Log in

Relevant bibliographies by topics / Dutch in Brazil. eng / Journal articles

To see the other types of publications on this topic, follow the link: Dutch in Brazil. eng.

Journal articles on the topic 'Dutch in Brazil. eng'

Author: Grafiati

Published: 4 June 2021

Last updated: 4 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Dutch in Brazil. eng.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Noorlander, D. L. "Reformers in the Land of the Holy Cross." Journal of Early American History 6, no. 2-3 (November 16, 2016): 169–95. http://dx.doi.org/10.1163/18770703-00603007.

Full text

Abstract:

The directors of the Dutch West India Company gambled their reputations and capital in a decades-long scheme to conquer and pacify Brazil, and in the end, they lost. This essay explores the various religious elements of that scheme or “mission,” as it was also called: establishing the Dutch Reformed Church as the colony’s public church, spreading the message of the “true religion,” attacking sin and reforming sinners. Coupled with a general, widespread sense of anti-Catholicism and anti-clericalism among the Dutch in Europe and America, these reform efforts exacerbated differences between the conquerors and conquered and contributed to Portuguese discontent in the years before the 1645 revolt.

APA, Harvard, Vancouver, ISO, and other styles

2

Letteboer, T. G. W., R. A. Zewald, E. J. Kamping, G. de Haas, J. J. Mager, R. J. Snijder, D. Lindhout, F. A. M. Hennekam, C. J. J. Westermann, and J. K. Ploos van Amstel. "Hereditary hemorrhagic telangiectasia: ENG and ALK-1 mutations in Dutch patients." Human Genetics 116, no. 1-2 (October 23, 2004): 8–16. http://dx.doi.org/10.1007/s00439-004-1196-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Van den Tol, Joris. "Michiel van Groesen (ed.), The Legacy of Dutch Brazil." De Zeventiende Eeuw. Cultuur in de Nederlanden in interdisciplinair perspectief 31, no. 2 (December 31, 2015): 360. http://dx.doi.org/10.18352/dze.9810.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Van Oers, Ron. "The Dutch Urban Heritage of Recife, Pernambuco, in Brazil." Journal of Architectural Conservation 7, no. 1 (January 2001): 56–71. http://dx.doi.org/10.1080/13556207.2001.10785286.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

JONGKIND, F. "The Agrarian Colonies of Dutch Calvinists in Paraná, Brazil." International Migration 27, no. 3 (September 1989): 467–86. http://dx.doi.org/10.1111/j.1468-2435.1989.tb00358.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Ruiz, Rafael. "The Spanish-Dutch War and the Policy of the Spanish Crown toward the Town of Sao Paulo." Itinerario 26, no. 1 (March 2002): 107–25. http://dx.doi.org/10.1017/s0165115300004964.

Full text

Abstract:

Historians have made in depth studies on the consequences of the Dutch incursions and invasion into the north and northwest of Brazil, for both the Spanish Empire and the United Provinces of the Dutch Republic. The purpose of this paper is to show that the war between Spain and the Dutch Republic also affected the south of Brazil and that it forced Spain to adopt measures that altered the policy of the Spanish Crown regarding Sao Paulo.

APA, Harvard, Vancouver, ISO, and other styles

7

Schutte, G. J. "F.L. Schalkwijk, The Reformed church in Dutch Brazil (1630-1654)." BMGN - Low Countries Historical Review 115, no. 2 (January 1, 2000): 310. http://dx.doi.org/10.18352/bmgn-lchr.5252.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Dewulf, Jeroen. "Amsterdam’s Atlantic: Print Culture and the Making of Dutch Brazil." Colonial Latin American Review 27, no. 1 (January 2, 2018): 143–45. http://dx.doi.org/10.1080/10609164.2018.1448546.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

MacLeod, Murdo J. "Amsterdam’s Atlantic: Print Culture and the Making of Dutch Brazil." Journal of Interdisciplinary History 48, no. 2 (August 2017): 262–63. http://dx.doi.org/10.1162/jinh_r_01140.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Harreld, Donald J. "The Legacy of Dutch Brazil, written by Michiel van Groesen." Journal of Early Modern History 21, no. 4 (July 31, 2017): 370–72. http://dx.doi.org/10.1163/15700658-00210004-03.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Pierson, Paul E. "Book Review: The Reformed Church in Dutch Brazil (1630–1654)." International Bulletin of Missionary Research 24, no. 2 (April 2000): 92–93. http://dx.doi.org/10.1177/239693930002400219.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Baud, Michiel. "The Legacy of Dutch Brazil, edited by Michiel van Groesen." New West Indian Guide 91, no. 3-4 (2017): 278–79. http://dx.doi.org/10.1163/22134360-09103007.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Benedetti, Julio, Erdinc Çakmak, and Keith Dinnie. "The competitive identity of Brazil as a Dutch holiday destination." Place Branding and Public Diplomacy 7, no. 2 (May 2011): 107–15. http://dx.doi.org/10.1057/pb.2011.10.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

McGinness, Anne B. "The Legacy of Dutch Brazil, edited by Michiel van Groesen." Journal of Jesuit Studies 2, no. 2 (April 9, 2015): 329–31. http://dx.doi.org/10.1163/22141332-00202007-10.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Burnard (review), Trevor, Joyce Goodfriend (review), Cynthia Van Zandt (review), Willem Frijhoff (review), and Wim Klooster (response). "The Empire that Never Was." Journal of Early American History 7, no. 1 (March 24, 2017): 33–80. http://dx.doi.org/10.1163/18770703-00701004.

Full text

Abstract:

This book forum focuses on Wim Klooster’s The Dutch Moment: War, Trade, and Settlement in the Seventeenth-Century Atlantic World (Cornell University Press, 2016). In his book, Wim Klooster shows how the Dutch built and eventually lost an Atlantic empire that stretched from the homeland in the United Provinces to the Hudson River and from Brazil and the Caribbean to the African Gold Coast. The fleets and armies that fought for the Dutch in the decades-long war against Spain included numerous foreigners, largely drawn from countries in northwestern Europe. Likewise, many settlers of Dutch colonies were born in other parts of Europe or the New World. According to Klooster, the Dutch would not have been able to achieve military victories without the native alliances they carefully cultivated. Indeed, Klooster concludes, the Dutch Atlantic was quintessentially interimperial, multinational, and multiracial. At the same time, it was an empire entirely designed to benefit the United Provinces. The four reviewers – Trevor Burnard, Joyce Goodfriend, Cynthia Van Zandt, and Willem Frijhoff – all offer praise, some more profusely than others. Their reviews critically question some aspects of Klooster’s narrative, particularly in relation to slavery, the inevitability of the Dutch Atlantic empire’s decline, his assessment of the rule of Johan-Maurits van Nassau-Siegen in Dutch Brazil, the role of violence and of women in Dutch colonization, as well as the relationship between microcosmic and macrocosmic perspectives on the history of Dutch America.

APA, Harvard, Vancouver, ISO, and other styles

16

CHING, Ng Swee. "A SHORT HISTORY OF MALAYSIA - PART 1." Periódico Tchê Química 02, no. 1 (August 20, 2004): 23. http://dx.doi.org/10.52571/ptq.v1.n02.2004.agosto/4_pgs_23_23.pdf.

Full text

Abstract:

Malaysia and Brazil has many similarities. In the 1500s the Portuguese was a mighty sea power and she went conquering faraway places. So both Brazil and Malaya were under the control of the Portuguese. Brazil is a much larger country and also nearer by sea to Portugal. So when other nations challenged the Portuguese they decided to focus on South America and so in 1640 the Dutch took over Malaya and Indonesia. By the 1700s the British began to move look towards the East for spices. They went to India and then came to Malaya. The Dutch decided to control Indonesia and so in 1780 the British took control of Malaya.

APA, Harvard, Vancouver, ISO, and other styles

17

Oliver, Liza. "Frans Post’s Brazil: Fractures in Seventeenth-Century Dutch Colonial Landscape Paintings." Dutch Crossing 37, no. 3 (November 2013): 198–219. http://dx.doi.org/10.1179/0309656413z.00000000039.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

van Groesen, Michiel. "Abraham Willaerts: Marine painter of Dutch Brazil and the Atlantic world." Oud Holland – Journal for Art of the Low Countries 132, no. 2-3 (October 31, 2019): 65–78. http://dx.doi.org/10.1163/18750176-1320203002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Dewulf, Jeroen. "Emulating a Portuguese Model." Journal of Early American History 4, no. 1 (March 14, 2014): 3–36. http://dx.doi.org/10.1163/18770703-00401006.

Full text

Abstract:

This article presents a new perspective on the master-slave relationship in New Netherland in order to complement the existing theories on the treatment of slaves in that Dutch colony. It shows how prior to the loss of Dutch Brazil, the West India Company modeled its slave policy after Portuguese practices, such as the formation of black militias and the use of Christianity as a means to foster slave loyalty. It also points out that in the initial slave policy of the Dutch Reformed Church was characterized by the ambition to replace the Iberian Catholic Church in the Americas. While the Reformed Church in the early decades of the Dutch colonial expansion was characterized by a community-building spirit and a flexible attitude toward newcomers, the loss of Brazil shattered the dream of a Protestant American continent and gave way to a more exclusivist approach with a much stronger emphasis on orthodoxy. This led to a dramatic change in attitude vis-à-vis slaves, which is reflected in the segregationist policies―both at a social and a religious level―in later Dutch slave colonies such as Suriname.

APA, Harvard, Vancouver, ISO, and other styles

20

A. Lima, Marcenilda, and Marcelo S. Sthel. "Emission of Air Pollution in the Transport Sector: Case Study of the City of Campos dos Goytacazes, Brazil." Engineering 12, no. 12 (2020): 851–62. http://dx.doi.org/10.4236/eng.2020.1212060.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Ferreira, Victor Bertocchi. "O Mundo Atlântico pelo prisma da opinião pública." Revista de História, no. 178 (October 18, 2019): 1–7. http://dx.doi.org/10.11606/issn.2316-9141.rh.2019.145048.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Brienen, R. P. "Georg Marcgraf (1610 – c. 1644): A German Cartographer, Astronomer, and Naturalist-Illustrator in Colonial Dutch Brazil." Itinerario 25, no. 1 (March 2001): 85–122. http://dx.doi.org/10.1017/s0165115300005581.

Full text

Abstract:

The German scholar Georg Marcgraf was the first trained astronomer in the New World and co-author of the earliest published natural history of Brazil, Historia naturalis Brasiliae (Leiden and Amsterdam 1648) (Fig. 1). Arriving in the Americas in 1638, Marcgraf took his place among a remarkable group of scholars and painters assembled at the Brazilian court of the German count Johan Maurits van Nassau-Siegen (1604–1679), the governor-general of Dutch Brazil from 1637–1644.1 Dutch Brazil was established by the Dutch West India Company (WIC), which was created in 1621 to engage in trade, conquest, and colonisation in the Americas and Africa. Except for Marcgraf, the most important members of the Count's entourage were Dutch and included the painters Albert Eckhout (c. 1610 - c. 1666) and Frans Post (1612–1680) and the physician Willem Piso (1611–1678). The rich group of scientific and visual materials they created are comparable in both scope and importance with the works created by Sydney Parkinson, William Hodges, and others during the Pacific voyages of Captain Cook in the eighteenth century.2 The Count's support of natural history, astronomy, and scientific and ethnographic illustration during his governorship was highly unusual, setting him apart from other colonial administrators and military leaders in the seventeenth century. Indeed, he is responsible for establishing both the first observatory and the first botanical garden in the New World, sparing no expense in creating a princely empire for himself in the Brazilian wilderness.

APA, Harvard, Vancouver, ISO, and other styles

23

Moreira, Gabriela Salim Xavier, Diana Cândida Lacerda Mota, Luciana Lorenzato, Idalina Shiraishi Kakeshita, Telma Maria Braga Costa, and Sebastião Sousa Almeida. "Transcultural adaptation procedures for the dutch eating behavior questionnaire (DEBQ) for Brazil." Revista Avaliação Psicológica 16, no. 4 (October 15, 2017): 426–35. http://dx.doi.org/10.15689/ap.2017.1604.12793.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Pijning, Ernst. "Paradise Regained: Historiography on the Dutch Occupation of Northeastern Brazil, 1630–1654." Itinerario 26, no. 2 (July 2002): 120–26. http://dx.doi.org/10.1017/s0165115300009165.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Vidal, Claudio Henrique Fernandes, Joacil Carlos da Silva, Cicero Jose Pacheco Lins, Alessandra Mertens Brainer-Lima, and Marcelo Moraes Valenca. "Craniovertebral junction malformation in Northeastern Brazil: the myth of the Dutch colonization." Arquivos de Neuro-Psiquiatria 71, no. 6 (June 2013): 405–7. http://dx.doi.org/10.1590/0004-282x20130047.

Full text

Abstract:

The high prevalence of craniovertebral junction malformation in Northeastern Brazil is historically associated with brachycephalic biotype (flat head), also common in this region. It has been postulated that this trait was introduced to this region by the Dutch during the colonial period in Brazil's history. Based on the confrontation of this paradigm against some historical facts, the authors concluded that the brachycephalic phenotype was inherited from prehistoric ancestors (Amerindians) who were already living in this region when white European men arrived.

APA, Harvard, Vancouver, ISO, and other styles

26

Rickli, João. "Encounter and engagement: negotiating otherness in the Dutch Protestant development cooperation network in Brazil." Vibrant: Virtual Brazilian Anthropology 9, no. 1 (June 2012): 599–621. http://dx.doi.org/10.1590/s1809-43412012000100020.

Full text

Abstract:

This article investigates encounters occurring in the development cooperation network facilitated by two Dutch Protestant agencies - ICCO and KiA - in Brazil, focusing on the process of negotiating otherness inherent to development initiatives. The text is based on multi-sited ethnographical research conducted in Brazil and in the Netherlands. In its first section, the text introduces the two organisations, highlighting the overlap between religious and secular moralities in their discourses and practices. The second section describes a meeting they promoted with their partners in Brazil, analysing how a grammar of difference is mobilised by the actors to make sense of the world and of the "far-away" other, creating what could be called cosmologies of development cooperation. The text focuses mainly on how concrete interactions influence these cosmologies, actualising, reproducing or contesting them in practice.

APA, Harvard, Vancouver, ISO, and other styles

27

Hulsman, Lodewijk. "Brazilian Indians in the Dutch Republic: The Remonstrances of Antonio Paraupaba to the States General in 1654 and 1656." Itinerario 29, no. 1 (March 2005): 51–78. http://dx.doi.org/10.1017/s0165115300021690.

Full text

Abstract:

The conquest of Olinda in 1630 by forces of the Dutch West Indian Company (WIC) was the beginning of a period that has become known as Dutch Brazil. The enterprise flourished after the board of directors of the WIC, the gentlemen XIX, appointed Count Johann Moritz von Nassau in 1636 as Governor General. Recife, the present capital of the Brazilian state of Pernambuco, became the administrative centre of an area reaching from the state of Alagoas to the state of Maranhāo. The uprising of a large part of the Portuguese population in 1645, a year after the departure of Nassau, turned Recife into a beleaguered fortress that surrendered itself and all other WIC possessions in Brazil on 26 January 1654.

APA, Harvard, Vancouver, ISO, and other styles

28

Antunes, Cátia. "Dutch-Portuguese Diplomatic Encounters, 1640-1703: Exchanges, Sovereignty and “World Peace”." Journal of Early Modern History 23, no. 5 (October 2, 2019): 458–74. http://dx.doi.org/10.1163/15700658-12342646.

Full text

Abstract:

Abstract This article traces the multiplex relationships established between Portuguese ambassadors, consuls and extraordinary envoys in the Dutch Republic between 1640 and 1703 with the Portuguese kingdom, the king, the Portuguese “Nation” in Amsterdam and the Dutch States General. In negotiating multiple contracts and treaties regarding “world peace,” these men determined the course of history not so much because they were bound by the service of a state or a king but rather because they served a multiplicity of interests that often damaged national interest in favor of specific interest groups. The article focuses particularly on the Dutch-Portuguese clashes in Western Africa and Brazil and how their settlements impacted the Dutch-Portuguese power sharing in Asia, ultimately challenging premises of sovereignty at a global scale.

APA, Harvard, Vancouver, ISO, and other styles

29

Casteels, Isabel. "Michiel van Groesen, Amsterdam's Atlantic. Print Culture and the Making of Dutch Brazil." Tijdschrift voor Sociale en Economische Geschiedenis/ The Low Countries Journal of Social and Economic History 15, no. 1 (July 12, 2018): 121. http://dx.doi.org/10.18352/tseg.1010.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Cook, Harold J. "Michiel van Groesen. Amsterdam’s Atlantic: Print Culture and the Making of Dutch Brazil." American Historical Review 123, no. 2 (April 1, 2018): 642–43. http://dx.doi.org/10.1093/ahr/123.2.642.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Passetti, Rodrigo Augusto Cortêz, Carlos Emanuel Eiras, Ludmila Couto Gomes, Junio Fabiano dos Santos, and Ivanor Nunes do Prado. "Intensive dairy farming systems from Holland and Brazil: SWOT analyse comparison." Acta Scientiarum. Animal Sciences 38, no. 4 (November 7, 2016): 439. http://dx.doi.org/10.4025/actascianimsci.v38i4.31467.

Full text

Abstract:

Intensive systems of milk production in Brazil and Holland are compared by SWOT analysis. Twenty-one farms, 10 in Wageningen, central region of Holland, and 11 in Castro, central-eastern region of the state of Paraná, Brazil, were sampled. Data were retrieved from semi-structured interviews with the owners or people responsible for dairy activities, using a questionnaire guide and a digital recorder. After results were analysed, a table was elaborated representing the strengths, weaknesses, opportunities and risks for each country. Dairy farms in Holland were uniform, or rather, small and medium-sized farms with high production. It has also been observed that Dutch farms have several problems due to high intensification, for example, hoof diseases with great economic loss. In the case of Brazilian dairy farms, several types of systems and degrees were detected. Brazilian production in the region analysed features a higher quantity than that in Holland, with less intensity when compared to that on Dutch farms.

APA, Harvard, Vancouver, ISO, and other styles

32

Hernandes, Bruna Muniz S., Carla Fredrichsen Moya, Flávio Camargo Leme, Anelise Carla Camplesi, and Thiago Francisco C. Solak. "Dystocia in young dutch dwarf rabbit (Oryctolagus cuniculus) – case report." Clínica Veterinária XXV, no. 149 (November 1, 2020): 48–54. http://dx.doi.org/10.46958/rcv.2020.xxv.n.149.p.48-54.

Full text

Abstract:

Rabbits are becoming common as pets in Brazil, and veterinarians are seeing an increased demand for clinical treatment of their species. Reproductive diseases in rabbits are rarely described in veterinary literature, with few cases of dystocia and fetal death reported. We report a case of dystocia in a 75 days old rabbit presented with a history of purulent vaginal discharge and loss of appetite. Dystocia was diagnosed by physical and radiographic examination, and ovariohisterectomy was recommended. Accurate diagnosis, immediate intervention and adequate treatment resulted in good postoperative outcome.

APA, Harvard, Vancouver, ISO, and other styles

33

Frisch, Andrea. "Amsterdam's Atlantic: Print Culture and the Making of Dutch Brazil by Michiel Van Groesen." Early American Literature 53, no. 2 (2018): 590–95. http://dx.doi.org/10.1353/eal.2018.0055.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

van Groesen, Michiel. "Lessons Learned: The Second Dutch Conquest of Brazil and the Memory of the First." Colonial Latin American Review 20, no. 2 (August 2011): 167–93. http://dx.doi.org/10.1080/10609164.2011.585770.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Meuwese, Mark. "Amsterdam's Atlantic: Print Culture and the Making of Dutch Brazil - by Groesen, Michiel Van." Bulletin of Latin American Research 37, no. 4 (September 2018): 519–20. http://dx.doi.org/10.1111/blar.12870.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Mendes, Rodolfo Moreda, and Mário Valério Filho. "Real-Time Monitoring of Climactic and Geotechnical Variables during Landslides on the Slopes of Serra do Mar and Serra da Mantiqueira (São Paulo State, Brazil)." Engineering 07, no. 03 (2015): 140–59. http://dx.doi.org/10.4236/eng.2015.73012.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Codina Bobia, Antonio José Maria. "Bare Singular Count Nouns in Dutch as a Heritage Language in Brazil / Nomes singulares nus em neerlandês como língua de herança." REVISTA DE ESTUDOS DA LINGUAGEM 27, no. 2 (February 25, 2019): 631. http://dx.doi.org/10.17851/2237-2083.27.2.631-668.

Full text

Abstract:

Abstract: The aim of this research was to evaluate the distribution of DPs in generic sentences, in Dutch Heritage Language Speakers (HLS) in Holambra, Brazil, especially regarding the acceptability of Bare Singular Count Nouns (BS). The Distribution of BS is more restricted in Dutch than in Brazilian Portuguese, nonetheless, we raised the hypothesis that, due to the influence of Brazilian Portuguese, these HLS would accept BS in contexts similar to those of Brazilians. We applied an acceptability judgement test to 60 adult HLS from Holambra (experimental group), 30 Brazilian monolinguals and 30 native Dutch speakers (control groups 1 and 2). We presented to each participant in the experimental group 10 Dutch stimulus sentences and 20 filler sentences in order to verify their acceptability on a five-item Likert scale. The results showed that sentences with BS eliciting a generic reading received high acceptability rates from the Experimental Group of Holambra (72% acceptability rate). These responses were more aligned with the Brazilian Control (78% acceptability rate) than with the Dutch Control (96% unacceptability rate). The statistical Regression Analysis of the BS showed that the Dutch Control had a significant divergent behavior (p.value = <2-16) when compared to the Experimental Group. The results seem thus to support our hypothesis that a slightly different grammar has risen in the Dutch HLS of Holambra, suffering attrition due to the influence of Brazilian Portuguese, since they accept Bare Singulars, showing no significant difference with the Brazilian Control Group. We will follow Oosterhof’s proposal (2008) on the distribution of empty determiners in Dutch and assume that the grammar of the Holambra speakers possesses a bundle of features allowing a 0[+R, +count, –pl] combination: That is, a singular count noun DP with an empty determiner, rendering a generic reading. Keywords: language acquisition; heritage languages; bare singular count nouns; Dutch; Brazilian Portuguese.Resumo: O objetivo desta pesquisa foi avaliar a distribuição de DPs em sentenças genéricas em falantes de neerlandês como língua de herança em Holambra, Brasil, especialmente em relação à aceitabilidade de nomes singulares nus (NNs). A distribuição de NNs é mais restrita em neerlandês do que no Português Brasileiro (PB), no entanto, levantamos a hipótese de que, devido à influência do PB os falantes de Holambra poderiam aceitar NNs em contextos semelhantes aos dos brasileiros. Aplicamos um teste de aceitabilidade em 60 HLS adultos de Holambra (grupo experimental), 30 monolíngues brasileiros e 30 falantes nativos de holandês (grupos de controle 1 e 2). Apresentamos a cada participante do grupo experimental 10 sentenças em neerlandês e 20 distratores, a fim de verificar sua aceitabilidade em uma escala Likert de cinco itens. Os resultados mostraram que sentenças genéricas com NNs receberam alta aceitação do Grupo Experimental de Holambra (72% de aceitabilidade). Essas respostas estão mais alinhadas com o Controle Brasileiro (78% de aceitabilidade) do que com o Controle Holandês (96% de inaceitabilidade). A análise de regressão estatística dos NNs mostrou que o Controle Holandês apresentou comportamento significativamente divergente (p. valor=<2-16) quando comparado com o Grupo Experimental. Os resultados parecem corroborar nossa hipótese de que uma gramática ligeiramente diferente surgiu nos falantes de holandês de Holambra, sofrendo atrito devido à influência do PB, uma vez que aceitam NNs, não mostrando diferença significativa com o Grupo de Controle Brasileiro. Seguiremos a proposta de Oosterhof (2008) sobre a distribuição de determinantes vazios em holandês, e propor que a gramática dos falantes de Holambra possui um conjunto de traços permitindo a combinação 0 [+ R, + count, -pl]: isto é, um nome nu singular contável com uma leitura genérica.Palavras-chave: aquisição de linguagem; línguas de herança; nomes singulares nus; neerlandês; português brasileiro.

APA, Harvard, Vancouver, ISO, and other styles

38

Schaumloeffel, Marco A. "Papiamentu and the Brazilian Connection Established through the Sephardic Jews." LETRAS, no. 67 (February 20, 2020): 75–89. http://dx.doi.org/10.15359/rl.1-67.4.

Full text

Abstract:

This study examines the linguistic contact between Papiamentu and Brazilian Portuguese established when the Sephardic Jews were expelled from Dutch Brazil and some of them relocated in Curaçao. Three lexical items of PA (yaya, ‘nanny, nursemaid’; bacoba, ‘banana’; and fulabola‘fore nger, index nger’) are analysed and put into their historical contextto show that their presence in Papiamentu can be attributed to the contact between Brazil and Curaçao due to the forced migration of the Sephardic Jews and their servants.

APA, Harvard, Vancouver, ISO, and other styles

39

Widana Gamage, S. M. K., A. Hassani-Mehraban, and D. Peters. "Identification of Iris yellow spot virus on Leek (Allium porrum) in Sri Lanka." Plant Disease 94, no. 8 (August 2010): 1070. http://dx.doi.org/10.1094/pdis-94-8-1070b.

Full text

Abstract:

Leek (Allium porrum) has become one of the major leafy vegetable export crops in Sri Lanka during last few years. This year-round crop is cultivated in open fields at elevations between 1,000 and 2,000 m on approximately 1,600 ha with a production of 27,000 t per year (2). In August 2009, straw-colored spots (2 to 3 mm in diameter), surrounded by a greenish halo and a necrotic area, resembling symptoms to those caused by Iris yellow spot virus (IYSV) were observed on leek in Kandapola in the Nuwara Eliya District. Additional thrips damage consisting of silver-colored spots was observed on all plants. IYSV (family Bunyaviridae, genus Tospovirus) was first described and characterized in the Netherlands in 1998 (1). During the last few years, this virus was reported from Australia, Brazil, Chile, France, Germany, Guatemala, India, Israel, New Zealand, Peru, Reunion Island, Serbia, South Africa, Spain, the United States (4), and Japan. Collected samples were initially analyzed for IYSV infections using antisera raised against nucleocapsid (N) protein in a double-antibody sandwich (DAS)-ELISA. The presence of IYSV was confirmed by a reverse transcription (RT)-PCR using IYSV-F-373 (5′CTGCGGGCTTCTCTGG3′) and IYSV-R-779 (5′GACTCACCAATGTCTTCAAC3′) primers that amplify a 400-bp fragment of the N gene. The entire N gene was not obtained when specific primers were used to retrieve the complete N gene. Four nucleotides of the reverse primer GAAAGATAGATATAATTAA (indicated in bold) did not match with sequence at the 3′end of the N gene. Hence, to obtain the remaining parts of the N gene, the primers UHP (5′CACTGGATCCTTTTGTTTTTGTTTTTTG3′) and Asian Termini (5′CCCGGATCCAGAGCAATCGAGGY3′) (3) were combined with IYSV-F and IYSV-R. The obtained amplicons were cloned into pGEM-T easy vector and sequenced. The N gene sequence has been deposited at the NCBI/GenBank (Accession No. GU901211). The deduced N protein sequence(s) were compared with other IYSV N protein sequences available in the GenBank and showed a 92% protein identity with the Brazilian strain (IYSV-BR) and 97% with the Dutch strain (IYSV-NL) with Accession Nos. AAF04199 and AAB61923, respectively. No data on the thrips vector species or on the disease incidence have been collected. The presence of IYSV in Sri Lanka can potentially be considered as a threat for the export of leek. To our knowledge, this is the first report that IYSV occurs in Sri Lanka. References: (1) I. Cortêz et al. Phytopathology 88:1276, 1998. (2) Department of Census and Statistics Sri Lanka. Retrieved from http://www.statistics.gov.lk , 2009. (3) A. Hassani-Mehraban et al. Phytopathology 95:852, 2005. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

APA, Harvard, Vancouver, ISO, and other styles

40

Bulkens, M., C. Minca, and H. Muzaini. "Sight lines, sight areas and unbroken open spaces? More-than-representational conceptualisations in Dutch landscape planning." Geographica Helvetica 70, no. 3 (September 11, 2015): 239–49. http://dx.doi.org/10.5194/gh-70-239-2015.

Full text

Abstract:

Abstract. Drawing on the case study of the Wageningse Eng, the Netherlands, this paper examines a set of spatial metaphors (and their attendant grounded impacts) employed within two key policy documents – the allocation plan and a related map – pertaining to how the cultural landscape is to be spatially managed and developed by the municipality. Although promoted as being based on historical facts and a cornerstone of Dutch commitment to participatory planning, the case being studied reveals the ways in which these metaphors are at times not only entirely subjective and arbitrary, but also perceived by residents and users as neglecting their rights with respect to the landscape and as instruments constraining what can or cannot be done in that area. More broadly, in the face of calls for more non-representational approaches to landscape analysis, the paper shows the continued salience of representational practices within spatial planning and how these may hold very material implications for landscapes.

APA, Harvard, Vancouver, ISO, and other styles

41

Stankiewicz, Zygmunt. "Die Kunst in der Zukunftsstadt." Journal of Interdisciplinary Studies 8, no. 1 (1996): 81–104. http://dx.doi.org/10.5840/jis199681/26.

Full text

Abstract:

Jede Aussage eines Menschen, sei es dutch Wort, Tat oder Werk, hat eine direkte Beziehung zu seiner Umwelt imd im besonderen zur menschlichen Gesellschaft. Der wahre Künstler ist in den meisten Fällen ein mit der Natur eng verbundener Mensch. Aus ihr nimmt er seine Inspiration zur schöpferischen Aussage. Denn, am Anfang war die Idee, die Idee war bei dem Schöpfer, und die Idee war der Schöpfer. Jedoch, wir brauchen eine neue, verantwortungsbewusste Künstlerschaft. Jeder von uns ist dazu auserwählt---schon seiner Berufung wegen---falls er das Geheimnis des Wandelns und der Wiedergutmachung erfahren hat. Eine umfassende Künstlergemeinschaft setzt voraus, dass alle Künstler, in ihr vereint und um Erfahrungen reicher, mit neuen Ideen der Menschheit dienen.

APA, Harvard, Vancouver, ISO, and other styles

42

Stankiewicz, Zygmunt. "Die Kunst in der Zukunftsstadt." Journal of Interdisciplinary Studies 8, no. 1 (1996): 81–104. http://dx.doi.org/10.5840/jis199681/26.

Full text

Abstract:

Jede Aussage eines Menschen, sei es dutch Wort, Tat oder Werk, hat eine direkte Beziehung zu seiner Umwelt imd im besonderen zur menschlichen Gesellschaft. Der wahre Künstler ist in den meisten Fällen ein mit der Natur eng verbundener Mensch. Aus ihr nimmt er seine Inspiration zur schöpferischen Aussage. Denn, am Anfang war die Idee, die Idee war bei dem Schöpfer, und die Idee war der Schöpfer. Jedoch, wir brauchen eine neue, verantwortungsbewusste Künstlerschaft. Jeder von uns ist dazu auserwählt---schon seiner Berufung wegen---falls er das Geheimnis des Wandelns und der Wiedergutmachung erfahren hat. Eine umfassende Künstlergemeinschaft setzt voraus, dass alle Künstler, in ihr vereint und um Erfahrungen reicher, mit neuen Ideen der Menschheit dienen.

APA, Harvard, Vancouver, ISO, and other styles

43

Dams, Britt. "Production, Communication, and Comprehension of Knowledge of the New World: Ethnographic Descriptions in Caspar Barlaeus’ Rerum per Octennium." Journal of Early American History 2, no. 3 (2012): 223–46. http://dx.doi.org/10.1163/18770703-00203002.

Full text

Abstract:

This article deals with the textual legacy of Dutch Brazil, in particular the ethnographic descriptions in one of the most popular works about the colony: Barlaeus’ Rerum per Octennium in Brasilia et alibi nuper gestarum. Barlaeus never set foot in Brazil, but was an important Dutch intellectual authority in the seventeenth century. To compose the Rerum per Octennium, he relied on a wide variety of available sources, not only firsthand observations, but also classical, biblical and other contemporary sources. From these, he made a careful selection to produce his descriptions. Recent research shows that the Dutch participated in networks of knowledge and imagination as well as in a more familiar early modern trading network. This article reveals that Barlaeus’ descriptions not only circulated as knowledge, but also produced new knowledge. The Rerum soon became one of the standard works about the colony due to the importance of its author and its composition. Furthermore, the article discusses the rhetorical techniques used in some selected descriptions in order to shed light upon the strategies Barlaeus used in his discourse on the strange reality of the New World. For example, his ethnographic descriptions employed parallel customs or events from the classical Antiquity or the Bible. In these comparisons he displays both his intellectual capacities and shows his desire to comprehend this exotic reality.

APA, Harvard, Vancouver, ISO, and other styles

44

Silva, Débora Pereira da, Douglas Pereira da Silva Pitaluga, Paulo Sérgio Scalize, and Hebert Oliveira Santos. "Seasonal evaluation of surface water quality at the Tamanduá stream watershed (Aparecida de Goiânia, Goiás, Brazil) using the Water Quality Index." Open Engineering 9, no. 1 (March 7, 2019): 90–98. http://dx.doi.org/10.1515/eng-2019-0010.

Full text

Abstract:

AbstractFreshwater is an essential natural resource for humanity, however, its quality has been compromised as a result of natural and anthropogenic interference. The objective of the present study was to determine the Bascarán Water Quality Index (WQIB) for the Tamanduá stream in the municipality of Aparecida de Goiânia, Goiás, Brazil, and relate it to the limits established by CONAMA resolutions nº 357 [1] and nº 274 [2], for Class 2 freshwater bodies. The study was carried out at three sampling points proximate to urban parks, with samples collected in both the dry and the rainy seasons with the measurement of flow. The physical, chemical and biological parameters were analyzed as recommended in Standard Methods [3]. Parametric descriptive statistics were used for data analysis. The WQIB results classified the water as acceptable (24%), normal (48%), improper (20%) and unpleasant (8%), with turbidity, DO and total coliforms responsible for decreased WQIB in the rainy season. The parameters pH, apparent color and DO do not conform with CONAMA resolution nº 357 [1] while water resources for bathing were classified as excellent according to CONAMA resolution nº 274 [2].

APA, Harvard, Vancouver, ISO, and other styles

45

Qualharini, Eduardo Linhares, Luiz Henrique Costa Oscar, and Maiane Ramos da Silva. "Rehabilitation of buildings as an alternative to sustainability in Brazilian constructions." Open Engineering 9, no. 1 (May 31, 2019): 139–43. http://dx.doi.org/10.1515/eng-2019-0017.

Full text

Abstract:

AbstractRehabilitation and Sustainability complement each other insofar as new uses are defined for the existing constructions, avoiding the disposal and consequent environmental impact of this action. In Brazil, the culture of new construction still prevails, even with the relevant inventory of existing buildings, as indicated in studies conducted in Rio de Janeiro and São Paulo. Dissemination of knowledge of rehabilitation techniques can encourage the development of strategies for the implementation of these practices in brazilian market. Therefore, this paper will try to indicate techniques that may be improved and incorporated into the rehabilitation of Brazilian constructions, aiming aspects of sustainability and reinsertion of contemporary construction in urban heritage.

APA, Harvard, Vancouver, ISO, and other styles

46

Ebert, Christopher. "Amsterdam’s Atlantic: Print Culture and the Making of Dutch Brazil, written by Michiel van Groesen." Journal of Early Modern History 22, no. 3 (June 22, 2018): 210–11. http://dx.doi.org/10.1163/15700658-12342578-03.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Ebert, Christopher. "Amsterdam’s Atlantic: Print Culture and the Making of Dutch Brazil, written by Michiel van Groesen." Journal of Early Modern History 22, no. 3 (June 22, 2018): 210–11. http://dx.doi.org/10.1163/15700658-12342578-03a.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

van den Bel, Martijn. "“Against Right and Reason”: The Bold but Smooth French Take-Over of Dutch Cayenne (1655–1664)." Itinerario 45, no. 1 (March 23, 2021): 70–98. http://dx.doi.org/10.1017/s0165115321000073.

Full text

Abstract:

AbstractThe Dutch loss of Brazil in 1654 favoured the resettlement of Dutch merchants along the Wild Coast and in the Lesser Antilles and the establishment of new colonies. Cayenne Island was one of them. One WIC patent was handed to Jan Claes Langedijck, who settled at the former French fort of Cépérou, and another patent was given to David Nassy, who settled in the Anse de Rémire, situated at the opposite part of the former island. Both colonies were taken by the French in May 1664 as part of the imperial French expansion under King Louis XIV and Jean-Baptist Colbert. It is argued here that the main French goal was to gain control of the sugar plantations of the Sephardic community located there, and, to a lesser extent, the much-desired territorial control of this region as proposed by the newly established French West India Company. The Dutch were aware of the attack, but could not intervene as it was already too late to send support to the poorly defended Cayenne colony. Both parties negotiated the take-over and the majority of the Dutch settlers stayed under French rule, as was suggested by the Dutch government and hoped for by the French.

APA, Harvard, Vancouver, ISO, and other styles

49

Pereira, Thales A. Zamberlan. "Was it Uruguay or coffee? The causes of the beef jerky industry's decline in southern Brazil (1850 - 1889)." Nova Economia 26, no. 1 (April 2016): 7–42. http://dx.doi.org/10.1590/0103-6351/3005.

Full text

Abstract:

Abstract: What caused the decline of beef jerky production in Brazil? The main sustenance for slaves, beef jerky was the most important industry in southern Brazil. Nevertheless, by 1850, producers were already worried that they could not compete with Uruguayan industry. Traditional interpretations attribute this decline to the differences in productivity between labor markets; indeed, Brazil utilized slave labor,whereas Uruguay had abolished slavery in 1842. Recent research also raises the possibility of a Brazilian "Dutch disease",which resulted from the coffee export boom. We test both hypotheses and argue that Brazilian production's decline was associated with structural changes in demand for low-quality meat. Trade protection policies created disincentives for Brazilian producers to increase productivity and diversify its cattle industry.

APA, Harvard, Vancouver, ISO, and other styles

50

Dewulf, Jeroen. "Iberian linguistic elements among the black population in New Netherland (1614–1664)." Journal of Pidgin and Creole Languages 34, no. 1 (March 22, 2019): 49–82. http://dx.doi.org/10.1075/jpcl.00028.dew.

Full text

Abstract:

Abstract Since the slave population in New Netherland (1614–1664) was small compared to that of other Dutch Atlantic colonies such as Curaçao, Dutch Brazil, and Suriname, it has traditionally received little attention by scholars, including creolists. It is, therefore, not well known that traces of Iberian languages can be found among the black population of seventeenth-century Manhattan. While the paucity of sources does not allow us to make any decisive claims with regard to the importance of Spanish and Portuguese for the colony’s black community, this article attempts to reconstruct the language use of this population group on the basis of an analysis of historical sources from New Netherland in a broader Atlantic context.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!