To see the other types of publications on this topic, follow the link: Corn rough dwarf virus disease.
Journal articles on the topic 'Corn rough dwarf virus disease'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 23 journal articles for your research on the topic 'Corn rough dwarf virus disease.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Teakle, DS, S. Hicks, RM Harding, RS Greber, and RG Milne. "Pangola stunt virus infecting pangola grass and summer grass in Australia." Australian Journal of Agricultural Research 39, no. 6 (1988): 1075. http://dx.doi.org/10.1071/ar9881075.
Full textAbstract:
A widespread disease of pangola grass (Digitaria decumbens) and summer grass (D. ciliaris) in south-eastern Queensland was characterized by a bunched and stunted growth habit, yellow or red discolouration of the foliage, seed heads with crimped, distorted racemes, and sometimes premature plant death. Virus-like particles present in extracts of diseased plants were unstable, 50-70 nm in diameter, had a core and outer coat and were morphologically similar to particles of viruses in the genus Fijivirus, family Reoviridae. The particles were shown by immune electron microscopy to be serologically closely related to pangola stunt and maize rough dwarf viruses, but unrelated to oat sterile dwarf virus. Similar virus-like particles were observed in crystalline arrays in ultrathin sections of cells in vein enations of D. ciliaris. Extracts of diseased pangola grass and summer grass contained 10 double-stranded RNA species, which were somewhat similar in size to those reported for pangola stunt virus. A planthopper, Sogatella kolophon, which is related to the South American vector of pangola stunt virus, S. furcifera, was associated with diseased pangola grass and summer grass in the field, and was shown to be a vector. However, efforts to infect maize, a major host of maize rough dwarf virus, were unsuccessful. On the basis of these properties the Australian virus is considered to be pangola stunt virus.
2
Lenardon, S. L., G. J. March, S. F. Nome, and J. A. Ornaghi. "Recent Outbreak of “Mal de Rio Cuarto” Virus on Corn in Argentina." Plant Disease 82, no. 4 (April 1998): 448. http://dx.doi.org/10.1094/pdis.1998.82.4.448c.
Full textAbstract:
“Mal de Río Cuarto” (MRC) is the most important viral disease affecting corn in Argentina. Reovirus-like particles were observed in diseased plants (1,4) and were later serologically related to an isolate of maize rough dwarf virus (3), though this relationship was recently questioned (2). Based on estimates of the prevalence and severity of MRC and yield losses, government agencies, corn hybrid seed companies, and growers agreed that the worst epidemic in the country occurred during the 1996 to 1997 agricultural year. Approximately 300,000 ha of corn were affected by the disease and yield losses were estimated at $120 million. Affected areas included the central and southern Santa Fe, the central, northern, southeastern, and western Buenos Aires, and the eastern and southern (originally the endemic center of MRC in Río Cuarto County) parts of Córdoba. Virus infections were confirmed by double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) in root samples from each surveyed location, using an antiserum to MRC virus. The occurrence of MRC in non-endemic areas suggests an unusual phenological coincidence of high vector populations, abundant natural virus reservoirs, and susceptible stages in the crop. Most commercial hybrids surveyed were apparently susceptible to the virus, although some were tolerant. References: (1) O. E. Bradfute et al. Phytopathology 71:205, 1981. (2) C. Marzachi et al. Sem. Virol. 6:103, 1995. (3) R. G. Milne et al. Phytopathology 73:1290, 1983. (4) S. F. Nome et al. Phytopathol. Z. 101:7, 1981.
3
Li, Mingjun, Xi Sun, Dianping Di, Aihong Zhang, Ling Qing, Tao Zhou, Hongqin Miao, and Zaifeng Fan. "Maize AKINβγ Proteins Interact with P8 of Rice Black Streaked Dwarf Virus and Inhibit Viral Infection." Viruses 12, no. 12 (December 4, 2020): 1387. http://dx.doi.org/10.3390/v12121387.
Full textAbstract:
Rice black streaked dwarf virus (RBSDV) is an important agent causing maize rough dwarf disease, whereas the host factors responding to RBSDV infection are poorly understood. To uncover the molecular interactions between RBSDV and maize, a yeast two-hybrid screen of a maize cDNA library was carried out using the viral P8 protein as a bait. ZmAKINβγ-1 and ZmAKINβγ-2 (βγ subunit of Arabidopsis SNF1 kinase homolog in maize) possessing high sequence similarities (encoded by two gene copies) were identified as interaction partners. Their interactions with P8 were confirmed in both Nicotiana benthamiana cells and maize protoplasts by bimolecular fluorescence complementation assay. The accumulation levels of ZmAKINβγ mRNAs were upregulated at the stage of the viral symptoms beginning to appear and then downregulated. ZmAKINβγs are putative regulatory subunits of the SnRK1 complex, a core regulator for energy homeostasis. Knockdown of ZmAKINβγs in maize regulated the expression levels of the genes involved in sugar synthesis or degradation, and also the contents of both glucose and sucrose. Importantly, downregulation of ZmAKINβγs expressions facilitated the accumulation of RBSDV in maize. These results implicate a role of ZmAKINβγs in the regulation of primary carbohydrate metabolism, and in the defense against RBSDV infection.
4
Zhou, Yu, Lin Zhang, Xiaoming Zhang, Hongyue Zu, Hong Di, Ling Dong, Xianjun Liu, et al. "Rice black-streaked dwarf virus Genome in China: Diversification, Phylogeny, and Selection." Plant Disease 101, no. 9 (September 2017): 1588–96. http://dx.doi.org/10.1094/pdis-12-16-1814-re.
Full textAbstract:
Rice black-streaked dwarf virus (RBSDV), a Fijivirus, causes maize rough dwarf disease and rice black-streaked dwarf disease in the summer maize-growing regions of the Yellow and Huai rivers, respectively, in China. Nevertheless, the diversification and selection of the entire genome from S1 to S10 have not been illuminated. Molecular variation, evolution, conserved regions, and other genomic properties were analyzed in 21 RBSDV isolates from maize (Zea mays L.) and rice (Oryza sativa) hosts sampled from nine geographic locations in China. Low codon adaptation index values ranging from 0.1878 to 0.2918 indicated a low degree of codon-usage bias and low potential expression for all 13 RBSDV open reading frames (ORFs). ORF9-2 showed a stronger effect of codon usage bias than did other ORFs, as the majority of points for this ORF lay close to the standard curve in the Nc plot (the effective number of codons [Nc] versus the frequency of G+C at synonymous third-base positions [GC3]). A 9-bp deletion mutation was detected in the RBSDV genome in the 3′ UTR of S8. Nucleotide diversity analysis indicated that the structural proteins of RBSDV, such as S2 and S4, were all more conserved than nonstructural proteins such as S9. Nucleotide diversity (π) was highest among S9 sequences (0.0656), and was significantly higher than among S4 sequences (0.0225, P < 0.01). The number of conserved regions among the 10 segments varied substantially. The highest number of conserved regions (5) was found in S5, whereas no conserved regions were identified in S9. Nucleotide diversity and the number of conserved regions were independent of the lengths of segments. Nucleotide diversity was also not correlated with the number of conserved regions in segments. Ten recombination events in 21 isolates were found in seven segments with breakpoint positions in UTRs, intergenic spacer regions, and gene coding regions. The number of recombination events was also independent of the lengths of segments. RBSDV isolates from China could be phylogenetically classified into two groups using either 10 segment sequences or the concatenated sequence of S1 through S10, regardless of host or geographical location. The phylogenetic tree generated from pairwise nucleotide identities of individual RBSDV segments such as S9 and S3, with nucleotide identity values of 93.74% and 95.86%, respectively, is similar to the tree constructed from the concatenated sequences of the entire RBSDV genome. The 13 RBSDV ORFs were under negative and purifying selection (Ka/Ks < 1). ORF5-2 was under the greatest selection pressure; however, ORF2, which encodes the core protein of RBSDV, was under the lowest selection pressure.
5
Kannan, Maathavi, Ismanizan Ismail, and Hamidun Bunawan. "Maize Dwarf Mosaic Virus: From Genome to Disease Management." Viruses 10, no. 9 (September 13, 2018): 492. http://dx.doi.org/10.3390/v10090492.
Full textAbstract:
Maize dwarf mosaic virus (MDMV) is a serious maize pathogen, epidemic worldwide, and one of the most common virus diseases for monocotyledonous plants, causing up to 70% loss in corn yield globally since 1960. MDMV belongs to the genus Potyvirus (Potyviridae) and was first identified in 1964 in Illinois in corn and Johnsongrass. MDMV is a single stranded positive sense RNA virus and is transmitted in a non-persistent manner by several aphid species. MDMV is amongst the most important virus diseases in maize worldwide. This review will discuss its genome, transmission, symptomatology, diagnosis and management. Particular emphasis will be given to the current state of knowledge on the diagnosis and control of MDMV, due to its importance in reducing the impact of maize dwarf mosaic disease, to produce an enhanced quality and quantity of maize.
6
Xiaohua, Han, Chen Tingmu, Yue Runqing, Guo Shulei, Xu Mengmeng, Lu Caixia, Fan Yanping, et al. "A Rice Black-Streaked Dwarf Virus Replication Curve Model to Evaluate Maize Rough Dwarf Disease Resistance." Plant Disease 103, no. 5 (May 2019): 868–73. http://dx.doi.org/10.1094/pdis-09-18-1532-re.
Full textAbstract:
Resistance to maize rough dwarf disease (MRDD), a major cause of crop losses, depends on external conditions such as the virus transmission period and the rate of viruliferous small brown planthoppers, Laodelphax striatellus. The precise identification of MRDD contributes to the utilization of resistant germplasm and the cloning of resistant genes. In this study, eight maize varieties were artificially inoculated in a greenhouse with viruliferous planthoppers. The viral titers in maize seedlings were detected by quantitative fluorescence RT-PCR, and the viral replication curves were analyzed by regression. A logistic model fit the Rice black-streaked dwarf virus (RBSDV) replication data for five susceptible varieties well, whereas a linear model fit the data for three resistant varieties. Among the five susceptible varieties, the time points with the maximum replication rates (tIP) of the highly susceptible Ye478 and XH6 were significantly earlier than those of the three susceptible varieties, Mo17, Zheng58, and Zhengdan958. P138, the most highly resistant variety, had the lowest slope of the best fit line, followed by moderately resistant Chang7-2 and Dan 340. The RBSDV replication curve model developed in this study can accurately identify the resistance of maize germplasm to MRDD at the molecular level. Our results also suggested that tIP and the slope of the RBSDV replication curve can be considered new criteria to evaluate maize resistance to MRDD.
7
Eberwine, John W., and Edward S. Hagood. "Effect of Johnsongrass (Sorghum halepense) Control on the Severity of Virus Diseases of Corn (Zea mays)." Weed Technology 9, no. 1 (March 1995): 73–79. http://dx.doi.org/10.1017/s0890037x00022983.
Full textAbstract:
Field experiments were conducted to evaluate the hypothesis that johnsongrass control in corn causes increased maize dwarf mosaic virus (MDMV) and maize chlorotic dwarf virus (MCDV) disease severity because of increased movement of insect vectors from dying johnsongrass to the corn crop. Johnsongrass control treatments included 1) broadcast POST nicosulfuron, 2) directed POST imazethapyr, 3) mechanical control, and 4) no treatment. Disease severity in both a virus-susceptible and a virus-tolerant corn hybrid was evaluated. With the virus-susceptible hybrid, greater disease severity was observed where johnsongrass was controlled in the experimental area than where johnsongrass was not controlled. Increases in disease severity were independent of the method of johnsongrass control. Corollary studies conducted on the same site verified a double infection of corn with MDMV and MCDV and documented movement of blackfaced leafhoppers, the insect vector of MCDV, subsequent to treatment of johnsongrass.
8
Morales, Katia, Jose Luis Zambrano, and Lucy R. Stewart. "Co-infection and Disease Severity of Ohio Maize dwarf mosaic virus and Maize chlorotic dwarf virus Strains." Plant Disease 98, no. 12 (December 2014): 1661–65. http://dx.doi.org/10.1094/pdis-12-13-1230-re.
Full textAbstract:
Two major maize viruses have been reported in the United States: Maize dwarf mosaic virus (MDMV) and Maize chlorotic dwarf virus (MCDV). These viruses co-occur in regions where maize is grown, such that co-infections are likely. Co-infection of different strains of MCDV is also observed, and a synergistic enhancement of symptoms in co-infected plants was previously reported. Here, we examined the impact of co-infections of two strains of MCDV (MCDV-S and MCDV-M1, severe and mild, respectively), and co-infections of MCDV and MDMV in the sweet corn hybrid ‘Spirit’ in greenhouse experiments. Quantitative plant growth and development parameters were measured and virus accumulation was measured by reverse-transcriptase quantitative polymerase chain reaction. Virus symptoms were enhanced and plants showed no recovery over time in co-infections of MDMV-OH and MCDV-S but virus titers and quantitative growth parameters did not indicate synergy in co-infected plants. MCDV-M1 co-infections with either MDMV-OH or MCDV-S did not show symptom enhancement or evidence of synergism.
9
Eberwine, John W., Edward S. Hagood, and Sue A. Tolin. "Quantification of Viral Disease Incidence in Corn (Zea mays) as Affected by Johnsongrass (Sorghum halepense) Control." Weed Technology 12, no. 1 (March 1998): 121–27. http://dx.doi.org/10.1017/s0890037x00042676.
Full textAbstract:
Field and laboratory experiments were conducted to evaluate the effect of postemergence johnsongrass control on incidence of maize chlorotic dwarf virus (MCDV) and maize dwarf mosaic virus (MDMV) in corn and to confirm the presence and movement of the blackfaced leafhopper, the insect vector of MCDV. Corn plants surrounded by MCDV- and MDMV-infected rhizomatous johnsongrass were either treated or not treated with nicosulfuron at 35 g ai/ha. Corn tissue samples were taken at the time of treatment and 4, 9, 14, and 21 d after treatment and the presence of MCDV and MDMV was determined by enzyme-linked immunosorbent assay (ELISA). Virus incidence in treated experimental units was higher at the later sampling dates relative to the nontreated. Earlier differences in incidence of MCDV and MDMV double infection in corn were detected where johnsongrass was controlled. Movement of the insect vector of MCDV was observed within the experimental area after johnsongrass was controlled, but was not significantly different from that in nontreated areas.
10
Meyer, M. D., and J. K. Pataky. "Increased Severity of Foliar Diseases of Sweet Corn Infected with Maize Dwarf Mosaic and Sugarcane Mosaic Viruses." Plant Disease 94, no. 9 (September 2010): 1093–99. http://dx.doi.org/10.1094/pdis-94-9-1093.
Full textAbstract:
Maize dwarf mosaic (MDM), caused by Maize dwarf mosaic virus (MDMV) and Sugarcane mosaic virus (SCMV), is an economically important viral disease of sweet corn (Zea mays). MDM is known to increase the severity of fungal root rots and southern corn leaf blight (SCLB). The effect of infection with MDMV-A and SCMV on eight foliar diseases was evaluated on 32 sweet corn hybrids (27 MDM-susceptible hybrids and five MDM-resistant hybrids) in 2007, 2008, and 2009. Virus infection substantially increased the severity of five diseases, including: SCLB, northern corn leaf spot (NCLS), gray leaf spot (GLS), Diplodia leaf streak (DLS), and eyespot. Among MDM-susceptible hybrids, mean severity of SCLB, NCLS, GLS, DLS, and eyespot on virus-infected plants was typically double that of plants that were asymptomatic of viral infection. Three diseases were not substantially increased by MDM, including: common rust, northern corn leaf blight (NCLB), and Stewart's wilt. Virus infection appeared to affect the severity of diseases caused by necrotrophic foliar fungi that colonize mesophyll tissue. MDM did not appear to substantially affect the severity of diseases caused by pathogens that form haustoria or invade the vascular system. The extent to which SCLB severity is increased by MDM in terms of changes in level of host resistance also was determined. For MDM-susceptible hybrids, reactions to SCLB ranged from resistant to moderately susceptible in MDM-free treatments, but each of these hybrids was classified as moderately susceptible to susceptible when infected with MDMV-A and/or SCMV. The results of this experiment demonstrate the importance of breeding for MDM resistance, not only to control this important viral disease of sweet corn, but also to lower the potential for detrimental effects from several other foliar diseases that often are of minor importance on sweet corn in the absence of MDM.
11
Stewart, L. R., R. Teplier, J. C. Todd, M. W. Jones, B. J. Cassone, S. Wijeratne, A. Wijeratne, and M. G. Redinbaugh. "Viruses in Maize and Johnsongrass in Southern Ohio." Phytopathology® 104, no. 12 (December 2014): 1360–69. http://dx.doi.org/10.1094/phyto-08-13-0221-r.
Full textAbstract:
The two major U.S. maize viruses, Maize dwarf mosaic virus (MDMV) and Maize chlorotic dwarf virus (MCDV), emerged in southern Ohio and surrounding regions in the 1960s and caused significant losses. Planting resistant varieties and changing cultural practices has dramatically reduced virus impact in subsequent decades. Current information on the distribution, diversity, and impact of known and potential U.S. maize disease-causing viruses is lacking. To assess the current reservoir of viruses present at the sites of past disease emergence, we used a combination of serological testing and next-generation RNA sequencing approaches. Here, we report enzyme-linked immunosorbent assay and RNA-Seq data from samples collected over 2 years to assess the presence of viruses in cultivated maize and an important weedy reservoir, Johnsongrass (Sorghum halepense). Results revealed a persistent reservoir of MDMV and two strains of MCDV in Ohio Johnsongrass. We identified sequences of several other grass-infecting viruses and confirmed the presence of Wheat mosaic virus in Ohio maize. Together, these results provide important data for managing virus disease in field corn and sweet corn maize crops, and identifying potential future virus threats.
12
Eyvazi, Asieh, Amir Massah, Aboozar Soorni, and Ghobad Babaie. "Molecular phylogenetic analysis shows that causal agent of maize rough dwarf disease in Iran is closer to rice black-streaked dwarf virus." European Journal of Plant Pathology 160, no. 2 (March 8, 2021): 411–25. http://dx.doi.org/10.1007/s10658-021-02253-4.
Full text
13
Zhou, Yu, Xiaoming Zhang, Dandan Wang, Jianfeng Weng, Hong Di, Lin Zhang, Ling Dong, et al. "Differences in Molecular Characteristics of Segment 8 in Rice black-streaked dwarf virus and Southern rice black-streaked dwarf virus." Plant Disease 102, no. 6 (June 2018): 1115–23. http://dx.doi.org/10.1094/pdis-10-17-1652-re.
Full textAbstract:
Rice black-streaked dwarf virus (RBSDV) and Southern rice black-streaked dwarf virus (SRBSDV) cause maize rough dwarf disease (MRDD) and rice black-streaked dwarf disease (RBSDD) in China. RBSDV segment 8 (S8) contains the only deletion mutation in the genomes of these viruses, which are both members of the genus Fijivirus. To illuminate the molecular differences between the RBSDV and SRBSDV genomes and better understand the evolution of these viruses, and to determine which virus is specifically associated with MRDD and RBSDD in each region, S8 was analyzed in 66 virus isolates collected from 10 geographic locations in China and 14 S8 sequences obtained from the National Center for Biotechnology Information GenBank. Phylogenetic analysis showed that the pathogen associated with MRDD and RBSDD in the Yellow and Huai River valleys was RBSDV, whereas the pathogen associated with these diseases in Sanya was SRBSDV. Codon usage bias in S8 differed significantly between RBSDV and SRBSDV, as indicated by effective number of codons used by a gene (Nc) and GC values, Nc plots, and variation explained by the first axis in correspondence analysis. The nucleotide identities among these 66 RBSDV and SRBSDV isolates ranged from 66.2 to 68.2%, and were considerably lower than the nucleotide identities within RBSDV (from 94.1 to 99.9%) or SRBSDV (from 93.9 to 100%) isolates. Most S8 polymorphisms were identified in the region from 1,000 to 1,200 bp in RBSDV and in the region from 500 to 700 bp in SRBSDV. The difference in the lengths of RBSDV (1,936 bp) and SRBSDV (1,928 bp) was due to an 8-bp deletion in the 3′-untranslated region of SRBSDV. Six recombination events were detected in S8 in RBSDV and two recombination events were detected in S8 in SRBSDV. Recombination breakpoints were found within the region containing the deletion mutation in nine isolates. However, no recombination events were detected between RBSDV and SRBSDV. Both of these viruses were under negative and purifying selection, although the ratio of nonsynonymous mutations to synonymous mutations (Ka/Ks) for RBSDV S8 (0.0530) was not significantly lower than that of SRBSDV S8 (0.0823, P = 0.1550). We found that SRBSDV was more highly genetically differentiated (product of effective population size and the migration rate among populations < 1; values for the among-populations component of genetic variation or normalized variation > 0.33; and P values of the sequence statistic, the rank statistic, and the nearest-neighbor statistic < 0.01) than RBSDV. However, gene flow between RBSDV and SRBSDV was not frequent.
14
Jones, Roger A. C. "Disease Pandemics and Major Epidemics Arising from New Encounters between Indigenous Viruses and Introduced Crops." Viruses 12, no. 12 (December 4, 2020): 1388. http://dx.doi.org/10.3390/v12121388.
Full textAbstract:
Virus disease pandemics and epidemics that occur in the world’s staple food crops pose a major threat to global food security, especially in developing countries with tropical or subtropical climates. Moreover, this threat is escalating rapidly due to increasing difficulties in controlling virus diseases as climate change accelerates and the need to feed the burgeoning global population escalates. One of the main causes of these pandemics and epidemics is the introduction to a new continent of food crops domesticated elsewhere, and their subsequent invasion by damaging virus diseases they never encountered before. This review focusses on providing historical and up-to-date information about pandemics and major epidemics initiated by spillover of indigenous viruses from infected alternative hosts into introduced crops. This spillover requires new encounters at the managed and natural vegetation interface. The principal virus disease pandemic examples described are two (cassava mosaic, cassava brown streak) that threaten food security in sub-Saharan Africa (SSA), and one (tomato yellow leaf curl) doing so globally. A further example describes a virus disease pandemic threatening a major plantation crop producing a vital food export for West Africa (cacao swollen shoot). Also described are two examples of major virus disease epidemics that threaten SSA’s food security (rice yellow mottle, groundnut rosette). In addition, brief accounts are provided of two major maize virus disease epidemics (maize streak in SSA, maize rough dwarf in Mediterranean and Middle Eastern regions), a major rice disease epidemic (rice hoja blanca in the Americas), and damaging tomato tospovirus and begomovirus disease epidemics of tomato that impair food security in different world regions. For each pandemic or major epidemic, the factors involved in driving its initial emergence, and its subsequent increase in importance and geographical distribution, are explained. Finally, clarification is provided over what needs to be done globally to achieve effective management of severe virus disease pandemics and epidemics initiated by spillover events.
15
Lucio-Zavaleta, E., D. M. Smith, and S. M. Gray. "Variation in Transmission Efficiency Among Barley yellow dwarf virus-RMV Isolates and Clones of the Normally Inefficient Aphid Vector, Rhopalosiphum padi." Phytopathology® 91, no. 8 (August 2001): 792–96. http://dx.doi.org/10.1094/phyto.2001.91.8.792.
Full textAbstract:
The RMV strain of Barley yellow dwarf virus (BYDV-RMV) is an unassigned member of the Luteoviridae that causes barley yellow dwarf in various cereal crops. The virus is most efficiently vectored by the aphid Rhopalosiphum maidis, but can also be vectored with varying efficiency by R. padi and Schizaphis graminum. Field collections of alate aphids migrating into the emerging winter wheat crop in the fall of 1994 in central New York identified a high proportion of R. padi transmitting BYDV-RMV. This prompted a comparison of the BYDV-RMV isolates and the R. padi populations found in the field with type virus and aphid species maintained in the laboratory. A majority of the field isolates of BYDV-RMV were similar to each other and to the type BYDV-RMV isolate in disease severity on oat and in transmission by the laboratory-maintained population of R. maidis and a field-collected population of R. maidis. However, several field populations of R. padi differed in their ability to transmit the various BYDV-RMV isolates. The transmission efficiency of the R. padi clones was increased if acquisition and inoculation feeding periods were allowed at higher temperatures. In addition, the transmission efficiency of BYDV-RMV was significantly influenced by the aphid that inoculated the virus source tissue. In general, BYDV-RMV transmission by R. padi was higher when R. padi was the aphid that inoculated the source tissue than when R. maidis was the inoculating aphid. The magnitude of the change varied among virus isolates and R. padi clones. These results indicate that, under certain environmental conditions, R. padi can play a significant role in the epidemiology of BYDV-RMV. This may be especially significant in regions where corn is a major source of virus and of aphids that can carry virus into a fall-planted wheat crop.
16
Stewart, Lucy R., Jane Todd, Kristen Willie, Deogracious Massawe, and Nitika Khatri. "A Recently Discovered Maize Polerovirus Causes Leaf Reddening Symptoms in Several Maize Genotypes and is Transmitted by Both the Corn Leaf Aphid (Rhopalosiphum maidis) and the Bird Cherry-Oat Aphid (Rhopalosiphum padi)." Plant Disease 104, no. 6 (June 2020): 1589–92. http://dx.doi.org/10.1094/pdis-09-19-2054-sc.
Full textAbstract:
A maize-infecting polerovirus variously named maize yellow dwarf virus RMV2 (MYDV-RMV2) and maize yellow mosaic virus (MaYMV) has been discovered and previously described in East Africa, Asia, and South America. It was identified in virus surveys in these locations instigated by outbreaks of maize lethal necrosis (MLN), known to be caused by coinfections of unrelated maize chlorotic mottle virus (MCMV) and any of several maize-infecting potyviruses, and was often found in coinfections with MLN viruses. Although sequenced in many locations globally and named for symptoms of related or coinfecting viruses, and with an infectious clone reported that experimentally infects Nicotiana benthamiana, rudimentary biological characterization of MaYMV in maize, including insect vector(s) and symptoms in single infections, has not been reported until now. We report isolation from other viruses and leaf tip reddening symptoms in several maize genotypes, along with transmission by two aphids, Rhopalosiphum padi and Rhopalosiphum maidis. This is important information distinguishing this virus and demonstrating that in single infections it causes symptoms distinct from those of potyviruses or MCMV in maize, and identification of vectors provides an important framework for determination of potential disease impact and management.
17
Deng, T. C., C. M. Chou, C. T. Chen, C. H. Tsai, and F. C. Lin. "First Report of Maize chlorotic mottle virus on Sweet Corn in Taiwan." Plant Disease 98, no. 12 (December 2014): 1748. http://dx.doi.org/10.1094/pdis-06-14-0568-pdn.
Full textAbstract:
In February 2014, a severe disease on maize (Zea mays L.) broke out in the fields of central and southwestern Taiwan and caused yield losses in sweet corn production. Chlorotic spots first appeared at the base of infected leaves and later developed into systemic mottling. Diffused necrotic patches were also found on leaves or husks of the diseased plants. Moreover, severe rosetting and stunting accompanied by abnormalities in ear production were observed on mature plants. Eighteen leaf samples from symptomatic plants were collected and submitted to our Plant Diagnostic Clinic for virus diagnosis. All of the samples were first tested by reverse transcriptase (RT)-PCR to detect Maize stripe virus (MSpV) and by indirect ELISA to detect Maize dwarf mosaic virus (MDMV) or Sugarcane mosaic virus (SCMV), which were endemic to this area (1). Only 2 out of 18 samples were positive for MDMV, SCMV, or mixed infection of both viruses. Sap inoculation tests conducted on seedlings of sweet corn cv. Honey 236 indicated that the MDMV- and SCMV-negative samples still had an unknown pathogen causing original symptoms in the receptor plants. The isolate from Yunlin county reacted only with the antibody to Maize chlorotic mottle virus (MCMV) (AC Diagnostics, Fayetteville, AR) in ELISA. For further identification, the MCMV-specific primers (forward: MCMVg3514F-GGGAACAACCTGCTCCA; reverse MCMVg4014R-GGACACGGAGTACGAGA) were designed from the nucleotide sequence of MCMV coat protein (CP) gene. In RT-PCR using the AccuPower RT/PCR PreMix kit (Bioneer, Daejeon, Korea), an expected 500-bp DNA fragment was observed. This PCR product was cloned and its nucleotide sequence was determined by Mission Biotech Co., Taipei, Taiwan. BLAST analysis of the CP gene of the MCMV-Yunlin revealed the maximum nucleotide identities (99%) with Chinese Sichuan isolates (GenBank Accession No. JQ984270) and 98% identities to four Chinese Yunnan isolates (GU138674, JQ982468, JQ982469, and KF010583) and one Kenya isolate (JX286709), compared with 97% to Kansas isolate (X14736) and 96% to Nebraska isolate (EU358605). Subsequently, the complete nucleotide sequence of the viral genome (KJ782300) was determined from five overlapping DNA fragments obtained from independent RT-PCR amplification. The virus isolate was infectious to sweet corn cultivars Bai-long-wang, Devotion, SC-34, SC2015, and Zheng-zi-mi, on which similar symptoms were developed after mechanical inoculation. During the spring of 2014, a total of 224 sweet corn samples were collected from the epidemic areas of Taichung, Yunlin, Chiayi, and Kaohsiung counties. Samples (n= 161) reacted positive for MCMV in ELISA and/or RT-PCR. In the field survey, more than 20 adult thrips might be observed on an MCMV-infected plant. Two species of Frankliniella were found on maize plants: F. williamsi Hood and F. intonsa Trybom. Maize thrips (F. williamsi), an occasional pest of maize occurring during winter and spring in Taiwan, was characterized by its abdominal sternite II on which 1 or 2 discal setae of equal length with posteromarginal setae were borne (2). Samples with 1, 5, 10, and 30 F. williamsi collected in the field were tested by RT-PCR; MCMV was detectable not only in the pooled crushed bodies but also in a single maize thrips. This is the first report of MCMV occurrence on maize in Taiwan and of the virus transmitted by maize thrips. References: (1) C. T. Chen et al. Taiwan Sugar 37(4):9, 1990. (2) C.-L. Wang et al. Zool. Stud. 49:824, 2010.
18
Lenardon, S. L., F. Giolitti, H. G. Welz, and P. Verma. "Occurrence of a Reovirus Infecting Maize in India." Plant Disease 85, no. 1 (January 2001): 99. http://dx.doi.org/10.1094/pdis.2001.85.1.99a.
Full textAbstract:
During the 1998-99 season, maize plants showing viruslike symptoms were observed at two locations in the Andhra Pradesh state in Southern India. Several hybrids were evaluated at Hyderabad in a replicated yield trial and most were affected, with disease incidence ranging from 4.4 to 61.8% of the plants among plots. Hybrid 4642 (Proagro 3-way hybrid, late maturity) and the pre-commercial hybrid YLY102 were the most susceptible, whereas the popular hybrid 4640 was among the least susceptible entries. In seed production fields near Eluru, incidence ranged from 10 to 15% among plots, with the female parent of hybrid 4210 (Proagro 3-way hybrid, early maturity) being especially affected. Symptoms observed in hybrids varied, presumably, according to the infection time and included severe plant dwarfing, dark-green leaves, enations on the lower leaf surface, and small malformed ears with few or no kernels. Symptomatic and asymptomatic field plants (root and leaf tissues) were tested by ds-RNA polyacrylamide gel electrophoresis and by double-antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) with antiserum to Mal de río cuarto virus (MRCV), a Reoviridae-Fijivirus member. MRCV and Maize rough dwarf virus (MRDV) were selected as controls because the symptoms were similar to those caused by these maize viruses (1,2). ds-RNA gels from symptomatic plants showed 10 bands with banding patterns different from those of MRCV or MRDV. DAS-ELISA indicated a distant relationship to MRCV. These results provide evidence of a reovirus infection to maize hybrids in India and suggest that a virus belonging to the family Reoviridae, genus Fijivirus is causing this new disease. The high disease incidence and the severity of symptoms should alert breeders and pathologists in southern Asia about potential yield losses. References: (1) G. Boccardo and R. G. Milne. 1984. Descriptions of Plant Viruses 294. Inst. Hortic. Res., Wellesbourne. (2) C. Marzachi et al. J. Plant Dis. Prot. 106:431–436, 1999.
19
Grilli, Mariano P., and David E. Gorla. "The spatio-temporal pattern of Delphacodes kuscheli (Homoptera: Delphacidae) abundance in central Argentina." Bulletin of Entomological Research 87, no. 1 (February 1997): 45–53. http://dx.doi.org/10.1017/s0007485300036348.
Full textAbstract:
AbstractDelphacodes kuscheli Fennah is the vector of maize rough dwarf virus, that affects maize production in central Argentina. The spatial and temporal abundance pattern of the insect vector was studied from October 1992 to November 1994, within endemic and non-endemic areas of the crop disease. Insect density was estimated every 7–15 days during spring and summer (maize season) or monthly during autumn and winter from high (6 m) and low (1.5 m) sticky traps placed at eight sampling stations along a 300 km transect. Each year, D. kuscheli density increased from October, peaked in December, to decrease afterwards and disappear in May. Density was lower in the nonendemic area and higher in the endemic one. The average absolute difference of density between sampling station pairs increased with the distance between the sampling stations (R2=0.85), and the correlation of density changes decreased with the distance between the sampling stations (R2=0.78), suggesting that the population dynamics were affected more by local than by regional factors. There was a significant correlation (with a 36 days lag) between the normalized difference vegetation index (NDVI) (calculated from 15 days maximum value composites images of NOAA-11 meteorological satellites) and D. kuscheli abundance. Based on this regression model, and using the time series of the satellite derived NDVI values, maps of the distribution and abundance of D. kuscheli within the study area for the spring and summer of 1992 were produced.
20
Wang, Q., X. P. Zhou, and J. X. Wu. "First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum)." Plant Disease 98, no. 4 (April 2014): 572. http://dx.doi.org/10.1094/pdis-07-13-0727-pdn.
Full textAbstract:
The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.
21
Xu, Zhennan, Feifei Wang, Zhiqiang Zhou, Qingchang Meng, Yanping Chen, Xiaohua Han, Shuanggui Tie, et al. "Identification and Fine-Mapping of a Novel QTL qMrdd2 Conferring Resistance to Maize Rough Dwarf Disease." Plant Disease, June 16, 2021. http://dx.doi.org/10.1094/pdis-03-20-0495-re.
Full textAbstract:
Maize rough dwarf disease (MRDD), caused by a virus, seriously affects maize quality and yield worldwide. MRDD can be most effectively controlled with disease-resistant hybrids of corn. Here, MRDD-resistant (Qi319) and -susceptible (Ye478) parental inbred maize lines and their 314 recombinant inbred lines (RILs) that were derived from a cross between them were evaluated across three environments. A stable resistance QTL, qMrdd2, was identified and mapped using BLUP values to a 0.55 Mb region between the markers MK807 and MK811 on chromosome 2 (B73 RefGen_v3), which was found to explain 8.6 to 11.0% of the total phenotypic variance in MRDD resistance. We validated the effect of qMrdd2 using a chromosome segment substitution line (CSSL) that was derived from a cross between maize inbred Qi319 as the MRDD resistance donor and Ye478 as the recipient. Disease severity index of the CSSL haplotype II harboring qMrdd2 was significantly lower than that of the susceptible parent Ye478. Subsequently, we fine-mapped qMrdd2 to a 315 kb region flanked by the markers RD81 and RD87 by testing recombinant-derived progeny using selfed backcrossed families. In this study, we identified a novel QTL for MRDD-resistance by combining the RIL and CSSL populations, which can be used to breed for MRDD resistant varieties of maize. Keywords: Maize, Maize rough dwarf disease, QTL, Fine-mapping, Recombinant inbred line, Chromosome segment substitution line.
22
Clemente-Orta, Gemma, Ramon Albajes, Iván Batuecas, and M. A. Achon. "Planting period is the main factor for controlling maize rough dwarf disease." Scientific Reports 11, no. 1 (January 13, 2021). http://dx.doi.org/10.1038/s41598-020-79994-5.
Full textAbstract:
AbstractMaize rough dwarf virus (MRDV) is one of the main yield-limiting factors of maize in the Mediterranean. However, knowledge about the interactions between the agroecosystem and the virus–vector–host relationship continues to be limited. We used multi-model inference to test a landscape-scale approach together with variables measured in the field, and we estimated the effects of early and late planting on MRDV incidence. The results revealed that the virus incidence increased by 3% when the planting was delayed, and this increase was coincident with the first peak of the vector population. The variables at the field and landscape scales with a strong effect on virus incidence were the proportions of grasses in adjacent crops, in uncultivated areas, and in edges close to maize plants. Grass plant cover in the edges also affected virus incidence, but these effects varied with the planting period. These findings provide new insights into the causes of MRDV incidence and may provide some guidance to growers to reduce losses caused by the virus. Among the recommendations to be prioritized are early planting, management of grasses at field edges, and non-overlapping cultivation of maize and winter cereals in the same area.
23
"Actual Outbreak Status of Rice Black-streaked Dwarf Virus Disease in Forage Corn of Korea." Journal of The Korean Society of Grassland and Forage Science 28, no. 3 (September 30, 2008): 221–28. http://dx.doi.org/10.5333/kgfs.2008.28.3.221.
Full text