Log in

Relevant bibliographies by topics / Constitution Federal Democratic Republic of Ethiopia / Journal articles

To see the other types of publications on this topic, follow the link: Constitution Federal Democratic Republic of Ethiopia.

Journal articles on the topic 'Constitution Federal Democratic Republic of Ethiopia'

Author: Grafiati

Published: 4 June 2021

Last updated: 1 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Constitution Federal Democratic Republic of Ethiopia.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Regassa, Tsegaye. "The making and legitimacy of the Ethiopian constitution: towards bridging the gap between constitutional design and constitutional practice." Afrika Focus 23, no. 1 (February 25, 2010): 85–118. http://dx.doi.org/10.1163/2031356x-02301007.

Full text

Abstract:

This article describes the making of the 1995 constitution of the Federal Democratic Republic of Ethiopia (FORE) and analyzes its implications for legitimacy. It contends that legitimacy of the constitution, which fosters fidelity to it, can –as one among other factors– help bridge the gap between constitutional design and constitutional practice. By making a process-content-context analysis of the constitution, it argues that the Ethiopian constitution which had a weak original legitimacy, can earn a derivative legitimacy through aggressive implementation. Aggressive implementation, it is maintained, demands fidelity to the constitution. Fidelity and other components of a redemptive constitutional practice (such as creative constitutional interpretation, constitutionally informed legislation, positive constitutional amendment, and constitutionally responsible voting) help deal with the perennial question of how to bridge the gap between constitutional design and constitutional practice in Ethiopia and beyond.

APA, Harvard, Vancouver, ISO, and other styles

2

Beru, Tsegaye. "An Outline for the Study of Ethiopian Constitutional Law." International Journal of Legal Information 43, no. 2_3 (2015): 234–312. http://dx.doi.org/10.1017/s0731126500012531.

Full text

Abstract:

This outline is prepared based on the 1995 Constitution of the Federal Democratic Republic of Ethiopia (“The 1995 Constitution”). It is important to acknowledge at the outset that the 1995 Constitution cannot be studied in isolation. Like its forerunners, it is not distinctively Ethiopian, save for the customary and religious laws that it recognized. Ethiopian constitutions, both past and present, have been derived, in part, from foreign constitutions including constitutions from western and eastern countries, including Japan. Although its immediate sources can be traced back to the Charter of the Transitional Government of 1991, this 1995 Constitution was built upon the constitutions that preceded it, the laws that have been promulgated since the 1930s, and the religious and customary laws that predated it.

APA, Harvard, Vancouver, ISO, and other styles

3

Shambel, Teshale. "The Constitutional Hurdles to Exercise Secession Right and Arguments on its Inclusion in the Ethiopian Constitution." Journal of Legal Studies 26, no. 40 (December 1, 2020): 37–47. http://dx.doi.org/10.2478/jles-2020-0010.

Full text

Abstract:

AbstractThe right to self-determination is one of the human rights enshrined under the Ethiopian constitution. It is also one of the rights mentioned under ICCPR and ICESCR as well as the constitutions of different countries. Being unique to many other human rights instruments and constitutions in the world, the Ethiopian constitution includes the unconditional right to secession as a part of self-determination for every one of the ethnic groups (nations, nationalities, and people) in the country. As argued among many scholars, the inclusion of unconditional secession as a part of self-determination right in the Ethiopian constitution was based on the wrong narrative that nations, nationalities and people in the country were oppressed. Thus, it is a point of political debate between elites and became the major cause of widening the divergence among views of different political parties in the country. Of course, within the constitution, there are hurdles that can potentially deny exercising of this right. Therefore, this study qualitatively analyses the impracticability of secession and unacceptability of narratives to its inclusion in the constitution of the federal democratic republic of Ethiopia.

APA, Harvard, Vancouver, ISO, and other styles

4

Hailu, Yemserach Legesse. "Language Law and Policy of the Federal Government of Ethiopia: Implications for Fair Trial and the Rights of Non-Amharic Language Speakers Accused." Acta Humana 9, no. 1 (March 31, 2021): 59–76. http://dx.doi.org/10.32566/ah.2021.1.4.

Full text

Abstract:

Ethiopia is a multilingual country with a federal form of state structure. The 1995 Constitution of the Federal Democratic Republic of Ethiopia (FDRE Constitution) gave equal recognition for all Ethiopian languages, but has chosen Amharic to become the working language of the Federal Government. In order to accommodate the needs of non-Amharic speakers in the provision of public services, the Constitution and other laws such as the Criminal Procedure Code, require the use of interpreters. Particularly in criminal proceedings, non-Amharic speakers are entitled to be assisted with a ‘qualified’ interpreter to meaningfully participate in the cases. In practice, it is observed that accused people who do not speak the working language of the federal government are unable to effectively understand or get prompt and detailed information regarding the nature and effect of the case brought against them. Even if they know the case, they are not able to effectively explain their defences to the court or associated bodies, and thereby defend their rights. This study reveals that non-Amharic speakers are not effectively served according to the legal standards. This problem subsists mainly due to the absence or limited number of interpreters, as well as the use of untrained interpreters. Despite some efforts to address the problem, the federal government has not yet laid down any formal mechanism by which people with limited and/or no Amharic language proficiency are properly served in criminal proceedings both before and during trial. This study proposes the federal government to establish court interpreter training institutions and to standardise court interpretation by allocating the necessary budget; lay down a formal mechanism such as enacting detailed laws and working manuals for assigning interpreters; providing other local languages the status of working language; consulting interpretation technologies and working in collaboration with different stakeholders.

APA, Harvard, Vancouver, ISO, and other styles

5

Lyons, Terrence. "Closing the Transition: the May 1995 Elections in Ethiopia." Journal of Modern African Studies 34, no. 1 (March 1996): 121–42. http://dx.doi.org/10.1017/s0022278x00055233.

Full text

Abstract:

The Ethiopian transition, that began with the overthrow of military dictator Mengistu Haile Mariam in May 1991, formally ended with the swearing in of the newly elected Government of the Federal Republic of Ethiopia in August 1995. The intervening four years were a contentious time of clashes among rival political forces to determine the rules under which the transition would be conducted and hence which forces would be favoured. The first act of the Ethiopian Peoples Revolutionary Democratic Front (EPRDF) after deposing Mengistu was to convene a National Conference and establish a Council of Representatives that initially included a wide array of political groups. The EPRDF led throughout this transitional period and capitalised on its commanding position to consolidate its power. The party dominated the political landscape by virtue of its military power, effective organisation and leadership, and control of the agenda and rules of competition. It structured the transition around new ethnically defined regions, a constitution that emphasised self-determination, and a series of largely uncontested elections.

APA, Harvard, Vancouver, ISO, and other styles

6

Berega, Yirgalem Germu. "Decisions of the Ethiopian Federal Supreme Court Cassation Division: Imprescriptible Invalidation of Contract of Land Sale." International Journal of Law and Public Administration 1, no. 2 (December 21, 2018): 58. http://dx.doi.org/10.11114/ijlpa.v1i2.3774.

Full text

Abstract:

In many parts of Ethiopia, land is the base for economic resources and prestige, as provided under the Constitution of Federal Democratic Republic of Ethiopia this valuable asset is exclusively vested in the State and the peoples of Ethiopia. Land is a common property of the Nations, Nationalities and Peoples of Ethiopia and shall not be subject to sale or to other means of exchange. Concerning contractual agreement, sale of land is made imprescriptible by the decision of the Federal Supreme Court Cassation Division. The problem of this decision is that the civil code of the state provides ten years of period of limitation for invalidation of contract, made no clear exception for that matter, and the Cassation Division is empowered to only interpret the law of the state, not making a new law. Based on the problem narrated, the following questions are posed: whether the decision of the division falls under the ambit of its mandate or not and what is the practical value of the ruling? The questions are addressed via consultation of legal instruments of the state, the decisions of the cassation division and scholarly materials on the area.

APA, Harvard, Vancouver, ISO, and other styles

7

Wolff, H. Ekkehard, Sileshi Berhanu, and Getinet Fulea. "On Visibility and Legitimisation of Languages: The ‘Linguistic Landscape’ in Adaama, Ethiopia." Aethiopica 16 (March 9, 2014): 149–91. http://dx.doi.org/10.15460/aethiopica.16.1.704.

Full text

Abstract:

With a focus on the city of Adaama (formerly: Nazret), the biggest urban agglomeration in Oromia Regional State, the paper addresses the “linguistic landscape” which is indicative of the overall sociolinguistic situation of a polity. Language use in the public space has not only practical-instrumental, but also historical, political, juridical, and most of allpsycho-sociological dimensions, the latter relating to the symbolic value of written language use. The paper deals with multilingual graphic representations on public commercial and private sign-boards, advertisements, and notices in Adaama city, with an additionalfocus on the situation on the campus of Adama Science and Technology University. Under the chosen theoretical framework, it analyses language visibility in terms of language legitimisation, both in terms of peoples’ attitudes and based on official documents regarding language status and language use in present-day Ethiopia, such as the Education and Training Policy (1994), the Constitution of the Federal Democratic Republic of Ethiopia (1995), the Revised Constitution of Oromia Regional State(2001/2006), and the Higher Education Proclamation (2009). The primary focus of the paper is on the status, functions, and representations of AfanOromo, including a review of the major historico-political changes affecting this language from Imperial Ethiopa (before 1974), the Därg period (until 1991), and under the new Constitution of the FDRE (since 1995). The paper also deals with linguistic and graphic issues concerning the “orthographic” representations of the four languages used: Afan Oromo, Amharic, Arabic, and English, involving three different graphic systems: Fidäl (Abugida), Arabic, and Roman.

APA, Harvard, Vancouver, ISO, and other styles

8

Fessha, Yonatan T. "Intergovernmental cooperation, divided societies and capital cities: The case of the Ethiopian capital." Verfassung in Recht und Übersee 53, no. 1 (2020): 12–29. http://dx.doi.org/10.5771/0506-7286-2020-1-12.

Full text

Abstract:

Some call it Addis Ababa. Others call it Finfinnee. That is the capital city of the Federal Democratic Republic of Ethiopia. “What’s in a name?” In fact, the name is at the centre of the row over the federal capital. Those who opt to refer the capital as Finfinnee claim that the capital belongs to the Oromo. Those that stick to the official name, Addis Ababa, reject the language of ownership. But this is not merely a fight over history. It is a constitutional politics that has gripped the federation. The debate over the Ethiopian capital brings to fore the question about the place of capital cities in multi-ethnic federations. Using the Ethiopian capital as a case study, this article investigates how capital cities can manage the tension between the accommodation of diverse communities and the indigeneity argument that is often used as a basis to claim ownership. The article argues that the mediation of tensions can be best addressed through the framework of intergovernmental cooperation.

APA, Harvard, Vancouver, ISO, and other styles

9

Ahmed Tura, Hussein. "Indigent’s Right to State Funded Legal Aid in Ethiopia." International Human Rights Law Review 2, no. 1 (2013): 120–50. http://dx.doi.org/10.1163/22131035-00201004.

Full text

Abstract:

This article examines the extent to which state-funded legal aid in criminal cases is recognized and implemented in Ethiopia. The Federal Democratic Republic of Ethiopia (FDRE) Constitution and human rights treaties to which Ethiopia is a party recognize an indigent’s right to defense counsel at state expense where the interests of justice so require. However, on the basis of available data collected from the courts, the police stations and prisons, this article finds that the implementing institutions, such as the Office of Public Defenders, are not operating effectively and moreover the public generally lacks legal awareness. These impediments have in turn contributed to a number of indigent accused being tried and convicted without the benefit of legal advice and representation at different stages of proceedings. It has also been found that almost all unrepresented accused have committed serious errors in said proceedings. In addition, lack of legal aid affects the overall justice system since the indigent cannot defend themselves against trained prosecutors armed with state power. In this article it is argued that in order for Ethiopia to implement an indigent’s right to state-funded legal aid, an independent legal aid agency must be established, which should be responsible for the administration of legal aid.

APA, Harvard, Vancouver, ISO, and other styles

10

Yohannes, Mamo. "The protection of minority rights under regional constitutions in the Federal Democratic Republic of Ethiopia: The case of Tigray." African Journal of Political Science and International Relations 11, no. 9 (September 30, 2017): 249–57. http://dx.doi.org/10.5897/ajpsir2015.0834.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Labiso, Tafano Ouke. "An Analysis of the Status of women Leadership in Education Sector of the catchment areas of Wolaita Sodo University." Advances in Social Sciences Research Journal 6, no. 9 (September 28, 2019): 186–212. http://dx.doi.org/10.14738/assrj.69.7095.

Full text

Abstract:

The purpose of this study was to investigate causes for the underrepresentation of women in top positions of the education sector of the catchment areas of Wolaita Sodo University. Hence, to realize this purpose, secondary school teachers, principals of secondary schools, and supervisors of all levels, and heads of education offices and departments of Dawro and Wolaita administrative zones were used as the target population. In order to make the study manageable, the sample secondary schools teachers were selected by simple random sampling technique, and principals and supervisors were selected through purposive sampling techniques. Descriptive survey research design and concurrent mixed approaches were applied. Both close-ended and open-ended questionnaires and unstructured interviews were used to collect data. Frequency counts, and percentages were employed for quantitative data through close-ended questionnaire. Data through qualitative questionnaire were narrated and used for the sake of triangulation. The finding showed that women were underrepresented due to self-related factors, socio-cultural factors, institutional factors, economic factors, and political-legal factors in the leadership positions of secondary and primary schools, principal ship positions, and supervisory positions. Thus, it was concluded that though the Federal Democratic Republic of Ethiopia has taken a number of affirmative actions and stipulated the issue of empowering women in the constitution, yet women were strikingly underrepresented in Dawro and Wolaita zones of south Ethiopia, particularly in the education sector. Therefore, it was recommended that taking into account that women are half the population, talented in leadership and management and the advantage of gender diversity in educational leadership institutions, government and the large society should strive towards empowering women.

APA, Harvard, Vancouver, ISO, and other styles

12

Ayensu, Kathleen Quartey. "Report of the 7th forum of the African Union Commission on International Law / Rapport du 7e forum de la Commission de l’Union africaine sur le droit international." Journal of the African Union Commission on International Law 2021 (2021): 355–422. http://dx.doi.org/10.47348/aucil/2021/a10.

Full text

Abstract:

INTRODUCTION The African Union Commission on International Law (the AUCIL) was established as an advisory organ on the basis of Article 5(2) of the Constitutive Act of the African Union. On February 4, 2009 the Executive Council of the Union adopted the operational Statute of the AUCIL. The objectives of the AUCIL, inter alia, are to undertake activities relating to the codification and progressive development of international law on the African continent with special reference to the laws of the Union, including African customary law arising from the practice of Member States (Article 4(4)). Furthermore, the AUCIL shall cooperate and collaborate in the teaching, study and dissemination of International law and African Union law, with universities, institutions and other educational and research bodies, and lawyers’ associations (Article 9). For several years now, the AUCIL has held an annual Forum as a means to fulfill these goals. The AUCIL convened its 7th Forum on 10 and 11 December, 2018, at the African Union headquarters in Addis Ababa, Federal Democratic Republic of Ethiopia. The Theme for the Forum was, “MANAGEMENT OF AFRICA’S NATURAL RESOURCES’’. This theme was deliberated on the context of African Union Agenda 2063. Officers for the Seventh Forum were: Chairman of Forum: Hon Judge Ismael Abdi Hersi, Vice-Chairperson of AUCIL Rapporteur General of Forum: Hon Kathleen Quartey Ayensu, AUCIL Commissioner In attendance: Ag Executive Secretary, Dr Guy-Fleury Ntwari, and selected Attorneys from the Office of the Legal Counsel, African Union Commission.

APA, Harvard, Vancouver, ISO, and other styles

13

International Monetary Fund. "Federal Democratic Republic of Ethiopia: Selected Issues." IMF Staff Country Reports 15, no. 326 (2015): 1. http://dx.doi.org/10.5089/9781513547725.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Selected Issues." IMF Staff Country Reports 13, no. 309 (2013): 1. http://dx.doi.org/10.5089/9781484335529.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Statistical Appendix." IMF Staff Country Reports 07, no. 245 (2007): 1. http://dx.doi.org/10.5089/9781451812794.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Selected Issues." IMF Staff Country Reports 08, no. 259 (2008): i. http://dx.doi.org/10.5089/9781451812817.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Statistical Appendix." IMF Staff Country Reports 08, no. 260 (2008): 1. http://dx.doi.org/10.5089/9781451812824.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Clapham, Christopher. "The constitution of the people's democratic Republic of Ethiopia." Journal of Communist Studies 3, no. 2 (June 1987): 192–95. http://dx.doi.org/10.1080/13523278708414865.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Selected Issues Paper." IMF Staff Country Reports 14, no. 304 (2014): 1. http://dx.doi.org/10.5089/9781498335294.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Debt Sustainability Analysis." IMF Staff Country Reports 05, no. 27 (2005): 1. http://dx.doi.org/10.5089/9781451812732.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Chetri, Than Bahadur. "Federal Democratic Republic Nepal: Deepening Problems and Prospects." Journal of Political Science 18 (June 29, 2018): 114–42. http://dx.doi.org/10.3126/jps.v18i0.20448.

Full text

Abstract:

Constructing federal democratic republic is a complex process. Both old and new democracies face different forms of challenges in building and maintaining, either internally or externally. Hence, this paper assesses the challenges in developing and maintaining democratic republic Nepal. With the help of secondary sources of information, it argues, building democracy in Nepal is undermined by foundational challenges and deepening challenges. Nepal, a closer analysis from the perspective of the constitution, geography and national wealth, rule of law, the nature of the party and their leaders, the prospect of a democratic republic is unclear.Journal of Political Science, Volume XVIII, 2018, Page: 114-142

APA, Harvard, Vancouver, ISO, and other styles

22

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2013 Article IV Consultation." IMF Staff Country Reports 13, no. 308 (2013): 1. http://dx.doi.org/10.5089/9781475578997.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Kudryachenko, A. "Federal Republic of Germany – Second German Democratic State." Problems of World History, no. 8 (March 14, 2019): 140–58. http://dx.doi.org/10.46869/2707-6776-2019-8-8.

Full text

Abstract:

The article describes the main stages of modern Germany’s experience in building of the parliamentary democracy. The author defines the historical progress of the German state on the wayto the formation of democratic foundations that created the basis of modern society. Three German constitutions of 1871, 1919 and 1949 were considered, they formed the basis for the development of apostwar federal state. Particular attention is focused on the transformation of the three western occupation zones of Germany into the Federal Republic of Germany and the development of the BasicLaw, which was initially regarded as temporary constitution. The author also drew attention to external factors that significantly influenced the transformation of post-Nazi Germany and theformation of the Basic Law. The historical retrospective of the formation of the second German democratic state is presented in a broad international context.

APA, Harvard, Vancouver, ISO, and other styles

24

Dahal, Girdhari. "Democratic Practice and Good Governance In Nepal." Journal of Political Science 17 (February 6, 2017): 18–35. http://dx.doi.org/10.3126/jps.v17i0.20511.

Full text

Abstract:

Nepal was declared Federal Democratic Republic after the mass movement of 2006, which was institutionalized by the Constitution of Nepal promulgated through Constitutional Assembly (CA) in 2015. The Constitution of Nepal is the people’s constitution. It was a dream of people to draft their constitution from CA since 1951. Nepal has a long history of democratic movements. Democratic movements in Nepal started from the period of autocratic Rana regime back in 1940s. Nepal Praja Parisad (the first political party of Nepal) had started organized democratic movement in Nepal. Thereafter many democratic movements and revolutions took place for the establishment of federal democratic republic Nepal. Democracy and good governance are closely interrelated to one another. Democracy is called the rule of law. Legitimate government, transparent rule, accountability to the people, free and fair election, independent judiciary, and fundamental rights and duties of the people are the essential elements of good governance as well as democracy. The main objective of this paper is to explore democratic movements and the concept of good governance in Nepal. The paper also tries to analyze the role of democratic movements for democracy and the relation between democracy and good governance in Nepal.Journal of Political Science. Vol. 17, 2017, Page: 18-35

APA, Harvard, Vancouver, ISO, and other styles

25

Wilson, R. T. "Poultry production and performance in the Federal Democratic Republic of Ethiopia." World's Poultry Science Journal 66, no. 3 (September 1, 2010): 441–54. http://dx.doi.org/10.1017/s0043933910000528.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Selected Issues and Statistical Appendix." IMF Staff Country Reports 06, no. 122 (2006): 1. http://dx.doi.org/10.5089/9781451812770.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Currie, David P. "Republication- Separation of Powers in the Federal Republic of Germany." German Law Journal 9, no. 12 (December 1, 2008): 2113–78. http://dx.doi.org/10.1017/s207183220000081x.

Full text

Abstract:

The Federal Republic of Germany celebrated its fortieth birthday in 1989, and the sudden and unexpected accession of the former German Democratic Republic the following year has drawn the world's attention to the newly united nation. This article is the third installment in an effort to explain the basic features of the German constitution.

APA, Harvard, Vancouver, ISO, and other styles

28

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2014 Article IV Consultation-Staff Report; Press Release; and Statement by the Executive Director for The Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 14, no. 303 (2014): 1. http://dx.doi.org/10.5089/9781484365601.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

29

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2015 Article IV Consultation-Press Release; Staff Report; and Statement by the Executive Director for The Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 15, no. 300 (2015): 1. http://dx.doi.org/10.5089/9781513560038.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2016 Article IV Consultation-Press Release; Staff Report; and Statement by the Executive Director for The Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 16, no. 322 (2016): 1. http://dx.doi.org/10.5089/9781475543643.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Gautam, Dilli Raj. "Salient Features of the Constitutions of Nepal and India: A Comparative Observation." KMC Research Journal 3, no. 3 (June 13, 2019): 53–72. http://dx.doi.org/10.3126/kmcrj.v3i3.35712.

Full text

Abstract:

While comparing the Constitution of Nepal 2015 and the Constitution of India 1950 the paper comparatively analyses the major issues such as citizenship, inclusiveness, fundamental rights and independence of judiciary. Both constitutions are committed to socialism based on democratic norms and values, including people’s competitive multiparty democratic system of governance, civil liberties, fundamental rights, federal republic, secularism, adult franchise, periodic elections, full freedom of the press, and independent, impartial, competent and free judiciary and concept of the rule of law. This qualitative research article observes the salient features of the constitution of Nepal and India in descriptive and analytical order with comparative methodology.

APA, Harvard, Vancouver, ISO, and other styles

32

Shneiderman, Sara, and Mark Turin. "Nepal and Bhutan in 2011." Asian Survey 52, no. 1 (January 2012): 138–46. http://dx.doi.org/10.1525/as.2012.52.1.138.

Full text

Abstract:

Abstract Nepal's political transition to a democratic federal republic remains incomplete. A November 2011 agreement on post-conflict integration and rehabilitation offers reason for hope. Continued disagreements over the structure of the federal state and its form of government have delayed the constitution-making process. Corruption, impunity, and weak infrastructure combine to erode Nepali confidence in effective governance. Bhutan's democratic exercise continues to be carefully controlled by entrenched elites, but the country held its first-ever local elections successfully and economic growth stabilized.

APA, Harvard, Vancouver, ISO, and other styles

33

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Poverty Reduction Strategy Paper Annual Progress Report." IMF Staff Country Reports 04, no. 37 (2004): 1. http://dx.doi.org/10.5089/9781451812657.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Yakovlev, Roman V. "New species of Aethalopteryx Schoorl, 1990 (Lepidoptera, Cossidae, Zeuzerinae) from Federal Democratic Republic of Ethiopia." Ecologica Montenegrina 38 (December 23, 2020): 210–14. http://dx.doi.org/10.37828/em.2020.38.29.

Full text

Abstract:

The article describes a new species, Aethalopteryx strohlei Yakovlev sp. nov. (Lepidoptera, Cossidae, Zeuzerinae) from the Debub Omo Zone of the Southern Nations, Nationalities and People's Region of the Federal Democratic Republic of Ethiopia. The article has 5 illustrations.

APA, Harvard, Vancouver, ISO, and other styles

35

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Staff Report for the 2012 Article IV Consultation." IMF Staff Country Reports 12, no. 287 (2012): 1. http://dx.doi.org/10.5089/9781475513233.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Ex Post Assessment of Long-Term Fund Engagement." IMF Staff Country Reports 05, no. 26 (2005): i. http://dx.doi.org/10.5089/9781451812725.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Yakovlev, Roman V. "Wittoecia – a new genus of Zeuzerinae (Lepidoptera, Cossidae) from the Federal Democratic Republic of Ethiopia." Ecologica Montenegrina 34 (August 4, 2020): 1–7. http://dx.doi.org/10.37828/em.2020.34.1.

Full text

Abstract:

The present paper contains the description of a new Cossidae genus, Wittoecia gen. n. (type species, by monotypy Azygophleps brehmi Yakovlev & Witt, 2016) from the Federal Democratic Republic of Ethiopia. The new combination Wittoecia brehmi (Yakovlev & Witt, 2016) comb. n. is established. With 8 color and 7 black-and-white figures.

APA, Harvard, Vancouver, ISO, and other styles

38

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Poverty Reduction Strategy Paper: 2003/04 Annual Progress Report." IMF Staff Country Reports 06, no. 27 (2006): 1. http://dx.doi.org/10.5089/9781451812756.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Rakotomalala, M. R., B. B. Abera, A. Pinel-Galzi, J. Rakotoarisoa, D. Alemu, and D. Fargette. "First Report of Rice yellow mottle virus in Rice in Federal Democratic Republic of Ethiopia." Plant Disease 98, no. 10 (October 2014): 1449. http://dx.doi.org/10.1094/pdis-05-14-0531-pdn.

Full text

Abstract:

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (5). In the Federal Democratic Republic of Ethiopia, however, the disease has never been reported in rice fields. In September 2012, plants with leaf yellowing and mottling symptoms were observed near Bahir Dar and in the Fogera district in the northwestern part of the country during a joint survey of scientists from Madagascar (FOFIFA), Ethiopian Institute of Agricultural Research (EIAR), and Japan International Cooperation Agency (JICA). The disease was observed in 2013 in Fogera and Dera districts, where samples were collected, causing small patches of infected plants in ~5% of the fields. Symptomatic leaves of two plants collected in the fields were inoculated on five plants of the susceptible O. sativa cultivar IR64. All inoculated plants reproduced the typical yellow mottle symptoms. Symptomatic leaves of eight plants collected in the fields reacted positively when tested by double antibody sandwich (DAS)-ELISA tests with a polyclonal antiserum raised against a Madagascan isolate of RYMV (2), indicating for the first time the presence of the virus in Ethiopia. Triple antibody sandwich (TAS) tests with discriminant monoclonal antibodies (2) revealed that they all belonged to serotype 4, a serotype found in East Africa and in Madagascar. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from four samples. The 720-bp coat protein (CP) gene was amplified with reverse transcription (RT)-PCR with the primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. KMO17554, KMO14555, KMO17556, and KMO17557). The four sequences showed over 98% nucleotide identity between each other. They shared over 92% nucleotide identity with isolates of strains S4 found in Kenya, Uganda, Tanzania, and Madagascar (4). Agricultural changes associated to rice intensification are known to favor RYMV emergence and spread (5). Recent efforts have been led by the National Rice Research and Development Strategy (NRRDSE) to intensify rice cultivation in Ethiopia (1). Early knowledge of RYMV occurrence in the country is a prerequisite to extended surveys of the disease and implementation of control measures. References: (1) K. Assefa et al. Challenges and opportunities of rice in Ethiopian agricultural development. www.eiar.gov.et/Publications/frgseries2.pdf , 2011. (2) D. Fargette et al. Arch. Virol. 147:583, 2002. (3) A. Pinel et al. Arch. Virol. 145:1621, 2000. (4) M. Rakotomalala et al. Virus Res. 171:71, 2013. (5) O. Traoré et al. Virus Res. 141:258, 2009.

APA, Harvard, Vancouver, ISO, and other styles

40

Abbink, Jon. "The Ethiopian Second Republic and the Fragile “Social Contract”." Africa Spectrum 44, no. 2 (August 2009): 3–28. http://dx.doi.org/10.1177/000203970904400201.

Full text

Abstract:

Eighteen years after the change of power and the ushering in of the second Ethiopian republic in 1991, the political process in Ethiopia has, according to most observers, rigidified and largely closed the space for representative democracy. This paper will look at the main organizing political ideas or ideology of the current Ethiopian republic and to the nature of its governance techniques in the face of domestic and international challenges with reference to the debate on “failing” or “fragile” states. The new “social contract” defined after 1991 and codified in the 1994 Constitution is precarious. Dissent and ethno-regional resistance to federal policies are dealt with mainly by coercion and discursive isolation. Oppositional forces voice the need for a rethinking of the organizing ideas and institutions of the second republic in order to enhance political consensus and a shared political arena, but get little response. The paper will sketch an interpretation of governance in Ethiopia, focusing on the dilemma of reconciling local and modernist political practices, and will discuss the status of “republican” ideas, in name important in Ethiopia but mostly absent in practice. Explicit debate of these ideas is usually sidelined – also in academic commentaries – in favour of a focus on the ethno-federal ideology of the Ethiopian state.

APA, Harvard, Vancouver, ISO, and other styles

41

Read, James S. "Nigeria's New Constitution for 1992: The third Republic." Journal of African Law 35, no. 1-2 (1991): 174–93. http://dx.doi.org/10.1017/s0021855300008421.

Full text

Abstract:

The 1979 Constitution of Nigeria was widely acclaimed as a boldly innovative attempt to introduce structures for democratic government which were new to the Commonwealth. These included the adoption of an American-style separation of legislative and executive powers, albeit with many distinctive elements, to replace the “Westminster model” which had been so productive of tension and conflict at both federal and regional levels under the Independence Constitution of 1960 and the Constitution of the First Republic (1963–66). The executive presidency also represented continuity with the realities of military government (1966–79). Although that transition from the Whitehall to the White House model in the Second Republic (1979–83) proved a short-lived experiment, the problems which precipitated the military coup of 31 December, 1983, or were cited as justifying it, were not attributed to defects in the basic constitutional structures but rather to the ways in which they had been operated by the politicians elected to office—many of whom, as survivors from the previous political era, were more familiar with “Westminster” than “Washington” Now a new generation of constitution-makers has affirmed, on behalf of the nation, its confidence in the basic scheme adopted in 1979: indeed, the new Constitution, enacted in 1989 for implementation in 1992, closely reproduces the structure and most of the detailed provisions of the 1979 Constitution; yet such similarity belies fundamental changes in the political system now in process of restoration.

APA, Harvard, Vancouver, ISO, and other styles

42

Löhnig, Martin. "Der Vertrag zwischen der Bundesrepublik Deutschland und der Volksrepublik Polen über die Grundlagen der Normalisierung ihrer gegenseitigen Beziehungen als Zäsur in der Geschichte der Bonner Republik." Miscellanea Historico-Iuridica 19, no. 2 (2020): 13–25. http://dx.doi.org/10.15290/mhi.2020.19.02.01.

Full text

Abstract:

For Poland, the "Warsaw Treaty between the Federal Republic of Germany and the People's Republic of Poland" brought legal certainty: The Polish western border was now recognized by both German states under international law. For the Federal Republic of Germany, the tough domestic political struggle for ratification of the treaty marks a turning point. The essay describes this struggle between the social-liberal government and the conservative opposition against the background of the German constitution (Basic Law), which should ensure the stability of the democratic system based on the experiences from the Weimar period. It shows how the conflict parties used instruments of the no-confidence vote and the dissolution of parliament and what role the Federal Constitutional Court (Bundesverfassungsgericht) played in this conflict: The leading decision of the court is analysed in detail. Last but not least, the surprising role of the GDR in this conflict is also examined.

APA, Harvard, Vancouver, ISO, and other styles

43

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2005 Article IV Consultation: Staff Report; Staff Statement; Public Information Notice on the Executive Board Discussion; and Statement by the Executive Director for The Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 06, no. 159 (2006): i. http://dx.doi.org/10.5089/9781451812787.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2007 Article IV Consultation: Staff Report; Staff Supplement; Public Information Notice on the Executive Board Discussion; and Statement by the Executive Director for the Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 07, no. 247 (2007): 1. http://dx.doi.org/10.5089/9781451812800.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: 2008 Article IV Consultation-Staff Report; Staff Supplement; Public Information Notice on the Executive Board Discussion; and Statement by the Executive Director for The Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 08, no. 264 (2008): i. http://dx.doi.org/10.5089/9781451812831.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Rensmann, Thilo. "Procedural Fairness in a Militant Democracy: The “Uprising of the Decent” Fails Before the Federal Constitutional Court." German Law Journal 4, no. 11 (November 1, 2003): 1117–36. http://dx.doi.org/10.1017/s2071832200012001.

Full text

Abstract:

“If there be any among us who wish to dissolve this union, or to change its republican form, let them stand undisturbed, as monuments of the safety with which error of opinion may be tolerated where reason is left free to combat it.” The framers of the German Grundgesetz (Basic Law or Constitution) of 1949 had lost Thomas Jefferson's optimistic faith that the self-healing powers of reason would render a democratic polity immune to totalitarian temptation. The Weimar Republic had proved defenceless against the rise of a totalitarian movement, which availed itself of the democratic process as a Trojan horse in its effort to establish a brutal dictatorship.

APA, Harvard, Vancouver, ISO, and other styles

47

Yearbook of Islamic and Middle East, Editors. "Declaration of Principles Agreement Signed by the Arab Republic of Egypt, the Federal Democratic Republic of Ethiopia and the Republic of the Sudan." Yearbook of Islamic and Middle Eastern Law Online 18, no. 1 (June 5, 2017): 479–86. http://dx.doi.org/10.1163/22112987_01801013.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Guobadia, Osahon O. "The Relevance of the Judiciary in a Democratic Nigeria." African Journal of International and Comparative Law 20, no. 2 (June 2012): 301–17. http://dx.doi.org/10.3366/ajicl.2012.0035.

Full text

Abstract:

A new constitutional democracy was established in Nigeria on 29 May 1999. This Fourth Republic was founded upon the Constitution of the Federal Republic of Nigeria 1999 (as amended) which unshackled the judiciary from the bondage of military decrees. This also brought excitement to the citizenry which finds expression in the belief that the judiciary, their last bastion of succour, is now poised to intervene in the inevitable tussle between might and the exercise of new democratic tenets. These tenets encompass the ideals of economic justice, political justice and social justice. 1 1 C. C. Nweze, ‘Judicial Sustainability of Constitutional Democracy in Nigeria: A Response to the Phonographic Theory of the Judicial Function’, in E. S. Nwauche and F. I. Asogwah (eds), Essays in Honour of Professor C. O. Okunkwo, (SAN) Jite Books (2000), p. 225. Against the backdrop of this reality, the article will examine the extent to which the judiciary in Nigeria has performed its constitutional role as an independent arm of government towards ensuring the observance of democratic values in a free, open, humane and civilised society.

APA, Harvard, Vancouver, ISO, and other styles

49

International Monetary Fund. "The Federal Democratic Republic of Ethiopia: Second Review of the Arrangement under the Exogenous Shocks Facility-Staff Report; Press Release on the Executive Board Discussion; and Statement by the Executive Director for the Federal Democratic Republic of Ethiopia." IMF Staff Country Reports 10, no. 339 (2010): i. http://dx.doi.org/10.5089/9781455212637.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Dahal, Girdhari. "Constitution of Nepal and Political Development: Adaption and Challenges of Implication." Janapriya Journal of Interdisciplinary Studies 6 (March 2, 2018): 148–59. http://dx.doi.org/10.3126/jjis.v6i0.19316.

Full text

Abstract:

The present constitution- promulgated by the Constitutional Assembly (CA) in September, 2015 is the seventh written document in the constitutional history of Nepal which has institutionalized Federal Democratic Republic achieved after the success of peoples' movement of 2006. It was made based on the principles of constitutionalism. The constitution of Nepal has addressed different issues for a modern state and is regarded as a progressive, people oriented constitution. It has also paved paths for further economic development. It has opened door for rights of the people, political stability, restructuring of the state, and sustainable peace and development of the state. However, there are many prospects as well as numerous challenges for its proper implementation. Some Madhes based parties (People of Terai) and ethnic minorities have criticized the constitution for being unable to address their pertinent issues fully. However, they have involved in the process of constitution implementation by participating in first local, provincial and federal level election held under new constitution. So the government needs to bring the Madhesh based parties and other groups into a peaceful consensus and should pave a path for implementation of this constitution. At the same time, implementation of federalism, election of local bodies, sustainable peace, political stability and development are among other challenges faced by this constitution. Janapriya Journal of Interdisciplinary Studies, Vol. 6 (December 2017), Page: 148-159

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!