Journal articles: 'Degenerate Oligonucleotide Primed PCR'

7

Barbaux, Sandrine, Odette Poirier, and François Cambien. "Use of degenerate oligonucleotide primed PCR (DOP-PCR) for the genotyping of low-concentration DNA samples." Journal of Molecular Medicine 79, no. 5-6 (2001): 329–32. http://dx.doi.org/10.1007/s001090100214.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Isagi, Y., M. Honjo, and I. Washitani. "Development of microsatellite markers for Primula sieboldii using degenerate oligonucleotide-primed PCR-amplified DNA." Molecular Ecology Notes 1, no. 1-2 (2001): 22–24. http://dx.doi.org/10.1046/j.1471-8278.2000.00009.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Jamshidian-Mojaver, M., S.-E. Tabatabaeizadeh, M. Naeemipour, H. R. Farzin, and M. R. Bassami. "Use of degenerate oligonucleotide primed polymerase chain reaction for detection of chicken anaemia virus contamination in avian viral vaccines." BULGARIAN JOURNAL OF VETERINARY MEDICINE 23, no. 3 (2020): 304–9. http://dx.doi.org/10.15547/bjvm.2230.

Full text

Abstract:

For quality control of biologicals of veterinary use, the absence of extraneous agents needs to be certified. One of the requirements for quality control of avian viral vaccines is to demonstrate freedom from extraneous and adventitious pathogenic agents, like chicken anaemia virus (CAV). In this study, a degenerate oligonucleotide primed PCR (DOP-PCR) for the detection of CAV was developed. Degenerate oligonucleotide primers were selected based on sequences corresponding to conserved regions of VP1 gene. After spiking of CAV genomic DNA to an infectious laryngotracheitis virus (ILTV) vaccine, detection limit for the test was 3.056×10-9 ng/µl. To evaluate the performance of the test, 11 avian viral vaccines including infectious bronchitis virus (IBV), newcastle disease virus (NDV), infectious bursal disease virus (IBDV) and ILTV vaccines from 5 manufacturers were screened for CAV and no contamination was detected. The test described here may provide a rapid, sensitive and specific method for contamination detection of avian viral vaccines with CAV, and may be applied for quality control of live and killed commercial vaccines.

APA, Harvard, Vancouver, ISO, and other styles

10

Larsen, Jacob, Anne Marie Ottesen, Maria Kirchhoff, Claes Lundsteen, and Jørgen K. Larsen. "High Resolution Comparative Genomic Hybridization Detects 7–8 Megabasepair Deletion in PCR Amplified DNA1." Analytical Cellular Pathology 23, no. 2 (2001): 61–64. http://dx.doi.org/10.1155/2001/301570.

Full text

Abstract:

We investigated if any change in spatial resolution of comparative genomic hybridization analysis could be detected when using DNA amplified by degenerate oligonucleotide primed PCR (DOP‐PCR) as opposed to the use of unamplified DNA. Five DNA samples from B‐cell leukemias with small 11q deletions were amplified by DOP‐PCR and analysed by means of high resolution comparative genomic hybridization (HR‐CGH) for the evaluation of aberration size detection limit. By means of HR‐CGH, we found the detection limit of DOP‐PCR CGH for deletions to be between 3 Mbp and 7–8 Mbp.

APA, Harvard, Vancouver, ISO, and other styles

11

Lee, Ji-Young, Young-Nyun Park, Kyung-Ok Uhm, Soo-Yeun Park, and Sun-Hwa Park. "Genetic Alterations in Intrahepatic Cholangiocarcinoma as revealed by Degenerate Oligonucleotide Primed PCR-Comparative Genomic Hybridization." Journal of Korean Medical Science 19, no. 5 (2004): 682. http://dx.doi.org/10.3346/jkms.2004.19.5.682.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Sanchez-Cespedes, Montserrat, Paul Cairns, Jin Jen, and David Sidransky. "Degenerate Oligonucleotide-Primed PCR (DOPPCR): Evaluation of its Reliability for Screening of Genetic Alterations in Neoplasia." BioTechniques 25, no. 6 (1998): 1036–38. http://dx.doi.org/10.2144/98256cr01.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Hoebee, B., J. M. de Stoppelaar, R. F. Suijkerbuijk, and S. Monard. "Isolation of rat chromosome-specific paint probes by bivariate flow sorting followed by degenerate oligonucleotide primed-PCR." Cytogenetic and Genome Research 66, no. 4 (1994): 277–82. http://dx.doi.org/10.1159/000133712.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Huang, Qiang, Stimson P. Schantz, Pulivarthi H. Rao, Juan Mo, Steven A. McCormick, and R. S. K. Chaganti. "Improving degenerate oligonucleotide primed PCR-comparative genomic hybridization for analysis of DNA copy number changes in tumors." Genes, Chromosomes and Cancer 28, no. 4 (2000): 395–403. http://dx.doi.org/10.1002/1098-2264(200008)28:4<395::aid-gcc5>3.0.co;2-j.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Pich, Uta, Andreas Houben, Jörg Fuchs, Armin Meister, and Ingo Schubert. "Utility of DNA amplified by degenerate oligonucleotide-primed PCR (DOP-PCR) from the total genome and defined chromosomal regions of field bean." Molecular and General Genetics MGG 243, no. 2 (1994): 173–77. http://dx.doi.org/10.1007/bf00280314.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Jin, F., CD Matthews, and N. Hussey. "P-11. Study on amplification uniformity of whole genome DNA in a single cell by degenerate oligonucleotide-primed PCR." Reproductive BioMedicine Online 4 (January 2002): 44. http://dx.doi.org/10.1016/s1472-6483(12)60094-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Van, Kyujung, Yang Jae Kang, Sang Rea Shim, and Suk-Ha Lee. "Genome-wide scan of the soybean genome using degenerate oligonucleotide primed PCR: an example for studying large complex genome structure." Genes & Genomics 34, no. 5 (2012): 467–74. http://dx.doi.org/10.1007/s13258-011-0238-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

JIN, Fan. "SINGLE CELL DEGENERATE OLIGONUCLEOTIDE PRIMER-PCR AND COMPARATIVE GENOMIC HYBRIDIZATION WITH MODIFIED CONTROL REFERENCE." Journal of Zhejiang University SCIENCE 2, no. 3 (2001): 318. http://dx.doi.org/10.1631/jzus.2001.0318.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Li, Ya-zhong, Xiao-dan Li, Yu-mei Jiang, Ren Wang та Bing Xia. "Cloning and Heterologous Expression of a New 3ʹ-Hydroxylase Gene from Lycoris radiata". Zeitschrift für Naturforschung C 64, № 1-2 (2009): 138–42. http://dx.doi.org/10.1515/znc-2009-1-222.

Full text

Abstract:

A full-length cDNA (LC3ʹH) was obtained from a cDNA library of Lycoris radiata by DOP-PCR (degenerate oligonucleotide primer PCR), 3ʹrace and 5ʹrace methods. Compared with the other reported enzymes from different plants, the deduced amino acid sequence of LC3ʹH exhibits significant homologies to 3ʹ-hydroxylases that are involved in the caffeic acid biosynthesis. These findings suggest that the new gene is closely related to the biosynthesis of caffeic acid, which is also an important step of the galanthamine biosynthesis in Amaryllidaceae plants.

APA, Harvard, Vancouver, ISO, and other styles

20

Green, E. K., S. C. Bain, P. J. Day, et al. "Detection of human apolipoprotein E3, E2, and E4 genotypes by an allele-specific oligonucleotide-primed polymerase chain reaction assay: development and validation." Clinical Chemistry 37, no. 7 (1991): 1263–68. http://dx.doi.org/10.1093/clinchem/37.7.1263.

Full text

Abstract:

Abstract A polymerase chain reaction (PCR) assay has been developed and validated by using allele-specific oligonucleotide (ASO) primers to specifically amplify E3, E2, and E4 polymorphic sequences of the human apolipoprotein E (apo E) genes. Degenerate ASOs containing one or two additional 3' mismatches provided greater specificity than did ASOs containing a single mid-sequence or 3' allele-specific mismatch with plasmid pEB4 or genomic DNA as template. Optimal specificity and efficiency of amplification did not correlate with primer annealing conditions, whether determined theoretically or via oligo-melting experiments. Pre-cycling denaturation times and high cycling denaturation temperatures were also required for optimal amplification, presumably because of the high G:C content (75-85%) of apo E gene sequences. Conditions permissive for amplification and discrimination with plasmid DNA did not transpose favorably to amplification from human genomic DNA from peripheral blood leukocytes; the latter required nested primer reactions. These data may be valuable in predicting PCR assay conditions for other G:C-rich sequences containing polymorphic sequence differences. The assay described is both more accurate and rapid (24 h) than previously described methods for phenotyping or genotyping human apo E from blood specimens.

APA, Harvard, Vancouver, ISO, and other styles

21

Scutt, Charles P., Yasuko Kamisugi, Philip M. Gilmartin, and Fukumi Sakai. "Laser isolation of plant sex chromosomes: studies on the DNA composition of the X and Y sex chromosomes of Silene latifolia." Genome 40, no. 5 (1997): 705–15. http://dx.doi.org/10.1139/g97-793.

Full text

Abstract:

X and Y sex chromosomes from the dioecious plant Silene latifolia (white campion) were isolated from mitotic metaphase chromosome preparations on polyester membranes. Autosomes were ablated using an argon ion laser microbeam and isolated sex chromosomes were then recovered on excised fragments of polyester membrane. Sex chromosome associated DNA sequences were amplified using the degenerate oligonucleotide primed polymerase chain reaction (DOP–PCR) and pools of DOP–PCR products were used to investigate the genomic organization of the S. latifolia sex chromosomes. The chromosomal locations of cloned sex chromosome repeat sequences were analysed by fluorescence in situ hybridization and data complementary to laser ablation studies were obtained by genomic in situ hybridization. In combination, these studies demonstrate that the X and Y sex chromosomes of S. latifolia are of very similar DNA composition and also that they share a significant repetitive DNA content with the autosomes. The evolution of sex chromosomes in Silene is discussed and compared with that in another dioecious species, Rumex acetosa.Key words: FISH, GISH, laser-microdissection, sex chromosome, Silene latifolia.

APA, Harvard, Vancouver, ISO, and other styles

22

Arneson, Nona, Juan Moreno, Vladimir Iakovlev, et al. "Comparison of Whole Genome Amplification Methods for Analysis of DNA Extracted from Microdissected Early Breast Lesions in Formalin-Fixed Paraffin-Embedded Tissue." ISRN Oncology 2012 (March 14, 2012): 1–10. http://dx.doi.org/10.5402/2012/710692.

Full text

Abstract:

To understand cancer progression, it is desirable to study the earliest stages of its development, which are often microscopic lesions. Array comparative genomic hybridization (aCGH) is a valuable high-throughput molecular approach for discovering DNA copy number changes; however, it requires a relatively large amount of DNA, which is difficult to obtain from microdissected lesions. Whole genome amplification (WGA) methods were developed to increase DNA quantity; however their reproducibility, fidelity, and suitability for formalin-fixed paraffin-embedded (FFPE) samples are questioned. Using aCGH analysis, we compared two widely used approaches for WGA: single cell comparative genomic hybridization protocol (SCOMP) and degenerate oligonucleotide primed PCR (DOP-PCR). Cancer cell line and microdissected FFPE breast cancer DNA samples were amplified by the two WGA methods and subjected to aCGH. The genomic profiles of amplified DNA were compared with those of non-amplified controls by four analytic methods and validated by quantitative PCR (Q-PCR). We found that SCOMP-amplified samples had close similarity to non-amplified controls with concordance rates close to those of reference tests, while DOP-amplified samples had a statistically significant amount of changes. SCOMP is able to amplify small amounts of DNA extracted from FFPE samples and provides quality of aCGH data similar to non-amplified samples.

APA, Harvard, Vancouver, ISO, and other styles

23

Hirose, Yuichi, Kenneth Aldape, Michelle Takahashi, Mitchel S. Berger, and Burt G. Feuerstein. "Tissue Microdissection and Degenerate Oligonucleotide Primed-Polymerase Chain Reaction (DOP-PCR) Is an Effective Method to Analyze Genetic Aberrations in Invasive Tumors." Journal of Molecular Diagnostics 3, no. 2 (2001): 62–67. http://dx.doi.org/10.1016/s1525-1578(10)60653-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Deng, Chuanliang, Lili Bai, Shufen Li, et al. "DOP–PCR based painting of rye chromosomes in a wheat background." Genome 57, no. 9 (2014): 473–79. http://dx.doi.org/10.1139/gen-2014-0110.

Full text

Abstract:

To determine the appropriateness of chromosome painting for identifying genomic elements in rye, we microdissected the 1R and 1RS chromosomes from rye (Secale cereale L. var. King II) and wheat–rye addition line 1RS, respectively. Degenerate oligonucleotide primed – polymerase chain reaction (DOP–PCR) amplification of 1R and 1RS products from dissected chromosomes were used as probes to hybridize to metaphase chromosomes of rye, wheat–rye addition lines 1R and 1RS, translocation line 1RS.1BL, and allohexaploid triticale. The results showed that (i) the hybridization signal distribution patterns on rye chromosomes using 1R-derived DOP–PCR products as the probe were similar to those using 1RS-derived DOP–PCR products as the probe; (ii) 1R and (or) 1RS could not be distinguished from other rye chromosomes solely by the hybridization patterns using 1R- and (or) 1RS-derived DOP–PCR products as the probe; (iii) rye chromosomes and (or) rye chromosome fragments could be clearly identified in wheat–rye hybrids using either 1R- or 1RS-derived DOP–PCR products as the probe and could be more accurate in the nontelomeric region than using genomic in situ hybridization (GISH). Our results suggested that 1R- and (or) 1RS-derived DOP–PCR products contain many repetitive DNA sequences, are similar on different rye chromosomes, are R-genome specific, and can be used to identify rye chromosomes and chromosome fragments in wheat–rye hybrids. Our research widens the application range of chromosome painting in plants.

APA, Harvard, Vancouver, ISO, and other styles

25

Provencher, Cathy, GisÃ¯Â¿Â½le LaPointe, StÃ¯Â¿Â½phane Sirois, Marie-Rose Van Calsteren, and Denis Roy. "Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Priming Glycosyltransferase Genes of the Exopolysaccharide Locus in Strains of the Lactobacillus casei Group." Applied and Environmental Microbiology 69, no. 6 (2003): 3299–307. http://dx.doi.org/10.1128/aem.69.6.3299-3307.2003.

Full text

Abstract:

ABSTRACT A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes.

APA, Harvard, Vancouver, ISO, and other styles

26

CULLINGFORD, E. Tim, T. Colin DOLPHIN, K. Kishore BHAKOO, Stefan PEUCHEN, Laura CANEVARI, and B. John CLARK. "Molecular cloning of rat mitochondrial 3-hydroxy-3-methylglutaryl-CoA lyase and detection of the corresponding mRNA and of those encoding the remaining enzymes comprising the ketogenic 3-hydroxy-3-methylglutaryl-CoA cycle in central nervous system of suckling rat." Biochemical Journal 329, no. 2 (1998): 373–81. http://dx.doi.org/10.1042/bj3290373.

Full text

Abstract:

We have investigated, by RNase protection assays in rat brain regions and primary cortical astrocyte cultures, the presence of the mRNA species encoding the three mitochondrially located enzymes acetoacetyl-CoA thiolase, mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase (mt. HMG-CoA synthase) and HMG-CoA lyase (HMG-CoA lyase) that together constitute the ketogenic HMG-CoA cycle. As a prerequisite we obtained a full-length cDNA encoding rat HMG-CoA lyase by degenerate oligonucleotide-primed PCR coupled to a modification of PCR-rapid amplification of cDNA ends (PCR-RACE). We report here: (1) the nucleotide sequence of rat mt. HMG-CoA lyase, (2) detection of the mRNA species encoding all three HMG-CoA cycle enzymes in all regions of rat brain during suckling, (3) approximately twice the abundance of mt. HMG-CoA synthase mRNA in cerebellum than in cortex in 11-day-old suckling rat pups, (4) significantly lower abundances of mt. HMG-CoA synthase mRNA in brain regions derived from rats weaned to a high-carbohydrate/low-fat diet compared with the corresponding regions derived from the suckling rat, and (5) the presence of mt. HMG-CoA synthase mRNA in primary cultures of neonatal cortical astrocytes at an abundance similar to that found in liver of weaned animals. These results provide preliminary evidence that certain neural cell types possess ketogenic potential and might thus have a direct role in the provision of fatty acid-derived ketone bodies during the suckling period.

APA, Harvard, Vancouver, ISO, and other styles

27

Zhou, Jian, Shaojing Wang, Li'ang Yu, et al. "Cloning and physical localization of male-biased repetitive DNA sequences in Spinacia oleracea (Amaranthaceae)." Comparative Cytogenetics 15, no. 2 (2021): 101–18. http://dx.doi.org/10.3897/compcytogen.v15i2.63061.

Full text

Abstract:

Spinach (Spinacia oleracea Linnaeus, 1753) is an ideal material for studying molecular mechanisms of early-stage sex chromosome evolution in dioecious plants. Degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR) technique facilitates the retrotransposon-relevant studies by enriching specific repetitive DNA sequences from a micro-dissected single chromosome. We conducted genomic subtractive hybridization to screen sex-biased DNA sequences by using the DOP-PCR amplification products of micro-dissected spinach Y chromosome. The screening yielded 55 male-biased DNA sequences with 30 576 bp in length, of which, 32 DNA sequences (12 049 bp) contained repeat DNA sequences, including LTR/Copia, LTR/Gypsy, simple repeats, and DNA/CMC-EnSpm. Among these repetitive DNA sequences, four DNA sequences that contained a fragment of Ty3-gypsy retrotransposons (SP73, SP75, SP76, and SP77) were selected as fluorescence probes to hybridization on male and female spinach karyotypes. Fluorescence in situ hybridization (FISH) signals of SP73 and SP75 were captured mostly on the centromeres and their surrounding area for each homolog. Hybridization signals primarily appeared near the putative centromeres for each homologous chromosome pair by using SP76 and SP77 probes for FISH, and sporadic signals existed on the long arms. Results can be served as a basis to study the function of repetitive DNA sequences in sex chromosome evolution in spinach.

APA, Harvard, Vancouver, ISO, and other styles

28

Zhou, Jian, Shaojing Wang, Li'ang Yu, et al. "Cloning and physical localization of male-biased repetitive DNA sequences in Spinacia oleracea (Amaranthaceae)." Comparative Cytogenetics 15, no. 2 (2021): 101–18. http://dx.doi.org/10.3897/compcytogen.v15.i2.63061.

Full text

Abstract:

Spinach (Spinacia oleracea Linnaeus, 1753) is an ideal material for studying molecular mechanisms of early-stage sex chromosome evolution in dioecious plants. Degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR) technique facilitates the retrotransposon-relevant studies by enriching specific repetitive DNA sequences from a micro-dissected single chromosome. We conducted genomic subtractive hybridization to screen sex-biased DNA sequences by using the DOP-PCR amplification products of micro-dissected spinach Y chromosome. The screening yielded 55 male-biased DNA sequences with 30 576 bp in length, of which, 32 DNA sequences (12 049 bp) contained repeat DNA sequences, including LTR/Copia, LTR/Gypsy, simple repeats, and DNA/CMC-EnSpm. Among these repetitive DNA sequences, four DNA sequences that contained a fragment of Ty3-gypsy retrotransposons (SP73, SP75, SP76, and SP77) were selected as fluorescence probes to hybridization on male and female spinach karyotypes. Fluorescence in situ hybridization (FISH) signals of SP73 and SP75 were captured mostly on the centromeres and their surrounding area for each homolog. Hybridization signals primarily appeared near the putative centromeres for each homologous chromosome pair by using SP76 and SP77 probes for FISH, and sporadic signals existed on the long arms. Results can be served as a basis to study the function of repetitive DNA sequences in sex chromosome evolution in spinach.

APA, Harvard, Vancouver, ISO, and other styles

29

Sharbel, Timothy F., David M. Green, and Andreas Houben. "B-chromosome origin in the endemic New Zealand frog Leiopelma hochstetteri through sex chromosome devolution." Genome 41, no. 1 (1998): 14–22. http://dx.doi.org/10.1139/g97-091.

Full text

Abstract:

The endemic New Zealand frog Leiopelma hochstetteri has variable numbers of mitotically stable B chromosomes. To assess whether the B chromosomes were derived from the autosome complement, they were isolated by micromanipulation and their DNA amplified by degenerate oligonucleotide primed PCR. Southern hybridizations of B chromosome DNA probes to genomic DNA from males and females characterized by differing numbers of B chromosomes demonstrated that the B chromosomes were derived from the univalent W sex chromosome characteristic of North Island populations. The presence of homologous B chromosome specific sequences from geographically distinct populations indicates a single origin of the B chromosomes. Furthermore, a primitive homology shared by B chromosomes and the W sex chromosome from an ancestral WZ/ZZ karyotype, which is still present in frogs from Great Barrier Island, shows that the B chromosomes originated soon after the univalent W sex chromosome had originated. Sequence analysis revealed that B chromosome DNA is composed of repeat sequences and has the potential to form stable hairpin structures. The molecular dynamics of these structures may reflect an inherent propensity to undergo rapid change in nucleotide sequence and chromosome structure.

APA, Harvard, Vancouver, ISO, and other styles

30

Patreze, C. M., D. B. Felix, F. R. Scarano, and M. Alves-Ferreira. "Isolating of a putative glyceraldehyde-3 phosphate dehydrogenase (GAPDH) from Calophyllum brasiliense, an important tropical forest tree." Silvae Genetica 61, no. 1-6 (2012): 44–51. http://dx.doi.org/10.1515/sg-2012-0006.

Full text

Abstract:

Abstract Calophyllum brasiliense Cambess. has characteristics that made it an excellent candidate model for ecogenomics in rain forest trees such as widespread natural occurrence and geographical patterns of adaptive genetic variation. Besides, it is also becoming a popular species for reforestation efforts in Brazil. Although, very little is known about its genetic diversity and the molecular mechanisms involved genetic adaptation traits. The first difficulty in launching genetic studies in a wild wood species is the lack of an optimized protocol for RNA and DNA isolation. In this work we built the essential framework for molecular genetics research with C. brasiliense comparing four distinct methods of RNA extraction from of three different tissues: leaves, stems and roots. We also were successful in the isolation of genomic DNA by an optimized CTAB method. Finally, degenerated oligonucleotide primers were designed for isolating of the glyceraldehyde-3 phosphate dehydrogenase (GAPDH) gene of C. brasiliense from the corresponding gene in closely related species. This gene is commonly used in plants as reference in expression gene analysis by Reverse Transcription Polymerase Chain Reaction (RT-PCR). Primers for RT-PCR were designed based on partial sequence obtained using degenerate primers designed. The optimized methods of RNA and DNA extraction combined with the identification, isolation and specific primer design for RT-PCR of a traditional Reference Gene provide the essential framework for molecular genetics research with C. brasiliense.

APA, Harvard, Vancouver, ISO, and other styles

31

Franke, Sabine, Iwona Wlodarska, Brigitte Maes, et al. "Lymphocyte predominance Hodgkin disease is characterized by recurrent genomic imbalances." Blood 97, no. 6 (2001): 1845–53. http://dx.doi.org/10.1182/blood.v97.6.1845.

Full text

Abstract:

Single-cell polymerase chain reaction (PCR) has been used as a tool to demonstrate clonality and B-cell origin of Reed-Sternberg (RS) cells in Hodgkin disease (HD). An analogous approach was used to investigate genomic imbalances in a (cyto)genetically poorly characterized subentity: lymphocyte predominance Hodgkin disease (LPHD). Nineteen cases of LPHD were selected for a comparative genomic hybridization (CGH) study. CGH was performed with degenerate oligonucleotide primed–PCR (DOP-PCR)–amplified DNA from 4-5 microdissected CD20+ malignant cells. All analyzed cases revealed a high number of genomic imbalances (average 10.8 per case), involving all chromosomes but the excluded 19, 22, and Y, indicating a high complexity of LPHD. The majority of detected aberrations were recurrent. Gain of 1, 2q, 3, 4q, 5q, 6, 8q, 11q, 12q, and X, and loss of chromosome 17 were identified in 36.8% to 68.4% of the analyzed cases. Some of them have also been found in non-Hodgkin lymphoma (NHL), and possibly represent secondary changes associated with disease progression. Gain of 2q, 4q, 5q, 6, 11q, however, are much more rarely observed in NHL and could be more specifically associated with LPHD. Particularly interesting is a frequent overrepresentation of chromosome arm 6q, a region usually deleted in NHL. Rearrangement of theBCL6 gene (3q27) demonstrated by cytogenetics and fluorescence in situ hybridization in 2 cases in this study suggests its contribution in pathogenesis of LPHD. In conclusion, the data show a consistent occurrence of genomic alterations in LPHD and highlight genomic regions that might be relevant for development and/or progression of this lymphoma entity.

APA, Harvard, Vancouver, ISO, and other styles

32

Cheng, Ya-Ming, and Bor-Yaw Lin. "Cloning and Characterization of Maize B Chromosome Sequences Derived From Microdissection." Genetics 164, no. 1 (2003): 299–310. http://dx.doi.org/10.1093/genetics/164.1.299.

Full text

Abstract:

Abstract Isolation of sequences from the maize B chromosome is always hampered by its high homology with the normal complements. In this study, this handicap was overcome by cloning the sequences from the pachytene B chromosomes dissected out of a slide by a micromanipulator followed by degenerate oligonucleotide-primed PCR. The isolated sequences were found to hybridize with genomic DNA in a B-dosage-dependent manner and with the pachytene B chromosome by fluorescence in situ hybridization (FISH), corroborating their B origin. A total of 19 B sequences were isolated, all of which are repetitive and, with one exception, are homologous to the A chromosome(s). Three sequences have strong homology to maize sequences that include two knob repeats and one zein gene (noncoding region), and 10 others are homologous to the noncoding region of Adh1, Bz1, Gag, Zein, and B centromere to a lesser degree. Six sequences have no homology to any gene. In addition to FISH, the B-specific sequence and a partially B-specific one were also mapped, by seven newly characterized TB-10L translocations, to a similar location on the central portion of the distal heterochromatic region, spreading over a region of about one-third of the B chromosome.

APA, Harvard, Vancouver, ISO, and other styles

33

Zitzelsberger, H., Ulrike Kulka, Lars Lehmann, et al. "Genetic heterogeneity in a prostatic carcinoma and associated prostatic intraepithelial neoplasia as demonstrated by combined use of laser-microdissection, degenerate oligonucleotide primed PCR and comparative genomic hybridization." Virchows Archiv 433, no. 4 (1998): 297–304. http://dx.doi.org/10.1007/s004280050252.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

de Sá, Patricia B., Wendy M. Havens, and Said A. Ghabrial. "Characterization of a Novel Broad-Spectrum Antifungal Protein from Virus-Infected Helminthosporium (Cochliobolus) victoriae." Phytopathology® 100, no. 9 (2010): 880–89. http://dx.doi.org/10.1094/phyto-100-9-0880.

Full text

Abstract:

A broad-spectrum anti-fungal protein of ≈10 kDa, designated victoriocin, was purified from culture filtrates of a virus-infected isolate of the plant-pathogenic fungus Helminthosporium victoriae (teleomorph: Cochliobolus victoriae) by a multistep procedure involving ultrafiltration and reverse-phase high-performance liquid chromatography (RP-HPLC). Amino acid sequences, obtained by automated Edman degradation sequencing of RP-HPLC-purified victoriocin-derived peptides, were used to design primers for degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR) amplification from H. victoriae DNA and cDNA templates. An open reading frame coding for a victoriocin precursor of 183 amino acids with calculated molecular mass of ≈20 kDa was amplified by PCR from H. victoriae genomic DNA but not from the control fungus Penicillium chrysogenum. Southern hybridization analysis confirmed the presence of the victoriocin gene in all H. victoriae strains tested. Sequence analysis indicated that victoriocin has a sequence motif similar to that found in scorpion short toxin/charybdotoxin and a consensus sequence similar to that found in defensins. Victoriocin, like some other antifungal proteins, including the totivirus-encoded killer proteins, is predicted to be expressed in vivo as a preprotoxin precursor consisting of a hydrophobic N-terminal secretion signal followed by a pro-region and terminating in a classical Kex2p endopeptidase cleavage site that generates the N terminus of the mature victoriocin. A putative cell wall protein of ≈30 kDa (P30) co-purified with victoriocin from cultural filtrates. The potential role of P30 in the antifungal activity of H. victoriae culture filtrates is discussed.

APA, Harvard, Vancouver, ISO, and other styles

35

Willhoeft, Ute, Jutta Mueller-Navia, and Gerald Franz. "Analysis of the sex chromosomes of the Mediterranean fruit fly by microdissected DNA probes." Genome 41, no. 1 (1998): 74–78. http://dx.doi.org/10.1139/g97-102.

Full text

Abstract:

In the Mediterranean fruit fly, Ceratitis capitata, the sex-determining region maps to the long arm of the Y chromosome. DNA from this region of the Y chromosome and, for comparison, from the tip of the long arm of the X chromosome, was isolated by microdissection and amplified by degenerate oligonucleotide primer PCR (DOP-PCR). FISH of the Y-chromosomal microdissection products medY1-medY5 to mitotic chromosomes revealed hybridization signals on most of the long arm of the Y chromosome, including the male-determining region, and on the long arm of the X chromosome, as well as weaker signals on the autosomes, some of which were located in the heterochromatin next to the centromeres. The X-chromosomal microdissected probe medX1 revealed strong signals on the sex chromosomes and randomly distributed signals on the autosomes. Chromosomal in situ suppression hybridization indicates that the Y chromosome contains considerable amounts of Y-enriched and Y-specific sequences and that X-enriched sequences are present on the long arm of the X chromosome. The microdissected probes medY1, medY2, and medX1 hybridize to the sex chromosomes of two closely related species,Ceratitis rosa and Trirhithrum coffeae.

APA, Harvard, Vancouver, ISO, and other styles

36

Staiber, Wolfgang. "Molecular evolution of homologous gene sequences in germline-limited and somatic chromosomes of Acricotopus." Genome 47, no. 4 (2004): 732–41. http://dx.doi.org/10.1139/g04-026.

Full text

Abstract:

The origin of germline-limited chromosomes (Ks) as descendants of somatic chromosomes (Ss) and their structural evolution was recently elucidated in the chironomid Acricotopus. The Ks consist of large S-homologous sections and of heterochromatic segments containing germline-specific, highly repetitive DNA sequences. Less is known about the molecular evolution and features of the sequences in the S-homologous K sections. More information about this was received by comparing homologous gene sequences of Ks and Ss. Genes for 5.8S, 18S, 28S, and 5S ribosomal RNA were choosen for the comparison and therefore isolated first by PCR from somatic DNA of Acricotopus and sequenced. Specific K DNA was collected by microdissection of monopolar moving K complements from differential gonial mitoses and was then amplified by degenerate oligonucleotide primer (DOP)-PCR. With the sequence data of the somatic rDNAs, the homologous 5.8S and 5S rDNA sequences were isolated by PCR from the DOP-PCR sequence pool of the Ks. In addition, a number of K DOP-PCR sequences were directly cloned and analysed. One K clone contained a section of a putative N-acetyltransferase gene. Compared with its homolog from the Ss, the sequence exhibited few nucleotide substitutions (99.2% sequence identity). The same was true for the 5.8S and 5S sequences from Ss and Ks (97.5%100% identity). This supports the idea that the S-homologous K sequences may be conserved and do not evolve independently from their somatic homologs. Possible mechanisms effecting such conservation of S-derived sequences in the Ks are discussed.Key words: microdissection, DOP-PCR, germline-limited chromosomes, molecular evolution.

APA, Harvard, Vancouver, ISO, and other styles

37

Pereyra, L. P., S. R. Hiibel, M. V. Prieto Riquelme, K. F. Reardon, and A. Pruden. "Detection and Quantification of Functional Genes of Cellulose- Degrading, Fermentative, and Sulfate-Reducing Bacteria and Methanogenic Archaea." Applied and Environmental Microbiology 76, no. 7 (2010): 2192–202. http://dx.doi.org/10.1128/aem.01285-09.

Full text

Abstract:

ABSTRACT Cellulose degradation, fermentation, sulfate reduction, and methanogenesis are microbial processes that coexist in a variety of natural and engineered anaerobic environments. Compared to the study of 16S rRNA genes, the study of the genes encoding the enzymes responsible for these phylogenetically diverse functions is advantageous because it provides direct functional information. However, no methods are available for the broad quantification of these genes from uncultured microbes characteristic of complex environments. In this study, consensus degenerate hybrid oligonucleotide primers were designed and validated to amplify both sequenced and unsequenced glycoside hydrolase genes of cellulose-degrading bacteria, hydA genes of fermentative bacteria, dsrA genes of sulfate-reducing bacteria, and mcrA genes of methanogenic archaea. Specificity was verified in silico and by cloning and sequencing of PCR products obtained from an environmental sample characterized by the target functions. The primer pairs were further adapted to quantitative PCR (Q-PCR), and the method was demonstrated on samples obtained from two sulfate-reducing bioreactors treating mine drainage, one lignocellulose based and the other ethanol fed. As expected, the Q-PCR analysis revealed that the lignocellulose-based bioreactor contained higher numbers of cellulose degraders, fermenters, and methanogens, while the ethanol-fed bioreactor was enriched in sulfate reducers. The suite of primers developed represents a significant advance over prior work, which, for the most part, has targeted only pure cultures or has suffered from low specificity. Furthermore, ensuring the suitability of the primers for Q-PCR provided broad quantitative access to genes that drive critical anaerobic catalytic processes.

APA, Harvard, Vancouver, ISO, and other styles

38

Kohout, T. A., and T. B. Rogers. "Use of a PCR-based method to characterize protein kinase C isoform expression in cardiac cells." American Journal of Physiology-Cell Physiology 264, no. 5 (1993): C1350—C1359. http://dx.doi.org/10.1152/ajpcell.1993.264.5.c1350.

Full text

Abstract:

Molecular cloning has identified at least nine unique isozymes of protein kinase C (PKC) designated alpha, beta I, beta II, gamma, delta, epsilon, zeta, and eta/L, with the recent addition of the theta-isoform. Previous attempts to characterize PKC isoform expression in heart have been limited by low levels of protein and perhaps by the presence of novel isoforms. Thus to critically examine the diversity of PKC expression in cardiac cells, we developed a reverse transcriptase-polymerase chain reaction (RT-PCR) approach that would amplify regions of the target cDNA of all the PKC isozymes in a single reaction. Degenerate oligonucleotide primers were designed to recognize sequences in the conserved regions of the PKC sequence motif: the cysteine-rich and the ATP-binding regions. Amplification of target PKC cDNA sequences resulted in PCR products with unique sizes and restriction digestion properties. The system was validated by identifying PCR products that correspond to all of the PKC isoform transcripts, except PKC-zeta, in a single reaction with cDNA derived from hippocampus. Cardiac cDNA was RT-PCR amplified, and the products were analyzed by a combination of restriction mapping and DNA sequencing that revealed the presence of only the alpha, delta, epsilon, and eta isoforms in adult rat cardiac myocytes and cultured neonatal ventricular myocytes. A unique nondegenerate primer pair was synthesized to recognize PKC-zeta cDNA. Results with these primers show that PKC-zeta is present in both cardiac myocyte preparations as well. The RT-PCR method developed here is an efficient approach that is broadly useful to examine PKC expression in many tissues, including the identification of potentially novel isoforms.(ABSTRACT TRUNCATED AT 250 WORDS)

APA, Harvard, Vancouver, ISO, and other styles

39

Aubele, Michaela, Margaret Cummings, Axel Walch, et al. "Heterogeneous Chromosomal Aberrations in Intraductal Breast Lesions Adjacent to Invasive Carcinoma." Analytical Cellular Pathology 20, no. 1 (2000): 17–24. http://dx.doi.org/10.1155/2000/930246.

Full text

Abstract:

There is evidence that breast cancer is a heterogeneous disease phenotypically as well as molecular biologically. So far, heterogeneity on the molecular biological level has not been investigated in potential precursor lesions, such as ductal hyperplasia (DH) and ductal carcinomain situ(DCIS). In this study we applied comparative genomic hybridization (CGH) to formalin‐fixed, paraffin‐embedded breast tissue with DH and DCIS, adjacent to invasive ductal carcinoma (IDC), to screen these potential precursor lesions for whole genomic chromosomal imbalances. Laser‐microdissection was used to select pure cell populations from the sections. Isolated DNA was amplified by degenerate oligonucleotide primed PCR (DOP‐PCR) and further processed for CGH analysis.Investigating multiple samples (n=25) from four patients we found an average of 5.6 ± 0.9 (mean ± SEM) chromosomal imbalances already present in DH. In the twelve DCIS lesions an average of 10.8 (±0.9) aberrations was identified with 14.8 (±0.8) aberrations in the four adjacent IDC lesions. The increasing number of chromosomal changes in parallel with the histopathological sequence corroborate the hypothesis, that the carcinomas may have developed through a sequential progression from normal to proliferative epithelium and eventually into carcinoma. However, heterogeneous results were identified in the multiple samples per entity from the same patient, demonstrated mainly in the DCIS samples in the chromosomal regions 6p, 9p, 11q, 16p and 17q, in the DH samples by 3p, 16p and 17q. This heterogeneous findings were most pronounced within the DH and was less in the DCIS and IDC samples. The only aberration consistently found in all samples – even in all DH samples – was amplification of the 20q13 region.Our results demonstrate, that the applied combination of laser‐microdissection, DOP‐PCR and CGH, may serve to analyse breast carcinogenesis pathways in suitable histological material. However, so far, it is unclear how to handle heterogeneous results and these make identification of relevant changes more difficult. Setting a threshold and valuating only those chromosomal changes which are present in a majority of samples may be one possibility. This involves however, the risk that infrequent but possibly significant aberrations may be missed.Figures onhttp://www.esacp.org/acp/2000/20‐1/aubele.htm.

APA, Harvard, Vancouver, ISO, and other styles

40

Cooper, D. L., and E. W. Baptist. "Degenerate oligonucleotide sequence-directed cross-species PCR cloning of the BCP 54/ALDH 3 cDNA: priming from inverted repeats and formation of tandem primer arrays." Genome Research 1, no. 1 (1991): 57–62. http://dx.doi.org/10.1101/gr.1.1.57.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Martin, R. R., and I. E. Tzanetakis. "First Report of Rosa multiflora cryptic virus in Rosa multiflora in the Eastern United States." Plant Disease 92, no. 12 (2008): 1706. http://dx.doi.org/10.1094/pdis-92-12-1706b.

Full text

Abstract:

In the process of attempting to identify the rose rosette agent, double-stranded RNA was isolated from several symptomatic Rosa multiflora plants from northwestern Arkansas. The pattern of the dsRNA bands differed among the five samples used in this study, suggesting the presence of several viruses. Four of the five plants tested had two predominant bands of approximately 1.8 and 1.5 kbp, a pattern similar to that observed in plants infected with Fragaria chiloensis cryptic virus (FCCV; 3), and further steps were taken for the identification of the putative virus. One plant that only had the two predominant bands was chosen for further characterization using degenerate oligonucleotide primed (DOP)-PCR (4). Twenty clones were sequenced and all were found to be part of two contigs of 937 and 1,087 nucleotides that have been deposited in GenBank (Accession nos. EU350962 and EU350963). The two contigs had 82 and 72% nucleotide and 85 and 69% amino acid sequence identities with RNA 1 and 2 of FCCV, respectively; 98 and 99% amino acid sequence identities with Rose multiflora cryptic virus (RMCV; 2) RNA 1 and 3, respectively. Oligonucleotide primers F (5′ gaatgggaactacgctttgc 3′) and R (5′ cgatgcttccaatgatgttg 3′) designed to amplify a 196-bp region of RNA 1 of the virus were tested using ss and dsRNA templates and were shown to be virus specific after sequencing of multiple PCR amplicons. Just before submission of this manuscript, the complete sequence of RMCV, a virus isolated from R. multiflora showing rose spring dwarf symptoms was published (2). RMCV and the dsRNAs isolated from R. multiflora in Arkansas are the same species because they share 99% nucleotide sequence identity. Cryptic viruses are expected to be symptomless though mild symptoms have been associated with several cryptic viruses (1). The presence of RMCV has been verified in both symptomless and plants infected with two severe diseases of rose, thus, the virus could play a role in the phenotype of these diseases as part of a virus complex. To our knowledge, this is the first report of RMCV in the eastern United States, which is closley related to RMCV from California (2). In the review process of this note, it was brought to our attention that a similar virus named Rose cryptic virus 1 was being investigated in Mississippi (Genbank Accession Nos. EU413666–68), supporting the statement that this virus is probably widespread in Rosa germplasm. References: (1) L. Chen et al. Arch. Virol. 151:849, 2006. (2) N. M. Salem et al. Arch. Virol. 153:455, 2008. (3) I. E. Tzanetakis et al. Virus Genes 36:267, 2008. (4) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008.

APA, Harvard, Vancouver, ISO, and other styles

42

Iserte, Javier Alonso, Betina Ines Stephan, Sandra Elizabeth Goñi, Cristina Silvia Borio, Pablo Daniel Ghiringhelli, and Mario Enrique Lozano. "Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides." Biotechnology Research International 2013 (February 21, 2013): 1–9. http://dx.doi.org/10.1155/2013/383646.

Full text

Abstract:

Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus ( nucleotides), Baculovirus ( to bp), Lactobacillus sp. ( to bp), and Pseudomonas sp. ( to bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members.

APA, Harvard, Vancouver, ISO, and other styles

43

Pellegrin, F., D. Nandris, H. Chrestin, and N. Duran-Vila. "Rubber Tree (Hevea brasiliensis) Bark Necrosis Syndrome I: Still No Evidence of a Biotic Causal Agent." Plant Disease 88, no. 9 (2004): 1046. http://dx.doi.org/10.1094/pdis.2004.88.9.1046c.

Full text

Abstract:

The main constraint in rubber plantations worldwide is the cessation of latex production because of two syndromes: (i) tapping panel dryness (TPD), a reversible physiological response to overexploitation; and (ii) bark necrosis (BN), an irreversible syndrome spreading from the collar toward the tapping cut. Early BN symptoms develop in the inner phloem tissues but never affect the cambium. Necrotic patches appear in the outer phloem, inducing bark cracking and peeling, but these alterations never lead to tree death. BN spreads gradually to neighboring rubber trees, and evidence of linear disease centers suggest that a pathogen may be involved, possibly transmitted by the tapping knife. Several previous etiological investigations (fungi, phytoplasma, bacteria, and virus) were performed (3) on leaves, bark, and latex using different methods (e.g., isolation, transmission, chemical treatments, and optic and electron microscope studies). Recent works focused on mechanically transmissible pathogens, such as viroid (2) or virus/double strand RNA, using RNA extraction (nonionic cellulose and appropriate ethanol concentrations) and treatment with RNase A, followed with sequential polyacrylamide gel electrophoresis (s-PAGE), reverse transcription-polymerase chain reaction (RT-PCR), degenerate oligonucleotide primer-PCR (DOP-PCR), and cloning and sequence analysis. While numerous viroid-like (between 250 and 400 nucleotides) and double strand virus-like (1,800 bp) low-molecular-weight RNAs were observed, no definite correlation was found with the BN status of trees. Sequencing of the various isolated RNAs only identified plasmids, nonpathogenic bacteria and yeasts, but none of the suspected pathogens. In addition, previous and recent transmission trials (tapping knife disinfection, bud grafting, bark implantation, and etc.) failed to confirm the involvement of a biotic agent. In conclusion, since these etiological investigations were inconclusive, a physiological disease is now suspected that involves exogenous stresses, nonoptimal vascular relations at the rootstock/scion junction and impaired cyanide metabolism (1,4). References: (1) H. Chrestin et al. Plant Dis. 88:1047, 2004. (2) N. Duran-Vila et al. J. Gen. Virol. 69:3069, 1988. (3) D. Nandris et al. Eur. J. For. Pathol. 21:340, 1991. (4) D. Nandris et al. Plant Dis. 88:1047, 2004.

APA, Harvard, Vancouver, ISO, and other styles

44

Broderick, Kevin, Christopher Pittock, Tony Arioli, Ernest H. Creaser, Jeremy J. Weinman, and Barry G. Rolfe. "Pathogenesis-Related Proteins in Trifolium subterraneum: A General Survey and Subsequent Characterisation of a Protein Inducible by Ethephon and Redlegged Earth Mite Attack." Functional Plant Biology 24, no. 6 (1997): 819. http://dx.doi.org/10.1071/pp97022.

Full text

Abstract:

One of the chief predators of subterranean clover (Trifolium subterraneum) pastures is redlegged earth mite (Halotydeus destructor; RLEM). Subterranean clover pathogenesis-related (PR) proteins induced by RLEM attack and ethephon treatment were surveyed, and PR proteins with peroxidase, β-1,3-glucanase and chitinase activities were detected. A protein co-migrating with a chitinase activity, induced by RLEM predation and treatment with ethephon, was isolated. It was purified and the N-terminal amino acid sequence determined. Using a degenerate oligonucleotide primer designed from this sequence, a corresponding cDNA fragment was amplified by reverse transcriptase-PCR, then cloned, and used as a probe to screen a subterranean clover cv. Karridale genomic library. The cDNA and a 97% homologous genomic clone were sequenced and the deduced amino acid sequence revealed an open reading frame of 157 amino acids capable of encoding a peptide of 16 478 Da. Significant homology (80%) was found between this protein and an abscisic acid (ABA)-responsive protein from Pisum sativum of unknown function which is an intracellular pathogenesis-related (IPR) protein. The gene encoding this protein also has homology to pea ‘disease response resistance genes’ and to proteins from other plant species in the PR-10 family. The induced protein was designated TsPR-10a due to its homology to other PR-10 proteins. Genomic Southern analysis indicates that the gene encoding this protein, designated Ypr10a, is a member of a multigene family with at least three members. Northern blot analysis indicates that the subterranean clover Ypr10a mRNA, or homologous transcript, level is strongly induced by ethephon treatment in both root and aerial tissues of 3 week old plants. The rapid induction kinetics of Ypr10a mRNA under ethephon treatment, its correlation with a putative chitinase activity, and homology to other PR-protein genes, suggests a pathogenesis-related role for TsPR-10a protein in subterranean clover.

APA, Harvard, Vancouver, ISO, and other styles

45

Limansky, Adriana S., Emma G. Sutich, María C. Guardati, Inés E. Toresani, and Alejandro M. Viale. "Genomic Diversity amongStreptococcus agalactiaeIsolates Detected by a Degenerate Oligonucleotide‐Primed Amplification Assay." Journal of Infectious Diseases 177, no. 5 (1998): 1308–13. http://dx.doi.org/10.1086/515275.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Sayada, Chalom, Bertrand Picard, Jacques Elion, and Rajagopal Krishnamoorthy. "Genomic fingerprinting ofYersinia enterocolitica species by degenerate oligonucleotide-primed polymerase chain reaction." Electrophoresis 15, no. 1 (1994): 562–65. http://dx.doi.org/10.1002/elps.1150150176.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Yang, Wen-Ho, Jia-Rong Wu, Tong-Hong Wang, and Lo-Chun Au. "Methylation profiling using degenerated oligonucleotide primer–PCR specific for genome-wide amplification of bisulfite-modified DNA." Analytical Biochemistry 369, no. 1 (2007): 120–27. http://dx.doi.org/10.1016/j.ab.2007.06.017.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Sanada, Masashi, Yasuhito Nanya, Akira Hangaishi, et al. "Array-Based Comparative Genomic Hybridization for Genome-Wide Analysis of DNA Copy Number in Myelodysplastic Syndromes." Blood 104, no. 11 (2004): 3420. http://dx.doi.org/10.1182/blood.v104.11.3420.3420.

Full text

Abstract:

Abstract Myelodysplastic syndrome(MDS)is a clonal disorder of hematopoietic stem cells characterized by ineffective hematopoiesis and propensity to acute myeloid leukemias. The conversion of a normal stem cell into a preleukemic and ultimately leukemic state is thought to be a multistep process requiring accumulation of a number of genetic changes. Conventional cytogenetic analysis has disclosed a number of chromosome abnormalities common to MDS and provided valuable clues to characterize these genetic lesions, rarity of balanced translocations and relative predominance of unbalanced abnormalities in MDS, including gene deletions and amplifications. However conventional analytical methods provide only limited resolutions of analysis for identification of genetic gains and losses and prevent further molecular delineation of relevant genes to the pathogenesis of MDS.&lt;/PRE&gt; Array-based comparative genomic hybridization (CGH) is a robust technique to enable rapid and comprehensive genome-wide analysis of genetic aberrations in cancers, in which differentially labeled DNAs from both tumor and normal samples are comparatively hybridized to a large number of genomic DNAs. In this study, we constructed a high-quality array-based CGH system for genome-wide analysis of chromosomal abnormalities to identify candidate target genes of MDS. Our whole genome arrays consisted of 3,300 BAC/PAC clones, thus having an average resolution of 1.0 Mb over the whole human genome. Each clone was amplified with degenerated oligonucleotide primed-PCR (DOP-PCR) and the amplified products were spotted in duplicate grids onto aminosilan-coated glass slides. For more high-resolution analysis, we employed the GeneChip Mapping 100k arrays (Affymetrix), originally developed for large-scale SNP typing, as a tool for detection of copy number changes in selected MDS cases. It contains 116,204 different SNPs on two separate arrays, covering the whole human genome with an average resolution of 21 kb. With this arrays DNA copy number’s changes could be estimated by comparing intensity of SNP signals of tumor cells with that of normal cells from the same patients. In addition, using paired samples from tumor cells and normal cells, large-scale LOH analysis became also possible.&lt;/PRE&gt; In total, 54 MDS samples were analyzed using our array CGH system. In addition to large chromosomal changes, including loss of 5q, 7q, 13q, and 20q, and gain of the whole chromosome 8, a number of small, cryptic chromosomal abnormalities were identified that would escape from conventional cytogenetic detection. Many of these abnormalities were represented only by a single PAC/BAC clone. In several chromosome regions, including 3q13, 5p15, 13p33, and 20q12, there existed commonly deleted regions, which could be confirmed by FISH analysis. Similarly gains of genetic materials were found on 8p23 and 17p13. Several genes were identified within these regions that may be candidates for relevant genes to these genetic alterations. In conclusion, genome-profiling using array CGH techniques were highly useful tools for delineating the pathogenesis of MDS.&lt;/PRE&gt;

APA, Harvard, Vancouver, ISO, and other styles

49

Pusch, Carsten M., Graeme J. Nicholson, Lutz Bachmann, and Michael Scholz. "Degenerate Oligonucleotide-Primed Preamplification of Ancient DNA Allows the Retrieval of Authentic DNA Sequences." Analytical Biochemistry 279, no. 1 (2000): 118–22. http://dx.doi.org/10.1006/abio.1999.4463.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Gravitt, P. E., C. L. Peyton, T. Q. Alessi, et al. "Improved Amplification of Genital Human Papillomaviruses." Journal of Clinical Microbiology 38, no. 1 (2000): 357–61. http://dx.doi.org/10.1128/jcm.38.1.357-361.2000.

Full text

Abstract:

ABSTRACT Genital human papillomaviruses (HPVs) are commonly detected from clinical samples by consensus PCR methods. Two commonly used primer systems, the MY09-MY11 (MY09/11) primers and the GP5+-GP6+ (GP5+/6+) primers, amplify a broad spectrum of HPV genotypes, but with various levels of sensitivity among the HPV types. Analysis of the primer-target sequence homology for the MY09/11 primers showed an association between inefficient amplification of HPV types and the number and position of mismatches, despite accommodation of sequence variation by inclusion of degenerate base sites. The MY09/11 primers were redesigned to increase the sensitivity of amplification across the type spectrum by using the same primer binding regions in the L1 open reading frame. Sequence heterogeneity was accommodated by designing multiple primer sequences that were combined into an upstream pool of 5 oligonucleotides (PGMY11) and a downstream pool of 13 oligonucleotides (PGMY09), thereby avoiding use of degenerate bases that yield irreproducible primer syntheses. The performance of the PGMY09-PGMY11 (PGMY09/11) primer system relative to that of the standard MY09/11 system was evaluated with a set of 262 cervicovaginal lavage specimens. There was a 91.5% overall agreement between the two systems (kappa = 0.83; P < 0.001). The PGMY09/11 system appeared to be significantly more sensitive than the MY09/11 system, detecting an additional 20 HPV-positive specimens, for a prevalence of 62.8% versus a prevalence of 55.1% with the MY09/11 system (McNemar's χ 2 = 17.2; P < 0.001). The proportion of multiple infections detected increased with the PGMY09/11 system (40.0 versus 33.8% of positive infections). HPV types 26, 35, 42, 45, 52, 54, 55, 59, 66, 73, and MM7 were detected at least 25% more often with the PGMY09/11 system. The PGMY09/11 primer system affords an increase in type-specific amplification sensitivity over that of the standard MY09/11 primer system. This new primer system will be useful in assessing the natural history of HPV infections, particularly when the analysis requires HPV typing.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Degenerate Oligonucleotide Primed PCR'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles