Academic literature on the topic 'Double taxation – Congo (Democratic Republic)'

According to the resource curse theory, persistent violence in developing areas results from rebels’ ability to finance warfare with natural resource revenues. Surprisingly, this overlooks the complexities of raising revenue from a mobile mining population that values security as well as income. The literature thus neglects a fundamental question: what are the incentives of rebel groups to prevent or perpetuate conflict in mining areas? This paper delineates a rational to both increase and decrease violence. Protecting a mine should allow rebels to extract taxes in return. Simultaneously, to maintain this demand for security, rebels may need to destabilize the wider area. The hypotheses are tested with novel data on rebel taxation at over 3’000 artisanal mines in the eastern Democratic Republic of the Congo. Supporting the hypotheses, the results show that rebel-taxed mines appear exempt from violence nearby but imperiled at the perimeter.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

The 2018–2020 Ebola outbreak in the Democratic Republic of the Congo is the first to occur in an armed conflict zone. The resulting impact on population movement, treatment centres and surveillance has created an unprecedented challenge for real-time epidemic forecasting. Most standard mathematical models cannot capture the observed incidence trajectory when it deviates from a traditional epidemic logistic curve. We fit seven dynamic models of increasing complexity to the incidence data published in the World Health Organization Situation Reports, after adjusting for reporting delays. These models include a simple logistic model, a Richards model, an endemic Richards model, a double logistic growth model, a multi-model approach and two sub-epidemic models. We analyse model fit to the data and compare real-time forecasts throughout the ongoing epidemic across 29 weeks from 11 March to 23 September 2019. We observe that the modest extensions presented allow for capturing a wide range of epidemic behaviour. The multi-model approach yields the most reliable forecasts on average for this application, and the presented extensions improve model flexibility and forecasting accuracy, even in the context of limited epidemiological data.

ObjectiveTo investigate the correlates of the double burden of malnutrition (DBM) among women in five sub-Saharan African countries.DesignSecondary analysis of Demographic and Health Surveys (DHS). The outcome variable was body mass index (BMI), a measure of DBM. The BMI was classified into underweight (BMI <18.50 kg/m2), normal weight (18.50–24.99 kg/m2), overweight (25.0–29.9 kg/m2) and obesity (≥30.0 kg/m2).SettingsGhana, Nigeria, Kenya, Mozambique and Democratic Republic of Congo (DRC).SubjectsWomen aged 15–49 years (n=64698).ResultsCompared with normal weight women, number of years of formal education was associated with the likelihood of being overweight and obese in Ghana, Mozambique and Nigeria, while associated with the likelihood of being underweight in Kenya and Nigeria. Older age was associated with the likelihood of being underweight, overweight and obese in all countries. Positive associations were also observed between living in better-off households and overweight and obesity, while a negative association was observed for underweight. Breastfeeding was associated with less likelihood of underweight in DRC and Nigeria, obesity in DRC and Ghana, overweight in Kenya and overweight and obesity in Mozambique and Nigeria relative to normal weight.ConclusionsOur analysis reveals that in all the countries, women who are breastfeeding are less likely to be underweight, overweight and obese. Education, age and household wealth index tend to associate with a higher likelihood of DBM among women. Interventions to address DBM should take into account the variations in the effects of these correlates.

Over the years, the African continent has had to battle several outbreaks of infectious diseases in different countries. Some of the most deadly were the Ebola virus disease (EVD) outbreaks that occurred in West Africa between 2014 and 2016 affecting Guinea, Liberia, and Sierra Leone and, more recently, from 2018 to 2020 in the Democratic Republic of Congo (DRC). In the era of the COVID-19 pandemic, it is important that as a continent, we draw lessons and insights from our past experiences to guide outbreak response strategies being deployed to curb the latest onslaught. The Ebola outbreaks have shown that disease outbreaks should not be seen only as medical emergencies, but as full blown humanitarian crises, because oftentimes, their socio-economic impacts are more devastating than the more obvious cost to life. In this mini-review, we explore the possible humanitarian costs of the COVID-19 pandemic on the African continent by looking through the lens of our past experiences with the EVD outbreaks, highlighting how the current pandemic could significantly affect the African economy, food security, and vulnerable demographics, like children and the sexual and reproductive health and rights of women and girls. We then proffer recommendations that could be instrumental in preventing a double tragedy involving the devastating health consequences of the virus itself and the deadly fallout from its multi-sectoral knock-on effects in African countries. Keywords: COVID-19, SARS-CoV-2, Ebola Virus Disease, Coronavirus.

ABSTRACT Ebola viruses represent a class of filoviruses that causes severe hemorrhagic fever with high mortality. Recognized first in 1976 in the Democratic Republic of Congo, outbreaks continue to occur in equatorial Africa. A safe and effective Ebola virus vaccine is needed because of its continued emergence and its potential for use for biodefense. We report the safety and immunogenicity of an Ebola virus vaccine in its first phase I human study. A three-plasmid DNA vaccine encoding the envelope glycoproteins (GP) from the Zaire and Sudan/Gulu species as well as the nucleoprotein was evaluated in a randomized, placebo-controlled, double-blinded, dose escalation study. Healthy adults, ages 18 to 44 years, were randomized to receive three injections of vaccine at 2 mg (n = 5), 4 mg (n = 8), or 8 mg (n = 8) or placebo (n = 6). Immunogenicity was assessed by enzyme-linked immunosorbent assay (ELISA), immunoprecipitation-Western blotting, intracellular cytokine staining (ICS), and enzyme-linked immunospot assay. The vaccine was well-tolerated, with no significant adverse events or coagulation abnormalities. Specific antibody responses to at least one of the three antigens encoded by the vaccine as assessed by ELISA and CD4+ T-cell GP-specific responses as assessed by ICS were detected in 20/20 vaccinees. CD8+ T-cell GP-specific responses were detected by ICS assay in 6/20 vaccinees. This Ebola virus DNA vaccine was safe and immunogenic in humans. Further assessment of the DNA platform alone and in combination with replication-defective adenoviral vector vaccines, in concert with challenge and immune data from nonhuman primates, will facilitate evaluation and potential licensure of an Ebola virus vaccine under the Animal Rule.

Surveillance and detection of polioviruses (PV) remain crucial to monitoring eradication progress. Intratypic differentiation (ITD) using the real-time RT-PCR kit is key to the surveillance workflow, where viruses are screened after cell culture isolation before a subset are verified by sequencing. The ITD kit is a series of real-time RT-PCR assays that screens cytopathic effect (CPE)-positive cell cultures using the standard WHO method for virus isolation. Because ITD screening is a critical procedure in the poliovirus identification workflow, validation of performance of real-time PCR platforms is a core requirement for the detection of poliovirus using the ITD kit. In addition, the continual update and improvement of the ITD assays to simplify interpretation in all platforms is necessary to ensure that all real-time machines are capable of detecting positive real-time signals. Four platforms (ABI7500 real-time systems, Bio-Rad CFX96, Stratagene MX3000P, and the Qiagen Rotor-Gene Q) were validated with the ITD kit and a redesigned poliovirus probe. The poliovirus probe in the real-time RT-PCR pan-poliovirus (PanPV) assay was re-designed with a double-quencher (Zen™) to reduce background fluorescence and potential false negatives. The updated PanPV probe was evaluated with a panel consisting of 184 polioviruses and non-polio enteroviruses. To further validate the updated PanPV probe, the new assay was pilot tested in five Global Polio Laboratory Network (GPLN) laboratories (Madagascar, India, Philippines, Pakistan, and Democratic Republic of Congo). The updated PanPV probe performance was shown to reduce background fluorescence and decrease the number of false positives compared to the standard PanPV probe.

Abstract A variety of human rights dilemmas were left unresolved in Rome. One issue likely to generate controversy is the relationship between the prohibition of double jeopardy, complementarity and minimal fair trial protections for defendants. Under the Rome Statute’s complementarity framework, the International Criminal Court (ICC) must defer to domestic proceedings if a state is handling the same case and the national authorities are not ‘unable or unwilling’ to prosecute the same person. Much ink has been spilt on Article 17 of the Statute and the ensuing case law, but less understood is the flipside of complementarity: under what circumstances is a state not allowed to prosecute defendants over whom the ICC has already exercised jurisdiction? With the case against Germain Katanga in the backdrop, this article argues that the ICC should take a more pro-active role in supervising secondary domestic proceedings against people previously convicted or acquitted in The Hague. Katanga’s return to the Democratic Republic of Congo to serve the remainder of his ICC-mandated sentence triggered a domestic trial implicating a variety of fair trial issues. Under a seldom-used provision in the Rome Statute, Article 108, the ICC Presidency was required to validate or reject Congo’s proceedings against Katanga. Not only did the Presidency allow his case to proceed, it prospectively abdicated any international oversight of national trials, while advancing sweeping normative claims about the irrelevance of human rights to the permissibility of secondary domestic trials. Three years later, Katanga languishes in a Congolese prison with little prospect of justice. Although the Katanga case is based on a unique set of facts, analogous developments in the cases against Saif Al-Islam Gaddafi and Jean-Pierre Bemba point to the growing likelihood of secondary domestic proceedings against people previously tried by the ICC, which in turn raises fundamental questions about the Rome Statute’s prohibition of double jeopardy and its relationship to complementarity and fair trial guarantees.

As a result of the different tax systems adopted by countries, foreign-sourced income earned by taxpayers may be subject to double taxation. This may therefore impede cross-border trade and investment. Double taxation relief is provided unilaterally, in terms of a country’s domestic laws or bilaterally in terms of Double Taxation Agreements. South African residents earning income from the Democratic Republic of Congo may be subject to tax in both countries. To eliminate such double taxation the South African Income Tax Act, No 58 of 1962, provides for unilateral relief from double taxation in the form of exemptions, rebates and deductions. The double tax agreement between South Africa and the Democratic Republic of the Congo came into effect recently and double taxation relief for South African residents is now also available in terms of tax treaty law. The objective of the research was to determine whether the combination of the unilateral measures and the double tax agreement provide relief in respect of all types of income earned by South African residents in the Democratic Republic of the Congo. It was concluded that the double tax agreement, together with the unilateral relief provided for in the Income Tax Act will grant relief for all types of income earned by South African residents in the Democratic Republic of the Congo.

Resumé

Dans le présent travail de recherche, nous présentons un cadre d’analyse, de planification et de mise en œuvre d’une recherche-action portant sur l’apport de l’éducation sexuelle participative comme démarche de la communication stratégique, et ses effets sur le public d’adolescents en milieu scolaire. Le but ultime étant de proposer une meilleure alternative à l’amélioration de la double prévention des IST/VIH/SIDA et des grossesses non désirées chez les adolescents scolarisés de 15-19 ans à Kinshasa, RDC.

Les principaux objectifs fixés à la présente recherche étaient :i) d’évaluer l’ampleur de la situation épidémiologique et sociale liée à la santé de reproduction y compris la prévention du VIH/SIDA chez les jeunes adolescents (15-19 ans) ;ii) d’identifier les besoins ainsi que les préoccupations spécifiques des adolescents et jeunes notamment en terme de vie sexuelle et affective ;iii) de projeter les axes de communication stratégiques susceptibles d’influencer positivement les comportements en vue d’améliorer la prévention des IST/VIH/SIDA et des grossesses précoces des adolescents et jeunes en milieu urbain ;iv) de construire sur base des observations et analyses précédentes, une approche de communication stratégique fondée sur l’éducation sexuelle participative; iv) et mesurer au point de vue cognitif et comportemental, l’écart attribuable à l’éducation sexuelle sur l’amélioration des connaissances, des attitudes et des pratiques favorables à la double prévention des IST/VIH/SIDA et des grossesses précoces chez les adolescents de 15-19 ans en milieu urbain de la RDC.

Réalisée dans une perspective de la promotion de la santé, son cadre théorique chemine avec celui de l’évidence des liens entre les IST/VIH/SIDA et la santé sexuelle et de reproduction. La combinaison du modèle d’analyse PRECEDE avec l’outil de planification PROCESSUS-P, a servi de fil conducteur de ce travail.

Cette étude confronte également la théorie de la communication avec les modèles de changement de comportement. En effet, les messages sur la sexualité émis par un émetteur, permettent à l’individu qui les reçoit, de se persuader à amorcer le changement de comportement qui passe par différents étapes. Mais au delà de la volonté individuelle, les relations de sexualité se vivent dans une interaction sociale dont il faudra tenir compte.

La construction de cette recherche a fait appel aux disciplines des sciences sociales, comportementales, de l’éducation, et de l’épidémiologie.

Nous avons combiné quatre approches différentes pour cerner nos hypothèses de recherche :i) la revue documentaire, ii) l’approche socio-anthropologique (qualitative) par des focus groups, entretiens semi dirigés, observations directes, iii) l’approche socio-épidémiologique (quantitative) par des enquêtes transversales et iv) l’approche opérationnelle par l’introduction d’une approche innovante utilisant le téléphone et la radio comme moyen pour identifier et orienter des messages à diffuser en milieu scolaire sur la prévention des IST/VIH/SIDA et les grossesses précoces.

Ce travail propose deux formats de résultats :les articles publiés ou en cours de l’être et les résultats complémentaires synthétisés dans différents tableaux.

Les articles abordent successivement :i) le profil de risque et de vulnérabilité lié au VIH/SIDA et à la santé des adolescents ;ii) la perception des adolescents en matière de santé sexuelle et reproductive ;iii) l’ analyse de l’intégration de l’éducation sexuelle dans les médias ;iv) l’utilisation du téléphone portable et de la radio pour identifier les préoccupations sexuelles des adolescents, v) les déterminants associés à la pratique de la double prévention des IST/VIH/SIDA et des grossesses précoces et vi) les effets cognitifs et comportementaux de l’éducation sexuelle participative sur la double prévention des IST/VIH/SIDA et des grossesses précoces en milieu scolaire de Kinshasa.

Les données synthétisées dans différents tableaux rendent compte de l’analyse de la réponse nationale sur la santé de la reproduction des adolescents et des différents aspects du cadre théorique d’analyse et de planification d’une communication stratégique pour la prévention des IST/VIH/SIDA et des grossesses précoces.

L’ensemble des résultats de cette recherche peut se résumer en dix points importants ci-après :

1.\
Doctorat en Sciences de la santé publique
info:eu-repo/semantics/nonPublished

Le dimanche 1er janvier 2012, la République Démocratique du Congo devenait le 48ème Etat africain sur 54 à se doter de la TVA. C’est une ordonnance –loi, du 20 août 2010, prise sur habilitation législative et complétée par un décret du 22 novembre 2011 qui a fait de ce pays le dernier géant du continent à opérer la transition fiscale voulue par le FMI. Il a fallu dix ans de travaux au sein de la DGI, en participation avec les professionnels et sous le contrôle permanent d’un représentant à demeure du FMI et de missions semestrielles de contrôle, pour que cet impôt s’applique au total à 5600 contribuables ayant plus de 80 000 dollars de chiffre d’affaires, avec une espérance d’arriver à 15 000 assujettis dans un pays aux60 millions d’habitants.Par conséquent, si l’élaboration progressive et participative de cette TVA est une réussite intégralement administrative, puisqu’à part une brève consultation du Sénat, le Parlement n’ a pas eu la possibilité d’émettre un consentement, même après sa réélection en 2012, lorsqu’il a fallu compléter le régime initial , avec un droit d’option par exemple, au bout d’un an d’une gestion qui a posé les difficiles problèmes attendus, pour le traitement comptable des remboursements de crédits d’amont, une question iconoclaste reste posée : était ce vraiment une nécessité que d’avoir une TVA dans un pays où la guerre endémique sévit à l’Est ? Certes les autres pays africains l’ont. Le modèle RDC de la TVA introduite, s’inspire d’ailleurs largement de ce qui se fait dans le continent, avec des seuils d’imposition, des exonérations et une unicité de taux que l’on retrouve en d’autres pays et qui est conforme aux prescriptions de directives harmonisatrices d’unions régionales . Mais mis à part la contrainte du FMI quine laisse pas le choix, même avec des rentrées fiscales nettement améliorées, par rapport à celles de l’ancienne taxation du chiffre d’affaires,n’aurait il pas été plus efficace d’aller à l’audace d’une mutation de la technologie des droits de douane , pour les rendre déductibles, tout en les conservant, au lieu de s’aligner sur la solution classique de leur réduction et de leur suppression, avec en compensation l’introduction précisément d’une TVA ? C’est ce changement de paradigme dans la politique fiscale que cet ouvrage propose en final d’un bilan critique de l’introduction de la TVA
Sunday 1 January 2012, the Democratic Republic of Congo became the 48th African state of 54 to adopt VAT. This is an order-law of 20 August 2010, taken on enabling legislation and supplemented by a decree of November 22,2011 that has made this country the last giant of the continent to the transition tax required by the IMF. It took ten years of work within the DGI, in participation with professionals and under the constant supervision of a representative of the IMF andremains biannual mission control for this tax applies to all taxpayers in 5600with more than 80 thousand dollars in revenue, with a hope of reaching15,000 subjects in a country with 60 million inhabitants.Therefore, if the progressive development and the participatory VAT isa full administrative success, since a part from a brief consultation with the Senate, Parliament has not been able to issue a consent, even after his reelection in 2012 when it came to complete the original plan, with a right ofoption for example, after a year's management who posed difficult problems expected for the accounting treatment of loan repayments upstream,iconoclastic a question remains unanswered: was it really a necessity to havea VAT in a country where war rages endemic to the east?While other African countries have. The DRC model of VAT introduced alsodraws heavily on what happens in the continent, with tax thresholds,exemptions and uniformity of rates found in other countries and complies withguidelines harmonizers’ regional unions. But apart from the stress of the IMFleaves no choice, even with tax revenues significantly improved compared tothe old taxation revenue, would not it have been more efficient to go to the audacity of a changing technology tariffs to make them tax-deductible, while keeping them instead to align itself with the classical solution of their reduction and deletion, with the introduction of compensation precisely a VAT?This is a paradigm shift in fiscal policy that this book offers a critical final of the introduction of VAT

Enhancing mineral processing techniques is a permanent challenge in the mineral and metal industry. Indeed to satisfy the requirements on the final product (metal) set by the consuming market, control is often applied on the mineral processing whose product, the ore concentrate, constitutes the input material of the extractive metallurgy. Therefore much attention is paid on mineral processing units and especially on concentration plants. As the ore size reduction procedure is the critical step of a concentrator, it turns out that controlling a grinding circuit is crucial since this stage accounts for almost 50 % of the total expenditure of the concentrator plant. Moreover, the product particle size from grinding stage influences the recovery rate of the valuable minerals as well as the volume of tailing discharge in the subsequent process.

The present thesis focuses on an industrial application, namely the Kolwezi concentrator (KZC) double closed-loop wet grinding circuit. As any industrial wet grinding process, this process offers complex and challenging control problems due to its configuration and to the requirements on the product characteristics. In particular, we are interested in the modelling of the process and in proposing a control strategy to maximize the product flow rate while meeting requirements on the product fineness and density.

A mathematical model of each component of the circuit is derived. Globally, the KZC grinding process is described by a dynamic nonlinear distributed parameter model. Within this model, we propose a mathematical description to exhibit the increase of the breakage efficiency in wet operating condition. In addition, a relationship is proposed to link the convection velocity to the feed ore rate for material transport within the mills.

All the individual models are identified from measurements taken under normal process operation or from data obtained through new specific experiments, notably using the G41 foaming as a tracer to determine material transport dynamics within the mills. This technique provides satisfactory results compared to previous studies.

Based on the modelling and the circuit configuration, both steady-state and dynamic simulators are developed. The simulation results are found to be in agreement with the experimental data. These simulation tools should allow operator training and they are used to analyse the system and to design the suitable control strategy.

As the KZC wet grinding process is a Multi-Input Multi-Output (MIMO) system, we propose a decentralized control scheme for its simplicity of implementation. To overcome all the control issues, a Double Internal Model Control (DIMC) scheme is proposed. This strategy is a feedforward-feedback structure based on the use of both a modified Disturbance Observer (DOB) and a Proportional-Integral Smith-Predictor (PI-SP). A duality between the DOB and PI-SP is demonstrated in design method. The latter is exploited to significantly simplify the design procedure. The designed decentralized controllers are validated in simulation on the process linearized model. A progressive implementation of the control strategy is proposed in the context of the KZC grinding circuit where instrumentation might not be obvious to acquire./

Améliorer les techniques de traitement de minerais est un défi permanent dans l'industrie des minéraux et des métaux. En effet, pour satisfaire aux exigences du produit fini (métal ) fixées par le marché de consommation, la commande automatique est souvent appliquée à l'usine du traitement de minerais dont le produit, le concentré, constitue la matière première de la métallurgie extractive. Une attention particulière est donc dévolue aux unités de traitement de minerais et en particulier aux concentrateurs. Comme le processus de réduction des dimensions granulométriques du minerai est l'étape critique d'un concentrateur, il s'avère que la commande d'un circuit de broyage est cruciale, car ce stade représente près de 50 % des dépenses totales de l' usine de concentration. De plus, la dimension granulométrique du produit de l'étape de broyage influe sur le taux de récupération des minéraux utiles ainsi que sur le volume des rejets du processus ultérieur.

La présente thèse porte sur une application industrielle, à savoir le concentrateur de Kolwezi (KZC qui est un circuit de broyage humide à double boucle fermée. Comme tout processus industriel de broyage humide, ce procédé présente une problématique de commande complexe et difficile en raison de sa configuration et des exigences relatives aux caractéristiques du produit. En particulier, nous nous intéressons à la modélisation de ce procédé et à proposer une stratégie adéquate de commande dans le but de maximiser le débit de production tout en respectant les exigences quant à la finesse et à la densité de la pulpe produite.

Un modèle mathématique de chaque composant du circuit a été déterminé. Globalement, le processus de broyage de KZC est décrit par un modèle dynamique non linéaire à paramètres distribués. Dans ce modèle, une description mathématique de l'augmentation de l'efficacité du broyage en milieu humide est proposée. En outre, nous avons proposé une relation liant la vitesse de convection au débit d'alimentation de minerais dans le modèle du transport de la matière à l'intérieur des broyeurs.

Tous les modèles mathématiques ont été identifiés à partir de mesures prises sur le procédé en fonctionnement d'équilibre stable ou à partir des données obtenues grâce à des nouvelles expériences spécifiques, notamment en utilisant le moussant G41 comme traceur pour déterminer la dynamique de transport de la matière dans les broyeurs. Cette technique a produit des résultats cohérents par rapport aux études antérieurs réalisées au moyen du traceur colorant ou radioactif.

Les simulateurs statique et dynamique ont été développés sur la base de la modélisation mathématique et de la configuration du circuit. Les résultats des simulations sont en accord avec les données expérimentales. Ces outils de simulation devraient permettre la formation des opérateurs et ont été utilisés pour analyser le système et concevoir la stratégie de commande la plus appropriée.

Comme le processus de broyage humide de KZC est un système à plusieurs grandeurs d'entrée et plusieurs grandeurs de sortie, nous avons proposé une structure de commande décentralisée en raison de sa simplicité de mise en œuvre .Afin de surmonter tous les problèmes de commande, un schéma de commande à double modèle interne (CDMI) est proposée. Cette stratégie est une structure à anticipation - rétroaction basée sur l'utilisation d'un observateur de perturbations (OBP) et d'un Prédicteur de Smith doté d'un régulateur Proportionnel-Intégral (PS-PI). Une dualité entre l'OBP et le PS-PI est démontrée dans la méthode de conception. Cette propriété est exploitée pour simplifier considérablement la procédure de conception. Les régulateurs décentralisés ainsi conçus sont validés en simulation sur le modèle linéarisé du procédé. Une mise en œuvre progressive de la stratégie de commande est proposée dans le contexte du circuit de broyage de KZC où l'instrumentation peut ne pas être évidente à acquérir.

Doctorat en Sciences de l'ingénieur
info:eu-repo/semantics/nonPublished

The focus of this study is rent in the diamond industry. Based on extensive datasets and a discussion of all relevant costs, we present resource rent statistics from the diamond industry in key producer countries in emerging economies such as Angola, Botswana, Democratic Republic of the Congo, Lesotho, Namibia, Sierra Leone, and South Africa, as well as the Russian Federation. Resource rents give an indication of the available space for taxation. To use this potential tax space effectively in the long term without changing the investment behaviour of the mining companies and the long-term viability of the industry, all costs, such as environmental and financial costs, must be included. The study attempts to expand on earlier work by the World Bank to calculate mineral rents for mining industries other than the diamond industry. Rent calculated as precisely as possible is an important basis for wealth calculations and for mineral policy development.

ABSTRACT Energy is one of the key drivers of economic growth and development world over. Overcoming energy poverty is one of world's great challenges. All the countries in the East African Region (EAR) are not producing sufficient energy to meet their current needs. The energy mix in the EAR currently includes hydroelectric power, geothermal energy, solar, biomass and fossil fuels. The region's petroleum products consumption, the entire volume of which is currently imported, is estimated at 180,000 bbl/day and is growing at between 4 – 6% p.a. It is projected that the region will consume about 400,000bbl/day by 2030. The discovery of commercially viable oil and gas deposits in Uganda, Kenya, Tanzania and Democratic Republic of Congo however, marks a great opportunity to turn around the rather bleak state of the energy sector in the region. These resources however remain largely untapped due to lack of the necessary infrastructure such as road networks, upstream facilities, refinery, pipelines, and gas processing facilities, that are necessary to access, store, process and transport these resources. A number of countries in the EAR are planning for the development of such key infrastructure to enable the commercialization of the discovered these resources. The EAR needs to harmonise the planning and development of petroleum infrastructure in order to leverage the power of collaborative action to attract investment and ensure optimal development of this infrastructure. A case in point is Uganda which plans to commercialise its discovered oil and gas resources, estimated at 6.5 billion barrels as of 2016, through the development of an oil refinery, a crude oil export pipeline and power generation. These projects are being developed with joint participation of the East African Community (EAC) Partner States. Uganda estimates to spend over USD 10 billion on oil and gas infrastructure in the next five years. The region needs to provide a conducive investment environment in order to attract financing for these projects. This can be achieved through providing incentives such as attractive taxation regimes, streamlined decision making and security, among others, given the high CAPEX investments. Given that background, this paper will; Assess the current status of the oil and gas infrastructure in the region vis a vis the growing energy needsDiscuss the optimal infrastructure requirements for the successful development of the oil and gas industry in order to meet the region's growing energy needs.Highlight the investment requirements, incentives, challenges and financing options for the planned refinery in Uganda.