum capsici Sydow) Causes Antraknosa In Cayenne Pepper (Capsicum frutescens L.)." Jurnal Agroekoteknologi Tropika Lembab 2, no. 2 (February 11, 2020): 105. http://dx.doi.org/10.35941/jatl.2.2.2020.3222.105-110.
Full textAbstract:
ABSTRACK.This research aims to determine the influence of some plant extracts that are potentially as biopesticides on the growth and development of the mushroom Colletotrichum, Sydow and to know plant extracts that are able to suppress The growth and development of Colletotrichum's Capsisi Sydow. The study was conducted from March to April 2019, In the laboratory of Pest and disease grow Faculty of Agriculture, Mulawarman University. The method used is to use complete random draft (RAL) with 5 treatment that is potato dextrose so that, agar dextrose betel leaf, agar dextrose papaya leaves, so that the Dextrose lengbrush, agar dextrose garlic and repeated 10 times.The results showed the administration of betel leaf plant extracts, papaya leaves, galangal, and garlic has a prospect to be developed as a biopesticides to control mushrooms Colletotrichum capsici Sydow Cause of the antraknosa chili Peppers. The medium with betel leaf extract is the most effective extract to suppress the growth and development of Colletotrichum's capside of Sydow.
6
SILVEIRA, AMANDA LETÍCIA DA, JULIANA STRACIERI, FERNANDA DIAS PEREIRA, ANDRESSA DE SOUZA, and ANTONIO DE GOES. "CARACTERIZAÇÃO MOLECULAR DE ISOLADOS DE Colletotrichum spp. ASSOCIADOS A PODRIDÃO FLORAL DOS CITROS." Revista Brasileira de Fruticultura 38, no. 1 (February 2016): 64–71. http://dx.doi.org/10.1590/0100-2945-041/15.
Full textAbstract:
RESUMO A podridão floral dos citros (PFC) é uma importante doença dessa cultura, responsável por elevadas perdas de produção. Normalmente, essa doença mostra-se limitante quando ocorrem prolongados períodos chuvosos durante o florescimento das plantas ou quando existe intenso molhamento foliar. Duas espécies de Colletotrichum estão associadas à doença: C. acutatum e C. gloeosporioides. Entretanto, recentemente, tem-se verificado que, mesmo sob condições não tão propícias, a doença tem ocorrido com relativa frequência, suspeitando-se do envolvimento de outras espécies de Colletotrichumou de novas condições de adaptação das espécies descritas. Este trabalho teve como objetivo determinar se há ou não outra espécie de Colletotrichum associada a PFC e avaliar a viabilidade do emprego de marcadores moleculares ISSR na caracterização taxonômica de isolados de Colletotrichum spp. associados a sintomas de PFC em flores, assim como de tecidos foliares e frutos cítricos assintomáticos. Para tanto, foi empregada uma combinação de iniciadores específicos, levando em conta a região ITS e marcadores moleculares ISSR. Os marcadores ISSR mostraram-se eficientes na caracterização taxonômica dos isolados de Colletotrichum analisados. A população avaliada foi constituída apenas por C. acutatum e C. gloeosporioides, descartando o envolvimento de uma espécie adicional. Foi constatada alta diversidade genética entre os isolados analisados, o que também se mostra convergente quanto às diferenças fenotípicas observadas sob condições de campo. Entretanto, não foi encontrada relação quanto à origem e as espécies de Colletotrichum spp. associadas. De modo inédito, ainda que assintomaticamente, foi detectada a presença de um isolado de C. acutatum associado a frutos cítricos.
7
Mariana, Mariana, Elly Liestiany, Fahmi Rizali Cholis, and Nazwan Syahbani Hasbi. "PENYAKIT ANTRAKNOSA CABAI OLEH Colletotrichum sp. DI LAHAN RAWA KALIMANTAN SELATAN." Jurnal Ilmu-Ilmu Pertanian Indonesia 23, no. 1 (June 15, 2021): 30–36. http://dx.doi.org/10.31186/jipi.23.1.30-36.
Full textAbstract:
[CHILLI ANTHRACNOSE DISEASE BY Colletotrichum sp. AT SWAMP LAND OF SOUTH KALIMANTAN PROVINCE]. Anthracnose is one of the major economic constraints for chili production worldwide. This disease is caused by the fungus Colletotrichum sp. The yield loss reaches 50% - 100% in the rainy season. In swamps, the incidence of this disease begins to increase. As the basis for the integrated control of anthracnose, it is necessary to record disease incidence and identify pathogens that attack conditions in swampsThe disease intensity survey was conducted in Hiyung chilli cultivation of Hiyung village lowland and the tidal swamplands of Marabahan district. The method is using Purposive Random Sampling approach. The Koch’s Postulates is used to determined the cause of the disease. Identification of pathogens that cause anthracnose is carried out in laboratories and greenhouses. Determination of obtained pathogen’s type is using literature references. The results of this study indicate that Hiyung chilli in the Hiyung village lowland shows a fairly high incidence of disease – i.e 43.78%, moreover, the result of Marabahan district tidal swamplands is 29.29%. Three Colletotrichum species were found, namely Colletotricum truncatum, C. gleosporiedes and C. acutatum.
8
Ritterband, David C., Mahendra Shah, and John A. Seedor. "Colletotrichum graminicola." Cornea 16, no. 3 (May 1997): 362???364. http://dx.doi.org/10.1097/00003226-199705000-00019.
Full text
9
Fernandez, Viviana, Dilek Dursun, Darlene Miller, and Eduardo C. Alfonso. "Colletotrichum keratitis." American Journal of Ophthalmology 134, no. 3 (September 2002): 435–38. http://dx.doi.org/10.1016/s0002-9394(02)01576-3.
Full text
10
Hammerschmidt, R. "Resisting Colletotrichum." Physiological and Molecular Plant Pathology 76, no. 1 (June 2011): 1. http://dx.doi.org/10.1016/j.pmpp.2011.08.002.
Full textDissertations / Theses on the topic "Colletotrichum"
1
Lubbe, Carolien M. "Colletotrichum diseases of Proteaceae." Thesis, Stellenbosch : Stellenbosch University, 2004. http://hdl.handle.net/10019.1/53732.
Full textAbstract:
Thesis (MSc)--Stellenbosch University, 2004.ENGLISH ABSTRACT: This thesis consists of four chapters that present research findings on Colletotrichum diseases associated with Proteaceae worldwide. The first chapter is a review of literature regarding the taxonomy and histology of Colletotrichum species associated with Proteaceae. The literature is not restricted to Proteaceae hosts, as information regarding Colletotrichum on Proteaceae is very limited. In chapter two, Colletotrichum spp. associated with proteaceous hosts growing in various parts of the world were identified based on morphology, sequence data of the internal transcribed spacer region (ITS-I, ITS-2), the 5.8S gene, and partial sequences of the B-tubulin gene. Four species of Colletotrichum were associated with Proteaceae. Colletotrichum gloeosporioides was isolated from Protea cynaroides cultivated in South Africa and Zimbabwe and from a Leucospermum sp. in Portugal, but is known to occur worldwide on numerous hosts. A recently described species, C. boninense, was associated with Zimbabwean and Australian Proteaceae, but also occurred on a Eucalyptus sp. in South Africa. This represents a major geographical and host extension for the species, and a description of the African strains is provided. Colletotrichum crassipes was represented by a single isolate obtained from a Dryandra plant in Madeira. Colletotrichum acutatum was isolated from Protea and Leucadendron in South Africa as well as from other proteaceous hosts occurring elsewhere. Colletotrichum acutatum f. sp. hakea was isolated from Hakea in South Africa. In chapter three, pathogenicity of these Colletotrichum species to certain proteas was established, relative aggressiveness of the different species tested and host response to them were compared as well as the effect that wounding had on host response. From the results obtained it is concluded that C. acutatum and C. gloeosporioides are the primary pathogens associated with Colletotrichum leaf necrosis, and C. acutatum is the main cause of anthracnose and stem necrosis of Proteaceae in South Africa. A histological study was performed in chapter four in response to the findings from the previous chapter. The behaviour of two C. acutatum isolates (one originating from Protea and the other from Hakea, C. acuataum f.sp. hakea) was studied on inoculated Protea leaf surfaces using light and scanning electron microscopy. Colletotrichum acutatum from Protea formed melanised appressoria on the leaf surface, whereas C. acutatum from Hakea formed very low numbers of both melanised and unmelanised appressoria. Most of the appressoria formed by C. acutatum from Protea were formed on the cell junctions and on the periclinal walls of the epidermal cells. From this study it is clear that C. acutatum f. sp. hakea is not a pathogen of Protea. Consequently the current use of this isolate as a biological control agent of Hakea in South Africa poses no threat to indigenous Protea species. Colletotrichum acutatum from Protea (although closely related to C. acutatum f. sp. hakea), is a pathogen of Protea, which was confirmed by histological observations. In conclusion, the present study has shown that several species of Colletotrichum are associated with diseased Proteaceae. These species differed in their pathogenicity and aggressiveness when inoculated onto certain protea cultivars. These differences could be partially explained by examining the behaviour of C. acutatum on the leaf surface. It is clear, however, that the distribution of the different species, their aggressrveness on different Proteaceae and their modes of infection needs to be investigated further. This work provides a basis for future research on the long-term effective management of these pathogens in fynbos production.
AFRIKAANSE OPSOMMING: Hierdie tesis bestaan uit vier hoofstukke wat handeloor navorsing van Colletotrichum siektes van Proteaceae wêreldwyd. Die eerste hoofstuk is 'n oorsig van literatuur rakende die taksonomie en histologie van die Colletotrichum spesies wat met Proteaceae geassosieer word. Die literatuur oorsig is nie beperk tot die Proteaceae nie aangesien baie min inligting rakende Colletotrichum op Proteaceae bestaan. In die tweede hoofstuk word die Colletotrichum spesies wat met proteas in verskeie dele van die wêreld geassosieer word, op grond van morfologie, DNS volgorde data van die interne getranskribeerde spasieerder area ("ITS-I, ITS-2"), die 5.8S geen, en gedeeltelike DNS volgordes van die B-tubulin geen geïdentifiseer. Vier Colletotrichum spesies is met die Proteaceae geassosieer. Colletotrichum gloeosporioides is geïsoleer vanaf Protea cynaroides wat in Suid-Afrika en Zimbabwe gekweek is en vanaf 'n Leucospermum sp. in Portugal, maar is bekend op verskeie gashere wêreldwyd. 'n Spesie wat onlangs beskryf is, C. boninense, is met Zimbabwiese en Australiaanse Proteaceae geassosieer, maar kom ook op 'n Eucalyptus sp. in Suid-Afrika voor. Dit is 'n groot uitbreiding van die geografiese voorkoms en gasheerreeks van hierdie spesie en 'n beskrywing van die Afrikaanse rasse word gegee. Colletotrichum crassipes is verteenwoordig deur 'n enkele isolaat wat vanaf 'n Dryandra plant in Madeira verkry is. Colletotrichum acutatum is vanaf Protea en Leucadendron in Suid-Afrika asook vanaf ander proteas wat elders voorkom, geïsoleer. Colletotrichum acutatum f. sp. hakea is vanaf Hakea in Suid-Afrika geïsoleer. In hoofstuk drie is die patogenisiteit van hierdie Colletotrichum spesies teenoor sekere proteas getoets, die relatiewe aggressiwiteit van die verskillende spesies is vergelyk, asook die gasheer se reaksie teenoor die spesies en die effek wat verwonding op die gasheer gehad het. Daar kan afgelei word vanaf die resultate dat C. acutatum en C. gloeosporioides die primêre patogene is wat met Colletotrichum blaarnekrose geassosieer word, en dat C. acutatum die hoof oorsaak is van antraknose en lootnekrose van Proteaceae in Suid-Afrika. 'n Histologiese studie is in hoofstuk vier uitgevoer in reaksie op die bevindings van die vorige hoofstuk. Die gedrag van twee C. acutatum isolate (een vanaf Protea en die ander vanaf Hakea, C. acutatum f.sp. hakea) op die oppervlaktes van geïnokuleerde Protea blare is bestudeer deur gebruik te maak van lig- en skandeer-elektronmikroskopie. Colletotrichum acutatum vanaf Protea vorm gemelaniseerde appressoria op die blaaroppervlak, terwyl C. acutatum vanaf Hakea klein hoeveelhede van beide gemelaniseerde en ongemelaniseerde appressoria vorm. Meeste van die appressoria wat deur C. acutatum vanaf Protea gevorm word, vorm op die aanhegtingspunte tussen selle en op die periklinale wande van die epidermale selle. Vanuit hierdie studie is dit duidelik dat C. acutatum f. sp. hakea nie 'n patogeen van Protea is nie. Gevolglik hou die huidige gebruik van hierdie isolaat as biologiese beheer agent van Hakea in Suid-Afrika geen gevaar in vir inheemse Protea spesies nie. Colletotrichum acutatum vanaf Protea (alhoewel dit naverwant is aan C. acutatum f. sp. hakea) is 'n patogeen van Protea en hierdie stelling is ook bevestig deur histologiese waarnemmgs. Ter samevatting het hierdie studie getoon dat verskeie Colletotrichum spesies geassosieer word met siektes van Proteaceae. Hierdie spesies het van mekaar verskil rakende patogenisiteit en aggressiwiteit nadat hulle op sekere protea kultivars geïnokuleer is. Hierdie verskille kon gedeeltelik verklaar word deur die gedrag van C. acutatum op die blaaroppervlaktes van verskillende protea kultivars. Dit is duidelik dat die verspreiding van die verskillende spesies, hulle aggressiwiteit op verskillende Proteaceae en hul infeksie metodes verder ondersoek moet word. Hierdie studie verskaf 'n basis vir toekomstige navorsing rakende lang-termyn effektiewe bestuur van hierdie patogene in fynbos aanplantings.
2
Junior, Hugo Jose Tozze. "Caracterização e identificação de espécies de Colletotrichum associadas à antracnose do pimentão (Capsicum annuum) no Brasil." Universidade de São Paulo, 2008. http://www.teses.usp.br/teses/disponiveis/11/11135/tde-20032008-151208/.
Full textAbstract:
A antracnose é uma das doenças mais importantes do pimentão em vários países. Por muitos anos, somente C. gloeosporioides foi relatado como agente causal da antracnose desta cultura no Brasil. Entretanto, recentemente C. acutatum e C. capsici também tem sido associados a esta doença em algumas regiões do país. Neste trabalho, 56 isolados de Colletotrichum obtidos de pimentão e procedentes de diferentes regiões produtoras do país foram caracterizados e identificados por meio de algumas características morfológicas e culturais, e pela análise por PCR utilizando oligonucleotídeos espécie-específicos. Isolados representativos de cada espécie identificada na população amostrada também foram caracterizados quanto à patogenicidade em frutos de pimentão verdes e maduros, feridos e não feridos e quanto a sensibilidade aos fungicidas azoxistrobina, carbendazim, tiabendazol, tebuconazol, captana, clorotalonil e cloreto de benzalcônio. Os resultados demonstram que C. acutatum é a espécie predominante nas principais regiões produtoras de pimentão do país, representando cerca de 72% da população amostrada. C. capsici foi encontrada com freqüência aproximada de 14%, nos estados de São Paulo e Minas Gerais. C. gloeosporioides representou apenas 5% da população amostrada e teve distribuição restrita ao estado de São Paulo e ao Distrito Federal. Um único isolado de C. coccodes foi encontrado no Rio Grande do Sul. Além dessas espécies, isolados identificados como C. boninense foram encontrados em São Paulo e no Rio Grande do Sul, com freqüência de 7% na população amostrada. Este parece ser o primeiro relato de C. boninense infectando pimentão no Brasil e em outras partes do mundo. A caracterização patogênica mostrou que isolados representativos de todas as espécies foram patogênicos aos frutos maduros feridos e não feridos. Nos frutos verdes feridos, apenas os isolados de C. acutatum e de C. capsici promoveram sintomas. Não foram observados sintomas nos frutos verdes sem ferimentos durante o período de avaliação do experimento (12 dias) para nenhum dos isolados. C. acutatum demonstrou ser a espécie mais agressiva, apresentando os menores períodos de latência e a maior esporulação tanto em frutos verdes (feridos) como nos maduros (feridos e não feridos). Os isolados pertencentes a diferentes espécies de Colletotrichum apresentaram sensibilidade diferenciada para todos os fungicidas sistêmicos avaliados. Os isolados de C. acutatum foram mais sensíveis a azoxistrobina, enquanto os isolados de C. gloeosporioides demonstraram a menor sensibilidade para este fungicida. Os isolados de C. gloeosporioides e C. boninense foram os mais sensíveis aos benzimidazóis (carbendazim e tiabendazol), enquanto o isolado de C. coccodes teve a menor sensibilidade para estes fungicidas. O fungicida tebuconazol promoveu o maior controle sobre o crescimento micelial dos isolados. Para este fungicida, C. capsici demonstrou ser a espécie menos sensível. Os resultados deste trabalho demonstram a presença de pelo menos cinco espécies de Colletotrichum responsáveis pela antracnose do pimentão no país e evidenciam a presença de importantes diferenças entre essas, que devem ser consideradas durante o manejo da doença.In several countries, anthracnose is one of the most serious diseases in pepper. C. gloeosporioides has, for many years, been reported as the causal agent of anthracnose in Brazil. C. acutatum and C. capsici have only recently been reported as agents of anthracnose in some regions of the country. In this study, 56 isolates of Colletotrichum obtained from pepper from different areas of the country were characterized and identified based on the morphological characteristics of the conidia, as well as culture characteristics and PCR analysis with species-specific pairs of primers. Isolates representative of each identified species in the sampled population were also characterized according to their pathogenicity in pepper fruits (unripe, ripe, wounded and nonwounded) and also according to their sensitivity to fungicide (azoxystrobin, carbendazim, thiabendazole, tebuconazole, captan, chlorothalonil and benzalkonium chloride). The results have showed that C. acutatum is the most prevalent species found in the main production areas of pepper, present in about 72% of the sampled population. C. capsici was equivalent to 14% of the sampled population and found in the states of São Paulo and Minas Gerais. C. gloeosporioides was present in only 5% of the samples and it was restricted to the state of São Paulo and Distrito Federal. Only one isolate of C. coccodes was found in Rio Grande do Sul. Besides theses species, isolates of C. boninense were found in São Paulo and Rio Grande do Sul, with an occurrence of 7% in the sampled population. This seems to be the first report of C. boninense infecting pepper in Brazil and other parts of the world. The pathogenic characterization showed that representative isolates of all species were pathogenic in ripe, wounded, or nonwounded fruits. In wounded green fruit, only isolates of C. acutatum and C. capsici caused infection resulting in disease symptoms. No disease symptoms were observed in green nonwounded fruits inoculated with all Colletotrichum isolates, after 12 days of inoculation. C. acutatum was the most aggressive species with the shortest periods of latency and the highest rate of sporulation in either green wounded fruits or ripe fruits (wounded and nonwounded). Isolates of different species of Colletotrichum showed different sensitivity to the systemic fungicides evaluated. The isolates of C. acutatum were more sensitive to azoxystrobin, whereas C. gloeosporioides showed the lowest sensitivity to this fungicide. C. gloeosporioides and C. boninense isolates were the most sensitive to benzimidazoles fungicides (carbendazim and thiabendazole), whereas C. coccodes isolates showed the lowest sensitivity to these fungicides. The tebuconazol fungicide exerted the highest effect on mycelial growth for all Colletotrichum species. C. capsici showed to be less sensitive to this fungicide. The results of this work have shown the presence of at least five species of Colletotrichum responsible for anthracnose in pepper in Brazil and have made evident the importance of the differences between these species, which must be taken into account for the control of the disease.
3
Sierra, Hayer Juan Fernan [UNESP]. "Variabilidade genética de Colletotrichum gloeosporioides e Colletotrichum acutatum em seringueira (Hevea brasiliensis) no Brasil." Universidade Estadual Paulista (UNESP), 2014. http://hdl.handle.net/11449/108731.
Full textAbstract:
Made available in DSpace on 2014-08-13T14:50:54Z (GMT). No. of bitstreams: 0
Previous issue date: 2014-02-07Bitstream added on 2014-08-13T18:01:21Z : No. of bitstreams: 1
000766190.pdf: 2070584 bytes, checksum: 9a03514bca85630b682825636e50389c (MD5)A seringueira [Hevea brasiliensis (Wild. ex Adr. de Juss.) Muell-Arg] é a maior fonte de borracha natural, amplamente cultivada, e de grande importância comercial devido a sua alta capacidade produtiva. Atualmente ela vem sendo atacada por várias doenças que causam enormes prejuízos econômicos. Dentre essas a antracnose, causada pelos fungos Colletotrichum gloeosporioides e Colletotrichum acutatum, está presente em todos os lugares heveícolas do mundo. Estes fungos causam vários danos na planta como lesões nos folíolos, nos ponteiros, nos ramos, nos frutos e cancros no painel de sangria. Diante desta situação e da alta incidência destes patógenos na cultura da seringueira, o presente trabalho teve como objetivo identificar a variabilidade genética dos isolados de C. gloeosporioides e C. acutatum associados à seringueira. Ferramentas filogenéticas e populacionais foram utilizados para determinar a distribuição e a frequência de cada um dos possíveis haplótipos. As 79 amostras coletadas em campo foram amplificadas por PCR com primers específicos das regiões espaçadores ITS e dos genes 18S, 28S e 5,8S. Posteriormente as regiões amplificadas foram sequenciadas pelo método Sanger. Para complementar as análises foram adicionadas sequências disponíveis no NCBI, totalizando uma matriz de dados de 263 amostras. As árvores geradas, a partir de análises filogenéticas Bayesiana, Máxima Verossimilhança e Neighbour-Joining, mostraram a divisão dos grupos de C. gloeosporioides e C. acutatum, possibilitando a separação da matriz em duas espécies específicas. As análises ...
The rubber tree [Hevea brasiliensis (Wild. ex Adr. Than Juss. ) Muell - Arg] is the largest source of natural rubber, widely cultivated, and of great commercial importance due to its high production capacity. Currently the rubber trees are being attacked for various diseases, causing huge economic losses. Among them, the anthracnose, caused by Colletotrichum gloeosporioides and Colletotrichum acutatum, is in all rubber crops places of the world. These fungi causes various damage, such as injuries on leaves, branches, fruits, as well as cankers in the taping panel. Given this situation, and the high incidence of this pathogen in the rubber crop, this study aimed to identify the genetic variability of the isolates of C. gloeosporioides and C. acutatum associated to rubber crop. Phylogenetic and population tools were performed to determine the distribution and frequency of each possible haplotypes. The 79 samples collected in the field were amplified by PCR by specific primers of the ITS spacers regions and the 18S, 28S and 5.8 S genes. Subsequently, the amplified regions were sequenced by the Sanger method. Several sequences available in NCBI were added, to complement the analysis, totaling a data matrix of 263 samples. Phylogenetic analyses generated by Bayesian, Maximum Likelihood and Neighbour -Joining methods, showed the division of the C. acutatum and C. gloeosporioides groups, enabling the separation of the matrix in two specific species. The population analysis showed some very common haplotypes distributed around the world, as well as another haplotypes with very restricted distribution, such as H1 haplotype of ...
4
Sierra, Hayer Juan Fernan 1980. "Variabilidade genética de Colletotrichum gloeosporioides e Colletotrichum acutatum em seringueira (Hevea brasiliensis) no Brasil /." Botucatu, 2014. http://hdl.handle.net/11449/108731.
Full textAbstract:
Orientador: Edson Luiz FurtadoBanca: Martha Maria Passador
Banca: Eduardo Bagagli
Banca: Marli de Fatima Stradioto Papa
Banca: Christiane Ceriane Aparecido
Resumo: A seringueira [Hevea brasiliensis (Wild. ex Adr. de Juss.) Muell-Arg] é a maior fonte de borracha natural, amplamente cultivada, e de grande importância comercial devido a sua alta capacidade produtiva. Atualmente ela vem sendo atacada por várias doenças que causam enormes prejuízos econômicos. Dentre essas a antracnose, causada pelos fungos Colletotrichum gloeosporioides e Colletotrichum acutatum, está presente em todos os lugares heveícolas do mundo. Estes fungos causam vários danos na planta como lesões nos folíolos, nos ponteiros, nos ramos, nos frutos e cancros no painel de sangria. Diante desta situação e da alta incidência destes patógenos na cultura da seringueira, o presente trabalho teve como objetivo identificar a variabilidade genética dos isolados de C. gloeosporioides e C. acutatum associados à seringueira. Ferramentas filogenéticas e populacionais foram utilizados para determinar a distribuição e a frequência de cada um dos possíveis haplótipos. As 79 amostras coletadas em campo foram amplificadas por PCR com primers específicos das regiões espaçadores ITS e dos genes 18S, 28S e 5,8S. Posteriormente as regiões amplificadas foram sequenciadas pelo método Sanger. Para complementar as análises foram adicionadas sequências disponíveis no NCBI, totalizando uma matriz de dados de 263 amostras. As árvores geradas, a partir de análises filogenéticas Bayesiana, Máxima Verossimilhança e Neighbour-Joining, mostraram a divisão dos grupos de C. gloeosporioides e C. acutatum, possibilitando a separação da matriz em duas espécies específicas. As análises ...
Abstract: The rubber tree [Hevea brasiliensis (Wild. ex Adr. Than Juss. ) Muell - Arg] is the largest source of natural rubber, widely cultivated, and of great commercial importance due to its high production capacity. Currently the rubber trees are being attacked for various diseases, causing huge economic losses. Among them, the anthracnose, caused by Colletotrichum gloeosporioides and Colletotrichum acutatum, is in all rubber crops places of the world. These fungi causes various damage, such as injuries on leaves, branches, fruits, as well as cankers in the taping panel. Given this situation, and the high incidence of this pathogen in the rubber crop, this study aimed to identify the genetic variability of the isolates of C. gloeosporioides and C. acutatum associated to rubber crop. Phylogenetic and population tools were performed to determine the distribution and frequency of each possible haplotypes. The 79 samples collected in the field were amplified by PCR by specific primers of the ITS spacers regions and the 18S, 28S and 5.8 S genes. Subsequently, the amplified regions were sequenced by the Sanger method. Several sequences available in NCBI were added, to complement the analysis, totaling a data matrix of 263 samples. Phylogenetic analyses generated by Bayesian, Maximum Likelihood and Neighbour -Joining methods, showed the division of the C. acutatum and C. gloeosporioides groups, enabling the separation of the matrix in two specific species. The population analysis showed some very common haplotypes distributed around the world, as well as another haplotypes with very restricted distribution, such as H1 haplotype of ...
Doutor
5
Werner, Stefan. "Untersuchungen zur Regulation und Bedeutung der Chitin-Synthese beim Maispathogen Colletotrichum graminicola (Ces.) Wils. (Teleomorph: Glomerella graminicola Politis) /." [S.l. : s.n.], 2002. http://deposit.ddb.de/cgi-bin/dokserv?idn=965236781.
Full text
6
Yu, Xuefeng. "Mass production of Colletotrichum coccodes." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 1997. http://www.collectionscanada.ca/obj/s4/f2/dsk1/tape11/PQDD_0017/NQ44638.pdf.
Full text
7
Koomen, Irene. "Biological control of Colletotrichum gloeosporioides." Thesis, University of Kent, 1990. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.278551.
Full textAbstract:
Colletotrichum gloeosporioides is the causal agent of anthracnose disease of mangoes. Infection occurs when humidity is high and rain-dispersed spores germinate and form an appressorium on immature mangoes. The infection then becomes quiescent until the fruit is harvested. On ripe fruit infection is visible as black, sunken lesions on the surface. At the pre-harvest stage, the disease is controlled with the application of a range of fungicides, and at the post-harvest stage by hot benomyl treatment. The extensive use of benomyl, both pre- and post-harvest, has resulted in the occurrence of isolates of C. gloeosporioides resistant to this fungicide. To devise an alternative strategy of disease control, the potential for biological control of anthracnose has been investigated. Potential microbial antagonists of C. gloeosporioides were isolated from blossom, leaves and fruit of mango, and screened using a series of assay techniques. In total 650 microorganisms, including bacteria, yeasts and filamentous fungi, were isolated and tested for their inhibition of growth of C. gloeosporioides on malt extract agar. Of these 650 isolates, 121 inhibited the fungus and were further tested on their ability to inhibit spore germination in vitro. Of these, 45 isolates, all bacteria and yeasts, were inoculated onto mangoes, which were artificially inoculated with C. gloeosporioides, and assessed for their potential to reduce the development of anthracnose lesions. A further selection was made, and 7 isolates were chosen to be used in a semi-commercial trial in the Philippines. This final screening procedure yielded two potential candidates for field trials, isolate 204 (identified as Bacillus cereus) and isolate 558 (identified as Pseudomonas fiuorescens). A field trial involving pre-harvest application of the biological control agent, was conducted using isolate 558. This isolate was chosen for this purpose since in in vitro experiments it significantly reduced germination of C. gloeosporioides spores. In the field trial 558 was applied in combination with nutrients and compared to treatments which had received no treatment or which had received conventional fungicide (benomyl) application. On spraying, high numbers of 558 were recorded on the leaf surface, but no reduction in post-harvest development of disease was observed. Failure of disease control was attributed to rapid death of the bacterium on the phylloplane. Inpost-harvest trials, isolates 204 and 558 were both tested in combination with different application methods, including the addition of sticker, peptone, fruit wax or a sucrose polyester. Application of 204 did not reduce disease development. Application of 558, however, did significantly reduce anthracnose development compared to the control fruit. No additional benefit was achieved by incorporating the bacteria in peptone, fruit wax or sucrose polyester. The mode of action of isolate 558 was investigated in detail. There was no evidence for parasitism taking place, or the production of volatile compounds, in the suppression of disease development. No antibiotic compounds were detected, but isolate 558 did produce a siderophore. A sharp increase in pH was also observed in culture media in which 558 was grown. Disease control may result from a combination of these two factors.
8
Sierra, Hayer Juan Fernan [UNESP]. "Caracterização e controle de colletotrichum spp. em seringueira (Hevea brasiliensis)." Universidade Estadual Paulista (UNESP), 2010. http://hdl.handle.net/11449/97222.
Full textAbstract:
Made available in DSpace on 2014-06-11T19:28:37Z (GMT). No. of bitstreams: 0
Previous issue date: 2010-02-05Bitstream added on 2014-06-13T20:37:50Z : No. of bitstreams: 1
sierrahayer_jf_me_botfca.pdf: 13042883 bytes, checksum: c8c75feb8bc74ce204bc7a174adc9e95 (MD5)A cultura da seringueira [Hevea brasiliensis (Willd. ex Adr. Jussieu) Muell. Arg.] vem sendo atacada por várias doenças de importância econômica, dentre as quais está a antracnose, causada pelo fungo Colletotrichum sp. (teleomorfo: Glomerella sp.). Este fungo causa vários danos na planta como lesões nos folíolos, nos ponteiros, nos ramos, nos frutos e cancros no painel de sangria. Somente Colletotrichum gloeosporioides foi relatado como agente causal desta doença no Brasil. O presente trabalho teve como objetivo identificar isolados de Colletotrichum spp. de seringueira de diversas regiões de plantio do Estado de São Paulo. O trabalho foi conduzido em cinco fases: a) caracterização cultural, na qual foram observadas a coloração e o aspecto das culturas in vitro. Produção de conídios e taxa de crescimento em seis temperaturas (10, 15, 20, 25, 30 e 35 °C); b) caracterização morfológica, na qual foi medido comprimento, largura e observado o formato dos conídios; c) teste de patogenicidade em folíolos destacados e em discos de folíolos, com quatro isolados de seringueira e dois de citros; d) crescimento em benomyl em quatro concentrações de princípio ativo; e) Identificação molecular para culturas monospóricas e multispóricas com primers específicos para as espécies de Colletotrichum gloeosporioides e Colletotrichum acutatum e os primers ITS1 e ITS4 os quais amplificaram uma pequena região (18S) e uma grande região (28S), e estes também permitiram a amplificação da região 5.8S do rDNA e os espaçadores internos transcritos (ITS1 e ITS2), e f) testes de crescimento em meio de cultivo acrescido com fungicidas: flutriafol, tebuconazol, epoxiconazol + piradostrobina, clorotalonil + tiofonato-metílico, captana, mancozebe, carbendazim, azoxistrobina + ciproconazol e propiconazol. Neste teste foram utilizados quatro isolados de diferentes órgãos da planta...
The rubber cultivation [Hevea brasiliensis (Willd. ex Adr. Jussieu) Muell. Arg.] is being attacked by several diseases of economic importance, among which is the anthracnose; this is caused by the fungus Colletotrichum spp. (teleomorph: Glomerella spp). This fungus causes several damages in the plant such as injuries in the leaves, branches, fruits and cankers in the taping panel. Only Colletotrichum gloeosporioides was reported as the causal agent of this disease in Brazil. The aim of this study was to identify isolates of the fungus Colletotrichum spp. from rubber trees, localized in different regions of Sao Paulo state. The study was carried out by six phases: a) culture characterization, in which the color and the culture appearance were observed in vitro, conidial production and growth rate at six temperatures (10, 15, 20, 25, 30, 35 °C); b) morphological characterization, which consist of measuring the length and width, and observed the shape of the conidia; c) pathogenicity test on selected leaves and disks of leaves, with four isolates from rubber and two isolates from citrus; d) growth in fungicide benomyl at four concentrations of active ingredient; e) molecular identification for monosporic and multisporic cultures with specific primers to the species of Colletotrichum gloeosporioides and Colletotrichum acutatum and ITS1 and ITS4 primers which amplified a small region (18S) and a large region (28S), and these also allowed the amplification of 5.8S rDNA and internal transcribed spacers (ITS1 and ITS2); f) Growth tests in culture medium supplemented with fungicides: flutriafol, tebuconazole, epoxiconazole + piradostrobina, chlorothalonil + tiofonato-methyl, captan, mancozeb, carbendazim, azoxystrobin + cyproconazole and propiconazole. In this test, four isolates were used from... (Complete abstract click electronic access below)
9
Giblin, Fiona Rosanna. "Avocado fruit responses to Colletotrichum gloeosporioides /." [St. Lucia, Qld.], 2005. http://www.library.uq.edu.au/pdfserve.php?image=thesisabs/absthe19403.pdf.
Full text
10
Ahn, Byeongseok. "Enhancing biocontrol activity of Colletotrichum coccodes." Thesis, McGill University, 2003. http://digitool.Library.McGill.CA:80/R/?func=dbin-jump-full&object_id=82816.
Full textAbstract:
Resistance responses of Abutilon theophrasti were investigated to determine defense mechanisms of the weed against Colletotrichum coccodes and to verify if some chemical suppression of the resistance mechanism could be exploited to enhance the virulence. Induced resistance in A. theophrasti has been confirmed in treatments with C. coccodes, benzothiadiazole, bentazon, and acifluorfen. Induction of peroxidase and phenylalanine ammonia lyase (PAL) activities in the leaves that did not contact with the inducing agents was observed after the localized stresses to the first leaf or the root of the plant with those agents. alpha-Amino-oxy acetic acid (AOA), 2-deoxy-D-glucose (DDG), mannose, oxalic acid, and analogues of oxalic acid and mannose were tested to enhance C. coccodes virulence. However, the compounds did not enhance C. coccodes virulence or affect A. theophrasti growth. Strong antifungal effects, poor inhibitory effects on plant defense mechanisms, or minor dependence of A. theophrasti on the defense mechanisms that the chemicals affected could be reasons. The efficacy of C. coccodes increased in the presence of 0.25 kg a.i. ha-1 bentazon more than when C. coccodes was applied alone, while the effect of glyphosate was minimal. Peroxidase activity was strongly induced by the treatment of C. coccodes and increased over time. PAL and activation of peroxidase was inhibited in the presence of bentazon, suggesting the synergy effect by bentazon is probably due to the suppression on the two defense-related enzymes. In conclusion, A. theophrasti exploits various biochemical and morphological types of defense mechanisms against C. coccodes infection. However, the activation of the defense responses can be suppressed or by-passed in an integrated weed management system.
Books on the topic "Colletotrichum"
1
J, Jeger Michael, Bailey John A, and British Society for Plant Pathology., eds. Colletotrichum: Biology, pathology, and control. Wallingford, Oxon, UK: C.A.B. International, 1992.
Find full text
2
O'Sullivan, Donal Martin. Genome structure & plasticity in Colletotrichum lindemuthianum. Dublin: University College Dublin, 1997.
Find full text
3
Genetic diversity of Colletotrichum gloeosporioides Penz. causing anthracnose disease of yam (Dioscorea spp.) in Nigeria. Berlin: J. Cramer, 2003.
Find full text
4
Hughes, Huw Bleddyn. Analysis of glycoproteins present at the surface of colletotrichum lindemuthianum conidia. Birmingham: University of Birmingham, 1999.
Find full text
5
Bryson, Rosemary Jane. Sexual hybridisation and the genetics of pathogenic specificity in 'Colletotrichum Lindemuthianum'. Birmingham: University of Birmingham, 1990.
Find full text
6
Pixton, Katherine Louise. An investigation into CIH1: A biotrophy-related gene of Colletotrichum lindemuthianum. Birmingham: University of Birmingham, 2002.
Find full text
7
Perfect, Sarah Ellen. Differentiation of the intracellular hyphae formed in the colletotrichum lindemuthianum - bean interaction. Birmingham: University of Birmingham, 1998.
Find full text
8
(Editor), J. A. Bailey, and M. J. Jeger (Editor), eds. Colletotrichum: Biology, Pathology and Control (Cabi Publishing). CABI, 1996.
Find full text
9
Pathology, and Host-Pathogen Interaction of Colletotrichum (1998 : Jerusalem) International Workshop on Host Specificity. Colletotrichum: Host Specificity, Pathology, and Host-Pathogen Interaction. Amer Phytopathological Society, 2000.
Find full text
10
Ettinger, William F. Characterization of cutinase from Colletotrichum capsici and comparison of the gene to cutinase genes from Colletotrichum gloeosporioides and Fusarium solani f. sp. pisi. 1987.
Find full textBook chapters on the topic "Colletotrichum"
1
Dickman, Martin B. "Colletotrichum." In Fungal Pathology, 127–47. Dordrecht: Springer Netherlands, 2000. http://dx.doi.org/10.1007/978-94-015-9546-9_5.
Full text
2
Crouch, JoAnne, Richard O’Connell, Pamela Gan, Ester Buiate, Maria F. Torres, Lisa Beirn, Ken Shirasu, and Lisa Vaillancourt. "The Genomics of Colletotrichum." In Genomics of Plant-Associated Fungi: Monocot Pathogens, 69–102. Berlin, Heidelberg: Springer Berlin Heidelberg, 2014. http://dx.doi.org/10.1007/978-3-662-44053-7_3.
Full text
3
O’Connell, Richard J., and John A. Bailey. "Hemibiotrophy in Colletotrichum lindemuthianum." In Electron Microscopy of Plant Pathogens, 211–22. Berlin, Heidelberg: Springer Berlin Heidelberg, 1991. http://dx.doi.org/10.1007/978-3-642-75818-8_16.
Full text
4
TeBeest, D. O., J. C. Correll, and G. J. Weidemann. "Speciation and Population Biology in Colletotrichum." In Plant Relationships Part B, 157–68. Berlin, Heidelberg: Springer Berlin Heidelberg, 1997. http://dx.doi.org/10.1007/978-3-642-60647-2_10.
Full text
5
Hiruma, Kei, and Yusuke Saijo. "Methods for Long-Term Stable Storage of Colletotrichum Species." In Methods in Molecular Biology, 309–12. New York, NY: Springer New York, 2016. http://dx.doi.org/10.1007/978-1-4939-3356-3_23.
Full text
6
Hiruma, Kei, and Yusuke Saijo. "Plant Inoculation with the Fungal Leaf Pathogen Colletotrichum higginsianum." In Methods in Molecular Biology, 313–18. New York, NY: Springer New York, 2016. http://dx.doi.org/10.1007/978-1-4939-3356-3_24.
Full text
7
Monte, Enrique, Rosa Hermosa, María del Mar Jiménez-Gasco, and Rafael M. Jiménez-Díaz. "Are species concepts outdated for fungi? Intraspecific variation in plant-pathogenic fungi illustrates the need for subspecific categorization." In Trends in the systematics of bacteria and fungi, 301–19. Wallingford: CABI, 2021. http://dx.doi.org/10.1079/9781789244984.0301.
Full textAbstract:
Abstract Precise naming of a species is very important for phytopathogenic fungi because names may carry key information for the management of the fungal diseases. Naming fungal species based on morphological traits or biological properties is outdated and unreliable. This chapter provides the classification of some plant pathogenic fungi including Rhizoctonia solani, Colletotrichum, Fusarium oxysporum, and Verticillum based on morphological, pathogenicity, molecular and phylogenetic analysis. Debate on species identification is no longer a question of being in favour of 'splitters' rather than of 'lumpers', but defining phytopathogenic species is particularly complicated and requires further consideration of subspecific categorizations.
8
Vasić, Tanja, Jasmina Radović, Snežana Andjelković, Bojan Andjelković, Sanja Živković, Dragoslav Đokić, and Zoran Lugić. "Assessment of Susceptibility of Different Alfalfa Genotypes to Colletotrichum destructivum." In Quantitative Traits Breeding for Multifunctional Grasslands and Turf, 103–8. Dordrecht: Springer Netherlands, 2014. http://dx.doi.org/10.1007/978-94-017-9044-4_14.
Full text
9
Rai, Mahendra, Gauravi Agarkar, and Dnyaneshwar Rathod. "Multiple Applications of Endophytic Colletotrichum Species Occurring in Medicinal Plants." In Novel Plant Bioresources, 227–36. Chichester, UK: John Wiley & Sons, Ltd, 2014. http://dx.doi.org/10.1002/9781118460566.ch18.
Full text
10
Puripunyavanich, Vichai, Penjan Sutthanukul, Rakchai Kurubunjerdjit, and Prartana Kewsuwan. "Anthracnose resistance induction in chilli by electron beam irradiation." In Mutation breeding, genetic diversity and crop adaptation to climate change, 172–77. Wallingford: CABI, 2021. http://dx.doi.org/10.1079/9781789249095.0017.
Full textAbstract:
Abstract Chilli seeds were irradiated with 0.3 kGy at 8 MeV from the electron beam source at the Thailand Institute of Nuclear Technology. M1 seeds were planted in Sukhothai Horticultural Research Centre and from these the line CA1131 was selected as suitable for growing in this area. Thirty anthracnose-resistant M2 chilli plants were selected after the appearance of anthracnose disease, caused by Colletotrichum gloeosporioides, in Sukhothai province from an initial M1 mutant population of 123 individuals. However, chilli fruits from 17 plants showed resistance after laboratory inoculation experiments. These chilli plants were crossed with the 'Hoarue Huaisai', which has large fruit. The F2 progenies were selected for anthracnose resistance and large fruits. Two hybrids with anthracnose resistance (derived from the cross CA1131 × 'Hoarue Huaisai') were identified and used for field anthracnose resistance tests in 2015. Resistant plants with large fruits were discovered in the F3 inbred line no. 6-1-4 grown during the dry season, but this line did not show strong disease resistance in the rainy season. A further 63 F5 inbred lines showed anthracnose resistance in the field experiment. Five samples per line of each of the 63 inbred lines were inoculated in the laboratory at Thailand Institute of Nuclear Technology. The fruits of inbred line no. 32-2-8 showed complete anthracnose resistance and seven lines were segregating as resistant. All eight of these lines are being used in the ongoing chilli project aimed at developing chilli varieties with broad resistance to anthracnose caused by three Colletotrichum species that are prevalent in Thailand.
Conference papers on the topic "Colletotrichum"
1
Цветкова, Ю. В., А. В. Черноброва, and А. В. Камченков. "Colletotrichum nymphaeae - возбудитель антракноза сельскохозяйственных культур." In III молодёжная всероссийская научная конференция с международным участием «PLANTAE & FUNGI». Botanical Garden-Institute FEB RAS, 2023. http://dx.doi.org/10.17581/paf2023.64.
Full textAbstract:
Colletotrichum nymphaeae (Pass.) Aa (Ascomycota, Sordariomycetes, Glomerellaceae) широко распространенный гриб, который встречается как паразит растений, так и эндофит и энтомопаразит. В Бразилии C. nymphaeae на цитрусовых широко известен как гриб salmão (лосось) из-за характерного лососево-розового цвета конидиальных масс, проявляющихся на зараженных цитрусовых червецах (Praelongorthezia praelonga (Hemiptera: Ortheziidae)) [9]. После дифференциации видов комплекса Colletotrichum acutatum, было показано, что C. nymphaeae является наиболее вредоносным для растений земляники по сравнению с другими представителями комплекса (С. fioriniae, C. godetiae, C. acutatum) [1, 5]. В последующие годы данный гриб был выявлен как возбудитель антракноза на оливах (Olea europaea), где вызывал ожог цветков, преждевременное опадение оливок, снижение качества масла; на миндале (Prunus dulcis) (потеря товарных качеств плодов, некроз побегов и плодоножек); на персиках (Prunus persica), яблоне (Malus domestica) и др. плодовых и ягодных культурах.[1,3,5,7,8] Было показано, что данный патоген может также вызывать загнивание плодов томатов в послеуборочный период. [2]. Типовые изоляты выделены из растений кувшинки белой (Nymphaea alba) [10]. В мире также обнаружен на перце (Capsicum annum), ветренице (Anemone spp.), протее (Protea repens) и др. [1]. В ходе исследования было показано, что в России C. nymphaeae широко распространен на растениях земляники садовой. Единично выделен из семян сои Амурской области, а также из семян подсолнечника, предназначенных для импорта в РФ. Для выделения грибов из растительных образцов использовали метод влажной камеры и агаризованной питательной среды. Для идентификации полученных изолятов проводили микроскопию и морфометрию ключевых признаков (ацервул, конидий); классическую ПЦР с универсальными праймерами с последующим определением нуклеотидных последовательностей. Для работы использовали следующие прймеры: ITS 4 (TCCTCCGCTTATTGATATGC)/ITS 5 (GGAAGTAAAAGTCGTAACAAGG) (участок внутреннего транскрибируемого спейсера, ITS); GDF (GCCGTCAACGACCCCTTCATTGA)/GDR (GGGTGGAGTCGTACTTGAGCATGT) (участок гена глицеральдегид-3-фосфат дегидрогеназы, GAPDH); TUB2Fd (GTBCACCTYCARACCGGYCARTG)/TUB4Rd (CCRGAYTGRCCRAARACRAAGTTGTC) (участок гена бета тубулина, TUB2). Изоляты, выделенные из растений земляники, характеризовались двумя основными морфотипами, а также отличалась по участку гена GAPDH. Группа изолятов с регионами происхождения Нидерланды, Сербия, Россия, отличалась от группы изолятов итальянского происхождения двумя точечными заменами. По маркерному, для данного вида участку гена бета тубулина, изоляты, выделенные из землянки, сои, подсолнечника, не отличались. При обнаружении семян подсолнечника, пораженных антракнозом, наблюдалось ингибирование прорастания семян и загнивание проростков. На семенах было развито типичное оранжевое спороношение, характерное для грибов р. Colletotrichum. После выделения изолята в чистую культуру была подготовлена суспензия спор концентрацией 5,5 *106 спор гриба/мл для проведения искусственного заражения растений и семян подсолнечника и растений земляники. При проведении искусственного заражения растений подсолнечника на стадии 6–8 настоящих листьев методами укола и опрыскивания, развития болезни отмечено не было. При параллельной обработке растений земляники были получены симптомы антракноза (некрозы на листьях, язвы на черешках листьев), выделен целевой патоген, что было подтверждено микроскопией и морфометрией, и определением нуклеотидных последовательностей. При заражении семян подсолнечника были получены различные результаты при различной экспозиции. При замачивании семян в суспензии спор на сутки прорастание семян отсутствовало. При экспозиции 1 час в варианте с обработкой проросло на 14% меньше семян, чем в контроле. При этом дальнейшее развитие проростков ингибировалось: на семядолях образовывались бурые пятна, иногда полностью покрывавшие проросток, корни загнивали, корневые волоски отсутствовали; при микроскопии было обнаружено прорастание спор, развитие гиф гриба. Через две недели проявлялось типичное спороношение на проростках. По литературным данным, это третье обнаружение патогенных грибов Colletotrichum acutatum species complex, на проростках подсолнечника [4, 6]. При проведении теста на патогенность на семенах сои изолятом, выделенным из семян сои, проявлялись типичные для данного вида признаки: быстрорастущий серый воздушный мицелий и оранжевая масса спор, наблюдалось образование аппрессориев, свидетельствующих о патогенном процессе. Несмотря на сообщения об обнаружении C. nymphaeae на растениях сем Fabaceae, это первое обнаружение данного вида на семенах сои. Таким образом, C. nymphaeae получил сравнительно широкое распространение во всем мире на различных группах растений-хозяев. Вредоносность патогена может определяться стадией заражения, в то время как для определенного круга растений хозяев данный гриб может быть использован как потенциальный биоагент против насекомых-вредителей.
2
Hauer, Karina Eva, and Maria Müller. "Colletotrichum coccodes ' the covert enemy of potatoes?" In VII South-Eastern Europe Syposium on Vegetables & Potatoes. University of Maribor Press, 2017. http://dx.doi.org/10.18690/978-961-286-045-5.65.
Full text
3
Liu, Junang, Gouying Zhou, Aixian Jin, and Yuanhao He. "Antifungal Activity of Chitosan Against Colletotrichum Gloeosporioides." In 2009 3rd International Conference on Bioinformatics and Biomedical Engineering (iCBBE 2009). IEEE, 2009. http://dx.doi.org/10.1109/icbbe.2009.5162373.
Full text
4
He, Chaojun, Jingyan Niu, Yumin Yang, and Zengbing Liu. "Novel Biotransformation of Digoxigenin by Colletotrichum lini AS3. 4486." In First International Conference on Information Sciences, Machinery, Materials and Energy. Paris, France: Atlantis Press, 2015. http://dx.doi.org/10.2991/icismme-15.2015.91.
Full text
5
"Genome assembly of Colletotrichum lini from long Nanopore reads." In Bioinformatics of Genome Regulation and Structure/Systems Biology (BGRS/SB-2022) :. Institute of Cytology and Genetics, the Siberian Branch of the Russian Academy of Sciences, 2022. http://dx.doi.org/10.18699/sbb-2022-026.
Full text
6
"Genome assembly of Colletotrichum lini from long Nanopore reads." In Bioinformatics of Genome Regulation and Structure/Systems Biology (BGRS/SB-2022) :. Institute of Cytology and Genetics, the Siberian Branch of the Russian Academy of Sciences, 2022. http://dx.doi.org/10.18699/bgrs/sb-2022-026.
Full text
7
Savoskina, O. A., S. I. Chebanenko, and Z. K. Kurbanova. "Micoherbicides and growth regulators in the cultivation of flax." In Растениеводство и луговодство. Тимирязевская сельскохозяйственная академия, 2020. http://dx.doi.org/10.26897/978-5-9675-1762-4-2020-149.
Full textAbstract:
Develop a biological preparation (a mixture of inoculum Urocystis agropyri /guack Agropyrum repens/ and Puccinia suaveollens /fragrant rust Cirsium setosum/) reduces the contamination of crops named weeds/. Growth regulators - Artafit and Lostor - effective against bacterial blight, Colletotrichum lini, Ozonium vinogradovi. It was shown that the and boost yields of flax.
8
Serra, Ilka Márcia Ribeiro de Souza, Karina Cristina Silva Braga, Lígia Tchaicka, and Thiago Anchieta de Melo. "Molecular differentiation of colletotrichum spp. associated with tropical fruit anthracnose." In INTERNATIONAL CONFERENCE OF COMPUTATIONAL METHODS IN SCIENCES AND ENGINEERING 2018 (ICCMSE 2018). Author(s), 2018. http://dx.doi.org/10.1063/1.5079163.
Full text
9
Yusoff, Nor Hanis Aifaa, Siti Aisyah Abdullah, Zaulia Othman, and Zamri Zainal. "In Vitro antifungal activity of essential oils against Colletotrichum gloeosporioides." In THE 2017 UKM FST POSTGRADUATE COLLOQUIUM: Proceedings of the University Kebangsaan Malaysia, Faculty of Science and Technology 2017 Postgraduate Colloquium. Author(s), 2018. http://dx.doi.org/10.1063/1.5027978.
Full text
10
Fadhilah, Q. G., I. Santoso, A. E. Maryanto, and Yasman. "Antifungal potential from Bacillus sp. against phytopathogenic fungus Colletotrichum sp." In PROCEEDINGS OF THE 6TH INTERNATIONAL SYMPOSIUM ON CURRENT PROGRESS IN MATHEMATICS AND SCIENCES 2020 (ISCPMS 2020). AIP Publishing, 2021. http://dx.doi.org/10.1063/5.0058769.
Full textReports on the topic "Colletotrichum"
1
Prusky, Dov, Noel T. Keen, and Benyamin Jacoby. Regulation of Colletotrichum Gloeosporiodes Latency in Avocado. United States Department of Agriculture, January 1985. http://dx.doi.org/10.32747/1985.7561068.bard.
Full text
2
Freeman, Stanley, and Daniel Legard. Epidemiology and Etiology of Colletotrichum Species Causing Strawberry Diseases. United States Department of Agriculture, September 2001. http://dx.doi.org/10.32747/2001.7695845.bard.
Full textAbstract:
Diseases caused by Colletotrichum spp. are one of the most important limitations on international strawberry production, affecting all vegetative and fruiting parts of the plant. From 1995 to 1997, C. acutatum infections reached epidemic levels in Israeli strawberry nurseries, causing extensive loss of transplants in fruit-bearing fields and additional reductions in yield. Although C. acutatum also occurs on strawberry in Florida, recent crown rot epidemics have been primarily caused by C. gloeosporioides. Little is known about the basic epidemiology of these important diseases on strawberry. The source of initial inoculum for epidemics in Israel, Florida (other US states including California) and the rest of the world is not well understood. Subspecies relationships between Colletotrichum isolates that cause the different diseases on strawberry (i.e. attack different tissues) are also not well understood. Objectives of this proposal were to detennine the potential of infested soil, strawberry debris and other hosts as sources of primary inoculum for strawberry diseases caused by Colletotrichum spp. in Israel and Florida. In addition, traditional (ie. morphological characteristics, benomyl sensitivity, vegetative compatibility grouping) and DNA based methods were used to investigate the etiology of these diseases in order to resolve epidemiologically important subspecies variation. In Israel it was found that C. gloeosporioides and C. acutatum infecting strawberry could remain viable in sterilized soil for up to one year and in methyl-bromide fumigated soil for up to 4 months; inoculum in mummified fruit remained viable for at least 5 months under field conditions whereas that in infected crowns was not recovered. Therefore, the contribution of these inocula to disease epidemics should be considered. The host range and specificity of C. acutatum from strawberry was examined on pepper, eggplant, tomato, bean and strawberry under greenhouse conditions. The fungus was recovered from all plant species over a three-month period but caused disease symptoms only on strawberry. C. acutatum was also isolated from healthy looking, asymptomatic plants of the weed species, Vicia and Conyza, growing in infected strawberry fruiting fields. Isolates of C. acutatum originating from strawberry and anemone infected both plant species in artificial inoculations. The habitation of a large number of plant species including weeds by C. acutatum suggests that although it causes disease only on strawberry and anemone in Israel, these plants may serve as a potential inoculum source for strawberry infection and pennit survival of the pathogen between seasons. In Florida, isolates of Colletotrichum spp. from diseased strawberry fruit and crowns were evaluated to detennine their etiology and the genetic diversity of the pathogens. Only C. acutatum was recovered from fruit and C. gloeosporioides were the main species recovered from crowns. These isolates were evaluated at 40 putative genetic loci using random amplified polymorphic DNA (RAPD). Genetic analysis of RAPD markers revealed that the level of linkage disequilibrium among polymorphic loci in C. gloeosporioides suggested that they were a sexually reproducing population. Under field conditions in Florida, it was detennined that C. gloeosporioides in buried crowns survived
3
Guevara, Yudy Alejandra, and Anibal Tapiero. Diversidad intra-específica de las poblaciones de Colletotrichum spp. afectando caucho en Colombia. Corporación Colombiana de Investigación Agropecuaria - AGROSAVIA, 2016. http://dx.doi.org/10.21930/agrosavia.informe.2016.5.
Full textAbstract:
El caucho (Hevea brasiliensis) está siendo afectado por diferentes especies de Colletotrichum spp. en Colombia. La incidencia, generalizada por alrededor de las 65.000 ha actualmente sembradas, se observa afectando plantaciones particularmente en la Orinoquia, con aproximadamente 55% del área total de caucho en Colombia (MINISTERIO de AGRICULTURA, 2016). Colletotrichum spp. causa síntomas de antracnosis en hoja, muerte descendente y caída de la hoja por Colletotrichum (CLF), incidiendo en la pérdida de área foliar e incrementando los costos de manejo del cultivo. Colateralmente, CLF ha modificado la parsimonia del proceso anual de defoliación-refoliación anual, provocando la exposición a infecciones por Pseudocercospora ulei, agente causal del Mal Suramericano de las Hojas (SALB) en áreas de escape, durante las épocas cuando predominan condiciones de humedad relativa y pluviosidad alta. Las citadas circunstancias plantean la necesidad de determinar la extensión de la diversidad de especies de Colletotrichum spp. afectando los cultivos de caucho en Colombia y establecer las implicaciones epidemiológicas que permitan proponer programas de manejo integrado para reducir los riesgos de pérdida económica
4
Rodriguez, Russell, and Stanley Freeman. Characterization of fungal symbiotic lifestyle expression in Colletotrichum and generating non-pathogenic mutants that confer disease resistance, drought tolerance, and growth enhancement to plant hosts. United States Department of Agriculture, February 2005. http://dx.doi.org/10.32747/2005.7587215.bard.
Full textAbstract:
Fungal plant pathogens are responsible for extensive annual crop and revenue losses throughout the world. To better understand why fungi cause diseases, we performed gene-disruption mutagenesis on several pathogenic Colletotrichum species and demonstrated that pathogenic isolates can be converted to symbionts (mutualism, commensalism, parasitism) expressing non-pathogenic lifestyles. The objectives of this proposal were to: 1- generate crop-specific mutants by gene disruption that express mutualistic lifestyles, 2- assess the ability of the mutualists to confer disease resistance, drought tolerance, and growth enhancement to host plants, 3- compare fslm1 sequences and their genomic locations in the different species, and 4- document the colonization process of each Colletotrichum species.It was demonstrated that wildtype pathogenic Colletotrichum isolates, can be converted by mutation from expressing a pathogenic lifestyle to symbionts expressing non-pathogenic lifestyles. In the US, mutants of Colletotrichum were isolated by homologous gene disruption using a vector containing a disrupted FSlm1 sequence while in Israel, C. acutatum mutants were selected by restriction enzyme mediated integration (REMI) transformation. One group (US) of non-pathogenic mutants conferred disease protection against pathogenic species of Colletotrichum, Fusarium, and Phytophthora; drought tolerance; and growth enhancement to host plants. These mutants were defined as mutualists and disease resistance correlated to a decrease in the time required for hosts to activate defense systems when exposed to virulent fungi. The second group (Israel) of non-pathogenic mutants did not confer disease resistance and were classified as commensals. In addition, we demonstrated that wildtype pathogenic Colletotrichum species can express non-pathogenic lifestyles, including mutualism, on plants they colonize asymptomatically. The expected long term contribution of this research to agriculture in the US and Israel is threefold. Host-specific mutualists will be utilized in the various crops to confer (1) disease resistance to reduce dependence on chemical fungicides; (2) drought tolerance to reduce water consumption for irrigation; (3) growth enhancement to increase yields.
5
Xu, Jin-Rong, and Amir Sharon. Comparative studies of fungal pathogeneses in two hemibiotrophs: Magnaporthe grisea and Colletotrichum gloeosporioides. United States Department of Agriculture, May 2008. http://dx.doi.org/10.32747/2008.7695585.bard.
Full textAbstract:
Plant pathogenic fungi have various life styles and different plant infection strategies. Hemibiotrophs like Magnaporthe grisea and Colletotrichum species develop specialized structures during plant infection. The goal of this study was to identify, characterize, and compare genes required for plant infection in M. grisea and C. gloeosporioides. Specific objectives are to: 1) further characterize genes identified in the preliminary studies of C. gloeosporioides and M. grisea;2) identify and characterize additional fungal genes tagged by GFP; and 3) identify in planta growth and appressorium-specific genes by subtractive hybridization and transcript profiling by the LongSAGE method. In this study, the PI and Co-PI collaborated closely on studies in M. grisea and C. gloeosporioides. In M. grisea, REMI and ATMT were used to transform the wildtype with promoter-less EGFP constructs. A total of 28 mutants defective in different plant infection processes or expressing EGFP during plant infection were identified. Genes disrupted in five selected mutants have been identified, including MG03295 that encodes a putative Rho GTPase. In transformant L1320, the transforming vector was inserted in the MIRI gene that encodes a nuclear protein. The expression of MIRI was highly induced during infection. Deletion and site-directed mutagenesis analyses were used to identify the promoter regions and elements that were essential for induced in planta expression of MIRI. This was the first detailed characterization of the promoter of an in planta gene in M. grisea and the MIRI promoter can be used to monitor infectious growth. In addition, the Agilent whole-genome array of M. grisea was used for microarray analyses with RNA samples from appressoria formed by the wild-type shain and the pmkl and mstl2 mutants. Over 200 genes were downregulated in the mst I 2 and pmkl mutants. Some of them are putative transcription factors that may regulate appressorium formation and infectious hyphal growth. In C. gloeosporioides, various REMI mutants showing different pathogenic behavior were identified and characterized. Mutants N3736 had a single insertion and was hyper-virulent. The gene disrupted in mutant3736 (named CgFMOI) encodes a FAD-dependent monooxygenase. Expression analyses linked the expression of the CgFMOI gene with the necrotrophic phase of fungal infection, and also suggest that expression of CgFMOl is unnecessary for the first stages of infection and for biotrophy establishment. All CgFMOl-silenced mutants had reduced virulence. In REMI mutant N159, the tagged gene encodes a putative copper transporter that is homologue of S. cerevisiae CTR2. In yeast, Ctr2 is a vacuolar transporter for moving copper from the vacuole to the cytoplasm. The gene was therefore termed CgCTR2. In addition to characterization of CgCTR2, we also conducted comparative analyses in M. grisea. The M. grisea CgCTR-2 homolog was isolated, knockout strains were generated and characterized and the M. grisea was used to complement the Nl 59 C. gloeosporioides mutant. Overall, we have accomplished most of proposed experiments and are in the process of organizing and publishing other data generated in this project. For objective 3, we used the microarray analysis approach. Several genes identified in this study are novel fungal virulence factors. They have the potential to be used as targets for developing more specific or effective fungicides. In the long run, comparative studies of fungal genes, such as our CgCTR2 work, may lead to better disease control strategies.
6
Roberta de Oliveira Moraes, Cássia, Brunno de Oliveira Almeida, Cíntia dos Santos Bento, and Luciano Menini. Métodos de manejo agroecológicos para o controle da antracnose (Colletotrichum spp.) em mamoeiro. Edifes Acadêmico, 2023. http://dx.doi.org/10.36524/9788582636633.
Full text
7
Prusky, Dov B., Tesfaye Mengiste, and Robert Fluhr. Mechanisms activated by fungal-based host pH modulators during quiescent infections and active postharvest disease development. United States Department of Agriculture, 2011. http://dx.doi.org/10.32747/2011.7597911.bard.
Full textAbstract:
This project aims were to provide new insights on the mechanisms activated during alkalinization and acidification of the infection court by Colletotrichum and Botrytis spp. respectively that will lead to quiescent infection-development on tomato fruits. We have chosen these pathogens due to their contrasting life style of alkalinization and acidification, respectively. We will study the roles of these fungal-based host-pH modulators in modulating host gene expression during quiescent infection development and compare these roles with those governing active colonization as a basis for developing novel strategies for control of postharvest diseases. The aims will be pursued through: Characterization of the effects of pH modulation on fungal-plant cell-cell signaling and on the fungal and plant transcriptome during the initial stages of fungal quiescence. The unpublished material that is presented as short abstract is considered one of the key point modulating Characterization of expression profiles of tomato fruits affected by acidifying and alkalinizing pathogensduring the transformation of quiescent to active infections by Colletotrichum and Botrytis. Functional analysis of selected genes involved in signaling pathways that affects the quiescent and active infections of Colletotrichum and Botrytis.
8
Freeman, Stanley, and Russell J. Rodriguez. The Interaction Between Nonpathogenic Mutants of Colletotrichum and Fusarium, and the Plant Host Defense System. United States Department of Agriculture, September 2000. http://dx.doi.org/10.32747/2000.7573069.bard.
Full textAbstract:
The intent of this proposal was to study the interaction between nonpathogenic mutants of Colletotrichum magna and Fusarium oxysporum, and the cucurbit host defense system. We had shown previously that a nonpathogenic endophytic mutant path- 1 of C. magna, caused no visible disease symptoms but protected watermelon seedlings from disease caused by the wildtype isolate and F. o. niveum. Objectives were: 1) Determine the microscopic, biochemical and molecular genetic interaction between "protected" (path- 1 colonized) cucurbit hosts and wildtype isolates of C. magna; 2) Isolate non-pathogenic mutants of F.o. melonis and test feasibility for protecting plants against fungal diseases. We found that path-1 caused no visible disease symptoms in cucurbit seedlings but conferred disease resistance against pathogenic isolates of C. magna, C. orbiculare, and F. oxysporum. Disease resistance conferred by path-1 correlated to a decrease in the time of activation of host defense systems after exposure of path-1 colonized plants to virulent pathogens. This was determined by monitoring the biochemical activity of PAL and peroxidase, and the deposition of lignin. It appears that path-1-conferred disease resistance is a multigenic phenomenon which should be more difficult for pathogen to overcome than single gene conferred resistance. Based on the benefits conferred by path-1, we have defined this mutant as expressing a mutualistic lifestyle. REMI (restriction enzyme-mediated integration) nonpathogenic mutants were also isolated using pHA1.3 plasmid linearized with Hind III and transformed into wildtype C. magna. The integrated vector and flanking genomic DNA sequences in REMI mutant R1 was re-isolated and cloned resulting in a product of approximately 11 kb designated pGMR1. Transformations of wildtype C. magna with pGMR1 resulted in the same non-pathogenic phenotype. A nonpathogenic mutant of F.o. melonis (pathogenic to melon) was isolated that colonized melon plants but elicited no disease symptoms in seedlings and conferred 25 - 50% disease protection against the virulent wildtype isolate. Subsequently, nonpathogenic mutant isolates of F.o. niveum (pathogenic to watermelon) were also isolated. Their protection capacity against the respective wildtype parent is currently under investigation. This research has provided information toward a better understanding of host-parasite interactions; specifically, endophytes, pathogens and their hosts. It will also allow us to assess the potential for utilizing nonpathogenic mutants as biological control agents against fungal pathogens and isolating molecular genetic factors of pathogenicity in Fusarium.
9
Rodriguez, Russell J., and Stanley Freeman. Gene Expression Patterns in Plants Colonized with Pathogenic and Non-pathogenic Gene Disruption Mutants of Colletotrichum. United States Department of Agriculture, February 2009. http://dx.doi.org/10.32747/2009.7592112.bard.
Full textAbstract:
Fungal plant pathogens are responsible for extensive annual crop and revenue losses throughout the world. To better understand why fungi cause diseases, we performed gene-disruption mutagenesis on several pathogenic Colletotrichum species and demonstrated that pathogenic isolates can be converted to symbionts expressing non-pathogenic lifestyles. One group of nonpathogenic mutants confer disease protection against pathogenic species of Col!etotrichum, Fusarium and Phytophthora; drought tolerance; and growth enhancement to host plants. These mutants have been defined as mutualists and disease resistance correlates to a decrease in the time required for hosts to activate defense systems when exposed to virulent fungi. A second group of non-pathogenic mutants did not confer disease resistance and were classified as commensals. In addition, we have demonstrated that wildtype pathogenic Colletotrichum species can express non-pathogenic lifestyles, including mutualism, on plants they colonize asymptomatically. We have been using wildtype and isogenic gene disruption mutants to characterize gene expression patterns in plants colonized with a pathogen, mutualist or commensal. The US group is contrasting genes expressed during colonization by mutuahstic and commensal mutants of C. magna and a pathogenic wildtype C. coccodes on tomato. The Israeli group is characterizing genes expressed during asymptomatic colonization of tomato by wildtype C. acutatum and a non-pathogenic mutant.To accomplish this we have been utilizing suppressive subtraction hybridization, microarray and sequencing strategies. The expected contribution of this research to agriculture in the US and Israel is: 1) understanding how pathogens colonize certain hosts asymptomatic ally will shed light on the ecology of plant pathogens which has been described as a fundamental deficiency in plant pathology; 2) identifying genes involved in symbiotically conferred disease resistance will help explain why and how pathogens cause disease, and may identify new candidate targets for developing genetically modified disease resistant crop plants.
10
C. Saulle, Carolina, Alexandre Claus, Letícia De A. Sales, Alan G. Gonçalves, Diogo R. B. Ducatti, Miguel D. Noseda, and Louise L. May De Mio. Photoinactivation of Colletotrichum truncatum, Corynespora cassiicola, Sclerotinia sclerotiorum and Rhizoctonia solani in soybean seeds by cationic porphyrins. Peeref, June 2023. http://dx.doi.org/10.54985/peeref.2306p7813370.
Full text