Journal articles on the topic 'Douala (Cameroun) – Plans'

Gnetum africanum Welw. is a plant specie of Central and West Africa, a Non Timber Forest Product (NTFP) with high nutritional, medicinal and economic value. In Cameroon, its leaves are recognized by the forestry administration as a special product. Strong demand combined with destructive harvesting techniques has resulted in its rarity in its distribution area. The objective of this work is to characterize the harvesting and trade of G. africanaum, and to assess its abundance (density and structure) in order to appreciate the economic value of the Lehman agroforest system (ALM) based in Massoumboum, a village located at 30 Km of Douala town, the economical capital of Cameroon. An ethnobotanical survey was conducted among harvesters and sellers of G. africanum in the ALM and in adjacent markets. An inventory of G. africanum stems and leaves was carried out at an overall sampling rate of 9.52%. The study revealed that, harvesting of G. africanum is freely done by women, youngers and elders. They start their activity early in the morning and convey their products to markets located in the periphery and inside the city of Douala. The price of the gramme is too high in the periphery than in the city, averaging 0.58 CFA franc. This price is high in the dry season due to the scarcity of other agricultural vegetables. The inventories conducted revealed densities of 6 191 stems/ha and 119 548 leaves/ha, with the high density of leaves obtained in less perturbed plots. The combination of field data (forest inventories) with those obtained in the markets (trade data), what we call « quantitative ethnobotany », allowed us to appreciate the temporal economic value (EV) of the ALM. This EV ranges from 500 000 - 700 000 CFA franc, for an average value of 37 059.9 CFA franc /ha. If well managed, G. africanum can contribute not only to the economy of the women-harvesters, but also to the economy of the ALM. The glaring development challenge of the background of what precedes is the development of non-detriment findings (NDF) for G. africanum in Cameroon. These consist of setting tools which aims to sustain the resource and trade such as the delimitation of Gnetum Allocation Units (GAU), as well as the development and implementation of simple management plans (SMPs).

Stem cuttings were collected in Cameroon from cassava plants displaying cassava mosaic disease (CMD) symptoms. The nature of the viruses present was determined by using the PCR with primers specific for the coat protein (CP) genes of African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV). All samples were infected by ACMV and eight of the 50 samples were infected by both ACMV and an EACMV-like virus. The complete nucleotide sequences of DNA-A and -B of representative ACMV and EACMV-like viruses were determined. The DNA-A component of the EACMV-like virus contained evidence of recombination in the AC2–AC3 region and DNA-B also contained evidence of recombination in BC1. However, both components retained gene arrangements typical of bipartite begomoviruses. When Nicotiana benthamiana plants were doubly inoculated with these Cameroon isolates of ACMV and EACMV (ACMV/CM, EACMV/CM) by using sap from cassava plants or infectious clones, the symptoms were more severe than for plants inoculated with either virus alone. Southern blot analysis of viral DNAs from infected plants showed that there were significantly higher levels of accumulation of both ACMV/CM components and, to a lesser extent, of EACMV/CM components in mixed-infected plants than in singly infected plants. These results strongly suggest the occurrence of a synergistic interaction between the two viruses.

ABSTRACT Viruses are both inducers and targets of posttranscriptional gene silencing (PTGS), a natural defense mechanism in plants. Here we report molecular evidence of the ability of single-stranded DNA (ssDNA) viruses to induce PTGS in infected plants irrespective of the severity of or recovery from the symptoms. Our results reveal that five distinct species of cassava-infecting geminiviruses were capable of triggering PTGS by producing two classes of virus-specific short interfering RNAs (siRNAs) of 21 to 26 nucleotides in two plant hosts, tobacco (Nicotiana benthamiana) and cassava (Manihot esculenta, Crantz). However, the efficacy of virus-induced PTGS varied depending on the intrinsic features of the virus and its interaction with the plant host. We found that symptom recovery over time in plants infected with the isolates of African cassava mosaic virus (ACMV-[CM]) or Sri Lankan cassava mosaic virus was associated with a much higher level of virus-derived siRNA accumulation compared to plants infected with viruses that do not show symptom recovery. Furthermore, we determined that the C terminus of AC1 that overlaps with the N terminus of AC2 early viral genes involved in virus replication were the primary targets for ACMV-[CM]-induced PTGS, whereas the C terminus of BC1 was targeted for the East African cassava mosaic Cameroon virus. In addition, our results reveal the possibility for double-stranded RNA formation during transcription in ssDNA viruses, which explains in part how these viruses can trigger PTGS in plants.

Geminiviruses (family Geminiviridae) are among the most devastating plant viruses worldwide, causing severe damage in crops of economic and subsistence importance. These viruses have very compact genomes and many of the encoded proteins are multifunctional. Here, we investigated the role of the East African cassava mosaic Cameroon virus (EACMCV) AC4 on virus infectivity in Nicotiana benthamiana. Results showed that plants inoculated with EACMCV containing a knockout mutation in an AC4 open reading frame displayed symptoms 2 to 3 days later than plants inoculated with wild-type virus, and these plants recovered from infection, whereas plants inoculated with the wild-type virus did not. Curiously, when an additional mutation was made in the knockout mutant, the resulting double mutant virus completely failed to cause any apparent symptoms. Interestingly, the role of AC4 on virus infectivity appeared to be dependent on an encoded N-myristoylation motif that mediates cell membrane binding. We previously showed that EACMCV containing the AC4T38I mutant produced virus progeny characterized by second-site mutations and reversion to wild-type virus. These results were confirmed in this study using additional mutations. Together, these results show involvement of EACMCV AC4 in virus infectivity; they also suggest a role for the combined action of mutation and selection, under prevailing environmental conditions, on begomovirus genetic variation and diversity.

“Umuntu Ngumuntu Ngabantu” translates into a person is a person because of people. There is an idea of unity in this frequently used Zulu proverb that is posted boldly next to the Afrocentric logo on the African Union International School (AUIS) website in Midrand South, Africa. All these words are factors within Pan-Africanism, and AUIS is more than an international school in South Africa, but it is one of two schools created by the African Centered Educational Foundation (ACE). The other school is called the African American Academy in Douala, Cameroon. Under the auspice of ACE, both schools share a very special mission implied within its vision that includes an education for the African Renaissance. Through a content analysis, this paper will illustrate how the African Centered Education Foundation represents Pan-Africanism through the institutionalization of African Centered Education illustrated by their technological media (school websites, facebook, online articles), educational tools (brochures, teacher evaluations, lesson plans, teacher’s introduction package), and their African diaspora volunteer teacher program.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has emerged as a potentially devastating and widespread virus of onion. IYSV was first reported in the United States from Idaho in 1993 and has since spread to many of the onion-producing areas (1). In South America, the most recent reports of the virus on onion were from Peru and Chile (2,4). In 2005, onion plants in Uvalde County, Texas exhibited necrotic lesions on leaves typical of IYSV and disease incidence approached 100% in some fields with yield loss and quality problems. Five of six plants tested were positive for IYSV with double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA; Agdia Inc., Elkhart, IN). In 2006, similar lesions were observed on onion plants in Uvalde County and approximately 400 km south in Hidalgo and Cameron counties. Infection points generally started as a single plant near the edge of fields and spread to plants in a 3- to 4-m area after 1 to 2 weeks. Early-season disease incidence was low in onions grown for bulbs and transplants, <10% in 2006. Disease incidence increased in some fields until the crop was harvested. Leaves of symptomatic plants were tested for IYSV and Tomato spotted wilt virus (TSWV) using DAS-ELISA, and 18 of 23 samples from the Hidalgo County area and 12 of 21 samples from the Uvalde County area were positive for IYSV. All samples tested for TSWV from these counties were negative. Virus infection in some ELISA-positive plants was verified by reverse transcription-polymerase chain reaction (RT-PCR) using primers derived from the small RNA of IYSV. The primers flanked the IYSV nucleocapsid (N) gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′ (3). RT-PCR gave a PCR product of expected size (approximately 1.2 kb). The DNA amplicon was cloned and sequenced (GenBank Accession No. DQ658242). Nucleotide sequence analysis confirmed the identity of the amplicon as that of IYSV N gene and sequence comparisons with known IYSV N gene sequences showed 95 to 98% sequence identity. The primary vector of IYSV, onion thrips (Thrips tabaci), is a widespread and destructive pest of onion in south Texas. The year-to-year incidence of IYSV and the severity of the disease will probably depend on the onion thrips population levels. Bulb yield reduction could be severe during years with high thrips populations. More research is needed to determine the impact of IYSV on bulb yield in Texas, the relationship between IYSV incidence and T. tabaci population levels, and oversummering hosts. To our knowledge, this is the first known report of IYSV in Texas. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004, (2) S. W. Mullis et al. Plant Dis. 90:377, 2006, (3) H. Pappu et al. Arch. Virol. 151:1015, 2006. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

To appreciate the impact of insect pollinators on the pod, seeds, and seed weight yields of Glycine max, the pollinating activities of flowering insects were studied in Yaoundé, during the two mild, rainy seasons in 2016 and 2017 (March-June). Observations were made on 45 to 20400 flowers per treatment. The flowers were subjected to different treatments: Free flowers (Treatment 1), bagged flowers (treatment 2), castrated and free flowers (treatment 3), and castrated and bagged flowers (treatment 4). Some (8695 and 3325) flowers of Glycine max (Fabaceae) were observed in 2016 and 2017, respectively, for the diversity and Frequency of insect visits. For results, 1527 visits of 13 insect species distributed in seven orders were recorded on G. max flowers. The most dominating Hymenoptera observed was Apis mellifera, with 40.20 % of the total insect visits. The highest number of insect pollinators harvested in the flowers of this Fabaceae was between 8h-9h. The studied insects have a positive impact on the yields of this plant. This positive impact of the pollinator insects on the yields was 26.29 %, 16.13 %, 15.02 and 4.45 % in fructification rate, number of seeds pod, the weight of seeds, and percentage of normal seeds respectively. The avoidance of pesticide treatment of plants during flowering could be a good management strategy to improve on plant yield.

In the summer of 2012, zucchini (Cucurbita pepo L.) plants of F1 hybrid Rigas showing very severe malformation and blisters in leaves and fruit were observed in the prefectures of Ilia and Messinia, Peloponnese, southwestern Greece. Over 100 samples were collected and only a few were found by double antibody sandwich (DAS)-ELISA to be singly or mixed infected with the commonly encountered Cucumber mosaic virus (CMV, genus Cucumovirus), Zucchini yellow mosaic virus (ZYMV, genus Potyvirus), and Watermelon mosaic virus (WMV, genus Potyvirus), to which Rigas is known to be tolerant. All affected plants were also tested by DAS-ELISA and RT-PCR (2) for the presence of Moroccan watermelon mosaic virus (MWMV; genus Potyvirus), a virus not previously reported in Greece, and were consistently found positive by both methods. Sap from plants in which MWMV was solely detected was used to mechanically inoculate Chenopodium quinoa Willd. and cucurbit species (zucchini, cucumber, melon, and watermelon). C. quinoa produced chlorotic local lesions, while cucurbits showed very severe mosaic and malformation of leaves. Zucchini plants of F1 hybrids Rigas, Golden (tolerant to WMV and ZYMV), and Elion (not exhibiting any tolerance) grown in a screenhouse produced equivalent severe symptoms on leaves and fruits. Furthermore, transmission experiments in a non-persistent manner using a clone of Myzus persicae Sulz. and zucchini plants of F1 hybrid Boreas as donor and test plants were carried out. Ten plants were used in each experiment (one aphid/plant) and this was repeated five times (50 plants in total). The transmission rate was high ranging from 75 to 90%. RT-PCR obtained amplicons of 627 bp were subjected to direct sequencing (GenBank Accession No KF772944), which revealed 99% sequence identity to the corresponding region of a MWMV Tunisian isolate (EF579955). In 2013, in addition to zucchini plants found MWMV positive, watermelon (Citrullus lanatus Thunb.) plants from the same region of Peloponnese showing leaf malformation and mosaic symptoms were found MWMV positive (4/30) by DAS-ELISA and RT-PCR, revealing the virus establishment and further spread. In the Mediterranean basin, the virus has already been reported in Morocco, Italy, France, Spain, Tunisia, and Algeria, where it has emerged recently from a common source, has quickly become established through rapid dissemination and is considered as an important emerging threat (4). Isolates from these countries, including the present one from Greece, are very closely molecularly related to each other, contrary to isolates from sub-Saharan Africa (South Africa, Sudan, Congo, Zimbabwe, Niger, Cameroon, Nigeria) that are much more divergent (1,3). To our knowledge, this is the first report of MWMV in Greece. References: (1) H. Lecoq et al. Plant Dis. 85:547, 2001. (2) H. Lecoq et al. New Dis. Rep. 16:19, 2007. (3) A. T. Owolabi et al. Int. J. Virol. 8:258, 2012. (4) S. Yakoubi et al. Arch. Virol. 153:775, 2008.

Molecular characterization of Fragaria chiloensis latent virus (FClLV) (3) was based on shotgun cloning of double-stranded RNA (dsRNA) obtained from a Chilean Fragaria chiloensis plant. While the majority of the clones acquired belonged to FClLV, several had similarities with the RNA polymerases of viruses of the family Partitiviridae. A region of more than 1 kb of the putative virus (GenBank Accession No. DQ093961) was acquired by a combination of shotgun cloning and reverse transcription-polymerase chain reaction (RT-PCR) (3) and was compared against sequences found in GenBank. The Alphacryptovirus Beet cryptic virus 3 (Genbank Accession No. S63913) and the RNA-dependent RNA polymerase encoded using dsRNA isolated from Pyrus pyrifolia (Genbank Accession No. BAA34783) produced the most significant alignments with approximately 40% amino acid sequence identity and 60% amino acid similarity with the coding region of the sequenced portion of the virus. Detection primers F (5′AAGTCCGTGAGCACTGCCAT3′) and R (5′TGAATACAAGTAACGGGAATTGA3′) that amplify a 152-bp fragment of the putative virus were developed and used for RT-PCR detection of the virus as described (4) in 20 F. chiloensis plants obtained from the National Clonal Germplasm Repository (NCGR) in Corvallis, OR. These 20 plants as well as the plant used for the dsRNA isolation were a subset of F. chiloensis clones collected from Chile in 1990 and 1992 as germplasm for the Fragaria collection in the NCGR system (2). Seven of the plants were found to be infected with the virus as determined using RT-PCR and sequencing of the amplicons. There was no correlation between the presence of FClLV and the novel virus. To eliminate the possibility that the sequenced region was encoded by F. chiloensis genome, DNA was isolated (DNeasy; QIAGEN Inc., Valencia, CA) and used as a template in PCR, and no amplicons were obtained in these tests. The possibility that the putative virus belonged to the Endornavirus genus was also examined. DsRNA was extracted, and individual bands were gel purified and subjected to cloning as described (4) and RT-PCR amplification. Both methods indicated that the polymerase region was encoded by a dsRNA species of approximately 1.8 kb, which is similar in size to the genomic molecules of other cryptic viruses that encode the virus polymerase (1). This information indicated that the virus is a novel cryptic virus and the name Fragaria chiloensis cryptic virus is proposed. References: (1) G. Boccardo and T. Candresse. Arch. Virol. 150:399, 2005. (2) J. S. Cameron et al. Acta Hortic. 348:65, 1993. (3) I. E. Tzanetakis and R. R. Martin. Virus Res. 112:32, 2005. (4) I. E. Tzanetakis et al. Plant Dis. 88:383, 2004.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

The study of the conditions which affect the pharmacological activity of medicinal plants is the basis for the development of phytomedicine. This study aimed at identifying some optimal conditions for antibacterial activity of extracts of Harungana madagascariensis. The leaves, bark, and roots were harvested in Douala, Littoral Region of Cameroon, in August 2019 at three times of the day: early in the morning (6 a.m.), at midday (12 p.m.), and in the afternoon (6 p.m.). They were dried at room temperature and ground to give a fine powder. Each powder was macerated in methanol for 72 h and boiled in distilled water and palm wine. The obtained extracts were evaluated for their antibacterial activity by broth microdilution method on 31 clinical and 4 reference bacterial strains. The results show that the best extraction yield was obtained using the bark extracted from palm wine by decoction. The methanol bark extract was found to be more active than other solvents (8 and 512 µg/mL). In fact, the activity of the 6 a.m. extract was significant on 4 of the 35 strains tested (MIC< 100 µg/mL) and moderate on 27 of the 35 strains tested (100≤ MIC≤ 625 μg/mL). The activity of the noon extract was significant on 8 strains and moderate on 23 strains and, finally, the activity of the extract of 6 p.m. was significant on 9 strains and moderate on 25 strains. The extract harvested at 6 p.m. inhibited the growth of the 35 strains tested and revealed significant activity (MIC <100 μg/mL) on Staphylococcus aureus, Escherichia coli, Citrobacter freundii, Serratia marcescens, Salmonella enterica serovar typhi, and Yersinia enterocolitica, making this hour the best harvesting time. This study further confirms that the bark of H. madagascariensis is a potent antibacterial agent, being better still when harvested at 6 p.m. and extracted with methanol.

Root extracts of a Cameroon medicinal plant, Dorstenia psilurus, were purified by screening for AMP-activated protein kinase (AMPK) activation in incubated mouse embryo fibroblasts (MEFs). Two isoprenylated flavones that activated AMPK were isolated. Compound 1 was identified as artelasticin by high-resolution electrospray ionization mass spectrometry and 2D-NMR while its structural isomer, compound 2, was isolated for the first time and differed only by the position of one double bond on one isoprenyl substituent. Treatment of MEFs with purified compound 1 or compound 2 led to rapid and robust AMPK activation at low micromolar concentrations and increased the intracellular AMP:ATP ratio. In oxygen consumption experiments on isolated rat liver mitochondria, compound 1 and compound 2 inhibited complex II of the electron transport chain and in freeze–thawed mitochondria succinate dehydrogenase was inhibited. In incubated rat skeletal muscles, both compounds activated AMPK and stimulated glucose uptake. Moreover, these effects were lost in muscles pre-incubated with AMPK inhibitor SBI-0206965, suggesting AMPK dependency. Incubation of mouse hepatocytes with compound 1 or compound 2 led to AMPK activation, but glucose production was decreased in hepatocytes from both wild-type and AMPKβ1−/− mice, suggesting that this effect was not AMPK-dependent. However, when administered intraperitoneally to high-fat diet-induced insulin-resistant mice, compound 1 and compound 2 had blood glucose-lowering effects. In addition, compound 1 and compound 2 reduced the viability of several human cancer cells in culture. The flavonoids we have identified could be a starting point for the development of new drugs to treat type 2 diabetes.

Aims: Baillonella toxisperma P. (moabi) is a woody which belongs to Sapotaceae family. It is endemic to the forests of Congo Basin, and therefore to Cameroonian forests. In Cameroon, B. toxiperma undergoes anthropogenic pressure which may lead to its complete disappearance. In this respect, the establishment of an appropriate technical route for regeneration of this species, which becomes rare because of overexploitation, is a necessity. This study aimed to improve the regeneration of moabi while contributing to sustainable agriculture.
 Study Design: A random device design with 5 treatments (control, compost derived sugar cane processing waste, bagasse, molasses and bagasse-molasses mixture) was used.
 Place and Duration of Study: Under Bimodal Forest climate in the Central Cameroon region, between September, 2018 and April 2019.
 Methodology: The breaking of moabi seeds dormancy, physico-chemical properties of soil and produced compost, and growth parameters (plant height, foliar production, diameter of stem, and dry biomass of plant) were evaluated to determine the development of the seedlings.
 Results: Moabi seeds stored cold at 4°C for 48 hours before sowing germinated better. Compost significantly (p˂0.001) increased moabi plants growth compared to bagasse, molasses, bagasse-molasses mixture. Dry biomass of treated moabi plants by compost, bagasse, bagasse-molasses mixture and molasses were 1.80; 1.13; 1.78; 1.40 fold greater than those of unfertilized plants respectively.
 Conclusion: The use of sugar cane compounds works as a double benefit because in addition to using compounds previously discarded, we are adding potent fertilizers that act strongly on moabi growth.

This paper argues that illegitimacy is a concept that relates to almost all of the fundamental ways in which Western society has traditionally organised itself. Sex, family and marriage, and the power of the church and state, are all implicated in the various ways in which society reproduces itself from generation to generation. All employ the concepts of legitimacy and illegitimacy to define what is and what is not permissible. Further, the creation of the illegitimate can occur in more or less legitimate ways; for example, through acts of consent, on the one hand; and force, on the other. This paper uses the study of an English Renaissance text, Shakespeare’s Henry V, to argue that these concepts remain potent ones, regularly invoked as a means of identifying and denouncing perceived threats to the good ordering of the social fabric. In western societies, many of which may be constructed as post-marriage, illegitimate is often applied as a descriptor to unlicensed migrants, refugees and asylum seekers. In countries subject to war and conflict, rape as a war crime is increasingly used by armies to create fractures within the subject community and to undermine the paternity of a cohort of children. In societies where extramarital sex is prohibited, or where rape has been used as a weapon of war, the bastard acts as physical evidence that an unsanctioned act has been committed and the laws of society broken, a “failure in social control” (Laslett, Oosterveen and Smith, 5). This paper explores these themes, using past conceptions of the illegitimate and bastardy as an explanatory concept for problematic aspects of legitimacy in contemporary culture.Bastardy was a particularly important issue in sixteenth and seventeenth century Europe when an individual’s genealogy was a major determining factor of social status, property and identity (MacFarlane). Further, illegitimacy was not necessarily an aspect of a person’s birth. It could become a status into which they were thrust through the use of divorce, for example, as when Henry VIII illegitimised his daughter Mary after annulling his marriage to Mary’s mother, Catherine of Aragon. Alison Findlay’s study of illegitimacy in Renaissance literature lists over 70 portrayals of illegitimacy, or characters threatened with illegitimacy, between 1588 and 1652 (253–257). In addition to illegitimacy at an individual level however, discussions around what constitutes the “illegitimate” figure in terms of its relationship with the family and the wider community, are also applicable to broader concerns over national identity. In work such as Stages of History, Phyllis Rackin dissected images of masculine community present in Shakespeare’s history plays to expose underlying tensions over gender, power and identity. As the study of Henry V indicates in the following discussion, illegitimacy was also a metaphor brought to bear on issues of national as well as personal identity in the early modern era. The image of the nation as a “family” to denote unity and security, both then and now, is rendered complex and problematic by introducing the “illegitimate” into that nation-family image. The rhetoric used in the recent debate over the Scottish independence referendum, and in Australia’s ongoing controversy over “illegitimate” migration, both indicate that the concept of a “national bastard”, an amorphous figure that resists precise definition, remains a potent rhetorical force. Before turning to the detail of Henry V, it is useful to review the use of “illegitimate” in the early modern context. Lacking an established position within a family, a bastard was in danger of being marginalised and deprived of any but the most basic social identity. If acknowledged by a family, the bastard might become a drain on that family’s economic resources, drawing money away from legitimate children and resented accordingly. Such resentment may be reciprocated. In his essay “On Envy” the scientist, author, lawyer and eventually Lord Chancellor of England Francis Bacon explained the destructive impulse of bastardy as follows: “Deformed persons, and eunuchs, and old men, and bastards, are envious. For he that cannot possibly mend his own case will do what he can to impair another’s.” Thus, bastardy becomes a plot device which can be used to explain and to rationalise evil. In early modern English literature, as today, bastardy as a defect of birth is only one meaning for the word. What does “in everything illegitimate” (quoting Shakespeare’s character Thersites in Troilus and Cressida [V.viii.8]) mean for our understanding of both our own society and that of the late sixteenth century? Bastardy is an important ideologeme, in that it is a “unit of meaning through which the ‘social space’ constructs the ideological values of its signs” (Schleiner, 195). In other words, bastardy has an ideological significance that stretches far beyond a question of parental marital status, extending to become a metaphor for national as well as personal loss of identity. Anti-Catholic polemicists of the early sixteenth century accused priests of begetting a generation of bastards that would overthrow English society (Fish, 7). The historian Polydore Vergil was accused of suborning and bastardising English history by plagiarism and book destruction: “making himself father to other men’s works” (Hay, 159). Why is illegitimacy so important and so universal a metaphor? The term “bastard” in its sense of mixture or mongrel has been applied to language, to weaponry, to almost anything that is a distorted but recognisable version of something else. As such, the concept of bastardy lends itself readily to the rhetorical figure of metaphor which, as the sixteenth century writer George Puttenham puts it, is “a kind of wresting of a single word from his owne right signification, to another not so natural, but yet of some affinitie or coueniencie with it” (Puttenham, 178). Later on in The Art of English Poesie, Puttenham uses the word “bastard” to describe something that can best be recognised as being an imperfect version of something else: “This figure [oval] taketh his name of an egge […] and is as it were a bastard or imperfect rounde declining toward a longitude.” (101). “Bastard” as a descriptive term in this context has meaning because it connects the subject of discussion with its original. Michael Neill takes an anthropological approach to the question of why the bastard in early modern drama is almost invariably depicted as monstrous or evil. In “In everything illegitimate: Imagining the Bastard in Renaissance Drama,” Neill argues that bastards are “filthy”, using the term as it is construed by Mary Douglas in her work Purity and Danger. Douglas argues that dirt is defined by being where it should not be, it is “matter in the wrong place, belonging to ‘a residual category, rejected from our normal scheme of classifications,’ a source of fundamental pollution” (134). In this argument the figure of the bastard aligns strongly with the concept of the Other (Said). Arguably, however, the anthropologist Edmund Leach provides a more useful model to understand the associations of hybridity, monstrosity and bastardy. In “Animal Categories and Verbal Abuse”, Leach asserts that our perceptions of the world around us are largely based on binary distinctions; that an object is one thing, and is not another. If an object combines attributes of itself with those of another, the interlapping area will be suppressed so that there may be no hesitation in discerning between them. This repressed area, the area which is neither one thing nor another but “liminal” (40), becomes the object of fear and of fascination: – taboo. It is this liminality that creates anxiety surrounding bastards, as they occupy the repressed, “taboo” area between family and outsiders. In that it is born out of wedlock, the bastard child has no place within the family structure; yet as the child of a family member it cannot be completely relegated to the external world. Michael Neill rightly points out the extent to which the topos of illegitimacy is associated with the disintegration of boundaries and a consequent loss of coherence and identity, arguing that the bastard is “a by-product of the attempt to define and preserve a certain kind of social order” (147). The concept of the liminal figure, however, recognises that while a by-product can be identified and eliminated, a bastard can neither be contained nor excluded. Consequently, the bastard challenges the established order; to be illegitimate, it must retain its connection with the legitimate figure from which it diverges. Thus the illegitimate stands as a permanent threat to the legitimate, a reminder of what the legitimate can become. Bastardy is used by Shakespeare to indicate the fear of loss of national as well as personal identity. Although noted for its triumphalist construction of a hero-king, Henry V is also shot through with uncertainties and fears, fears which are frequently expressed using illegitimacy as a metaphor. Notwithstanding its battle scenes and militarism, it is the lawyers, genealogists and historians who initiate and drive forward the narrative in Henry V (McAlindon, 435). The reward of the battle for Henry is not so much the crown of France as the assurance of his own legitimacy as monarch. The lengthy and legalistic recital of genealogies with which the Archbishop of Canterbury proves to general English satisfaction that their English king Henry holds a better lineal right to the French throne than its current occupant may not be quite as “clear as is the summer sun” (Henry V 1.2.83), but Henry’s question about whether he may “with right and conscience” make his claim to the French throne elicits a succinct response. The churchmen tell Henry that, in order to demonstrate that he is truly the descendant of his royal forefathers, Henry will need to validate that claim. In other words, the legitimacy of Henry’s identity, based on his connection with the past, is predicated on his current behaviour:Gracious lord,Stand for your own; unwind your bloody flag;Look back into your mighty ancestors:Go, my dread lord, to your great-grandsire’s tomb,From whom you claim; invoke his warlike spirit…Awake remembrance of these valiant dead,And with your puissant arm renew their feats:You are their heir, you sit upon their throne,The blood and courage that renowned themRuns in your veins….Your brother kings and monarchs of the earthDo all expect that you should rouse yourselfAs did the former lions of your blood. (Henry V 1.2.122 – 124)These exhortations to Henry are one instance of the importance of genealogy and its immediate connection to personal and national identity. The subject recurs throughout the play as French and English characters both invoke a discourse of legitimacy and illegitimacy to articulate fears of invasion, defeat, and loss of personal and national identity. One particular example of this is the brief scene in which the French royalty allow themselves to contemplate the prospect of defeat at the hands of the English:Fr. King. ‘Tis certain, he hath pass’d the river Somme.Constable. And if he be not fought withal, my lord,Let us not live in France; let us quit all,And give our vineyards to a barbarous people.Dauphin. O Dieu vivant! shall a few sprays of us,The emptying of our fathers’ luxury,Our scions, put in wild and savage stock,Spirt up so suddenly into the clouds,And overlook their grafters?Bourbon. Normans, but bastard Normans, Norman bastards!...Dauphin. By faith and honour,Our madams mock at us, and plainly sayOur mettle is bred out; and they will giveTheir bodies to the lust of English youthTo new-store France with bastard warriors. (Henry V 3.5.1 – 31).Rape and sexual violence pervade the language of Henry V. France itself is constructed as a sexually vulnerable female with “womby vaultages” and a “mistress-court” (2.4.131, 140). In one of his most famous speeches Henry graphically describes the rape and slaughter that accompanies military defeat (3.3). Reading Henry V solely in terms of its association of military conquest with sexual violence, however, runs the risk of overlooking the image of bastards themselves as both the threat and the outcome of national defeat. The lines quoted above exemplify the extent to which illegitimacy was a vital metaphor within early modern discourses of national as well as personal identity. Although the lines are divided between various speakers – the French King, Constable (representing the law), Dauphin (the Crown Prince) and Bourbon (representing the aristocracy) – the images develop smoothly and consistently to express English dominance and French subordination, articulated through images of illegitimacy.The dialogue begins with the most immediate consequence of invasion and of illegitimacy: the loss of property. Legitimacy, illegitimacy and property were so closely associated that a case of bastardy brought to the ecclesiastical court that did not include a civil law suit about land was referred to as a case of “bastardy speciall”, and the association between illegitimacy and property is present in this speech (Cowell, 14). The use of the word “vine” is simultaneously a metonym for France and a metaphor for the family, as in the “family tree”, conflating the themes of family identity and national identity that are both threatened by the virile English forces.As the dialogue develops, the rhetoric becomes more elaborate. The vines which for the Constable (from a legal perspective) represented both France and French families become instead an attempt to depict the English as being of a subordinate breed. The Dauphin’s brief narrative of the English origins refers to the illegitimate William the Conqueror, bastard son of the Duke of Normandy and by designating the English as being descendants of a bastard Frenchman the Dauphin attempts to depict the English nation as originating from a superabundance of French virility; wild offshoots from a true stock. Yet “grafting” one plant to another can create a stronger plant, which is what has happened here. The Dauphin’s metaphors, designed to construct the English as an unruly and illegitimate offshoot of French society, a product of the overflowing French virility, evolve instead into an emblem of a younger, stronger branch which has overtaken its enfeebled origins.In creating this scene, Shakespeare constructs the Frenchmen as being unable to contain the English figuratively, still less literally. The attempts to reduce the English threat by imagining them as “a few sprays”, a product of casual sexual excess, collapses into Bourbon’s incoherent ejaculation: “Normans, but bastard Normans, Norman bastards!” and the Norman bastard dominates the conclusion of the scene. Instead of containing and marginalising the bastard, the metaphoric language creates and acknowledges a threat which cannot be marginalised. The “emptying of luxury” has engendered an uncontrollable illegitimate who will destroy the French nation beyond any hope of recovery, overrunning France with bastards.The scene is fascinating for its use of illegitimacy as a means of articulating fears not only for the past and present but also for the future. The Dauphin’s vision is one of irreversible national and familial disintegration, irreversible because, unlike rape, the French women’s imagined rejection of their French families and embrace of the English conquerors implies a total abandonment of family origins and the willing creation of a new, illegitimate dynasty. Immediately prior to this scene the audience has seen the Dauphin’s fear in action: the French princess Katherine is shown learning to speak English as part of her preparation for giving her body to a “bastard Norman”, a prospect which she anticipates with a frisson of pleasure and humour, as well as fear. This scene, between Katherine and her women, evokes a range of powerful anxieties which appear repeatedly in the drama and texts of the sixteenth and early seventeenth centuries: anxieties over personal and national identity, over female chastity and masculine authority, and over continuity between generations. Peter Laslett in The World We Have Lost – Further Explored points out that “the engendering of children on a scale which might threaten the social structure was never, or almost never, a present possibility” (154) at this stage of European history. This being granted, the Dauphin’s depiction of such a “wave” of illegitimates, while it might have no roots in reality, functioned as a powerful image of disorder. Illegitimacy as a threat and as a strategy is not limited to the renaissance, although a study of renaissance texts offers a useful guidebook to the use of illegitimacy as a means of polarising and excluding. Although as previously discussed, for many Western countries, the marital status of one’s parents is probably the least meaningful definition associated with the word “illegitimate”, the concept of the nation as a family remains current in modern political discourse, and illegitimate continues to be a powerful metaphor. During the recent independence referendum in Scotland, David Cameron besought the Scottish people not to “break up the national family”; at the same time, the Scottish Nationalists have been constructed as “ungrateful bastards” for wishing to turn their backs on the national family. As Klocker and Dunne, and later O’Brien and Rowe, have demonstrated, the emotive use of words such as “illegitimate” and “illegal” in Australian political rhetoric concerning migration is of long standing. Given current tensions, it might be timely to call for a further and more detailed study of the way in which the term “illegitimate” continues to be used by politicians and the media to define, demonise and exclude certain types of would-be Australian immigrants from the collective Australian “national family”. Suggestions that persons suspected of engaging with terrorist organisations overseas should be stripped of their Australian passports imply the creation of national bastards in an attempt to distance the Australian community from such threats. But the strategy can never be completely successful. Constructing figures as bastard or the illegitimate remains a method by which the legitimate seeks to define itself, but it also means that the bastard or illegitimate can never be wholly separated or cast out. In one form or another, the bastard is here to stay.ReferencesBeardon, Elizabeth. “Sidney's ‘Mongrell Tragicomedy’ and Anglo-Spanish Exchange in the New Arcadia.” Journal for Early Modern Cultural Studies 10 (2010): 29 - 51.Davis, Kingsley. “Illegitimacy and the Social Structure.” American Journal of Sociology 45 (1939).John Cowell. The Interpreter. Cambridge: John Legate, 1607.Greenblatt, Stephen. Renaissance Self-Fashioning: From More to Shakespeare. 1980. Chicago: University of Chicago Press, 2005.Findlay, Alison. Illegitimate Power: Bastards in Renaissance Drama. Manchester: Manchester University Press, 2009.Hay, Denys. Polydore Vergil: Renaissance Historian and Man of Letters. Oxford: Clarendon Press, 1952.Laslett, Peter. The World We Have Lost - Further Explored. London: Methuen, 1983.Laslett, P., K. Oosterveen, and R. M. Smith, eds. Bastardy and Its Comparative History. London: Edward Arnold, 1980.Leach, Edmund. “Anthropological Aspects of Language: Animal Categories and Verbal Abuse.” E. H. Lennenberg, ed. New Directives in the Study of Language. MIT Press, 1964. 23-63. MacFarlane, Alan. The Origins of English Individualism: The Family Property and Social Transition Oxford: Basil Blackwell, 1978.Mclaren, Ann. “Monogamy, Polygamy and the True State: James I’s Rhetoric of Empire.” History of Political Thought 24 (2004): 446 – 480.McAlindon, T. “Testing the New Historicism: “Invisible Bullets” Reconsidered.” Studies in Philology 92 (1995):411 – 438.Neill, Michael. Putting History to the Question: Power, Politics and Society in English Renaissance Drama. New York: Columbia University Press, 2000.Pocock, J.G.A. Virtue, Commerce and History: Essays on English Political Thought and History, Chiefly in the Eighteenth Century. Cambridge: Cambridge University Press, 1985. Puttenham, George. The Arte of English Poesie. Ed. Gladys Doidge Willcock and Alice Walker. Cambridge: Cambridge University Press, 1936.Reekie, Gail. Measuring Immorality: Social Inquiry and the Problem of Illegitimacy. Cambridge: Cambridge University Press, 1998. Rowe, Elizabeth, and Erin O’Brien. “Constructions of Asylum Seekers and Refugees in Australian Political Discourse”. In Kelly Richards and Juan Marcellus Tauri, eds., Crime Justice and Social Democracy: Proceedings of the 2nd International Conference. Brisbane: Queensland University of Technology, 2013.Schleiner, Louise. Tudor and Stuart Women Writers. Bloomington: Indiana University Press, 1994.Shakespeare, William. Henry V in The Norton Shakespeare. Ed. S. Greenblatt, W. Cohen, J.E. Howard, and Katharine Eisaman Maus. New York and London: Norton, 2008.

IntroductionIn July 1997, the Mackay campus of Central Queensland University hosted a conference with the theme Regional Australia: Visions of Mackay. It was the first academic conference to be held at the young campus, and its aim was to provide an opportunity for academics, business people, government officials, and other interested parties to discuss their visions for the development of Mackay, a regional community of 75,000 people situated on the Central Queensland coast (Danaher). I delivered a presentation at that conference and authored a chapter in the book that emerged from its proceedings. The chapter entitled “Mackay Online” explored the potential impact that the Internet could have on the Mackay region, particularly in the areas of regional business, education, health, and entertainment (Pace). Two decades later, how does the reality compare with that vision?Broadband BluesAt the time of the Visions of Mackay conference, public commercial use of the Internet was in its infancy. Many Internet services and technologies that users take for granted today were uncommon or non-existent then. Examples include online video, video-conferencing, Voice over Internet Protocol (VoIP), blogs, social media, peer-to-peer file sharing, payment gateways, content management systems, wireless data communications, smartphones, mobile applications, and tablet computers. In 1997, most users connected to the Internet using slow dial-up modems with speeds ranging from 28.8 Kbps to 33.6 Kbps. 56 Kbps modems had just become available. Lamenting these slow data transmission speeds, I looked forward to a time when widespread availability of high-bandwidth networks would allow the Internet’s services to “expand to include electronic commerce, home entertainment and desktop video-conferencing” (Pace 103). Although that future eventually arrived, I incorrectly anticipated how it would arrive.In 1997, Optus and Telstra were engaged in the rollout of hybrid fibre coaxial (HFC) networks in Sydney, Melbourne, and Brisbane for the Optus Vision and Foxtel pay TV services (Meredith). These HFC networks had a large amount of unused bandwidth, which both Telstra and Optus planned to use to provide broadband Internet services. Telstra's Big Pond Cable broadband service was already available to approximately one million households in Sydney and Melbourne (Taylor), and Optus was considering extending its cable network into regional Australia through partnerships with smaller regional telecommunications companies (Lewis). These promising developments seemed to point the way forward to a future high-bandwidth network, but that was not the case. A short time after the Visions of Mackay conference, Telstra and Optus ceased the rollout of their HFC networks in response to the invention of Asynchronous Digital Subscriber Line (ADSL), a technology that increases the bandwidth of copper wire and enables Internet connections of up to 6 Mbps over the existing phone network. ADSL was significantly faster than a dial-up service, it was broadly available to homes and businesses across the country, and it did not require enormous investment in infrastructure. However, ADSL could not offer speeds anywhere near the 27 Mbps of the HFC networks. When it came to broadband provision, Australia seemed destined to continue playing catch-up with the rest of the world. According to data from the Organisation for Economic Cooperation and Development (OECD), in 2009 Australia ranked 18th in the world for broadband penetration, with 24.1 percent of Australians having a fixed-line broadband subscription. Statistics like these eventually prompted the federal government to commit to the deployment of a National Broadband Network (NBN). In 2009, the Kevin Rudd Government announced that the NBN would combine fibre-to-the-premises (FTTP), fixed wireless, and satellite technologies to deliver Internet speeds of up to 100 Mbps to 90 percent of Australian homes, schools, and workplaces (Rudd).The rollout of the NBN in Mackay commenced in 2013 and continued, suburb by suburb, until its completion in 2017 (Frost, “Mackay”; Garvey). The rollout was anything but smooth. After a change of government in 2013, the NBN was redesigned to reduce costs. A mixed copper/optical technology known as fibre-to-the-node (FTTN) replaced FTTP as the preferred approach for providing most NBN connections. The resulting connection speeds were significantly slower than the 100 Mbps that was originally proposed. Many Mackay premises could only achieve a maximum speed of 40 Mbps, which led to some overcharging by Internet service providers, and subsequent compensation for failing to deliver services they had promised (“Optus”). Some Mackay residents even complained that their new NBN connections were slower than their former ADSL connections. NBN Co representatives claimed that the problems were due to “service providers not buying enough space in the network to provide the service they had promised to customers” (“Telcos”). Unsurprisingly, the number of complaints about the NBN that were lodged with the Telecommunications Industry Ombudsman skyrocketed during the last six months of 2017. Queensland complaints increased by approximately 40 percent when compared with the same period during the previous year (“Qld”).Despite the challenges presented by infrastructure limitations, the rollout of the NBN was a boost for the Mackay region. For some rural residents, it meant having reliable Internet access for the first time. Frost, for example, reports on the experiences of a Mackay couple who could not get an ADSL service at their rural home because it was too far away from the nearest telephone exchange. Unreliable 3G mobile broadband was the only option for operating their air-conditioning business. All of that changed with the arrival of the NBN. “It’s so fast we can run a number of things at the same time”, the couple reported (“NBN”).Networking the NationOne factor that contributed to the uptake of Internet services in the Mackay region after the Visions of Mackay conference was the Australian Government’s Networking the Nation (NTN) program. When the national telecommunications carrier Telstra was partially privatised in 1997, and further sold in 1999, proceeds from the sale were used to fund an ambitious communications infrastructure program named Networking the Nation (Department of Communications, Information Technology and the Arts). The program funded projects that improved the availability, accessibility, affordability, and use of communications facilities and services throughout regional Australia. Eligibility for funding was limited to not-for-profit organisations, including local councils, regional development organisations, community groups, local government associations, and state and territory governments.In 1998, the Mackay region received $930,000 in Networking the Nation funding for Mackay Regionlink, a project that aimed to provide equitable community access to online services, skills development for local residents, an affordable online presence for local business and community organisations, and increased external awareness of the Mackay region (Jewell et al.). One element of the project was a training program that provided basic Internet skills to 2,168 people across the region over a period of two years. A second element of the project involved the establishment of 20 public Internet access centres in locations throughout the region, such as libraries, community centres, and tourist information centres. The centres provided free Internet access to users and encouraged local participation and skill development. More than 9,200 users were recorded in these centres during the first year of the project, and the facilities remained active until 2006. A third element of the project was a regional web portal that provided a free easily-updated online presence for community organisations. The project aimed to have every business and community group in the Mackay region represented on the website, with hosting fees for the business web pages funding its ongoing operation and development. More than 6,000 organisations were listed on the site, and the project remained financially viable until 2005.The availability, affordability and use of communications facilities and services in Mackay increased significantly during the period of the Regionlink project. Changes in technology, services, markets, competition, and many other factors contributed to this increase, so it is difficult to ascertain the extent to which Mackay Regionlink fostered those outcomes. However, the large number of people who participated in the Regionlink training program and made use of the public Internet access centres, suggests that the project had a positive influence on digital literacy in the Mackay region.The Impact on BusinessThe Internet has transformed regional business for both consumers and business owners alike since the Visions of Mackay conference. When Mackay residents made a purchase in 1997, their choice of suppliers was limited to a few local businesses. Today they can shop online in a global market. Security concerns were initially a major obstacle to the growth of electronic commerce. Consumers were slow to adopt the Internet as a place for doing business, fearing that their credit card details would be vulnerable to hackers once they were placed online. After observing the efforts that finance and software companies were making to eliminate those obstacles, I anticipated that it would only be a matter of time before online transactions became commonplace:Consumers seeking a particular product will be able to quickly find the names of suitable suppliers around the world, compare their prices, and place an order with the one that can deliver the product at the cheapest price. (Pace 106)This expectation was soon fulfilled by the arrival of online payment systems such as PayPal in 1998, and online shopping services such as eBay in 1997. eBay is a global online auction and shopping website where individuals and businesses buy and sell goods and services worldwide. The eBay service is free to use for buyers, but sellers are charged modest fees when they make a sale. It exemplifies the notion of “friction-free capitalism” articulated by Gates (157).In 1997, regional Australian business owners were largely sceptical about the potential benefits the Internet could bring to their businesses. Only 11 percent of Australian businesses had some form of web presence, and less than 35 percent of those early adopters felt that their website was significant to their business (Department of Industry, Science and Tourism). Anticipating the significant opportunities that the Internet offered Mackay businesses to compete in new markets, I recommended that they work “towards the goal of providing products and services that meet the needs of international consumers as well as local ones” (107). In the two decades that have passed since that time, many Mackay businesses have been doing just that. One prime example is Big on Shoes (bigonshoes.com.au), a retailer of ladies’ shoes from sizes five to fifteen (Plane). Big on Shoes has physical shopfronts in Mackay and Moranbah, an online store that has been operating since 2009, and more than 12,000 followers on Facebook. This speciality store caters for women who have traditionally been unable to find shoes in their size. As the store’s customer base has grown within Australia and internationally, an unexpected transgender market has also emerged. In 2018 Big on Shoes was one of 30 regional businesses featured in the first Facebook and Instagram Annual Gift Guide, and it continues to build on its strengths (Cureton).The Impact on HealthThe growth of the Internet has improved the availability of specialist health services for people in the Mackay region. Traditionally, access to surgical services in Mackay has been much more limited than in metropolitan areas because of the shortage of specialists willing to practise in regional areas (Green). In 2003, a senior informant from the Royal Australasian College of Surgeons bluntly described the Central Queensland region from Mackay to Gladstone as “a black hole in terms of surgery” (Birrell et al. 15). In 1997 I anticipated that, although the Internet would never completely replace a visit to a local doctor or hospital, it would provide tools that improve the availability of specialist medical services for people living in regional areas. Using these tools, doctors would be able to “analyse medical images captured from patients living in remote locations” and “diagnose patients at a distance” (Pace 108).These expectations have been realised in the form of Queensland Health’s Telehealth initiative, which permits medical specialists in Brisbane and Townsville to conduct consultations with patients at the Mackay Base Hospital using video-conference technology. Telehealth reduces the need for patients to travel for specialist advice, and it provides health professionals with access to peer support. Averill (7), for example, reports on the experience of a breast cancer patient at the Mackay Base Hospital who was able to participate in a drug trial with a Townsville oncologist through the Telehealth network. Mackay health professionals organised the patient’s scans, administered blood tests, and checked her lymph nodes, blood pressure and weight. Townsville health professionals then used this information to advise the Mackay team about her ongoing treatment. The patient expressed appreciation that the service allowed her to avoid the lengthy round-trip to Townsville. Prior to being offered the Telehealth option, she had refused to participate in the trial because “the trip was just too much of a stumbling block” (Averill 7).The Impact on Media and EntertainmentThe field of media and entertainment is another aspect of regional life that has been reshaped by the Internet since the Visions of Mackay conference. Most of these changes have been equally apparent in both regional and metropolitan areas. Over the past decade, the way individuals consume media has been transformed by new online services offering user-generated video, video-on-demand, and catch-up TV. These developments were among the changes I anticipated in 1997:The convergence of television and the Internet will stimulate the creation of new services such as video-on-demand. Today television is a synchronous media—programs are usually viewed while they are being broadcast. When high-quality video can be transmitted over the information superhighway, users will be able to watch what they want, when and where they like. […] Newly released movies will continue to be rented, but probably not from stores. Instead, consumers will shop on the information superhighway for movies that can be delivered on demand.In the mid-2000s, free online video-sharing services such as YouTube and Vimeo began to emerge. These websites allow users to freely upload, view, share, comment on, and curate online videos. Subscription-based streaming services such as Netflix and Amazon Prime have also become increasingly popular since that time. These services offer online streaming of a library of films and television programs for a fee of less than 20 dollars per month. Computers, smart TVs, Blu-ray players, game consoles, mobile phones, tablets, and other devices provide a multitude of ways of accessing streaming services. Some of these devices cost less than 100 dollars, while higher-end electronic devices include the capability as a bundled feature. Netflix became available in Mackay at the time of its Australian launch in 2015. The growth of streaming services greatly reduced the demand for video rental shops in the region, and all closed down as a result. The last remaining video rental store in Mackay closed its doors in 2018 after trading for 26 years (“Last”).Some of the most dramatic transformations that have occurred the field of media and entertainment were not anticipated in 1997. The rise of mobile technology, including wireless data communications, smartphones, mobile applications, and tablet computers, was largely unforeseen at that time. Some Internet luminaries such as Vinton Cerf expected that mobile access to the Internet via laptop computers would become commonplace (Lange), but this view did not encompass the evolution of smartphones, and it was not widely held. Similarly, the rise of social media services and the impact they have had on the way people share content and communicate was generally unexpected. In some respects, these phenomena resemble the Black Swan events described by Nassim Nicholas Taleb (xvii)—surprising events with a major effect that are often inappropriately rationalised after the fact. They remind us of how difficult it is to predict the future media landscape by extrapolating from things we know, while failing to take into consideration what we do not know.The Challenge for MackayIn 1997, when exploring the potential impact that the Internet could have on the Mackay region, I identified a special challenge that the community faced if it wanted to be competitive in this new environment:The region has traditionally prospered from industries that control physical resources such as coal, sugar and tourism, but over the last two decades there has been a global ‘shift away from physical assets and towards information as the principal driver of wealth creation’ (Petre and Harrington 1996). The risk for Mackay is that its residents may be inclined to believe that wealth can only be created by means of industries that control physical assets. The community must realise that its value-added information is at least as precious as its abundant natural resources. (110)The Mackay region has not responded well to this challenge, as evidenced by measures such as the Knowledge City Index (KCI), a collection of six indicators that assess how well a city is positioned to grow and advance in today’s technology-driven, knowledge-based economy. A 2017 study used the KCI to conduct a comparative analysis of 25 Australian cities (Pratchett, Hu, Walsh, and Tuli). Mackay rated reasonably well in the areas of Income and Digital Access. But the city’s ratings were “very limited across all the other measures of the KCI”: Knowledge Capacity, Knowledge Mobility, Knowledge Industries and Smart Work (44).The need to be competitive in a technology-driven, knowledge-based economy is likely to become even more pressing in the years ahead. The 2017 World Energy Outlook Report estimated that China’s coal use is likely to have peaked in 2013 amid a rapid shift toward renewable energy, which means that demand for Mackay’s coal will continue to decline (International Energy Agency). The sugar industry is in crisis, finding itself unable to diversify its revenue base or increase production enough to offset falling global sugar prices (Rynne). The region’s biggest tourism drawcard, the Great Barrier Reef, continues to be degraded by mass coral bleaching events and ongoing threats posed by climate change and poor water quality (Great Barrier Reef Marine Park Authority). All of these developments have disturbing implications for Mackay’s regional economy and its reliance on coal, sugar, and tourism. Diversifying the local economy through the introduction of new knowledge industries would be one way of preparing the Mackay region for the impact of new technologies and the economic challenges that lie ahead.ReferencesAverill, Zizi. “Webcam Consultations.” Daily Mercury 22 Nov. 2018: 7.Birrell, Bob, Lesleyanne Hawthorne, and Virginia Rapson. The Outlook for Surgical Services in Australasia. Melbourne: Monash University Centre for Population and Urban Research, 2003.Cureton, Aidan. “Big Shoes, Big Ideas.” Daily Mercury 8 Dec. 2018: 12.Danaher, Geoff. Ed. Visions of Mackay: Conference Papers. Rockhampton: Central Queensland UP, 1998.Department of Communications, Information Technology and the Arts. Networking the Nation: Evaluation of Outcomes and Impacts. Canberra: Australian Government, 2005.Department of Industry, Science and Tourism. Electronic Commerce in Australia. Canberra: Australian Government, 1998.Frost, Pamela. “Mackay Is Up with Switch to Speed to NBN.” Daily Mercury 15 Aug. 2013: 8.———. “NBN Boost to Business.” Daily Mercury 29 Oct. 2013: 3.Gates, Bill. The Road Ahead. New York: Viking Penguin, 1995.Garvey, Cas. “NBN Rollout Hit, Miss in Mackay.” Daily Mercury 11 Jul. 2017: 6.Great Barrier Reef Marine Park Authority. Reef Blueprint: Great Barrier Reef Blueprint for Resilience. Townsville: Great Barrier Reef Marine Park Authority, 2017.Green, Anthony. “Surgical Services and Referrals in Rural and Remote Australia.” Medical Journal of Australia 177.2 (2002): 110–11.International Energy Agency. World Energy Outlook 2017. France: IEA Publications, 2017.Jewell, Roderick, Mary O’Flynn, Fiorella De Cindio, and Margaret Cameron. “RCM and MRL—A Reflection on Two Approaches to Constructing Communication Memory.” Constructing and Sharing Memory: Community Informatics, Identity and Empowerment. Eds. Larry Stillman and Graeme Johanson. Newcastle: Cambridge Scholars Publishing, 2007. 73–86.Lange, Larry. “The Internet: Where’s It All Going?” Information Week 17 Jul. 1995: 30.“Last Man Standing Shuts Doors after 26 Years of Trade.” Daily Mercury 28 Aug. 2018: 7.Lewis, Steve. “Optus Plans to Share Cost Burden.” Australian Financial Review 22 May 1997: 26.Meredith, Helen. “Time Short for Cable Modem.” Australian Financial Review 10 Apr. 1997: 42Nassim Nicholas Taleb. The Black Swan: The Impact of the Highly Improbable. New York: Random House, 2007.“Optus Offers Comp for Slow NBN.” Daily Mercury 10 Nov. 2017: 15.Organisation for Economic Cooperation and Development. “Fixed Broadband Subscriptions.” OECD Data, n.d. <https://data.oecd.org/broadband/fixed-broadband-subscriptions.htm>.Pace, Steven. “Mackay Online.” Visions of Mackay: Conference Papers. Ed. Geoff Danaher. Rockhampton: Central Queensland University Press, 1998. 111–19.Petre, Daniel and David Harrington. The Clever Country? Australia’s Digital Future. Sydney: Lansdown Publishing, 1996.Plane, Melanie. “A Shoe-In for Big Success.” Daily Mercury 9 Sep. 2017: 6.Pratchett, Lawrence, Richard Hu, Michael Walsh, and Sajeda Tuli. The Knowledge City Index: A Tale of 25 Cities in Australia. Canberra: University of Canberra neXus Research Centre, 2017.“Qld Customers NB-uN Happy Complaints about NBN Service Double in 12 Months.” Daily Mercury 17 Apr. 2018: 1.Rudd, Kevin. “Media Release: New National Broadband Network.” Parliament of Australia Press Release, 7 Apr. 2009 <https://parlinfo.aph.gov.au/parlInfo/search/display/display.w3p;query=Id:"media/pressrel/PS8T6">.Rynne, David. “Revitalising the Sugar Industry.” Sugar Policy Insights Feb. 2019: 2–3.Taylor, Emma. “A Dip in the Pond.” Sydney Morning Herald 16 Aug. 1997: 12.“Telcos and NBN Co in a Crisis.” Daily Mercury 27 Jul. 2017: 6.

IntroductionIt has been nearly half a century since the appearance of Susan Sontag’s landmark essay “The Imagination of Disaster.” The critic wrote of the public fascination with science fiction disaster films, claiming that, on the one hand “from a psychological point of view, the imagination of disaster does not greatly differ from one period in history to another [but, on the other hand] from a political and moral point of view, it does” (224). Even if Sontag is right about aspects of the imagination of disaster not changing, the types, frequency, and magnitude of disasters and their representation in media and popular culture suggest that dynamic conditions prevail on both counts. Disaster has become a significantly urban phenomenon, and highly publicised “worst case” scenarios such as Hurricane Katrina and the Haiti earthquake highlight multiple demographic, cultural, and environmental contexts for visualising cataclysm. The 1950s and 60s science fiction films that Sontag wrote about were filled with marauding aliens and freaks of disabused science. Since then, their visual and dramatic effects have been much enlarged by all kinds of disaster scenarios. Partly imagined, these scenarios have real-life counterparts with threats from terrorism and the war on terror, pan-epidemics, and global climate change. Sontag’s essay—like most, if not all of the films she mentions—overlooked the aftermath; that is, the rebuilding, following extra-terrestrial invasion. It ignored what was likely to happen when the monsters were gone. In contrast, the psychological as well as the practical, social, and economic aspects of reconstruction are integral to disaster discourse today. Writing about how architecture might creatively contribute to post-conflict (including war) and disaster recovery, for instance, Boano elaborates the psychological background for rebuilding, where the material destruction of dwellings and cities “carries a powerful symbolic erosion of security, social wellbeing and place attachment” (38); these are depicted as attributes of selfhood and identity that must be restored. Similarly, Hutchison and Bleiker (385) adopt a view evident in disaster studies, that disaster-struck communities experience “trauma” and require inspired responses that facilitate “healing and reconciliation” as well as material aid such as food, housing, and renewed infrastructure. This paper revisits Sontag’s “The Imagination of Disaster,” fifty years on in view of the changing face of disasters and their representation in film media, including more recent films. The paper then considers disaster recovery and outlines the difficult path that “creative industries” like architecture and urban planning must tread when promising a vision of rebuilding that provides for such intangible outcomes as “healing and reconciliation.” We find that hopes for the seemingly positive psychologically- and socially-recuperative outcomes accompanying the prospect of rebuilding risk a variety of generalisation akin to wish-fulfilment that Sontag finds in disaster films. The Psychology of Science Fiction and Disaster FilmsIn “The Imagination of Disaster,” written at or close to the height of the Cold War, Sontag ruminates on what America’s interest in, if not preoccupation with, science fiction films tell us about ourselves. Their popularity cannot be explained in terms of their entertainment value alone; or if it can, then why audiences found (and still find) such films entertaining is something that itself needs explanation.Depicted in media like photography and film, utopian and dystopian thought have at least one thing in common. Their visions of either perfected or socially alienated worlds are commonly prompted by criticism of the social/political status quo and point to its reform. For Sontag, science fiction films portrayed both people’s worst nightmares concerning disaster and catastrophe (e.g. the end of the world; chaos; enslavement; mutation), as well as their facile victories over the kinds of moral, political, and social dissolution the films imaginatively depicted. Sontag does not explicitly attribute such “happy endings” to wish-fulfilling phantasy and ego-protection. (“Phantasy” is to be distinguished from fantasy. It is a psychoanalytic term for states of mind, often symbolic in form, resulting from infantile wish-fulfilment, desires and instincts.) She does, however, describe the kinds of fears, existential concerns (like annihilation), and crises of meaning they are designed (purpose built) to allay. The fears are a product of the time—the down and dark side of technology (e.g. depersonalisation; ambivalence towards science, scientists, and technology) and changes wrought in our working and personal lives by urbanisation. In short, then as now, science fictions films were both expressions of deep and genuine worries and of the pressing need to inventively set them to rest.When Sontag claims that “the imagination of disaster does not greatly differ” (224) from one period to another, this is because, psychologically speaking, neither the precipitating concerns and fears (death, loss of love, meaninglessness, etc.), nor the ways in which people’s minds endeavour to assuage them, substantively differ. What is different is the way they are depicted. This is unsurprisingly a function of the political, social, and moral situations and milieus that provide the context in which the imagination of disaster unfolds. In contemporary society, the extent to which the media informs and constructs the context in which the imagination operates is unprecedented.Sontag claims that there is little if any criticism of the real social and political conditions that bring about the fears the films depict (223). Instead, fantasy operates so as to displace and project the actual causes away from their all too human origins into outer space and onto aliens. In a sense, this is the core and raison d’etre for such films. By their very nature, science fiction films of the kind Sontag is discussing cannot concern themselves with genuine social or political criticism (even though the films are necessarily expressive of such criticism). Any serious questioning of the moral and political status quo—conditions that are responsible for the disasters befalling people—would hamper the operation of fantasy and its production of temporarily satisfying “solutions” to whatever catastrophe is being depicted.Sontag goes on to discuss various strategies science fiction employs to deal with such fears. For example, through positing a bifurcation between good and evil, and grossly oversimplifying the moral complexity of situations, it allows one to “give outlet to cruel or at least amoral feelings” (215) and to exercise feelings of superiority—moral and otherwise. Ambiguous feelings towards science and technology are repressed. Quick and psychologically satisfying fixes are sought for these by means of phantasy and the imaginative construction of invulnerable heroes. Much of what Sontag says can straightforwardly be applied to catastrophe in general. “Alongside the hopeful fantasy of moral simplification and international unity embodied in the science fiction films lurk the deepest anxieties about contemporary existence” (220). Sontag writes:In the films it is by means of images and sounds […] that one can participate in the fantasy of living through one’s own death and more, the death of cities, the destruction of humanity itself. Science fiction films are not about science. They are about disaster, which is one of the oldest subjects in art. In science fiction films disaster is rarely viewed intensively; it is always extensive. It is a matter of quality and ingenuity […] the science fiction film […] is concerned with the aesthetics of disaster […] and it is in the imagery of destruction that the core of a good science fiction film lies. (212–13)In science fiction films, disaster, though widespread, is viewed intensively as well as extensively. The disturbances constitutive of the disaster are moral and emotional as well as material. People are left without the mental or physical abilities they need to cope. Government is absent or useless. We find ourselves in what amounts to what Naomi Zack (“Philosophy and Disaster”; Ethics for Disaster) describes as a Hobbesian second state of nature—where government is inoperative and chaos (moral, social, political, personal) reigns. Science fiction’s way out is to imaginatively construct scenarios emotionally satisfying enough to temporarily assuage the distress (anomie or chaos) experienced in the film.There is, however, a tremendous difference in the way in which people who face catastrophic occurrences in their lives, as opposed to science fiction, address the problems. For one thing, they must be far closer to complex and quickly changing realities and uncertain truths than are the phantastic, temporarily gratifying, and morally unproblematic resolutions to the catastrophic scenarios that science fiction envisions. Genuine catastrophe, for example war, undermines and dismantles the structures—material structures to be sure but also those of justice, human kindness, and affectivity—that give us the wherewithal to function and that are shown to be inimical to catastrophe as such. Disaster dispenses with civilization while catastrophe displaces it.Special Effects and Changing StorylinesScience fiction and disaster film genres have been shaped by developments in visual simulation technologies providing opportunities for imaginatively mixing fact and fiction. Developments in filmmaking include computer or digital techniques for reproducing on the screen what can otherwise only be imagined as causal sequences of events and spectacles accompanying the wholesale destruction of buildings and cities—even entire planets. Indeed films are routinely promoted on the basis of how cinematographers and technicians have advanced the state of the art. The revival of 3-D movies with films such as Avatar (2009) and Prometheus (2012) is one of a number of developments augmenting the panoramas of 1950s classics featuring “melting tanks, flying bodies, crashing walls, awesome craters and fissures in the earth, plummeting spacecraft [and] colourful deadly rays” (Sontag 213). An emphasis on the scale of destruction and the wholesale obliteration of recognisable sites emblematic of “the city” (mega-structures like the industrial plant in Aliens (1986) and vast space ships like the “Death Star” in two Star Wars sequels) connect older films with new ones and impress the viewer with ever more extraordinary spectacle.Films that have been remade make for useful comparison. On the whole, these reinforce the continuation and predictability of some storylines (for instance, threats of extra-terrestrial invasion), but also the attenuation or disappearance of other narrative elements such as the monsters and anxieties released by mid-twentieth century atomic tests (Broderick). Remakes also highlight emerging themes requiring novel or updated critical frameworks. For example, environmental anxieties, largely absent in 1950s science fiction films (except for narratives involving colliding worlds or alien contacts) have appeared en masse in recent years, providing an updated view on the ethical issues posed by the fall of cities and communities (Taylor, “Urban”).In The Invasion of the Bodysnatchers and its remakes (1956, 1978, 1993), for example, the organic and vegetal nature of the aliens draws the viewer’s attention to an environment formed by combative species, allowing for threats of infestation, growth and decay of the self and individuality—a longstanding theme. In the most recent version, The Invasion (2007), special effects and directorial spirit render the orifice-seeking tendrils of the pod creatures threateningly vigorous and disturbing (Lim). More sanctimonious than physically invasive, the aliens in the 1951 version of The Day the Earth Stood Still are fed up with humankind’s fixation with atomic self-destruction, and threaten global obliteration on the earth (Cox). In the 2008 remake, the suave alien ambassador, Keanu Reeves, targets the environmental negligence of humanity.Science, including science as fiction, enters into disaster narratives in a variety of ways. Some are less obvious but provocative nonetheless; for example, movies dramatising the arrival of aliens such as War of the Worlds (1953 and 2005) or Alien (1979). These more subtle approaches can be personally confronting even without the mutation of victims into vegetables or zombies. Special effects technologies have made it possible to illustrate the course of catastrophic floods and earthquakes in considerable scientific and visual detail and to represent the interaction of natural disasters, the built environment, and people, from the scale of buildings, homes, and domestic lives to entire cities and urban populations.For instance, the blockbuster film The Day After Tomorrow (2004) runs 118 minutes, but has an uncertain fictional time frame of either a few weeks or 72 hours (if the film’s title is to taken literally). The movie shows the world as we know it being mostly destroyed. Tokyo is shattered by hailstones and Los Angeles is twisted by cyclones the likes of which Dorothy would never have seen. New York disappears beneath a mountainous tsunami. All of these events result from global climate change, though whether this is due to human (in) action or other causes is uncertain. Like their predecessors, the new wave of disaster movies like The Day After Tomorrow makes for questionable “art” (Annan). Nevertheless, their reception opens a window onto broader political and moral contexts for present anxieties. Some critics have condemned The Day After Tomorrow for its scientific inaccuracies—questioning the scale or pace of climate change. Others acknowledge errors while commending efforts to raise environmental awareness (Monbiot). Coincident with the film and criticisms in both the scientific and political arena is a new class of environmental heretic—the climate change denier. This is a shadowy character commonly associated with the presidency of George W. Bush and the oil lobby that uses minor inconsistencies of science to claim that climate change does not exist. One thing underlying both twisting facts for the purposes of making science fiction films and ignoring evidence of climate change is an infantile orientation towards the unknown. In this regard, recent films do what science fiction disaster films have always done. While freely mixing truths and half-truths for the purpose of heightened dramatic effect, they fulfil psychological tasks such as orchestrating nightmare scenarios and all too easy victories on the screen. Uncertainty regarding the precise cause, scale, or duration of cataclysmic natural phenomena is mirrored by suspension of disbelief in the viability of some human responses to portrayals of urban disaster. Science fiction, in other words, invites us to accept as possible the flight of Americans and their values to Mexico (The Day After Tomorrow), the voyage into earth’s molten core (The Core 2003), or the disposal of lava in LA’s drainage system (Volcano 1997). Reinforcing Sontag’s point, here too there is a lack of criticism of the real social and political conditions that bring about the fears depicted in the films (223). Moreover, much like news coverage, images in recent natural disaster films (like their predecessors) typically finish at the point where survivors are obliged to pick up the pieces and start all over again—the latter is not regarded as newsworthy. Allowing for developments in science fiction films and the disaster genre, Sontag’s observation remains accurate. The films are primarily concerned “with the aesthetics of destruction, with the peculiar beauties to be found in wreaking havoc, in making a mess” (213) rather than rebuilding. The Imagination of Disaster RecoverySontag’s essay contributes to an important critical perspective on science fiction film. Variations on her “psychological point of view” have been explored. (The two discourses—psychology and cinema—have parallel and in some cases intertwined histories). Moreover, in the intervening years, psychological or psychoanalytical terms and narratives have themselves become even more a part of popular culture. They feature in recent disaster films and disaster recovery discourse in the “real” world.Today, with greater frequency than in the 1950s and 60s films arguably, representations of alien invasion or catastrophic global warming serve to background conflict resolutions of a more quotidian and personal nature. Hence, viewers are led to suspect that Tom Cruise will be more likely to survive the rapacious monsters in the latest The War of the Worlds if he can become less narcissistic and a better father. Similarly, Dennis Quaid’s character will be much better prepared to serve a newly glaciated America for having rescued his son (and marriage) from the watery deep-freezer that New York City becomes in The Day After Tomorrow. In these films the domestic and familial comprise a domain of inter-personal and communal relations from which victims and heroes appear. Currents of thought from the broad literature of disaster studies and Western media also call upon this domain. The imagination of disaster recovery has come to partly resemble a set of problems organised around the needs of traumatised communities. These serve as an object of urban governance, planning, and design conceived in different ways, but largely envisioned as an organic unity that connects urban populations, their pasts, and settings in a meaningful, psychologically significant manner (Furedi; Hutchison and Bleiker; Boano). Terms like “place” or concepts like Boano’s “place-attachment" (38) feature in this discourse to describe this unity and its subjective dimensions. Consider one example. In August 2006, one year after Katrina, the highly respected Journal of Architectural Education dedicated a special issue to New Orleans and its reconstruction. Opening comments by editorialist Barbara Allen include claims presupposing enduring links between the New Orleans community conceived as an organic whole, its architectural heritage imagined as a mnemonic vehicle, and the city’s unique setting. Though largely unsupported (and arguably unsupportable) the following proposition would find agreement across a number of disaster studies and resonates in commonplace reasoning:The culture of New Orleans is unique. It is a mix of ancient heritage with layers and adaptations added by successive generations, resulting in a singularly beautiful cultural mosaic of elements. Hurricane Katrina destroyed buildings—though not in the city’s historic core—and displaced hundreds of thousands of people, but it cannot wipe out the memories and spirit of the citizens. (4) What is intriguing about the claim is an underlying intellectual project that subsumes psychological and sociological domains of reasoning within a distinctive experience of community, place, and memory. In other words, the common belief that memory is an intrinsic part of the human condition of shock and loss gives form to a theory of how urban communities experience disaster and how they might re-build—and justify rebuilding—themselves. This is problematic and invites anachronistic thinking. While communities are believed to be formed partly by memories of a place, “memory” is neither a collective faculty nor is it geographically bounded. Whose memories are included and which ones are not? Are these truly memories of one place or do they also draw on other real or imagined places? Moreover—and this is where additional circumspection is inspired by our reading of Sontag’s essay—does Allen’s editorial contribute to an aestheticised image of place, rather than criticism of the social and political conditions required for reconstruction to proceed with justice, compassionately and affectively? Allowing for civil liberties to enter the picture, Allen adds “it is necessary to enable every citizen to come back to this exceptional city if they so desire” (4). However, given that memories of places and desires for their recovery are not univocal, and often contain competing visions of what was and should be, it is not surprising they should result in competing expectations for reconstruction efforts. This has clearly proven the case for New Orleans (Vederber; Taylor, “Typologies”)ConclusionThe comparison of films invites an extension of Sontag’s analysis of the imagination of disaster to include the psychology, politics, and morality of rebuilding. Can a “psychological point of view” help us to understand not only the motives behind capturing so many scenes of destruction on screen and television, but also something of the creative impulses driving reconstruction? This invites a second question. How do some impulses, particularly those caricatured as the essence of an “enterprise culture” (Heap and Ross) associated with America’s “can-do” or others valorised as positive outcomes of catastrophe in The Upside of Down (Homer-Dixon), highlight or possibly obscure criticism of the conditions which made cities like New Orleans vulnerable in the first place? The broad outline of an answer to the second question begins to appear only when consideration of the ethics of disaster and rebuilding are taken on board. If “the upside” of “the down” wrought by Hurricane Katrina, for example, is rebuilding of any kind, at any price, and for any person, then the equation works (i.e., there is a silver lining for every cloud). If, however, the range of positives is broadened to include issues of social justice, then the figures require more complex arithmetic.ReferencesAllen, Barbara. “New Orleans and Katrina: One Year Later.” Journal of Architectural Education 60.1 (2006): 4.Annan, David. Catastrophe: The End of the Cinema? London: Lorrimer, 1975.Boano, Camillo. “‘Violent Space’: Production and Reproduction of Security and Vulnerabilities.” The Journal of Architecture 16 (2011): 37–55.Broderick, Mick, ed. Hibakusha Cinema: Hiroshima, Nagasaki and the Nuclear Image in Japanese Film. London: Kegan Paul, 1996.Cox, David. “Get This, Aliens: We Just Don’t Care!” The Guardian 15 Dec. 2008 ‹http://www.guardian.co.uk/film/filmblog/2008/dec/15/the-day-the-earth-stood-still›. Furedi, Frank. “The Changing Meaning of Disaster.” Area 39.4 (2007): 482–89.Heap, Shaun H., and Angus Ross, eds. Understanding the Enterprise Culture: Themes in the Work of Mary Douglas. Edinburgh: Edinburgh University Press, 1992. Homer-Dixon, Thomas. The Upside of Down: Catastrophe, Creativity and the Renewal of Civilization. Washington, DC: Island Press, 2006.Hutchison, Emma, and Roland Bleiker. “Emotional Reconciliation: Reconstituting Identity and Community after Trauma.” European Journal of Social Theory 11 (2008): 385–403.Lim, Dennis. “Same Old Aliens, But New Neuroses.” New York Times 12 Aug. 2007: A17.Monbiot, George. “A Hard Rain's A-gonna Fall.” The Guardian 14 May 2004.Sontag, Susan. “The Imagination of Disaster” (1965). Against Interpretation and Other Essays. New York: Dell, 1979. 209–25.Taylor, William M. “Typologies of Katrina: Mnemotechnics in Post-Disaster New Orleans.” Interstices 13 (2012): 71–84.———. “Urban Disasters: Visualising the Fall of Cities and the Forming of Human Values.” Journal of Architecture 11.5 (2006): 603–12.Verderber, Stephen. “Five Years After – Three New Orleans Neighborhoods.” Journal of Architectural Education 64.1 (2010): 107–20.Zack, Naomi. Ethics for Disaster. New York: Rowman and Littlefield, 2009.———. “Philosophy and Disaster.” Homeland Security Affairs 2, article 5 (April 2006): ‹http://www.hsaj.org/?article=2.1.5›.FilmographyAlien. Dir. Ridley Scott. Brandywine Productions, 1979.Aliens. Dir. James Cameron. Brandywine Productions, 1986.Avatar. Dir. James Cameron. Lightstorm Entertainment et al., 2009.The Core. Dir. Jon Amiel. Paramount Pictures, 2003.The Day after Tomorrow. Dir. Roland Emmerich. 20th Century Fox, 2004.The Invasion of the Body Snatchers. Dir. Don Siegel. Allied Artists, 1956; also 1978 and 1993.The Invasion. Dirs. Oliver Hirschbiegel and Jame McTeigue. Village Roadshow et al, 2007.Prometheus. Dir. Ridley Scott. Scott Free and Brandywine Productions, 2012Star Wars Episode IV: A New Hope. Dir. George Lucas. Lucasfilm, 1977.Star Wars Episode VI: Return of the Jedi. Dir. George Lucas. Lucasfilm, 1983.Volcano. Dir. Mick Jackson. 20th Century Fox, 1997.War of the Worlds. Dir. George Pal. Paramount, 1953; also Steven Spielberg. Paramount, 2005.Acknowledgments The authors are grateful to Oenone Rooksby and Joely-Kym Sobott for their assistance and advice when preparing this article. It was also made possible in part by a grant from the Australian Research Council.

Newspapers and the 7:15 Showing Cinemagoing involves planning. Even in the most impromptu instances, one has to consider meeting places, line-ups and competing responsibilities. One arranges child care, postpones household chores, or rushes to finish meals. One must organise transportation and think about routes, traffic, parking or public transit. And during the course of making plans for a trip to the cinema, whether alone or in the company of others, typically one turns to locate a recent newspaper. Consulting its printed page lets us ascertain locations, a selection of film titles and their corresponding show times. In preparing to feed a cinema craving, we burrow through a newspaper to an entertainment section, finding a tableau of information and promotional appeals. Such sections compile the mini-posters of movie advertisements, with their truncated credits, as well as various reviews and entertainment news. We see names of shopping malls doubling as names of theatres. We read celebrity gossip that may or may not pertain to the film selected for that occasion. We informally rank viewing priorities ranging from essential theatrical experiences to those that can wait for the videotape release. We attempt to assess our own mood and the taste of our filmgoing companions, matching up what we suppose are appropriate selections. Certainly, other media vie to supplant the newspaper's role in cinemagoing; many now access on-line sources and telephone services that offer the crucial details about start times. Nonetheless, as a campaign by the Newspaper Association of America in Variety aimed to remind film marketers, 80% of cinemagoers refer to newspaper listings for times and locations before heading out. The accuracy of that association's statistics notwithstanding, for the moment, the local daily or weekly newspaper has a secure place in the routines of cinematic life. A basic impetus for the newspaper's role is its presentation of a schedule of show times. Whatever the venue -- published, phone or on-line -- it strikes me as especially telling that schedules are part of the ordinariness of cinemagoing. To be sure, there are those who decide what film to see on site. Anecdotally, I have had several people comment recently that they no longer decide what movie to see, but where to see a (any) movie. Regardless, the schedule, coupled with the theatre's location, figures as a point of coordination for travel through community space to a site of film consumption. The choice of show time is governed by countless demands of everyday life. How often has the timing of a film -- not the film itself, the theatre at which it's playing, nor one's financial situation --determined one's attendance? How familiar is the assessment that show times are such that one cannot make it, that the film begins a bit too earlier, that it will run too late for whatever reason, and that other tasks intervene to take precedence? I want to make several observations related to the scheduling of film exhibition. Most generally, it makes manifest that cinemagoing involves an exercise in the application of cinema knowledge -- that is, minute, everyday facilities and familiarities that help orchestrate the ordinariness of cultural life. Such knowledge informs what Michel de Certeau characterises as "the procedures of everyday creativity" (xiv). Far from random, the unexceptional decisions and actions involved with cinemagoing bear an ordering and a predictability. Novelty in audience activity appears, but it is alongside fairly exact expectations about the event. The schedule of start times is essential to the routinisation of filmgoing. Displaying a Fordist logic of streamlining commodity distribution and the time management of consumption, audiences circulate through a machine that shapes their constituency, providing a set time for seating, departure, snack purchases and socialising. Even with the staggered times offered by multiplex cinemas, schedules still lay down a fixed template around which other activities have to be arrayed by the patron. As audiences move to and through the theatre, the schedule endeavours to regulate practice, making us the subjects of a temporal grid, a city context, a cinema space, as well as of the film itself. To be sure, one can arrive late and leave early, confounding the schedule's disciplining force. Most importantly, with or without such forms of evasion, it channels the actions of audiences in ways that consideration of the gaze cannot address. Taking account of the scheduling of cinema culture, and its implication of adjunct procedures of everyday life, points to dimensions of subjectivity neglected by dominant theories of spectatorship. To be the subject of a cinema schedule is to understand one assemblage of the parameters of everyday creativity. It would be foolish to see cinema audiences as cattle, herded and processed alone, in some crude Gustave LeBon fashion. It would be equally foolish not to recognise the manner in which film distribution and exhibition operates precisely by constructing images of the activity of people as demographic clusters and generalised cultural consumers. The ordinary tactics of filmgoing are supplemental to, and run alongside, a set of industrial structures and practices. While there is a correlation between a culture industry's imagined audience and the life that ensues around its offerings, we cannot neglect that, as attention to film scheduling alerts us, audiences are subjects of an institutional apparatus, brought into being for the reproduction of an industrial edifice. Streamline Audiences In this, film is no different from any culture industry. Film exhibition and distribution relies on an understanding of both the market and the product or service being sold at any given point in time. Operations respond to economic conditions, competing companies, and alternative activities. Economic rationality in this strategic process, however, only explains so much. This is especially true for an industry that must continually predict, and arguably give shape to, the "mood" and predilections of disparate and distant audiences. Producers, distributors and exhibitors assess which films will "work", to whom they will be marketed, as well as establish the very terms of success. Without a doubt, much of the film industry's attentions act to reduce this uncertainty; here, one need only think of the various forms of textual continuity (genre films, star performances, etc.) and the economies of mass advertising as ways to ensure box office receipts. Yet, at the core of the operations of film exhibition remains a number of flexible assumptions about audience activity, taste and desire. These assumptions emerge from a variety of sources to form a brand of temporary industry "commonsense", and as such are harbingers of an industrial logic. Ien Ang has usefully pursued this view in her comparative analysis of three national television structures and their operating assumptions about audiences. Broadcasters streamline and discipline audiences as part of their organisational procedures, with the consequence of shaping ideas about consumers as well as assuring the reproduction of the industrial structure itself. She writes, "institutional knowledge is driven toward making the audience visible in such a way that it helps the institutions to increase their power to get their relationship with the audience under control, and this can only be done by symbolically constructing 'television audience' as an objectified category of others that can be controlled, that is, contained in the interest of a predetermined institutional goal" (7). Ang demonstrates, in particular, how various industrially sanctioned programming strategies (programme strips, "hammocking" new shows between successful ones, and counter-programming to a competitor's strengths) and modes of audience measurement grow out of, and invariably support, those institutional goals. And, most crucially, her approach is not an effort to ascertain the empirical certainty of "actual" audiences; instead, it charts the discursive terrain in which the abstract concept of audience becomes material for the continuation of industry practices. Ang's work tenders special insight to film culture. In fact, television scholarship has taken full advantage of exploring the routine nature of that medium, the best of which deploys its findings to lay bare configurations of power in domestic contexts. One aspect has been television time and schedules. For example, David Morley points to the role of television in structuring everyday life, discussing a range of research that emphasises the temporal dimension. Alerting us to the non- necessary determination of television's temporal structure, he comments that we "need to maintain a sensitivity to these micro-levels of division and differentiation while we attend to the macro-questions of the media's own role in the social structuring of time" (265). As such, the negotiation of temporal structures implies that schedules are not monolithic impositions of order. Indeed, as Morley puts it, they "must be seen as both entering into already constructed, historically specific divisions of space and time, and also as transforming those pre-existing division" (266). Television's temporal grid has been address by others as well. Paddy Scannell characterises scheduling and continuity techniques, which link programmes, as a standardisation of use, making radio and television predictable, 'user friendly' media (9). John Caughie refers to the organization of flow as a way to talk about the national particularities of British and American television (49-50). All, while making their own contributions, appeal to a detailing of viewing context as part of any study of audience, consumption or experience; uncovering the practices of television programmers as they attempt to apprehend and create viewing conditions for their audiences is a first step in this detailing. Why has a similar conceptual framework not been applied with the same rigour to film? Certainly the history of film and television's association with different, at times divergent, disciplinary formations helps us appreciate such theoretical disparities. I would like to mention one less conspicuous explanation. It occurs to me that one frequently sees a collapse in the distinction between the everyday and the domestic; in much scholarship, the latter term appears as a powerful trope of the former. The consequence has been the absenting of a myriad of other -- if you will, non-domestic -- manifestations of everyday-ness, unfortunately encouraging a rather literal understanding of the everyday. The impression is that the abstractions of the everyday are reduced to daily occurrences. Simply put, my minor appeal is for the extension of this vein of television scholarship to out-of-home technologies and cultural forms, that is, other sites and locations of the everyday. In so doing, we pay attention to extra-textual structures of cinematic life; other regimes of knowledge, power, subjectivity and practice appear. Film audiences require a discussion about the ordinary, the calculated and the casual practices of cinematic engagement. Such a discussion would chart institutional knowledge, identifying operating strategies and recognising the creativity and multidimensionality of cinemagoing. What are the discursive parameters in which the film industry imagines cinema audiences? What are the related implications for the structures in which the practice of cinemagoing occurs? Vectors of Exhibition Time One set of those structures of audience and industry practice involves the temporal dimension of film exhibition. In what follows, I want to speculate on three vectors of the temporality of cinema spaces (meaning that I will not address issues of diegetic time). Note further that my observations emerge from a close study of industrial discourse in the U.S. and Canada. I would be interested to hear how they are manifest in other continental contexts. First, the running times of films encourage turnovers of the audience during the course of a single day at each screen. The special event of lengthy anomalies has helped mark the epic, and the historic, from standard fare. As discussed above, show times coordinate cinemagoing and regulate leisure time. Knowing the codes of screenings means participating in an extension of the industrial model of labour and service management. Running times incorporate more texts than the feature presentation alone. Besides the history of double features, there are now advertisements, trailers for coming attractions, trailers for films now playing in neighbouring auditoriums, promotional shorts demonstrating new sound systems, public service announcements, reminders to turn off cell phones and pagers, and the exhibitor's own signature clips. A growing focal point for filmgoing, these introductory texts received a boost in 1990, when the Motion Picture Association of America changed its standards for the length of trailers, boosting it from 90 seconds to a full two minutes (Brookman). This intertextuality needs to be supplemented by a consideration of inter- media appeals. For example, advertisements for television began appearing in theatres in the 1990s. And many lobbies of multiplex cinemas now offer a range of media forms, including video previews, magazines, arcades and virtual reality games. Implied here is that motion pictures are not the only media audiences experience in cinemas and that there is an explicit attempt to integrate a cinema's texts with those at other sites and locations. Thus, an exhibitor's schedule accommodates an intertextual strip, offering a limited parallel to Raymond Williams's concept of "flow", which he characterised by stating -- quite erroneously -- "in all communication systems before broadcasting the essential items were discrete" (86-7). Certainly, the flow between trailers, advertisements and feature presentations is not identical to that of the endless, ongoing text of television. There are not the same possibilities for "interruption" that Williams emphasises with respect to broadcasting flow. Further, in theatrical exhibition, there is an end-time, a time at which there is a public acknowledgement of the completion of the projected performance, one that necessitates vacating the cinema. This end-time is a moment at which the "rental" of the space has come due; and it harkens a return to the street, to the negotiation of city space, to modes of public transit and the mobile privatisation of cars. Nonetheless, a schedule constructs a temporal boundary in which audiences encounter a range of texts and media in what might be seen as limited flow. Second, the ephemerality of audiences -- moving to the cinema, consuming its texts, then passing the seat on to someone else -- is matched by the ephemerality of the features themselves. Distributors' demand for increasing numbers of screens necessary for massive, saturation openings has meant that films now replace one another more rapidly than in the past. Films that may have run for months now expect weeks, with fewer exceptions. Wider openings and shorter runs have created a cinemagoing culture characterised by flux. The acceleration of the turnover of films has been made possible by the expansion of various secondary markets for distribution, most importantly videotape, splintering where we might find audiences and multiplying viewing contexts. Speeding up the popular in this fashion means that the influence of individual texts can only be truly gauged via cross-media scrutiny. Short theatrical runs are not axiomatically designed for cinemagoers anymore; they can also be intended to attract the attention of video renters, purchasers and retailers. Independent video distributors, especially, "view theatrical release as a marketing expense, not a profit center" (Hindes & Roman 16). In this respect, we might think of such theatrical runs as "trailers" or "loss leaders" for the video release, with selected locations for a film's release potentially providing visibility, even prestige, in certain city markets or neighbourhoods. Distributors are able to count on some promotion through popular consumer- guide reviews, usually accompanying theatrical release as opposed to the passing critical attention given to video release. Consequently, this shapes the kinds of uses an assessment of the current cinema is put to; acknowledging that new releases function as a resource for cinema knowledge highlights the way audiences choose between and determine big screen and small screen films. Taken in this manner, popular audiences see the current cinema as largely a rough catalogue to future cultural consumption. Third, motion picture release is part of the structure of memories and activities over the course of a year. New films appear in an informal and ever-fluctuating structure of seasons. The concepts of summer movies and Christmas films, or the opening weekends that are marked by a holiday, sets up a fit between cinemagoing and other activities -- family gatherings, celebrations, etc. Further, this fit is presumably resonant for both the industry and popular audiences alike, though certainly for different reasons. The concentration of new films around visible holiday periods results in a temporally defined dearth of cinemas; an inordinate focus upon three periods in the year in the U.S. and Canada -- the last weekend in May, June/July/August and December -- creates seasonal shortages of screens (Rice-Barker 20). In fact, the boom in theatre construction through the latter half of the 1990s was, in part, to deal with those short-term shortages and not some year-round inadequate seating. Configurations of releasing colour a calendar with the tactical manoeuvres of distributors and exhibitors. Releasing provides a particular shape to the "current cinema", a term I employ to refer to a temporally designated slate of cinematic texts characterised most prominently by their newness. Television arranges programmes to capitalise on flow, to carry forward audiences and to counter-programme competitors' simultaneous offerings. Similarly, distributors jostle with each other, with their films and with certain key dates, for the limited weekends available, hoping to match a competitor's film intended for one audience with one intended for another. Industry reporter Leonard Klady sketched some of the contemporary truisms of releasing based upon the experience of 1997. He remarks upon the success of moving Liar, Liar (Tom Shadyac, 1997) to a March opening and the early May openings of Austin Powers: International Man of Mystery (Jay Roach, 1997) and Breakdown (Jonathan Mostow, 1997), generally seen as not desirable times of the year for premieres. He cautions against opening two films the same weekend, and thus competing with yourself, using the example of Fox's Soul Food (George Tillman, Jr., 1997) and The Edge (Lee Tamahori, 1997). While distributors seek out weekends clear of films that would threaten to overshadow their own, Klady points to the exception of two hits opening on the same date of December 19, 1997 -- Tomorrow Never Dies (Roger Spottiswoode, 1997) and Titanic (James Cameron, 1997). Though but a single opinion, Klady's observations are a peek into a conventional strain of strategising among distributors and exhibitors. Such planning for the timing and appearance of films is akin to the programming decisions of network executives. And I would hazard to say that digital cinema, reportedly -- though unlikely -- just on the horizon and in which texts will be beamed to cinemas via satellite rather than circulated in prints, will only augment this comparison; releasing will become that much more like programming, or at least will be conceptualised as such. To summarize, the first vector of exhibition temporality is the scheduling and running time; the second is the theatrical run; the third is the idea of seasons and the "programming" of openings. These are just some of the forces streamlining filmgoers; the temporal structuring of screenings, runs and film seasons provides a material contour to the abstraction of audience. Here, what I have delineated are components of an industrial logic about popular and public entertainment, one that offers a certain controlled knowledge about and for cinemagoing audiences. Shifting Conceptual Frameworks A note of caution is in order. I emphatically resist an interpretation that we are witnessing the becoming-film of television and the becoming-tv of film. Underneath the "inversion" argument is a weak brand of technological determinism, as though each asserts its own essential qualities. Such a pat declaration seems more in line with the mythos of convergence, and its quasi-Darwinian "natural" collapse of technologies. Instead, my point here is quite the opposite, that there is nothing essential or unique about the scheduling or flow of television; indeed, one does not have to look far to find examples of less schedule-dependent television. What I want to highlight is that application of any term of distinction -- event/flow, gaze/glance, public/private, and so on -- has more to do with our thinking, with the core discursive arrangements that have made film and television, and their audiences, available to us as knowable and different. So, using empirical evidence to slide one term over to the other is a strategy intended to supplement and destabilise the manner in which we draw conclusions, and even pose questions, of each. What this proposes is, again following the contributions of Ien Ang, that we need to see cinemagoing in its institutional formation, rather than some stable technological, textual or experiential apparatus. The activity is not only a function of a constraining industrial practice or of wildly creative patrons, but of a complex inter-determination between the two. Cinemagoing is an organisational entity harbouring, reviving and constituting knowledge and commonsense about film commodities, audiences and everyday life. An event of cinema begins well before the dimming of an auditorium's lights. The moment a newspaper is consulted, with its local representation of an internationally circulating current cinema, its listings belie a scheduling, an orderliness, to the possible projections in a given location. As audiences are formed as subjects of the current cinema, we are also agents in the continuation of a set of institutions as well. References Ang, Ien. Desperately Seeking the Audience. New York: Routledge, 1991. Brookman, Faye. "Trailers: The Big Business of Drawing Crowds." Variety 13 June 1990: 48. Caughie, John. "Playing at Being American: Games and Tactics." Logics of Television: Essays in Cultural Criticism. Ed. Patricia Mellencamp. Bloomington: Indiana UP, 1990. De Certeau, Michel. The Practice of Everyday Life. Trans. Steve Rendall. Berkeley: U of California P, 1984. Hindes, Andrew, and Monica Roman. "Video Titles Do Pitstops on Screens." Variety 16-22 Sep. 1996: 11+. Klady, Leonard. "Hitting and Missing the Market: Studios Show Savvy -- or Just Luck -- with Pic Release Strategies." Variety 19-25 Jan. 1998: 18. Morley, David. Television, Audiences and Cultural Studies. New York: Routledge, 1992. Newspaper Association of America. "Before They See It Here..." Advertisement. Variety 22-28 Nov. 1999: 38. Rice-Barker, Leo. "Industry Banks on New Technology, Expanded Slates." Playback 6 May 1996: 19-20. Scannell, Paddy. Radio, Television and Modern Life. Oxford: Blackwell, 1996. Williams, Raymond. Television: Technology and Cultural Form. New York: Schocken, 1975. Citation reference for this article MLA style: Charles Acland. "Matinees, Summers and Opening Weekends: Cinemagoing Audiences as Institutional Subjects." M/C: A Journal of Media and Culture 3.1 (2000). [your date of access] <http://www.uq.edu.au/mc/0003/cinema.php>. Chicago style: Charles Acland, "Matinees, Summers and Opening Weekends: Cinemagoing Audiences as Institutional Subjects," M/C: A Journal of Media and Culture 3, no. 1 (2000), <http://www.uq.edu.au/mc/0003/cinema.php> ([your date of access]). APA style: Charles Acland. (2000) Matinees, Summers and Opening Weekends: Cinemagoing Audiences as Institutional Subjects. M/C: A Journal of Media and Culture 3(1). <http://www.uq.edu.au/mc/0003/cinema.php> ([your date of access]).

Obscured in contemporary climate change discourse is the fact that under even the most serious mitigation scenarios being envisaged it will be virtually impossible to avoid runaway ecosystem collapse; so great is the momentum of global greenhouse build-up (Anderson and Bows). And under even the best-case scenario, two-degree warming, the ecological, social, and economic costs are proving to be much deeper than first thought. The greenhouse genie is out of the bottle, but the best that appears to be on offer is a gradual transition to the pro-growth, pro-consumption discourse of “ecological modernisation” (EM); anything more seems politically unpalatable (Barry, Ecological Modernisation; Adger et al.). Here, I aim to account for how cheaply EM has managed to allay ecology. To do so, I detail the operations of the co-optive, definitional strategy which I call the “high-ground” strategy, waged by a historic bloc of actors, discourses, and institutions with a common interest in resisting radical social and ecological critique. This is not an argument about climate laggards like the United States and Australia where sceptic views remain near the centre of public debate. It is a critique of climate leaders such as the United Kingdom, Germany, and the Netherlands—nations at the forefront of the adoption of EM policies and discourses. With its antecedent in sustainable development discourse, by emphasising technological innovation, eco-efficiency, and markets, EM purports to transcend the familiar dichotomy between the economy and the environment (Hajer; Barry, ‘Towards’). It rebuts the 1970s “limits to growth” perspective and affirms that “the only possible way out of the ecological crisis is by going further into the process of modernisation” (Mol qtd. in York and Rosa 272, emphasis in original). Its narrative is one in which the “dirty and ugly industrial caterpillar transforms into an ecological butterfly” (Huber, qtd. in Spaargaren and Mol). How is it that a discourse notoriously quiet on endless growth, consumer culture, and the offshoring of dirty production could become the cutting edge of environmental policy? To answer this question we need to examine the discursive and ideological effects of EM discourse. In particular, we must analyse the strategies that work to continually naturalise dominant institutions and create the appearance that they are fit to respond to climate change. Co-opting Environmental Discourse Two features characterise state environmental discourse in EM nations: an almost universal recognition of the problem, and the reassurance that present institutions are capable of addressing it. The key organs of neoliberal capitalism—markets and states—have “gone green”. In boardrooms, in advertising and public relations, in governments, and in international fora, climate change is near the top of the agenda. While EM is the latest form of this discourse, early hints can be seen in President Nixon’s embrace of the environment and Margaret Thatcher’s late-1980s green rhetoric. More recently, David Cameron led a successful Conservative Party “detoxification” program with an ostentatious rhetorical strategy featuring the electoral slogan, “Vote blue, go green” (Carter). We can explain this transformation with reference to a key shift in the discursive history of environmental politics. The birth of the modern environmental movement in the 1960s and 70s brought a new symbolic field, a new discourse, into the public sphere. Yet by the 1990s the movement was no longer the sole proprietor of its discourse (Eder 203). It had lost control of its symbols. Politicians, corporations, and media outlets had assumed a dominant role in efforts to define “what climate change was and what it meant for the world” (Carvalho and Burgess 1464). I contend that the dramatic rise to prominence of environmental issues in party-political discourse is not purely due to short-term tactical vote-winning strategy. Nor is it the case that governments are finally, reluctantly waking up to the scientific reality of ecological degradation. Instead, they are engaged in a proactive attempt to redefine the contours of green critique so as to take the discourse onto territory in which established interests already control the high ground. The result is the defusing of the oppositional element of political ecology (Dryzek et al. 665–6), as well as social critique in general: what I term the gentrification of climate change. If we view environmentalism as, at least partially, a cultural politics in which contested definitions of problem is the key political battleground, we can trace how dominant interests have redefined the contours of climate change discourse. We can reveal the extent to which environmentalism, rather than being integrated into capitalism, has been co-opted. The key feature of this strategy is to present climate change as a mere aberration against a background of business-as-usual. The solutions that are presented are overwhelmingly extensions of existing institutions: bringing CO2 into the market, the optimistic development of new techno-scientific solutions to climate problems, extending regulatory regimes into hitherto overlooked domains. The agent of this co-optive strategy is not the state, industry, capital, or any other manifest actor, but a “historic bloc” cutting across divisions between society, politics, and economy (Laclau and Mouffe 42). The agent is an abstract coalition that is definable only to the extent that its strategic interests momentarily intersect at one point or another. The state acts as a locus, but the bloc is itself not reducible to the state. We might also think of the agent as an assemblage of conditions of social reproduction, in which dominant social, political, and economic interests have a stake. The bloc has learned the lesson that to be a player in a definitional battle one must recognise what is being fought over. Thus, exhortations to address climate change and build a green economy represent the first stage of the definitional battle for climate change: an attempt to enter the contest. In practical terms, this has manifest as the marking out of a self-serving division between action and inaction. Articulated through a binary modality climate change becomes something we either address/act on/tackle—or not. Under such a grammar even the most meagre efforts can be presented as “tackling climate change.” Thus Kevin Rudd was elected in 2007 on a platform of “action on climate change”, and he frequently implored that Australia would “do its bit” on climate change during his term. Tony Blair is able to declare that “tackling climate change… need not limit greater economic opportunity” and mean it in all sincerity (Barry, ‘Towards’ 112). So deployed, this binary logic minimises climate change to a level at which existing institutions are validated as capable of addressing the “problem,” and the government legitimised for its moral, green stand. The Hegemonic Articulation of Climate Change The historic bloc’s main task in the high-ground strategy is to re-articulate the threat in terms of its own hegemonic discourse: market economics. The widely publicised and highly influential Stern Review, commissioned by the British Government, is the standard-bearer of how to think about climate change from an economic perspective. It follows a supremely EM logic: economy and ecology have been reconciled. The Review presents climate change, famously, as “the greatest market failure the world has ever seen” (Stern et al. viii). The structuring horizon of the Stern Review is the correction of this failure, the overcoming of what is perceived to be not a systemic problem requiring a reappraisal of social institutions, but an issue of carbon pricing, technology policy, and measures aimed at “reducing barriers to behavioural change”. Stern insists that “we can be ‘green’ and grow. Indeed, if we are not ‘green’, we will eventually undermine growth, however measured” (iv). He reassures us that “tackling climate change is the pro-growth strategy for the longer term, and it can be done in a way that does not cap the aspirations for growth of rich or poor countries” (viii). Yet Stern’s seemingly miraculous reconciliation of growth with climate change mitigation in fact implies a severe degree of warming. The Stern Review aims to stabilise carbon dioxide equivalent concentrations at 550ppm, which would correspond to an increase of global temperature of 3-4 degrees Celsius. As Foster et al. note, this scenario, from an orthodox economist who is perceived as being pro-environment, is ecologically unsustainable and is viewed as catastrophic by many scientists (Foster, Clark, and York 1087–88). The reason Stern gives for not attempting deeper cuts is that they “are unlikely to be economically viable” (Stern et al. 231). In other words, the economy-ecology articulation is not a meeting of equals. Central to the policy prescriptions of EM is the marketising of environmental “bads” like carbon emissions. Carbon trading schemes, held in high esteem by moderate environmentalists and market economists alike, are the favoured instruments for such a task. Yet, in practice, these schemes can do more harm than good. When Prime Minister Kevin Rudd tried to legislate the Carbon Pollution Reduction Scheme as a way of addressing the “greatest moral challenge of our generation” it represented Australia’s “initial foray into ecological modernisation” (Curran 211). Denounced for its weak targets and massive polluter provisions, the Scheme was opposed by environmental groups, the CSIRO, and even the government’s own climate change advisor (Taylor; Wilkinson). While the Scheme’s defenders claimed it was as a step in the right direction, these opponents believed it would hurt more than help the environment. A key strategy in enshrining a particular hegemonic articulation is the repetition and reinforcement of key articulations in a way which is not overtly ideological. As Spash notes of the Stern Review, while it does connect to climate change such issues as distributive justice, value and ethical conflicts, intergenerational issues, this amounts to nothing but lip service given the analysis comes pre-formed in an orthodox economics mould. The complex of interconnected issues raised by climate change is reduced to the impact of carbon control on consumption growth (see also Swyngedouw and While, Jonas, and Gibbs). It is as if the system of relations we call global capitalism—relations between state and industry, science and technology, society and nature, labour and capital, North and South—are irrelevant to climate change, which is nothing but an unfortunate over-concentration of certain gases. In redrawing the discursive boundaries in this way it appears that climate change is a temporary blip on the path to a greener prosperity—as if markets and capitalism merely required minor tinkering to put them on the green-growth path. Markets are constituted as legitimate tools for managing climate change, in concert with regulation internalised within neoliberal state competition (While, Jonas, and Gibbs 81). The ecology-economy articulation both marketises “green,” and “greens” markets. Consonant with the capitalism-environment articulation is the prominence of the sovereign individual. Both the state and the media work to reproduce subjects largely as consumers (of products and politics) rather than citizens, framing environmental responsibility as the responsibility to consume “wisely” (Carvalho). Of course, what is obscured in this “self-greening” discourse is the culpability of consumption itself, and of a capitalist economy based on endless consumption growth, exploitation of resources, and the pursuit of new markets. Greening Technology EM also “greens” technology. Central to its pro-growth ethos is the tapering off of ecosystem impacts through green technologies like solar, wind, tidal, and geothermal. While green technologies are preferable to dependence upon resource-intensive technologies of oil and coal, that they may actually deliver on such promises has been shown to be contingent upon efficiency outstripping economic growth, a prospect that is dubious at best, especially considering the EM settlement is one in which any change to consumption practices is off the agenda. As Barry and Paterson put it, “all current experience suggests that, in most areas, efficiency gains per unit of consumption are usually outstripped by overall increases in consumption” (770). The characteristic ideological manoeuvre of foregrounding non-representative examples is evident here: green technologies comprise a tiny fraction of all large-scale deployed technologies, yet command the bulk of attention and work to cast technology generally in a green light. It is also false to assume that green technologies do not put their own demands on material resources. Deploying renewables on the scale that is required to address climate change demands enormous quantities of concrete, steel, glass and rare earth minerals, and vast programs of land-clearing to house solar and wind plants (Charlton 40). Further, claims that economic growth can become detached from ecological disturbance are premised on a limited basket of ecological indicators. Corporate marketing strategies are driving this green-technology articulation. While a single advertisement represents an appeal to consume an individual commodity, taken collectively advertising institutes a culture of consumption. Individually, “greenwash” is the effort to spin one company’s environmental programs out of proportion while minimising the systemic degradation that production entails. But as a burgeoning social institution, greenwash constitutes an ideological apparatus constructing industry as fundamentally working in the interests of ecology. In turn, each corporate image of pristine blue skies, flourishing ecosystems, wind farms, and solar panels constitutes a harmonious fantasy of green industry. As David Mackay, chief scientific advisor to the UK Government has pointed out, the political rhetoric of green technology lulls people into a false sense of security (qtd. in Charlton 38). Again, a binary logic works to portray greener technologies—such as gas, “clean coal”, and biomass combustion—as green. Rescuing Legitimacy There are essentially two critical forces that are defused in the high-ground strategy’s definitional project. The first is the scientific discourse which maintains that the measures proposed by leading governments are well below what is required to reign in dangerous climate change. This seems to be invisible not so much because it is radical but because it is obscured by the uncertainties in which climate science is couched, and by EM’s noble-sounding rhetoric. The second is the radical critique which argues that climate change is a classic symptom of an internal contradiction of a capitalist economy seeking endless growth in a finite world. The historic bloc’s successful redefinition strategy appears to jam the frequency of serious, scientifically credible climate discourse, yet at the level of hegemonic struggle its effects range wider. In redefining climate change and other key signifiers of green critique – “environment”, “ecology”, “green”, “planet”—it expropriates key properties of its antagonist. Were it not that climate change is now defined on the cheery, reassuring ground of EM discourse, the gravity of the alarming—rather than alarmist (Risbey)—scientific discourse may just have offered radical critique the ammunition it needed to provoke society into serious deliberations over its socioeconomic path. Radical green critique is not in itself the chief enemy of the historic bloc. But it is a privileged element within antagonistic discourse and reinforces the critical element of the feminist, civil rights, and student movements of the 1960s and 1970s. In this way ecology has tended to act as a nodal point binding general social critique: all of the other demands began to be inscribed with the green critique, just as the green critique became a metaphor for all of the others (Laclau). The metaphorical value of the green critique not only relates to the size and vibrancy of the movement—the immediate visibility of ecological destruction stood as a powerful symbol of the kernel of antagonistic politics: a sense that society had fundamentally gone awry. While green critique demands that progress should be conditional upon ecology, EM professes that progress is already green (Eder 217n). Thus the great win achieved by the high-ground strategy is not over radical green critique per se but over the shifting coalition that threatens its legitimacy. As Stavrakakis observes, what is novel about green discourse is nothing essential to the signifiers it deploys, but the way that a common signifier comes to stand in and structure the field as a whole – to serve as a nodal point. It has a number of signifiers: environmental sustainability, social justice, grassroots democracy, and peace and non-violence, all of which are “quilted” around the master-signifiers of “ecology”, “green”, or “planet”. While these master-signifiers are not unique to green ideology, what is unique is that they stand at the centre. But the crucial point to note about the green signifier at the heart of political ecology is that its value is accorded, in large part, through its negation of the dominant ideology. That is to say, it is not that green ideology stands as merely another way of mapping the social; rather, the master-signifier "green" contains an implicit refutation of the dominant social order. That “green” is now almost wholly evacuated of its radical connotations speaks to the effectiveness of the redefinitional effort.The historic bloc is aided in its efforts by the complexity of climate change. Such opacity is characteristic of contemporary risks, whose threats are mostly “a type of virtual reality, real virtuality” (Beck 213). The political struggle then takes place at the level of meaning, and power is played out in a contest to fix the definitions of key risks such as climate change. When relations of (risk) definition replace relations of production as the site of the effects of power, a double mystification ensues and shifts in the ground on which the struggle takes place may go unnoticed. Conclusion By articulating ecology with markets and technology, EM transforms the threat of climate change into an opportunity, a new motor of neoliberal legitimacy. The historic bloc has co-opted environmentalist discourse to promote a gentrified climate change which present institutions are capable of managing: “We are at the fork in the road between order and catastrophe. Stick with us. We will get you through the crisis.” The sudden embrace of the environment by Nixon and by Thatcher, the greening of Cameron’s Conservatives, the Garnaut and Stern reports, and the Australian Government’s foray into carbon trading all have their more immediate policy and political aims. Yet they are all consistent with the high-ground definitional strategy, professing no contraction between sustainability and the present socioeconomic order. Undoubtedly, EM is vastly preferable to denial and inaction. It may yet open the doors to real ecological reform. But in its present form, its preoccupation is the legitimation crisis threatening dominant interests, rather than the ecological crisis facing us all. References Adger, W. Neil, Tor A. Benjaminsen, Katrina Brown, and Hanne Svarstad. ‘Advancing a Political Ecology of Global Environmental Discourses.’ Development and Change 32.4 (2001): 681–715. Anderson, Kevin, and Alice Bows. “Beyond ‘Dangerous’ Climate Change: Emission Scenarios for a New World.” Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences 369.1934 (2010): 20–44. Barry, John, and Matthew Paterson. “Globalisation, Ecological Modernisation and New Labour.”Political Studies 52.4 (2004): 767–84. Barry, John. “Ecological Modernisation.” Debating the Earth : the Environmental Politics Reader. Ed. John S. Dryzek & David Schlosberg. Oxford; New York: Oxford University Press, 2005. ——-. “Towards a Model of Green Political Economy: From Ecological Modernisation to Economic Security.” Global Ecological Politics. Ed. John Barry and Liam Leonard. Bingley: Emerald Group Publishing, 2010. 109–28. Beck, Ulrich. “Risk Society Revisited.” The Risk Society and Beyond: Critical Issues for Social Theory. Ed. Barbara Adam, Ulrich Beck, & Joost Van Loon. London: SAGE, 2000. Carter, Neil. “Vote Blue, Go Green? Cameron’s Conservatives and the Environment.” The Political Quarterly 80.2 (2009): 233–42. Carvalho, Anabela. “Ideological Cultures and Media Discourses on Scientific Knowledge: Re-reading News on Climate Change.” Public Understanding of Science 16.2 (2007): 223–43. Carvalho, Anabela, and Jacquelin Burgess. “Cultural Circuits of Climate Change in UK Broadsheet Newspapers, 1985–2003.” Risk analysis 25.6 (2005): 1457–69. Charlton, Andrew. “Choosing Between Progress and Planet.” Quarterly Essay 44 (2011): 1. Curran, Giorel. “Ecological Modernisation and Climate Change in Australia.” Environmental Politics 18.2: 201-17. Dryzek, John. S., Christian Hunold, David Schlosberg, David Downes, and Hans-Kristian Hernes. “Environmental Transformation of the State: The USA, Norway, Germany and the UK.” Political studies 50.4 (2002): 659–82. Eder, Klaus. “The Institutionalisation of Environmentalism: Ecological Discourse and the Second Transformation of the Public Sphere.” Risk, Environment and Modernity: Towards a New Ecology. Ed. Scott Lash, Bronislaw Szerszynski, & Brian Wynne. 1996. 203–23. Foster, John Bellamy, Brett Clark, and Richard York. “The Midas Effect: a Critique of Climate Change Economics.” Development and Change 40.6 (2009): 1085–97. Hajer, Maarten. The Politics of Environmental Discourse: Ecological Modernization and the Policy Process. Oxford: Oxford University Press, 1995. Laclau, Ernesto. On Populist Reason. London: Verso, 2005. Laclau, Ernesto, and Chantal Mouffe. Hegemony and Socialist Strategy: Towards a Radical Democratic Politics. London: Verso, 1985. Risbey, J. S. “The New Climate Discourse: Alarmist or Alarming?” Global Environmental Change18.1 (2008): 26–37. Spaargaren, Gert, and Arthur P.J. Mol, “Sociology, Environment, and Modernity: Ecological Modernization as a Theory of Social Change.” Society and Natural Resources 5.4 (1992): 323-44. Spash, Clive. L. “Review of The Economics of Climate Change (The Stern Review).”Environmental Values 16.4 (2007): 532–35. Stavrakakis, Yannis. “Green Ideology: A Discursive Reading.” Journal of Political Ideologies 2.3 (1997): 259–79. Stern, Nicholas et al. Stern Review: The Economics of Climate Change. Vol. 30. London: HM Treasury, 2006. Swyngedouw, Erik. “Apocalypse Forever? Post-political Populism and the Spectre of Climate Change.” Theory, Culture & Society 27.2-3 (2010): 213–32. Taylor, Lenore. “Try Again on Carbon: Garnaut.” The Australian 17 Apr. 2009: 1. While, Aidan, Andrew E.G. Jonas, and David Gibbs. “From Sustainable Development to Carbon Control: Eco-state Restructuring and the Politics of Urban and Regional Development.”Transactions of the Institute of British Geographers 35.1 (2010): 76–93. Wilkinson, Marian. “Scientists on Attack over Rudd Emissions Plan.” Sydney Morning Herald Apr. 15 2009: 1. York, Richard, and Eugene Rosa. “Key Challenges to Ecological Modernization theory.”Organization & Environment 16.1 (2003): 273-88.