Academic literature on the topic 'Endoparasit'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Endoparasit.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Endoparasit"
1
Puspitarini, Diah Ayu, Sri Subekti, and Kismiyati Kismiyati. "Identifikasi dan Prevalensi Cacing Endoparasit pada Saluran Pencernaan Kakap Merah (Lutjanus argentimaculatus) di Keramba Jaring Apung Balai Besar Perikanan Budidaya Laut, Lampung [Identification And Prevalence of Endoparasite Worms in The Gastrointestinal Tract of Red Snapper (Lutjanus argentimaculatus) In Floating Net The Centre Of Mariculture, Lampung]." Jurnal Ilmiah Perikanan dan Kelautan 10, no. 1 (June 2, 2018): 59. http://dx.doi.org/10.20473/jipk.v10i1.8549.
Full textAbstract:
AbstrakPenelitian ini bertujuan untuk mengetahui jenis dan tingkat prevalensi cacing endoparasit pada saluran pencernaan kakap merah (Lutjanus argentimaculatus) di Keramba Jaring Apung Balai Besar Perikanan Budidaya Laut Lampung. Metode yang digunakan dalam penelitian ini adalah metode survey. Pengambilan sampel sebanyak 30 ekor ikan yang berukuran 20-35 cm menggunakan metode purposive sampling. Organ yang diamati lambung dan usus, kemudian dilakukan identifikasi dan penghitungan prevalensi. Hasil dari penelitian ini menunjukkan jenis cacing endoparasit yang menginfeksi saluran pencernaan kakap merah (Lutjanus argentimaculatus) di Keramba Jaring Apung Balai Besar Perikanan Budidaya Laut Lampung adalah larva stadium tiga Anisakis physeteris (Anisakis tipe II) dan Cucullanus heterochrous. Prevalensi kakap merah yang terinfeksi endoparasit adalah 10%, terdiri dari Anisakis physeteris (Anisakis tipe II) sebesar 7% dan Cucullanus heterochrous sebesar 3%. AbstractThe purpose of the research is to know kinds and prevalence of endoparasites worm gastrointestinal red snapper (Lutjanus argentimaculatus) in floating net cages the Centre of Mariculture Lampung. The metode of the research is survey method. The sample that used is 30 fishes that size 20-35 cm used purposive sampling method. The organ that getting examination is intestine and stomach, after that do identification and counting of prevalence. The result showed kinds of endoparasite worms that infected is stage three larvae of Anisakis physeteris (Anisakis type II) and Cucullanus heterochrous. The prevalence of endoparasites in red snapper is 10% that consist from on Anisakis physeteris (Anisakis type II) 7% and Cucullanus heterochrous 3%.
2
Abdan, Muamar, Agung S. Batubara, Firman M. Nur, Derita Yulianto, Sugito Sugito, and Zainal A. Muchlisin. "Intensitas dan prevalensi ektoparasit dan endoparasit pada ikan belanak Liza macrolepis (Smith, 1846) di perairan pantai Barat-Selatan Aceh." Depik 9, no. 3 (November 30, 2020): 484–91. http://dx.doi.org/10.13170/depik.9.3.17959.
Full textAbstract:
The Largescale mullet Liza macrolepis is a common fish found in estuaries and coastal areas and the fish is used as a source of protein by coastal communities. This study aims to analyze the prevalence and intensity of parasitic infected on mullets harvested from the waters of the West - South Aceh. This research was conducted from March to April 2019 in 8 locations, namely; Estuary Aceh River, Gampong Jawa, Banda Aceh city, Coastal Ujong Pancu, Peukan Bada, Aceh Besar, Estuary Teunom River, Calang, Aceh Jaya, Estuary, and Coastal Kuala Bubon, Samatiga, West Aceh, Estuary Nagan River Langkak Kuala Tuha Nagan Raya, Estuary, and Coastal Susoh, Blang Pidie, Southwest Aceh, Estuary and Coastal Indra Damai, Kluet Selatan, South Aceh and Estuary Sua- Sua River and Ujong Umo River, Simeulue. A total of 343 samples were examined for ectoparasites and endoparasites at the Laboratory of Hatchery, Faculty of Marine and Fisheries, Syiah Kuala University. The results showed that there were seven species of parasites, infected the mullet samples namely; Ectoparasites (Cymanthoa sp., Ergasilus sp., Lernanthropus sp., Monstriloida sp., Myxobolus sp.) and Endoparasites (Nematodes and Trematodes). Prevalence value of Kota Banda Aceh was 33% ectoparasites and 28% endoparasites), Aceh Besar was 21% ectoparasites and 15% endoparasites, Aceh Jaya was 4% ectoparasites and 4% endoparasites, Southwest Aceh was 2% ectoparasites and 2% endoparasites, Simeulue was 9% ectoparasites and 9% endoparasites. It is concluded that the higher prevalence and intensity were found in fish samples from Banda Aceh and Aceh Besar, while no fish from Nagan Raya and Aceh Selatan were infected by parasites.Keywords:ParasiteCoastalEstuaryPollutant ABSTRAKIkan belanak Liza macrolepis sering dijumpai di muara dan pesisir pantai dan dijadikan sebagai sumber protein oleh masyarakat pesisir. Saat ini belum ada penelitian terkait jenis-jenis parasite yang menyerang ikan belanak di perairan Aceh, khususnya di pantai Barat Selatan Aceh. Oleh karena itu, penelitian ini bertujuan untuk menganalisis prevelensi dan intensitas parasit pada ikan belanak di perairan Barat Selatan Aceh. Penelitian dilakukan sejak Maret sampai April 2019 meliputi 8 lokasi, yaitu; Muara Krueng Aceh, Gampong Jawa Kota Banda Aceh, Ujung Pancu, Peukan Bada Aceh Besar, Muara Krueng Teunom, Calang Aceh Jaya, Muara Sungai/Pesisir Kuala Bubon, Samatiga Aceh Barat, Muara Krueng Nagan, Kuala Tuha Nagan Raya, Muara/Pesisir Susoh, Blang Pidie Aceh Barat Daya, Muara/Pesisir Indra Damai, Kluet Selatan Aceh Selatan dan Muara sungai Ujong Umo dan muara sungai Sua – Sua, tepah barat dan Simeulu Timur, Simeulu. Metode digunakan adalah preparat ulas (Smeer method). Sebanyak 343 sampel dibedah untuk dilakukan pemeriksan ektoparasit dan endoparasit di Laborarorium Pembenihan Ikan, Fakultas Kelautan dan Perikanan, Universitas Syiah Kuala. Hasil penelitian ditemukan 7 jenis parasit, ektoparasit (Cymanthoa sp., Ergasilus sp., Lernanthropus sp., Monstriloida sp., Myxobolus sp.) dan Endoparasit (Nematoda dan Trematoda). Nilai prevalensi; Kota Banda Aceh (33% ektoparasit, 28% endoparasit), Aceh Besar (21 % ektoparasit, 15% endoparasit), Aceh Jaya (4% ektoprasit dan 4%endoparasit), Aceh Barat Daya (2% ektoprasit dan 2% endoparasit) Simeulu (9% ektoparasit dan 9% endoparasit). Disimpulkan bahwa prevelensi dan intensitas parasit tertinggi dijumpai pada sampel ikan dari Banda Aceh dan Aceh Besar, sedangkan ikan sampel dari Nagan Raya dan Aceh Selatan bebas dari serangan parasit. Kata kunci:ParasitpesisirMuara sungaiPencemaran
3
Nilhakim, Lukman, Henky Irawan, and Rika Wulandari. "Identifikasi, intensitas dan prevalensi endoparasit pada ikan bawal bintang (Trachinotus blochii ) dilokasi budidaya kota tanjungpinang." Intek Akuakultur 3, no. 1 (May 18, 2019): 45–56. http://dx.doi.org/10.31629/intek.v3i1.1005.
Full textAbstract:
Intensitas parasit merupakan jumlah parasit yang menginvasi organisme pada suatu satuan ruang dan waktu, sedangkan prevalensi parasit merupakan jumlah ikan dalam populasi yang terinvasi parasite. Tujuan dari penelitian ini adalah untuk mengetahui nilai intensitas dan prevalensi akibat invasi endoparasit pada ikan bawal bintang. Metode penelitian di lakukan secara observasi atau pengamatan mikroskopis yang diawali dengan kegiatan isolasi dan di lanjutkan dengan proses identifikasi berdasarkan buku manual identifikasi. Hasil penelitian mendapatkan jenis endoparasit yang berhasil di isolasi pada organ target adalah Dragenus sp, Lecithomchirum sp, gorgorbynchus sp, ornithonyssus sp dan camalanus sp. Nilai intensitas endoparasit tertinggi di tunjukan oleh jenis parasit pada lokasi kampung kolam sebesar 11 (ind/ekor). Nilai prevalensi endoparasit tertinggi di tunjukan pada lokasi kampung kolam sebesar 30% . Penelitian meyimpulkan nilai intensitas dan prevalensi endoparasit tertinggi ditunjukaan pada lokasi kampung kolam, kelurahan sei jang, kecamatan bukit bestari, kota Tanjungpinang
4
Wirawan, I. Gusti Komang Oka, Melkianus Dedimus Same Randu, and I. Ketut Jaya. "Keragaman dan Intensitas Infeksi Endoparasit Gastrointestinal pada Sapi Bali dengan Sistem Ekstensif di Kabupaten Kupang." Jurnal Sain Veteriner 37, no. 2 (December 11, 2019): 151. http://dx.doi.org/10.22146/jsv.43185.
Full textAbstract:
Tanah Putih Village has the potential for the development of Bali cattle because it has extensive grazing land and the majority of farmers raise Bali cattle. The aim of the study was to obtain data on the diversity and intensity of gastrointestinal endoparasitic infection in Balinese cattle with an extensive breeding system in Tanah Putih Village, Kupang Timur District, Kupang Regency, East Nusa Tenggara Province. Gastrointestinal endoparasitic diversity was identify using sedimentation and flotation methods while the intensity of endoparasitic infection was carried out using McMaster method, while data on the diversity and rates of gastrointestinal endoparasitic infection were analyzed descriptively. The results of the study on the diversity of gastrointestinal endoparasites found there are five types of nematode worm eggs namely Haemonchus contortus, Oesophagostomum radiatum, Strongyloides papillosus, Bunostomum phlebotomum, and Trichostrongylus axei. Factors that support the diversity of endoparasites are feed sources, livestock populations, and grazing rotation. The average number of worm eggs found based on the total eggs per gram of faeces for Haemonchus contortus as many as 100 eggs and the other four types of worm eggs amounted to 50 eggs. The average number of eggs indicates that endoparasitic infections in these animals fall into the mild intensity category, is influenced by season, feed source, and age of livestock. The five types of gastrointestinal endoparasites found namely Haemonchus contortus, Oesophagostomum radiatum, Strongyloides papillosus, Bunostomum phlebotomum, and Trichostrongylus axei.
5
Permana, Gusti Ngurah, Jhon Harianto Hutapea, and Haryanti Haryanti. "OPTIMASI PCR (POLYMERASE CHAIN REACTION) UNTUK DETEKSI ENDOPARASIT YANG MENYERANG TELUR DAN LARVA IKAN TUNA SIRIP KUNING (Thunnus albacares)." Jurnal Riset Akuakultur 5, no. 1 (November 17, 2016): 35. http://dx.doi.org/10.15578/jra.5.1.2010.35-42.
Full textAbstract:
Endoparasit merupakan parasit yang menginfeksi dan terdapat di dalam tubuh inang, endoparasit ini telah menginfeksi telur dan larva ikan tuna sirip kuning. Tujuan dari penelitian adalah untuk mengetahui metode deteksi dan infeksi dari endoparasit ini secara molekuler dengan teknik PCR (Polymerase Chain Reaction). Telur dan larva yang terinfeksi dikumpulkan dari bak pemeliharaan untuk dianalisis. Sampel diekstraksi dengan menggunakan metode lysis bufer dan trizol. Hasil analisis menunjukkan lysis bufer memberikan pola pita yang lebih jelas dan bersih. Primer P2: 1322f (2F) CCGGAACTTTAGAGTATCGG; 1680r (2R) TCGGTTCAG ACTGA ACCAAG menghasilkan pola pita yang konsisten dan jelas dengan panjang fragmen 350 bp. Hal ini mengindikasikan bahwa endoparasit (Ichtyodinium chambelardi) menyerang telur ikan tuna di dalam bak terkontrol dan infeksinya terjadi adalah secara horisontal yang berasal dari air media pemeliharaan
6
Utama, Fahdi Putra, Kismiyati ., Gunanti Mahasri, and Putri Desi Wulansari. "IDENTIFIKASI DAN PREVALENSI CACING ENDOPARASIT PADA IKAN LAYANG DELES (Decapterus macrosoma) DI PELABUHAN PERIKANAN NUSANTARA BRONDONG, LAMONGAN." Jurnal Akuakultur Rawa Indonesia 6, no. 1 (July 7, 2018): 77–82. http://dx.doi.org/10.36706/jari.v6i1.7151.
Full textAbstract:
ABSTRACT The High Interest of public to Marine fish, create more demand of Slander Scad (Decapterus macrosoma). Slander Scad is one commodity that has economic value and high nutritional content. The Slander Scad is obtained from the catch of fishermen in the Nusantara Fishery Port Brondong, Lamongan. Fish that caught from the wild is likely to get a disease caused by infection of the endoparasites.worm. The parasites that infect Slander scad probably caused by environmental factors that could decrease immune system, causing the fish easily infected by endoparasites worm such as Anisakis. This parasite is zoonotic and can infect humans, therefore, to identify and prevalence for humans who consume fish can manage properly. The purpose of this study was to identify the species of endoparasite worms that infect Slander Scad (D. Macrosoma) in Nusantara Fishery Port of Brondong, Lamongan. The research method is using a survey method through sampling at locations directly. 75 samples of Slander Scad were examined. The main parameters observed in this study are to observe the species and the prevalence of endoparasitic worm that infected Slander scad. The result of the identification of endoparasite that infected Slander Scad were analyzed descriptively and presented in the form of figures and tables. The results showed the presence of the third-stage Anisakis simplex larvae that infect the Slander Scad in the liver, intestines, gonads, muscles in the abdominal side, in the Nusantara Fishery Port of Brondong Lamongan, East Java with a total prevalence of Anisakis simplex worm was 42.67%. Keywords: Slander Scad, Prevalence, Anisakis simplex, and zoonotic.
7
Prianggara, Alfan, Gunanti Mahasri, and Abdul Manan. "HUBUNGAN ANTARA KUALITAS AIR DENGAN PREVALENSI ENDOPARASIT PADA SALURAN PENCERNAAN IKAN NILA (Oreochromis niloticus) DI KERAMBA JARING APUNG PROGRAM URBAN FARMING DI KOTA SURABAYA." Journal of Aquaculture and Fish Health 5, no. 3 (January 16, 2019): 85. http://dx.doi.org/10.20473/jafh.v5i3.11327.
Full textAbstract:
Kendala kualitas air dalam budidaya ikan nila (Oreochromis niloticus) pada Program Urban Farming diakibatkan karena waduk maupun bozem yang digunakan merupakan perairan tergenang dan kualitas airnya tergantung darimana air itu berasal, apabila kualitas air buruk maka ikan akan stres, menjadi lemah dan mudah terserang parasit. Penelitian ini bertujuan untuk mengetahui kualitas air pada pemeliharaan ikan nila (O. niloticus), prevalensi endoparasit pada saluran pencernaan serta korelasi antara kualitas air dengan prevalensi endoparasit pada saluran pencernaan ikan nila (O. niloticus) di Keramba Jaring Apung Program Urban Farming kota Surabaya. Lokasi waduk atau bozem yang digunakan adalah Urban Farming kecamatan Wiyung, Jambangan dan Lakarsantri, kota Surabaya. Metode yang digunakan adalah metode survey. Parameter utama dalam penelitian ini adalah prevalensi endoparasit dan kualitas air. Hasil pengukuran kualitas air berkisar antara : suhu 29-300C; pH 7-8,5; kecerahan 18-30 cm; DO 4,8- 5,3 mg/l; nitrit <0,043-2,213 mg/l; nitrat <0,008-7,781 mg/l dan amoniak 0,063-0,35 mg/l. Prevalensi rata-rata endoparasit Eimeria spp. 5,71 % dan Acanthogyrus spp. 8 %. Terdapat korelasi positif antara kecerahan, amoniak dan DO dengan prevalensi Eimeria spp. serta suhu, pH, nitrat dan nitrit dengan prevalensi Acanthogyrus spp. Terdapat korelasi negatif antara suhu, pH, nitrat dan nitrit dengan prevalensi Eimeria spp. serta kecerahan, amoniak dan DO dengan prevalensi Acanthogyrus spp.
8
Mursyid, Muhammad Hipzul, Anwar Rosyidi, Wayan Wariata, and Made Sriasih. "Kasus Infestasi Endoparasit pada Kerbau (Bubalus bubalis) di Kecamatan Praya Barat Kabupaten Lombok Tengah." Jurnal Ilmu dan Teknologi Peternakan Indonesia (JITPI), Indonesian Journal of Animal Science and Technology 5, no. 2 (June 17, 2020): 93. http://dx.doi.org/10.29303/jitpi.v5i2.66.
Full textAbstract:
The purpose of this study was to determine endoparasitic infestation on Buffaloes in Praya Barat district, Central Lombok. Stools samples were taken from 61 buffaloes from 5 villages and examined at Banyumulek Animal Health Laboratory of Animal Husbandry and Animal Health Service of NTB Province using the floating and sedimentation methods to perceive the presence of parasitic eggs. The data obtained were analyzed descriptively. The results show that from 61 fecal samples analyzed, 20 samples (32.7%) were positively infected with endoparasites with a single type of infection and multi-species infection. A total of 13 samples (21.3%) were infected with Nematodes, 2 samples (3.27%) were infected with Cestode, 2 samples (3.27%) were infected with Trematode and 11 samples (18.03%) were infected with Protozoa. The degree of endoparasitic infection in buffaloes in West Praya district is included in the category of mild infection. Endoparasites that infect buffaloes in Praya Barat are coming from family Toxocaridae, Trichostrongylidae, Cooperidae, Anoplocephalidae, Strongylidae, Strongyloididae, Chabertidae, Fasciolidae and Eimeriidae. The highest prevalence for worm parasite was Toxocaridae with the percentage of 11.46%, whilst for the protozoa was the family of Eimeriidae accounted for 18.01%.
9
Moenek, Devi, Aven B. Oematan, and Novianti N. Toelle. "KERAGAMAN ENDOPARASIT GASTROINTESTINAL DAN PROFIL DARAH PADA AYAM KAMPUNG (GALLUS DOMESTICUS)." JURNAL KAJIAN VETERINER 7, no. 2 (February 14, 2020): 114–20. http://dx.doi.org/10.35508/jkv.v7i2.1983.
Full textAbstract:
Penelitian ini bertujuan untuk mengetahui keragaman jenis endoparasit gastrointestinal dan pengaruhnya terhadap profil darah ayam kampung yang meliputi jumlah eritrosit, kadar hemoglobin, Packed cell volume, dan jumlah total leukosit. Pengambilan sampel feses dan darah ayam kampung dilapangan sedangkan pemeriksaan dan identifkasi endoparasit pada feses ayam kampung serta pemeriksaan darah di laboratorium Kesehatan Hewan Program Studi Kesehatan Hewan Politani Kupang. Peubah yang diamati adalah morfologi atau ciri-ciri endoparasit dan gambaran darah terutama jumlah eritrosit, kadar hemoglobin, Packed cell volume, dan jumlah total leukosit Seluruh sampel yang terkumpul diidentifikasi menggunakan mikroskop dibantu dengan panduan kunci identifikasi dan didokumentasikan menggunakan kamera digital, dan data gambaran darah yang diperoleh akan disesuakan dengan gambaran darah normal kemudian semua data yang diperoleh, diolah secara deskriptif. Penelitian ini akan dilaksanakan didaerah Kecamatan Amarasi Kabupaten Kupang. Dari pemeriksaan ditemukan telur cacing Ascaridia galli untuk semua sampel feses dan pemeriksaan darah menunjukkan bahwa jumlah eritrosit 3.782 X 10^6/µL, kadar hemoglobin 12.16 g/L, PCV 43.18%, dan jumlah total leukosit 112.5 X 10^3/µL.
10
Pujaningsih, Retno Iswarin, Dian Wahyu Harjanti, Baginda Iskandar Moeda Tampubolon, Widianto Widianto, Ahmad Ahsan, and Wening Suri Pawestri. "Aplikasi Penambahan Kunyit dan Multinutrien Blok Plus pada Pakan Kambing Jawarandu terhadap Infestasi Endoparasit dan Konsumsi Pakan." Jurnal Ilmu Peternakan dan Veteriner Tropis (Journal of Tropical Animal and Veterinary Science) 11, no. 1 (March 30, 2021): 22. http://dx.doi.org/10.46549/jipvet.v11i1.128.
Full textAbstract:
Goat management in rural areas is still commonly done traditionally with little regard for health factors. One factor is the presence of parasitic worms in the goat's digestive tract which causes disturbed growth. The research aims to evaluate the effect of the addition of turmeric and multinutrient block plus (MNBP) in eliminating endoparasites and increasing feed intake of Jawarandu goats. The material used was 12 male Jawarandu goats weighing an average of 20 kg. A completely randomized design was used in this study with 4 treatments and 3 replications. Treatment T0: basal ration + MNBP; T1: T0 + 1% turmeric; T2: T0 + 3% turmeric; T3: T0 + 5% turmeric. The parameters observed were feed intake, weight gain, number of endoparasites and total eggs per gram of feces. Data analysis using analysis of variance significance level of 5% to determine the effect of treatment. If there is a treatment effect, it is followed by Duncan's multiple range test. The results showed a decrease in the number of endoparasites. The best treatment to induce an antibody system is T2 treatment, namely the addition of turmeric with a level of 3%. Feed intake was not significantly increasing although improving body weight gain in T2 and T3. The conclusion of the study is that the administration of MNBP and turmeric with a level of 5% has not been able to eliminate all endoparasites until the 28th day. MNBP and turmeric are useful as natural antioxidants. Increased level of turmeric can increase weight gain and immune system of goats.
Keyword: Multinutrient blocks, turmeric, Jawarandu goats, endoparasite, feed intake
Dissertations / Theses on the topic "Endoparasit"
1
Bläuer, Stephan Klaus. "Endoparasiten bei Tagraubvögeln und Eulen in der Schweiz /." [S.l.] : [s.n.], 1998. http://www.ub.unibe.ch/content/bibliotheken_sammlungen/sondersammlungen/dissen_bestellformular/index_ger.html.
Full text
2
ALBUQUERQUE, M?rcia Cavalcanti de. "Biodiversidade das comunidades endoparasit?rias de peixes forrageiros do reservat?rio de Tr?s Marias, alto rio S?o Francisco, Brasil." Universidade Federal Rural do Rio de Janeiro, 2013. https://tede.ufrrj.br/jspui/handle/jspui/2383.
Full textAbstract:
Submitted by Jorge Silva (jorgelmsilva@ufrrj.br) on 2018-08-24T18:57:55Z
No. of bitstreams: 1
2013 - Marcia Cavalcanti de Albuquerque.pdf: 12812324 bytes, checksum: 6ad3724579dc770eb98b1bc085f473fe (MD5)Made available in DSpace on 2018-08-24T18:57:55Z (GMT). No. of bitstreams: 1 2013 - Marcia Cavalcanti de Albuquerque.pdf: 12812324 bytes, checksum: 6ad3724579dc770eb98b1bc085f473fe (MD5) Previous issue date: 2013-01-25
CAPES
CNPq
This study aimed to identify the parasite species of eight forage fish species from the Tr?s Marias reservoir; to clarify some aspects about their parasite faunas through the quantification of the parasite parameters (prevalence, intensity and , abundance); to determine diversity indices of each endocommunity; to compare the endoparasite communities using qualitative and quantitative methods; and to investigate which biotic and abiotic factors were relevant in the endoparasite communities structuration. A total of 492 fish (Characiformes, Characidae) were collected in the Tr?s Marias reservoir (18?12'59"S, 45?17'34"W), upper S?o Francisco river, State of Minas Gerais, between May 2003 and July 2010. Of these total, 44 specimens were of Astyanax bimaculatus (Linnaeus, 1758), 76 of Astyanax fasciatus (Cuvier, 1819), 70 of Bryconops affinis (G?nther, 1864), 64 of Hemigrammus marginatus Ellis, 1911, 41 of Moenkausia costae (Steindachner, 1907), 51 of Orthospinus franciscensis (Eigenmann, 1914), 63 of Tetragonopterus chalceus Spix & Agassiz, 1829 and 83 of Triportheus guentheri (Garman, 1890). Were found 21 endoparasite species among the eight communities ? Digenea: Creptotrema creptotrema Travassos, Artigas & Pereira, 1928, Magnivitellinum simplex Kloss, 1966, unidentified species of Digenea (adults), Austrodiplostomum sp. and Clinostomum marginatum (Rudolphi, 1819) Braun, 1899 (metacercariaes); Eucestoda: unidentified species of Cyclophyllidea (metacestode) and unidentified species of Proteocephalidae (plerocercoids); Nematoda: Procamallanus saofranciscencis Moreira, Oliveira & Costa, 1994, Rhabdochona spA., Spinitectus rodolphiheringi Vaz & Pereira, 1934 (adults), Contracaecum sp., Hysterothylacium sp., Goezia sp., unidentified species of Cucullanidae, Procamallanus sp., Procamallanus (Spirocamallanus) sp., Spiroxys sp., Rhabdochona sp. and Cystidicoloides fischeri (Travassos, Artigas & Pereira, 1928) (larvas); Myxozoa: Henneguya sp. (plasmodium with spores); and Protozoa (Apicomplexa): Calyptospora sp. (cysts with oocysts). Seven of these species were more frequent between the eight hosts: plerocercoids of Proteocephalidae, P. saofranciscencis, Contracaecum sp., Hysterothylacium sp., Spiroxys sp., Rhabdochona sp. and Henneguya sp.. The A. bimaculatus was the richest (16 endoparasite species) and the T. guentheri was the most diverse (Shannon-Wiener = 0,86) communiity. The H. marginatus was the less rich (nine taxa) and diverse community (Shannon-Wiener = 0,03). The most qualitative similarity was between the A. bimaculatus and A. fasciatus communities, while the most quantitative similarity occurred between the H. marginatus and O. franciscensis communities. The structure of parasite communities was mainly influenced by five factors: biotic ? fish species, size and diet; and abiotic: water electrical conductivity and fish collection period. However, the fish diet seems to be the major determining composition of the parasite communities of forage fish from the Tr?s Marias reservoir.
Este trabalho teve como objetivos identificar as esp?cies de parasitos de oito esp?cies de peixes forrageiros do reservat?rio de Tr?s Marias; esclarecer alguns aspectos sobre suas faunas parasit?rias atrav?s da quantifica??o dos par?metros parasit?rios (preval?ncia, intensidade e abund?ncia); determinar ?ndices de diversidade de cada endocomunidade; comparar quantitativa e qualitativamente as comunidades endoparasit?rias desses oito hospedeiros; e investigar quais fatores bi?ticos e abi?ticos foram relevantes na estrutura??o das comunidades endoparasit?rias. Um total de 492 peixes (Characiformes, Characidae) foram coletados no reservat?rio de Tr?s Marias (18?12'59"S, 45?17'34"W), alto rio S?o Francisco, Minas Gerais, entre maio de 2003 e julho 2010. Desse total, 44 esp?cimes eram de Astyanax bimaculatus (Linnaeus, 1758), 76 de Astyanax fasciatus (Cuvier, 1819), 70 de Bryconops affinis (G?nther, 1864), 64 de Hemigrammus marginatus Ellis, 1911, 41 de Moenkausia costae (Steindachner, 1907), 51 de Orthospinus franciscensis (Eigenmann, 1914), 63 de Tetragonopterus chalceus Spix & Agassiz, 1829 e 83 de Triportheus guentheri (Garman, 1890). Foram encontradas 21 esp?cies de endoparasitos dentre as oito comunidades - Digenea: Creptotrema creptotrema Travassos, Artigas & Pereira, 1928, Magnivitellinum simplex Kloss, 1966, uma esp?cie n?o identificada (adultos), Austrodiplostomum sp. e Clinostomum marginatum (Rudolphi, 1819) Braun, 1899 (metacerc?rias); Eucestoda: esp?cie n?o identificada de Cyclophyllidea (metacestoide) e esp?cie n?o identificada de Proteocephalidae (plerocercoides); Nematoda: Procamallanus saofranciscencis Moreira, Oliveira & Costa, 1994, Rhabdochona spA., Spinitectus rodolphiheringi Vaz & Pereira, 1934 (adultos), Contracaecum sp., Hysterothylacium sp., Goezia sp., esp?cie n?o identificada de Cucullanidae, Procamallanus sp., Procamallanus (Spirocamallanus) sp., Spiroxys sp., Rhabdochona sp. e Cystidicoloides fischeri (Travassos, Artigas & Pereira, 1928) (larvas); Myxozoa: Henneguya sp. (plasm?dio com esporos); e Protozoa (Apicomplexa): Calyptospora sp. (cistos com oocistos). Sete dessas foram mais frequentes dentre os oito hospedeiros: plerocercoides de Proteocephalidae, P. saofranciscencis, Contracaecum sp., Hysterothylacium sp., Spiroxys sp., Rhabdochona sp. e Henneguya sp.. A comunidade de A. bimaculatus foi a mais rica (16 esp?cies de endoparasitos) e a de T. guentheri a mais diversa (Shannon-Wiener = 0,86). A comunidade de H. marginatus foi a menos rica (nove t?xons) e diversa (Shannon-Wiener = 0,03). A maior similaridade qualitativa foi entre as comunidades de A. bimaculatus e A. fasciatus, enquanto que a maior similaridade quantitativa se deu entre as comunidades de H. marginatus e O. franciscensis. A estrutura das comunidades parasit?rias foi influenciada principalmente por cinco fatores: bi?ticos ? esp?cie, comprimento e dieta dos peixes; e abi?ticos ? condutividade el?trica da ?gua e ?poca de coleta dos peixes. Contudo, a dieta dos peixes pareceu ser o maior determinante da composi??o das comunidades endoparasit?rias dos forrageiros do reservat?rio de Tr?s Marias.
3
Presotto, Douglas. "Estudo da prevalencia de infecção por endoparasitos em cães (Canis familiaris, Linnaeus, 1758) do municipio de Hortolandia, SP." [s.n.], 2009. http://repositorio.unicamp.br/jspui/handle/REPOSIP/315957.
Full textAbstract:
Orientador: Silmara Marques AllegrettiDissertação (mestrado) - Universidade Estadual de Campinas, Instituto de Biologia
Made available in DSpace on 2018-08-14T06:53:17Z (GMT). No. of bitstreams: 1 Presotto_Douglas_M.pdf: 2909601 bytes, checksum: e84648e96ca5cedc35dc57d264d439bd (MD5) Previous issue date: 2009
Resumo: Endoparasitoses em cães produzidas por nematódeos das Famílias Toxocaridae, Trichuridae, Onchocercidae, Ancylostomatidae, Strongyloididae e por cestódeos da família Dilepididae são uma ocorrência freqüente na clínica veterinária, além de se constituírem em infecções zoonóticas prevalentes em áreas urbanas; as produzidas por protozoários dos gêneros Cystoisospora e Giardia, também tem adquirido grande importância para a saúde humana e animal. O convívio estreito entre homens e cães, aliado ao crescimento dessa população nos centros urbanos, tem feito de algumas dessas endoparasitoses um importante problema de Saúde Pública. Assim, o conhecimento de sua prevalência constituiu-se em importante instrumento de prevenção e controle. Este presente estudo objetivou determinar a prevalência dessas infecções em cães do município de Hortolândia, situado no Estado de São Paulo, bem como avaliar o risco à saúde para a população humana; amostras de fezes (n = 250), sangue (n = 66) e material de necropsias (n = 50) foram coletadas e examinadas no período compreendido entre os anos de 2006 e 2008. As amostras foram obtidas a partir de cães sem controle (errantes), adultos (a partir de um ano de idade), recolhidos e mantidos nas dependências do Centro de Controle de Zoonoses (CCZ) e avaliadas pelos métodos parasitológicos tradicionais para pesquisa de helmintos e protozoários. As necropsias foram realizadas em animais submetidos à eutanásia, após avaliação veterinária. A prevalência geral de endoparasitos neste estudo foi de 87,2% em amostras fecais e de 100% em necropsias. Nas amostras fecais os parasitos observados foram: Ancylostoma sp. (79,2%), Giardia duodenalis (20,0%), Toxocara sp. (16,8%), Cystoisospora sp. (16,4%), Trichuris vulpis (11,6%), Dipylidium caninum (1,6%) e Toxascaris leonina (1,2%). Nas necropsias, Ancylostoma caninum (72,0%), Dipylidium caninum (64,0%), Toxocara canis (44,0%), Cystoisospora sp. (30,0% em material fecal de necropsia), Trichuris vulpis (20,0%) e Toxascaris leonina (2,0% em material fecal de necropsia). Houve diferença estatisticamente significativa em relação ao sexo para os nematódeos Toxocara spp., com maior ocorrência nos machos (p = 0,0137) e Trichuris vulpis, com maior ocorrência nas fêmeas (p = 0,0015). Houve diferença estatisticamente significativa em relação à estação do ano para os nematódeos Ancylostoma spp., com menor ocorrência na primavera (p = 0,0001) e Trichuris vulpis, com maior ocorrência no inverno (p = 0,0039). Os resultados demonstraram altas prevalências dessas infecções parasitárias em cães adultos, com idades variáveis, a partir de um ano, até animais senis, e também em animais imunossuprimidos, devido às condições adversas à que estavam submetidos (abandono, maus-tratos, desnutrição e doenças concomitantes); os resultados sugerem também um alto grau de contaminação ambiental e, conseqüentemente, o risco à saúde humana (diretamente, pelo contato com esses ambientes e indiretamente, pela exposição a que podem ficar submetidos os cães domiciliados, quando em contato com esses ambientes ou com cães de rua).
Abstract: Parasitic diseases in dogs, produced by nematodes (families Toxocaridae, Trichuridae, Onchocercidae, Ancylostomatidae and Strongyloididae) and cestodes (family Dilepididae), are a frequent occurrence in the clinical veterinary medicine. These helmintic diseases are important zoonotic infections, prevalent in urban areas; infectious diseases caused by protozoans (genus Cystoisospora and Giardia), also have acquired great importance for the animal and humam health. The close relationship between men and dogs, and the growth of canine population in the urban areas, has made some of these parasitic infections an important problem of Public Health. Thus, the knowledge of its prevalence is an important way of prevention and control. This present work purposed to determine the prevalence of these infections in dogs from the city of Hortolândia (Brazil), as well as evaluate the risk to the human health; feces samples (n = 250), blood samples (n = 66) and samples from necropsies (n = 50) were collected and examined in the understood period between the years of 2006 and 2008. These samples came from stray dogs (uncontrolled), adults (from one year of age), captured and kept in the dependences of the Center of Zoonoses Control (CCZ) and evaluated by the traditional methods of laboratory for diagnosis of helminths and protozoans. The necropsies had been done in animals submitted to the euthanasia, after veterinary evaluation. The overall prevalence of endoparasites in this work was 87,2% in feces samples and 100% in necropsies. The parasites observed in feces samples were Ancylostoma sp. (79,2%), Giardia duodenalis (20,0%), Toxocara sp. (16,8%), Cystoisospora sp. (16,4%), Trichuris vulpis (11,6%), Dipylidium caninum (1,6%) and Toxascaris leonina (1,2%). The parasites observed in necropsies were Ancylostoma caninum (72,0%), Dipylidium caninum (64,0%), Toxocara canis (44,0%), Cystoisospora sp. (30,0% in necropsy's feces samples), Trichuris vulpis (20,0%) e Toxascaris leonina (2,0% in necropsy's feces samples). There was statistically significant difference between gender for the nematodes Toxocara spp., with higher prevalence in males (p = 0,0137) and Trichuris vulpis, with higher prevalence in females (p = 0,0015). There was statistically significant difference between seasons for the nematodes Ancylostoma spp., with less prevalence in spring (p = 0,0001) and Trichuris vulpis, with higher prevalence in winter (p = 0,0039). The data demonstrated the high prevalence of these parasitic infections in adult dogs, with changeable ages, from one year, until senile animals, mainly in animals under adverse life conditions (abandonment, malnutrition, illnesses); they also suggest the high degree of environmental contamination and, consequently, the risk to the human health (directly, by the contact with these environments and indirectly, by the exposition of the domiciliated dogs, when in contact with these environments or stray dogs).
Mestrado
Mestre em Parasitologia
4
Fagundes, Thais Ferreira. "Ocorr?ncia e sazonalidade de parasitos gastrintestinais em avestruzes (Struthio camelus) de tr?s faixas et?rias em uma cria??o no Munic?pio de Areal/RJ." Universidade Federal Rural do Rio de Janeiro, 2009. https://tede.ufrrj.br/jspui/handle/tede/774.
Full textAbstract:
Made available in DSpace on 2016-04-28T20:15:33Z (GMT). No. of bitstreams: 1
2009 - Thais Ferreira Fagundes.pdf: 371119 bytes, checksum: 3ab10bc2aba1cc751859fbdf5b9ed967 (MD5)
Previous issue date: 2009-02-11Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior
Ostriche breeding has recently achieved commercial importance around the world. It is important to know the parasites those affect animals in commercial farms, as infections can reduce the weight gain, compromise reproductive potential and lead animals to death. Brazil has great environmental differences among its regions, depending on weather conditions and production management, and arrangements must be provided as ostriches are not used to deal with these conditions. The aim of this study was to identify gastrointestinal parasites and checks its seasonal occurrence among animals in a commercial farm in Areal / RJ. Fresh fecal samples were monthly collected (from April/2004 to May/2006) and placed in indentified plastic bags under refrigeration until processing. Centrifugal flotation in sugar saturated solution (counting eggs per grams of feces EPG), faecal culture (identify third-stage - L3 larvae) and centrifugal-sedimentation (protozoa identification) techniques were performed. Two hundred and sixty-four fecal samples were collected and divided in three groups according to ostriches ages: <90, 91 365 and >365 days (adults). Dry and rainy seasons were defined according to meteorological data obtained. Typical eggs of the Order Strongylida were identified in 169 samples (158 from adult ostriches). Once obtained, L3 larvae were identified as Codiostomum struthionis. Species of protozoa were detected in 252 of 264 samples (single and mixed infection). At least one of the three Genus (Cryptosporidium, Blastocystis and Entamoeba) was identified in 95.45% of the samples evaluated. Ostriches >365 days had greater eggs removal during the rainy season compared to dry season, being this difference significant (p=0.0002). When evaluating seasonality, Blastocystis cysts were mostly found among dry season samples (p=0.0043) in the age group of < 90. In the age group > 365 days there was difference significant of removal oocysts/cysts between the dry and rainy seasons for Cryptosporidium (p=0.0161) and Entamoeba (p=0.0387), being higher in the rainy season. Among age group, significant difference of removal of cysts between < 90 and > 365 days to Entamoeba (p=0.0430), greater removal in adults. Significant differences were also found between ages related to EPG disposal (p<0.05 for ostriches < 90 and > 365 days; p<0.05 for ostriches from 91 to 365 and > 365 days), as result of high EPG of adults.
Como o n?mero de criat?rios vem aumentando em todo o mundo, o conhecimento dos parasitos que acometem as avestruzes ? importante, pois quando infectadas pode ocorrer um menor ganho de peso, comprometer o potencial reprodutivo e at? causar a morte. O ambiente brasileiro varia bastante e, dependendo das condi??es clim?ticas de cada regi?o, a efici?ncia de produ??o tamb?m se altera, pois a avestruz ? pouco afeita a ambientes chuvosos. Este trabalho teve como objetivos identificar os parasitos gastrintestinais de avestruzes de uma cria??o em Areal/RJ e verificar a sazonalidade de ocorr?ncia dos parasitos de acordo com a faixa et?ria das aves. Foram coletadas, mensalmente, amostras fecais rec?m emitidas e acondicionadas em sacos pl?sticos devidamente identificados, e mantidas sob refrigera??o at? o momento de serem examinadas. Uma parte das fezes foi processada seguindo a t?cnica de centr?fugo-flutua??o em solu??o saturada de a??car para a contagem de ovos por grama de fezes (OPG). Outra parte foi utilizada na realiza??o de coproculturas para identificar a larva de terceiro est?dio (L3). E a terceira por??o do material fecal foi processada seguindo a t?cnica de centr?fugo-sedimenta??o para identifica??o de protozo?rios. Foram coletadas, entre abril de 2004 e maio de 2006, 264 amostras de fezes de avestruzes divididas em tr?s faixas et?rias: at? 90 dias, de 91-365 dias e acima de 365 dias (adultos). Foram obtidos dados meteorol?gicos para defini??o das esta??es seca e chuvosa. Verificaram-se 170 amostras positivas para ovos t?picos da ordem Strongylida, sendo 159 amostras provenientes de avestruzes adultas. Ap?s a obten??o das L3, estas foram identificadas como Codiostomum struthionis. Foram observados protozo?rios em 252 das 264 amostras examinadas ocorrendo infec??o simples ou mista, ou seja, 95,4% das amostras estavam positivas para pelo menos um dos tr?s g?neros encontrados: Cryptosporidium, Blastocystis e Entamoeba. Ap?s a an?lise estat?stica pode-se observar que na faixa et?ria acima de 365 dias houve diferen?a significativa para libera??o de ovos e entre as esta??es seca e chuvosa (p= 0,0002), sendo a maior elimina??o na esta??o chuvosa. Na an?lise da diferen?a entre as esta??es para protozo?rios houve diferen?a significativa na elimina??o de cisto de Blastocystis (p= 0,0043) na faixa et?ria de 0-90 dias, onde na esta??o seca a libera??o foi maior, e na faixa et?ria acima de 365 dias houve diferen?a significativa de elimina??o de oocistos/cistos entre a esta??o seca e chuvosa para Cryptosporidium (p= 0,0161) e Entamoeba (p= 0,0387), sendo maior na chuva. Entre as faixas et?rias, houve diferen?a significativa de elimina??o de cistos entre 0-90 dias e acima de 365 dias para Entamoeba (p= 0,0430). Para a compara??o de elimina??o de OPG entre as faixas et?rias houve diferen?a significativa entre 0-90 dias e acima de 365 dias (p<0,05) e 91-365 dias e acima de 365 dias (p<0,05), sendo a maior elimina??o nos adultos.
5
Lajas, Luís Miguel de Jesus Mota Fernandes. "Survey of parasitic diseases in African-lion (Panthera leo) from Niassa National Reserve, Mozambique." Master's thesis, Universidade de Lisboa. Faculdade de Medicina Veterinária, 2015. http://hdl.handle.net/10400.5/10852.
Full textAbstract:
Dissertação de Mestrado Integrado em Medicina VeterináriaPanthera leo - The African lion - is an iconic species of the African continent, classified as vulnerable by the International Union for Conservation of Nature (IUCN). Once believed to be a widespread species throughout Africa, the African lion is now extinct in most of its range in West Africa and is facing considerable population declines in Eastern and Southern Africa. Niassa National Reserve (NNR) is the largest conservation area in Mozambique and it is also one of the most important conservation areas remaining in Africa. It supports the highest densities of wildlife in the country. It has also been identified as one of the few “lion strongholds” where the species has a better chance of long term survival. Infectious diseases are known to negatively impact the survival of lion populations and are considered a main threat that can significantly impair conservation efforts. However, the impact of parasitic infections has been overlooked and poorly documented in wild lions. To the best of the author’s knowledge, no studies addressing this subject have been conducted on this lion population or any other in Mozambique. In order to characterize the parasitological fauna of these animals, a study was carried out in the Niassa National Reserve, with the full support of the Niassa Carnivore Project and in partnership with the Administration of the Niassa Reserve. In total, 44 lion faecal samples were collected in an area of 600 km² (Concession L5-South), and later processed and analyzed at the Laboratory of Parasitology and Parasitic Diseases, Faculty of Veterinary Medicine, Lisbon University. Results show that 65.9 % (29/44) of the samples were infected with parasites, namely 47.7 % for Toxocara sp., 31.8 % for Aelurostrongylus sp., 27.3 % for Taeniidae, 25 % for Spirometra sp.,18.2 % for Paramphistomum sp. and 13.6 % for Linguatula sp. Out of the 29 positive samples, 72 % (21/29) were co-infected, registering double infection in 21 % (6/29), triple in 34 % (10/29), quadruple in 10 % (3/29) and fivefold in 7 % (2/29). These results are consistent with previous studies performed in the African continent, with the exception of Linguatula sp., which had not yet been reported in wild lions. These results highlight the importance of further studies in this subject, not only with this and other animal species but on human populations as well. In order to carry out the identification of the species of parasites found it to would be important to associate classic parasitology techniques with molecular biology techniques. In the future, it would also be important to complement this study with results regarding the presence of other pathogens such as viruses and bacteria.
RESUMO - O Panthera leo - o Leão-Africano - é uma espécie emblemática do continente Africano, classificada como Vulnerável pela International Union for Conservation of Nature (IUCN). Outrora visto como uma espécie abundante em África, o Leão-Africano encontra-se hoje extinto na grande maioria da sua área de distribuição na África Ocidental, e enfrenta declínios populacionais consideráveis na África Oriental e Austral. A Reserva Nacional do Niassa (RNN) é a maior área de conservação em Moçambique e das mais importantes em África. Esta Reserva concentra as maiores densidades de fauna selvagem no país. Esta área foi identificada como um das poucas “fortalezas do leão-africano”, onde a espécie terá melhores hipóteses de sobreviver a longo prazo. As doenças infeciosas são conhecidas por terem impactos negativos na sobrevivência de populações de leões e são consideradas uma das principais causas que pode condicionar os esforços de conservação na espécie. Contudo, o impacto das infeções de origem parasitária tem sido fracamente documentado em leões selvagens. Anteriormente, não foram realizados quaisquer estudos relativos a este tema nesta população de leões ou em qualquer outra em Moçambique. De modo a caracterizar a fauna parasitológica destes animais, foi realizado um estudo na RNN, com o total apoio do Projecto dos Carnívoros do Niassa (NCP) e a Administração da Reserva do Niassa. No total, foram colhidas 44 amostras fecais numa área de cerca de 600 km² (Concessão L5-Sul), que foram posteriormente processadas no Laboratório de Parasitologia e Doenças Parasitárias da Faculdade de Medicina Veterinária da Universidade de Lisboa. Os resultados demostraram que 65.9% (29/44) das amostras continham formas parasitárias, nomeadamente: 47.7% continham ovos de Toxocara sp., 31.8% com larvas L1 de Aelurostrongylus sp., 27.3% continham ovos de Taeniidae, 25% com ovos de Spirometra sp., 18.2% continham ovos de Paramphistomum sp., e 13.6% continham ovos de Linguatula sp. Nas 29 amostras positivas, 72% (21/29) foram observadas coinfecções de dois parasitas em 21% (6/29), três em 34% (10/29), quatro em 10% (3/29) e cinco em 7% (2/29). Estes resultados estão de acordo com estudos anteriormente realizados no continente Africano, com exceção de Linguatula sp., que não tinha sido reportado em leões selvagens. Estes resultados revelam a importância da continuação de estudos nesta área, com esta e outras espécies animais e as populações humanas. Para tal seria importante associar as técnicas de parasitologia clássica a técnicas de biologia molecular para proceder à identificação das espécies de parasitas encontradas. De futuro, seria também importante complementar este estudo com resultados relativos à presença de outras agentes como vírus e bactérias.
6
Scháňková, Štěpánka. "Endoparazité koní." Doctoral thesis, Česká zemědělská univerzita v Praze, 2015. http://www.nusl.cz/ntk/nusl-259640.
Full textAbstract:
Nine ponies were randomly allocated to one of three groups (A, B, C). Gradually, these groups of ponies were experimentally infected with third stage cyathostome larvae. Each pony was infected with 30,000 infective cyathostome larvae stored 4 weeks under the natural environmental conditions of the Czech Republic. These animals were examined post--mortem for small strongyle infections from October 2011 to January 2012. Seventeen species of the following Cyathostominae genera were identified: Coronocyclus, Cyathostomum,Cylicocyclus, Cylicostephanus, Gyalocephalus and Petrovinema. Of the 17 species of Cyathostominae recovered, Cyathostomum catinatum, Cyathostomum alveatum and Cylicocyclus nassatus were the most prevalent (100 %). From the entire population of Cyathostominae, 65,6 % were located in the caecum and only 34,4 % in the colon. Only 1,736 (24,6 %) females and 5,329 (75,4 %) males were observed. In the first and second phase (group A, B) of the experiment, 98.57 % and 95.48 % of adult nematodes were found, respectively. However, only 29,07% of adults were found in the third phase (group C) of experiment, and the proportion of arrested larvae (EL3) was 67.73%. All ponies were treated orally with ivermectin at a dosage of 400 ug /kg. However, adult Oxyuris equi were present in six horses. This is the first European study to demonstrate anthelmintic resistence in Oxyuris equi to macrocyclic lactones.
7
Oliveira, Elisa Junqueira. "Critérios de seleção para características de importância econômica em ovinos da raça Santa Inês." Universidade de São Paulo, 2016. http://www.teses.usp.br/teses/disponiveis/17/17135/tde-05122016-115752/.
Full textAbstract:
Os objetivos deste estudo foram: estimar parâmetros genéticos para: coloração da conjuntiva ocular (CCO), contagem de ovos por grama de fezes (OPG), volume globular (VG), proteína plasmática total (PPT), escore da condição corporal (ECC) e peso corporal (PC) e, ainda, explorar o perfil genético da população, utilizando análises de agrupamento com base nos valores genéticos. E estimar parâmetros genéticos para peso corporal (PC) e características de conformação (perímetro torácico (PT), altura da garupa (AG), altura da cernelha (AC), largura da garupa (LG), comprimento corporal (CC) e escore de condição corporal (ECC)) com intuito de definir critérios de seleção. Foram analisadas um total de 2.525 informações de 771 animais nascidos entre 2002 e 2013, filhos de 68 carneiros e 352 ovelhas, pertencentes a sete rebanhos localizados no estado de São Paulo. Os animais foram avaliados mensalmente durante junho de 2013 a outubro de 2014. Os componentes de covariância foram estimados por modelo animal em análises multicaracterísticas, por meio de abordagem Bayesiana. As estimativas de herdabilidade para CCO, PC, VG, PPT, OPG e ECC foram 0,21 (0,04); 0,18 (0,05); 0,30 (0,06); 0,17 (0,05); 0,19 (0,03) e 0,31 (0,07), respectivamente, indicando que a seleção pode ser realizada com base no valor genético dos indivíduos para estas características. As correlações genéticas entre a CCO e PC, VG, PPT, OPG e ECC foram -0,40 (0,17); -0,63 (0,09); -0,23 (0,15); 0,77 (0,09); -0,59 (0,11), respectivamente, e entre PC e ECC a correlação genética foi de 0,84 (0,15). Assim como as outras medidas de resistência a verminose, a CCO pode ser incluída como critério na seleção; esta apresenta estimativa de herdabilidade mediana correlação genética favorável com as outras medidas de resistência a verminose e com PC e ECC, além de ser de fácil obtenção e baixo custo. Foi possível obter grupos de indivíduos com perfil genético de resistência/resiliência a verminose a partir das análises de agrupamento. As estimativas de herdabilidade para PC, PT, AG, AC, LG e ECC foram: 0,25 (0,08); 0,22 (0,07); 0,24 (0,07); 0,25 (0,07); 0,19 (0,05) e 0,32 (0,07), respectivamente e as correlações genéticas entre o peso e as medidas corporais foram de alta magnitude, variando entre 0,66 (0,11) a 0,98 (0,016), indicando que as medidas corporais, principalmente o perímetro torácico, pode ser incluído como um critério de seleção complementar ao peso corporal.The objective of this study was to estimate genetic parameters for conjunctival staining score (CSS), fecal eggs count (FEC), packed cell volume (PCV), total plasma protein (TPP), body condition score (BCS) and body weight (BW), and also explore the genetic profile of the population, using cluster analysis based on genetic values. And to estimate genetic parameters for body weight (BW) and conformation traits (heart girth (HG), hip height (HH), wither height (WH), rump width (RW), body length (BL) and body condition score (BCS)) to define selection criteria. A total of 2,525 records from 771 animals born between 2002 and 2013 to 68 rams and 352 ewes, belonging to five herds located in the São Paulo state were used. The animals were evaluated monthly during June 2013 to October 2014. The covariance components were estimated by animal model multi-trait using Bayesian analysis. The estimates of heritability for CSS, BW, PCV, FEC, BCS and PPT were 0.21 (0.04); 0.18 (0.05); 0.30 (0.06); 0.19 (0.03), 0.31 (0.07) and 0.17 (0.07), respectively, indicating that you can select animals based on the genetic value of individuals. The genetic correlations between CSS and BW, CSS and PCV, CSS and PPT, CCS and FEC, CSS and BCS and between the BW and BCS -0.40 (0.17); -0.63 (0.09); -0.23 (0.15); 0.77 (0.09); 0.84 (0.15), respectively. As other resistance traits the worms, the CCO can be included as a criterion in the selection. For this trait has estimated median heritability (0.21±0.04) and positive genetic correlation with other resistance measures to worms and BW and BCS, as well as being easy to obtain and low cost. It was possible to obtain groups of individuals with genetic profile of resistance / resilience to worms from the cluster analysis. The estimates of heritability for BW, HG, HH, WH, RW, BL and BCS were 0.25 (0.08); 0.22 (0.07); 0.24 (0.07); 0.25 (0.07); 0.19 (0.05) and 0.32 (0.07), respectively and genetic correlations between weight and body measures were highest magnitude, ranging from 0.66 (0.11) to 0.98 (0,016) indicating that body measurements, mainly heart girth, can be included as a criterion in the selection in addition to body weight.
8
Silva, Tairon Pannunzio Dias e. "Modelagem de fósforo em cordeiros submetidos à infecção experimental com Trichostrongylus colubriformis com uso de 32P." Universidade de São Paulo, 2017. http://www.teses.usp.br/teses/disponiveis/64/64134/tde-19052017-151023/.
Full textAbstract:
Objetivando-se avaliar variáveis hemato-bioquímicas, digestibilidade aparente dos nutrientes e desempenho animal, assim como, o metabolismo e a cinética do fósforo (P) em cordeiros infectados experimentalmente com Trichostrongylus colubriformis, foram realizados dois experimentos. No primeiro estudo, foram utilizados 18 cordeiros machos, da raça Santa Inês, distribuídos em dois tratamentos experimentais: grupo infectado (I, n=9) e grupo controle (C, n=9) sem infecção. Os cordeiros do grupo I receberam aproximadamente 5000 L3, três vezes por semana, durante três semanas, totalizando 45000 L3 de T. colubriformis. O controle do consumo do alimento foi diário, utilizando a metodologia do tipo pair-fed (para eliminar efeito de consumo). Foram avaliados quinzenalmente, durante 75 dias, os dados de peso vivo, escore de condição corporal e amostras de sangue e fezes foram colhidas para determinação do hemograma, bioquímica sérica e contagem de ovos por grama de fezes (OPG), respectivamente. Também foi avaliado a digestibilidade aparente dos nutrientes e os parâmetros ruminais dos cordeiros. Os cordeiros apresentaram infecção moderada (OPG = 620,3 ± 594,98) com redução de eritrócitos, hemoglobina, hematócrito, volume corpuscular médio, concentração de hemoglobina corpuscular média e proteínas totais (P < 0,1). Por outro lado, houve aumento do número de plaquetas, bem como a quantidade de eosinófilos circulantes quando comparado aos cordeiros do grupo C (P < 0,1). Não houve alteração no consumo voluntário dos cordeiros I (P > 0,05), porém houve menor digestibilidade da MS (P < 0,1). Diante disso, conclui-se que a infecção por T. colubriformis alterou parâmetros hematológicos, bioquímicos, não interferindo no consumo de matéria seca, mas, reduzindo digestibilidade da MS em cordeiros infectados. No segundo estudo, objetivou-se avaliar o metabolismo e a cinética do P em cordeiros infectados experimentalmente com T. colubriformis utilizando a técnica de diluição isotópica e modelagem. Para tanto, foram utilizados 15 cordeiros distribuídos nos tratamentos infectado (I, n=8) e controle (C, n=7) como descrito acima. Após 66 dias da última inoculação foi injetado 6,6 MBq de 32P/cordeiro para avaliar a cinética do mineral. Amostras de sangue, fezes e urina foram coletados nos sete dias seguintes, com abate dos cordeiros no último dia para colheita de amostras dos tecidos ósseo e moles (fígado, rim, coração e músculo). Para análises dos fluxos de P foi utilizado o modelo biomatemático descrito por Lopes et al. (2001). Foi verificado consumo semelhante de P (VI) entre os cordeiros dos dois tratamentos (P > 0,1), menor absorção das frações do P endógeno (Vaf) e dietético (Vaa) bem como maior excreção do P de origem dietético (VFD) nos cordeiros I (P < 0,1). Com a menor absorção (VaT) de P em cordeiros I, houve, consequentemente, menor distribuição e menor incorporação de P nos ossos (VO+D). Conclui-se que o metabolismo de P de cordeiros infectados por T. colubriformis foi alterado, com redução da sua absorção intestinal e biodisponibilidade, com aumento da perda fecal e redução do fluxo de P para ossosAiming to evaluate hemato-biochemical variables, apparent digestibility and performance as well as the metabolism and kinetic of phosphorus (P) in lambs experimentally infected with Trichostrongylus colubriformis, two experiments were conducted. At the first study, 18 male lambs were distributed in two experimental treatments: infected group (I, n=9) and control group (C, n=9) unaffected. Infected lambs received approximately 5000 T. colubriformis infective larvae (L3), three times per week, during three weeks, totalling 45 000 T. colubriformis L3. The control of daily feed intake was performed (pair-fed). Data of live weight, body condition score and samples of blood and faeces were collected fortnightly, during 75 days to analyze the hemogram, biochemical variables and faecal egg count (FEC), respectively. In addition, apparent digestibility and ruminal parameters of lambs were determined. Lambs presented moderate infection (FEC = 620.3 ± 594.98) with decreased erythrocytes, haemoglobin, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin concentration and total protein. On the other hand, increased platelets counts as well as the amount of circulating eosinophils when compared to the group C (P < 0.1). The voluntary intake of infected lambs was not altered, but there was lower dry matter digestibility. It was concluded that T. colubriformis infection altered haematological and biochemical parameters. It did not interfere in dry matter intake, but decreased digestibility in infected lambs. In the second study, the objective was to study the metabolism and kinetic of P in lambs experimentally infected with T. colubriformis using isotope dilution technique and modelling. For this, 15 lambs distributed in the infected treatment (I, n=8) e control (C, n=7) as described above were used. After 66 days of the last inoculation was injected 6.6 MBq of 32P/lamb to evaluate the kinetics of the mineral. Blood, faeces and urine samples were collected in the following seven days and the slaughter of lambs was carried out on the last day in order to collect bone and soft tissues (Liver, kidney, heart and muscle) samples. To analyze P flows the biomathematical model described by Lopes et al. (2001) was used. Similar P intake between treatments was verified (VI) (P > 0.1), lower absorption of endogenous (Vaf) and dietary P (Vaa) as well as higher excretion of dietary P (VFD) in infected lambs (P < 0.1). With the lower absorption (VaT) of P in infected lambs, there was, consequently, lower distribution and lower incorporation of P in the bones (VO+D). It was concluded that P metabolism of lambs infected with T. colubriformis was altered, with reduced intestinal absorption and bioavailability, increased faecal loss and reduced P flow to bone
9
Gon?alves, Landreani Ramirez. "Freq??ncia de endoparasitos e considera??es sobre as esp?cies do g?nero Eimeria Schneider, 1875 (Apicomplexa: Eimeriidae) em su?nos do munic?pio de Rio Claro, microrregi?o do vale do Para?ba sul fluminense, Estado do Rio de Janeiro." Universidade Federal Rural do Rio de Janeiro, 2008. https://tede.ufrrj.br/jspui/handle/tede/867.
Full textAbstract:
Made available in DSpace on 2016-04-28T20:17:27Z (GMT). No. of bitstreams: 1
2008 - Landreani Ramirez Goncalves.pdf: 6369784 bytes, checksum: 2ab259d1285dd8c5e8bb6e214271bc0a (MD5)
Previous issue date: 2008-10-03The aim of this work was to identify the parasites present in feces of pigs created rustically, as well as, verify the possibility of the morphological differences between the oocysts of the genus Eimeria recovered and, the frequency of these and of other endoparasites considering the age and sex of the animals. Eighteen samples of feces were collected directly from the rectum of animals from the 13 properties located in Municipality of Rio Claro, in the South Fluminense Para?ba Valley in the State of Rio de Janeiro. After the sporulation process of the positive samples, the oocysts could be observed and identified. In the current study, was possible to observe that despite of the animals are created rustically, these presented a low infection percentage. Helminthes eggs were present in 41,25 % of the examined samples being that eggs of the Strongylidae family present in 35% of the samples and were observed with a bigger frequency in young animals (27,5 %) being less frequent in the adults (7,5 %); Trichuris suis eggs were found only in young animals (3,75 %); Ascaris suum eggs in one young animal (1,25 %) and one animal was positive for eggs of the Strongylida order (1,25 %). Fifty-four percent (54 %) of the samples was positive for the species of the genus Eimeria, 46,25 % for Cryptosporidium spp. and 6,25 % for Cystoisospora suis. The species of the genus Eimeria founded and characterized in this study were confirmed through the use of histograms, as being: E. debliecki, E. neodebliecki, E. polita, E. suis, E. porci and E. scabra. It was observed, that the young animals presented bigger infection percentage. The characteristics observed in this study, in the oocysts and sporocysts, was better detailed microscopically revealing structures not observed previously by other authors, as well as, few have been the works concerning to infection for endoparasites in swines in Brazil, principally the works correlating your frequency and epidemiology.
Com o objetivo de identificar os agentes parasit?rios presentes nas fezes de su?nos criados de forma r?stica, assim como, poss?veis diferen?as morfol?gicas entre os oocistos das esp?cies do g?nero Eimeria encontradas e, a freq??ncia destas e de outros endoparasitos levando-se em considera??o a idade e sexo dos animais foram examinadas 80 amostras de fezes, coletadas diretamente da ampola retal dos animais oriundos de 13 propriedades localizadas no munic?pio de Rio Claro microrregi?o do Vale do Para?ba Sul Fluminense, Estado do Rio de Janeiro. As amostras positivas foram colocadas para esporular com a finalidade de facilitar a identifica??o das esp?cies de cocc?dios encontrados. No presente estudo, pode-se observar que apesar dos animais serem criados de forma r?stica, apresentaram baixo percentual de infec??o. Ovos de helmintos estavam presentes em 41,25% das amostras examinadas sendo que ovos da fam?lia Strongylidae estavam presentes em 35% das amostras e foram observados com uma maior freq??ncia em animais jovens (27,5%) sendo menos freq?ente nos adultos (7,5%); ovos de Trichuris suis somente foram encontrados em animais jovens (3,75%); ovos de Ascaris suum em um animal jovem (1,25%) e um animal foi positivo para ovos da ordem Strongylida (1,25%). Cinq?enta e quatro porcento (54%) das amostras estavam positivas para o g?nero Eimeria, 46,25% para Cryptosporidium spp. e 6,25% para Cystoisospora suis. As esp?cies do g?nero Eimeria encontradas e caracterizadas neste estudo foram confirmadas atrav?s da utiliza??o de histogramas, como sendo E. debliecki, E. neodebliecki, E. polita, E. suis, E. porci, E. scabra. Observou-se ainda, que os animais jovens apresentaram maior percentual de infec??o. As caracter?sticas morfom?tricas observadas neste estudo, tanto nos oocistos como nos esporocistos, foi melhor detalhada microscopicamente revelando estruturas n?o observadas anteriormente por outros autores, assim como, poucos t?m sido os estudos concernentes ? infec??o por endoparasitos em su?nos no Brasil, principalmente os trabalhos relacionados ? sua freq??ncia e a epidemiologia.
10
Morgado, Gonçalo Mendes. "Parasitoses internas e frequência de desparasitação em cães do concelho de Vila Franca de Xira, Portugal." Master's thesis, Universidade de Lisboa, Faculdade de Medicina Veterinária, 2016. http://hdl.handle.net/10400.5/11918.
Full textAbstract:
Dissertação de Mestrado Integrado em Medicina VeterináriaAo tratar os cães de uma forma empírica, existe a possibilidade de dois cenários indesejáveis acontecerem: os cães que apresentam um alto risco de infeção zoonótica não são corretamente controlados e os cães que apresentam um risco zoonótico praticamente nulo, estão a fazer tratamentos anti-helmínticos desnecessários. Este estudo foi direcionado para determinar a prevalência de parasitas gastrointestinais e pulmonares em cães com proprietário na cidade de Vila Franca de Xira, avaliar a presença de fatores que possam estar ligados a um maior risco de transmissão de doenças parasitárias zoonóticas e que protocolos de prevenção, nomeadamente para endoparasitas, são utilizados nos cães examinados. Através do método de flutuação (Willis), de Baermann e esfregaço fecal (coloração de Ziehl-Neelsen modificada) foram analisadas 80 amostras para pesquisa de endoparasitas gastrointestinais e pulmonares. Foram também preenchidos presencialmente 80 inquéritos pelos respetivos proprietários. A prevalência global de parasitas gastrointestinais e pulmonares foi de 5,0%. Foram observadas amostras positivas a Ancylostoma sp. (1/80); Angiostrongylus vasorum (1/80); Cystoisospora spp. (2/80); Toxocara canis (1/80) e Trichuris vulpis (1/80). Dois animais infetados apresentavam infeções parasitárias mistas, ambos por nemátodes. Relativamente a comportamentos de potencial risco zoonótico, 27,5% (22/80) dos cães exibia algum tipo de picacismo, 17,5% (14/80) ingeria fezes; 83,3% (65/80) lambia a cara do proprietário e 42,3% (33/78) dormia com ele. Dos 80 cães examinados, apenas 3,8% (3/80) dos cães não eram desparasitados internamente, ainda que apenas 51,4% (37/72) seguissem o protocolo de controlo de parasitoses internas, aconselhado pelo médico-veterinário de quatro desparasitações anuais, considerado como o limiar mínimo de eficácia na prevenção de endoparasitoses zoonóticas pela ESCCAP. Atendendo a que muitas pessoas ainda não têm a informação e conhecimento necessários sobre os métodos mais eficazes de controlo de doenças parasitárias, sendo este desconhecimento mais relevante nas zoonóticas, é necessário criar medidas para tornar esta informação mais disponível e acessível ao grande público, quer aumentando a intervenção do Médico Veterinário durante a consulta, quer referenciando mais plataformas com conhecimento idóneo e gratuita, como as da ESCCAP.
ABSTRACT - Internal parasites and deworm frequency of dogs in Vila Franca de Xira, Portugal - By deworming dogs empirically, two scenarios can happen: Dogs that are in a high risk state of zoonotic infection are not correctly controlled and dogs that have an almost null zoonotic infection risk, are being unnecessarily treated with anthelmintics. The purpose of this study was to determine parasitic gastrointestinal and pulmonary prevalence in dogs in Vila Franca de Xira city, which factors may be connected to a bigger zoonotic pressure in the transmission of parasitic diseases and what endoparasitic prevention protocols are the dogs following. Using Baermann and a flotation (Willis) method, a fecal smear (modified Ziehl-Neelsen stain), 80 samples were analyzed for gastrointestinal and pulmonary parasites. 80 surveys were filled by the dogs` owners. The global prevalence of gastrointestinal and pulmonary parasites was 5,0%. Positive samples of Ancylostoma sp. (1/80); Angiostrongylus vasorum (1/80); Cystoisospora sp. (2/80); Toxocara canis (1/80) and Trichuris vulpis (1/80) were found. Two infected dogs had endoparasitic co-infections, both by nematodes. Regarding potential high risk zoonotic behaviors, 27,5% (22/80) of dogs had some type of pica; 17,5% (14/80) ate feces; 83,3% (65/80) licked their owners` face and 42,3% (33/78) slept with its owner. Of the eighty dogs examined, only 3,8% (3/80) weren`t dewormed and only 51,4% (37/72) followed the veterinarians advised deworming protocol of four deworms a year, considered by the ESCCAP the minimal acceptable deworming schedule to prevent endoparasitic zoonoses in dogs. Considering that most people lack the knowledge or information needed to be able to control parasitic diseases, and that this lack of awareness is even more relevant on the zoonotic ones, it is necessary to create measures, that increase the availability of information to the public. This can be achieved by veterinarians spending more time educating pet owners during appointments or by referencing more platforms known of correct and free information, as the information provided by ESCCAP.
Books on the topic "Endoparasit"
1
Léonide, Jacqueline. Les Diptères sarcophagidés endoparasites des Orthoptères français: Essai biotaxonomique. Aix-en-Provence: Université de Provence, 1986.
Find full text
2
Symons, L. E. A. Pathophysiology of endoparasitic infection, compared with ectoparasitic infestation and microbial infection. New York: Academic Press, 1989.
Find full text
3
Pathophysiology of endoparasitic infection: Compared with ectoparasitic infestation and microbial infection. Sydney: Academic Press, 1989.
Find full text
4
Pritchard, Jackie Lee. Infectious diseases (bacterial, viral, mycotic and endoparasitic) of feral macaques (Macaca) and baboons (Papio): A bibliography, 1972-1988. Seattle, Wash: Primate Information Center, Regional Primate Research Center, University of Washington, 1988.
Find full text
5
Smith, Angeline G. 'O ptimisation of tritiated thymidine ([³H]-TdR) and 5-Bromo-2'-deoxyuridine (BrdU) to trace nerve cell development within the endoparasitic cestode Mesocestoides corti.'. [S.l: The Author], 1997.
Find full text
6
Ernst, Carl H. Synopsis of Helminths Endoparasitic in Snakes of the United States And Canada. Society for the Study of Amphibians & Reptiles, 2006.
Find full text
7
Dineen, J. K. Immunogenetic Approaches to the Control of Endoparasites, With Particular Reference to Parasites of Sheep. CSIRO Publishing, 1985.
Find full text
8
Sewall, David K. Chemotherapeutic and nontarget side-effects of benomyl to the orange tortrix (Argyrotaenia citrana) and the braconid endoparasite Apanteles aristoteliae. 1986.
Find full text
9
van, Wyk J. A., Schalkwyk P. C. van, and World Association for the Advancement of Veterinary Parasitlogy., eds. Managing anthelmintic resistance in endoparasites: Workshop held at the 16th International Conference of the World Association for the Advancement of Veterinary Parasitolgy, 10-15 August, 1997, Sun City, South Africa. [s.l.]: The Organisers, 1997.
Find full text
10
Parkinson, Michael, John P. Dalton, and Sandra M. O’Neill. Fasciolosis. Oxford University Press, 2011. http://dx.doi.org/10.1093/med/9780198570028.003.0079.
Full textAbstract:
Liver fluke disease, or fasciolosis, of livestock and humans is caused by endoparasitic trematodes of the genus Fasciola. Fasciola hepatica is responsible for the disease in temperate climates whereas F. gigantica is found in tropical zones. Recently, hybrids between F. hepatica and F. gigantica have been described (Le et al. 2008, Periago et al. 2008). Fasciolosis is a true zoonoses as it is predominantly a disease of animals that can be transmitted to humans at a specific stage of the parasite’s complex life cycle. There are a number of definitive hosts which includes sheep, cattle, and humans but this parasite has evolved to infect many other mammalian hosts including pigs, dogs, alpacas, llamas, rats, and goats (Apt et al. 1993; Chen and Mott 1990; Esteban et al. 1998). While prevalence of infection in humans may be relatively low in relation to animals, in specific geographic locations, for example in Bolivia, the prevalence of fasciolosis is so high in the human populations (hyperendemic) that it contributes to the spread of disease in animals (Esteban et al. 1999; Mas-Coma et al. 1999).Archeological studies showing Fasciola eggs in ancient mummies in Egypt demonstrate that fasciolosis is an ancient human disease (David 1997). Sporadic cases of fasciolosis were reported in Egypt in 1958 (Kuntz et al. 1958). The first to carry out an extensive review on human fasciolosis were Chen and Mott (1990). They reported 2,595 cases in over 40 countries in Europe, the Americas, Asia, Africa and the western Pacifi c from 1970 – 1990. This review raised awareness of fasciolosis in humans and triggered a growth in epidemiological studies and a consequential dramatic increase in reporting of cases in the literature. Now human fasciolosis is recognized by the World Health Organization (WHO) as an important disease in humans with an estimated 2.4 million people infected annually and 180 million at risk to infection in over 61 countries (Haseeb et al. 2002). There have been several cases of large scale epidemics in France (Dauchy et al. 2007), Egypt (Curtale et al. 2007) and Iran (Rokni et al. 2002).However, the only extensive epidemiological studies to determine the rate of infection have been carried out in Egypt and Bolivia (Curtale et al. 2003, 2007; Esteban et al. 2002; Parkinson et al. 2007). These studies have shown that co-infection with other diseases is a common occurrence and this may lead to under-reporting of the incidence of fasciolosis (Esteban et al. 2003; Maiga et al. 1991). In many countries, the overall rates of infection are extrapolated from sporadic reports of the disease and, consequently, worldwide disease prevalence is uncertain. In this chapter we will review the cause and effect of human fasciolosis, and particularly highlight important considerations in designing control strategies to reduce infection in at-risk communities.
Book chapters on the topic "Endoparasit"
1
Ranjan, Madhavi. "Endoparasite." In Encyclopedia of Animal Cognition and Behavior, 1. Cham: Springer International Publishing, 2020. http://dx.doi.org/10.1007/978-3-319-47829-6_1027-1.
Full text
2
Gooch, Jan W. "Endoparasite." In Encyclopedic Dictionary of Polymers, 889. New York, NY: Springer New York, 2011. http://dx.doi.org/10.1007/978-1-4419-6247-8_13648.
Full text
3
Dunford, James C., Louis A. Somma, David Serrano, C. Roxanne Rutledge, John L. Capinera, Guy Smagghe, Eli Shaaya, et al. "Endoparasite." In Encyclopedia of Entomology, 1319. Dordrecht: Springer Netherlands, 2008. http://dx.doi.org/10.1007/978-1-4020-6359-6_3569.
Full text
4
Friese, Klaus, Axel Schäfer, and Herbert Hof. "Endoparasiten." In Infektionskrankheiten in Gynäkologie und Geburtshilfe, 542–83. Berlin, Heidelberg: Springer Berlin Heidelberg, 2003. http://dx.doi.org/10.1007/978-3-642-55586-2_11.
Full text
5
Tielens, A. G. M., and Peter Köhler. "Nutrition of Endoparasites." In Encyclopedia of Parasitology, 1973–79. Berlin, Heidelberg: Springer Berlin Heidelberg, 2016. http://dx.doi.org/10.1007/978-3-662-43978-4_2170.
Full text
6
Mehlhorn, Heinz. "Endoparasites of Humans." In Encyclopedia of Parasitology, 893–900. Berlin, Heidelberg: Springer Berlin Heidelberg, 2016. http://dx.doi.org/10.1007/978-3-662-43978-4_1046.
Full text
7
Mehlhorn, Heinz. "Endoparasites of Humans." In Encyclopedia of Parasitology, 1–8. Berlin, Heidelberg: Springer Berlin Heidelberg, 2016. http://dx.doi.org/10.1007/978-3-642-27769-6_1046-2.
Full text
8
Friese, Klaus, Axel Schäfer, and Herbert Hof. "Weitere Endoparasiten: Helminthen (Würmer)." In Infektionskrankheiten in Gynäkologie und Geburtshilfe, 585–610. Berlin, Heidelberg: Springer Berlin Heidelberg, 2003. http://dx.doi.org/10.1007/978-3-642-55586-2_12.
Full text
9
Heppner, John B., John B. Heppner, John L. Capinera, Jamie Ellis, Andrey N. Alekseev, Phyllis G. Weintraub, John L. Capinera, et al. "Venoms of Endoparasitic Wasps." In Encyclopedia of Entomology, 4092–93. Dordrecht: Springer Netherlands, 2008. http://dx.doi.org/10.1007/978-1-4020-6359-6_3958.
Full text
10
Lord, Jennifer S., and Darren R. Brooks. "Bat Endoparasites: A UK Perspective." In Bats (Chiroptera) as Vectors of Diseases and Parasites, 63–86. Berlin, Heidelberg: Springer Berlin Heidelberg, 2013. http://dx.doi.org/10.1007/978-3-642-39333-4_4.
Full textConference papers on the topic "Endoparasit"
1
Aksoy, Serap. "Possibilities for novel control using symbionts and endoparasites." In 2016 International Congress of Entomology. Entomological Society of America, 2016. http://dx.doi.org/10.1603/ice.2016.93325.
Full text
2
Silva, Erica Rodrigues de Matos. "Prevalência de endoparasitos em cães no Brasil: Revisão Bibliográfica." In Anais do XVII Simpósio de Medicina Veterinária e IV Semana Científica da UPIS. Recife, Brasil: Even3, 2021. http://dx.doi.org/10.29327/138587.2-1.
Full text
3
CAVALCANTE, Iara Tamires Rodrigues, Saullo Laet Almeida VICENTE, Newcelia Paiva BARRETO, Ana Carolina Alves de CALDAS, Joyce Barreto FERNANDES, Sheyla Priscila de Oliveira NASCIMENTO, and Gilberto de Carvalho SOBRAL. "Incidência de endoparasitas em ovinos alimentados com feno de jurema preta (Mimosa tenuiflora (Wild) Poir)." In Congresso Internacional Interdisciplinar em Extensão Rural e Desenvolvimento. Recife, Brasil: Even3, 2018. http://dx.doi.org/10.29327/15327.1-6.
Full text
4
José Barboza Filho, Edivaldo, Andressa de Oliveira, Andressa Batista Veras De Menezes, Layanne Araújo Silva, Renata De Souza Meireles, and RODRIGO VENTURA RODRIGUES. "Ocorrência de endoparasitas de importância para saúde pública em alface crespa (Lactucas Sativas), comercializadas no município de Barreiras – BA." In II Congresso Internacional de Saúde Única ( Interface Mundial). ,: Even3, 2020. http://dx.doi.org/10.29327/icidsuim2020.292102.
Full text
5
Herawati, Nur ‘Aini, and Sudarmaji. "Prevalence of Infection of Endoparasites and Its Intensity in Small Mammals’ Liver Captured from Irrigated Rice Crop Area and Villages." In 5th Universitas Ahmad Dahlan Public Health Conference (UPHEC 2019). Paris, France: Atlantis Press, 2020. http://dx.doi.org/10.2991/ahsr.k.200311.027.
Full text
6
Dias, Francisca Hortência Couras, Khyson Gomes Abreu, Maria Alaíne Da Cunha Lima, Adriano Salviano Lopes, and Eloyza Gomes De França Silva. "FITONEMATOIDES ASSOCIADOS À CULTURA DO COENTRO (CORIANDRUM SATIVUM)." In I Congresso Brasileiro de Biodiversidade Virtual. Revista Multidisciplinar de Educação e Meio Ambiente, 2021. http://dx.doi.org/10.51189/rema/1086.
Full textAbstract:
Introdução: O coentro (Coriandrum sativum L.) é uma hortaliça, pertencente à família Apicaceae, considerada uma cultura de fácil cultivo, com ciclo vegetativo curto. Consumida em abundância no Brasil, principalmente nas regiões Norte e Nordeste, excelente fonte de ferro e cálcio, rica em vitaminas, com aroma e sabor atrativos. As hortaliças são alvos de ataques de vários patógenos, um desses patógenos é o fitonematoide, esses microrganismos parasitam e alimentam-se das plantas, capazes de atacar todos os órgãos da planta, desde raízes até as folhas e sementes, acarretando grandes prejuízos na produção da cultura. Alguns fatores pode influenciar a densidade populacional de nematoides no solo, como temperatura, umidade, aeração, presença de defensivos e fertilizantes no solo e fatores biológicos. Objetivo: O objetivo deste trabalho de revisão foi de agrupar informações sobre dois dos principais fitonematoides associados à cultura do coentro, assim como os danos causados pelos mesmos e o controle desses patógenos. Metodologia: Para a elaboração da revisão, foram feitos levantamentos e estudo de trabalhos relacionados com o tema abordado. Resultados: Para o coentro, os nematoides do gênero Rotylenchulus sp. e Helicotylenchus sp. são os que apresentam maiores índices de distribuição em áreas produtoras dessa cultura, destacando-se a região Nordeste. O gênero Rotylenchulus engloba 11 espécies, classificadas como semi-endoparasitas, distribuídas em regiões tropicais e subtropicais. Esse gênero causa danos em hortaliças como melão (Cucumis melo L.), melancia (Citrullus lanatus), tomate (Solanum lycopersicum) e entre outras culturas. O gênero Helicotylenchus sp. é comumente conhecido por nematoide espiralado, classificado como um ectoparasitas de raízes, apresenta larga distribuição geográfica, em alguns estados brasileiros já foi confirmada a associação desse gênero com várias culturas, como por exemplo o couve-flor (Brassica oleracea) e feijão de porco (Canavalia ensifonnis). O manejo inadequado devido à falta de conhecimento de alguns agricultores contribui para a disseminação dos nematoides, o melhor método de controle ainda é através da utilização de cultivares resistentes, mas quando essa opção não for possível, existem outros tipos de controle como o físico, biológico, cultural e químico. Conclusão: O Rotylenchulus sp. e Helicotylenchus sp são dois dos principais gêneros associados à cultura do coentro.